1 2 a distinct class of internal ribosomal entry site (ires) in

1

1 2

A distinct class of internal ribosomal entry site (IRES) in members of the Kobuvirus and 3 proposed Salivirus and Paraturdivirus genera of Picornaviridae 4

5 6 Trevor R. Sweeney, Vidya Dhote, Yingpu Yu# and Christopher U. T. Hellen* 7 8 9

1Department of Cell Biology, State University of New York Downstate Medical Center, 10 Brooklyn, New York 11203 USA 11

12 * Corresponding author: Christopher U.T. Hellen 13

Dept. of Cell Biology, 14 SUNY Downstate Medical Center, 15 450 Clarkson Avenue, Box 44, 16 Brooklyn, NY 11203 17 USA 18 19 Tel. 718-270-1034 20 Fax 718-270-2656 21

Email [email protected] 22 23 # Present address: Laboratory of Virology and Infectious Disease, 24 Center for the Study of Hepatitis C, 25 The Rockefeller University, 26 New York, NY 10065, 27 USA 28

29 30 Key words: Aichi virus, evolution, Kobuvirus, IRES, picornavirus, recombination, 31

RNA structure, Salivirus 32 33 Running title: A distinct structural class of picornavirus IRES 34 Word count for the abstract: 249 Word count for the text: 8506 words 35 36

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.05862-11 JVI Accepts, published online ahead of print on 23 November 2011

on January 28, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

2

Abstract 37 The 5’-untranslated regions (5’ UTRs) of picornavirus genomes contain an internal ribosomal 38 entry site (IRES) that promotes end-independent initiation of translation. Picornavirus IRESs are 39 classified into four structurally distinct groups, each with different initiation factor requirements. 40 Here, we identify a fifth IRES class in members of Kobuvirus, Salivirus and Paraturdivirus 41 genera of Picornaviridae: (i) Aichi virus (AV), bovine kobuvirus (BKV), canine kobuvirus 42 (CKoV), Mouse kobuvirus (MKoV), sheep kobuvirus (SKV), (ii) Salivirus A (SV-A) and (iii) 43 Turdivirus 2 (TV2) and TV3. The 410nt.-long AV IRES comprises four domains (I-L), including 44 a hairpin (L) that overlaps a Yn-Xm-AUG (pyrimidine tract/spacer/initiation codon) motif. SV-45 A, CKoV and MKoV also contain these four domains, whereas BKV, SKV and TV2/TV3 5’ 46 UTRs contain domains that are related to domain I and equivalent to domains J and K, but lack 47 an AV-like domain L. These IRESs are located at different relative positions between a 48 conserved 5’-terminal origin of replication and divergent coding sequences. Elements in these 49 IRESs also occur elsewhere: domain J’s apical subdomain, which contains a GNRA tetraloop, 50 matches an element in Type 1 IRESs, and eIF4G-binding motifs in domain K and in Type 2 51 IRESs are identical. Other elements are unique and their presence leads to unique initiation 52 factor requirements. In vitro reconstitution experiments showed that like AV but in contrast to 53 other currently-characterized IRESs, SV-A requires the DExH-box protein DHX29 during 54 initiation, likely to ensure that the initiation codon, which is sequestered in domain L, is properly 55 accommodated in the ribosomal mRNA-binding cleft. 56 57 58 59


.org/D

ownloaded from

http://jvi.asm.org/

3

Introduction 60 The genomes of RNA viruses contain structural elements that have important roles in 61 translation, replication and encapsidation. Their activities depend on structural integrity and on 62 specific sequence motifs, thus limiting sequence variation, so that functionally related elements 63 in different viruses commonly contain conserved sequence motifs and have a common 64 architecture in which covariant substitutions maintain base-pairing patterns. Internal ribosomal 65 entry sites (IRESs) are large structured RNA elements that mediate end-independent initiation of 66 translation (28). The five classes of viral IRES that have been identified to date each has a 67 different characteristic structure and promotes initiation by a distinct mechanism 68 The simplest mechanism is used by the ~180 nt-long intergenic region (IGR) IRESs of 69 dicistroviruses, which consist of three pseudoknots (52). They bind directly to the ribosome and 70 mediate initiation without the involvement of eukaryotic initiation factors (eIFs) (62, 88). The 71 second IRES class is epitomized by the ~330 nt-long HP IRESs of Hepatitis C virus (HCV) and 72 pestiviruses (47) and includes structurally related HP-like IRESs that occur in numerous 73 picornaviruses, including porcine kobuvirus (PKV), a member of the Kobuvirus genus, members 74 of the Teschovirus, Sapelovirus, Senecavirus, Tremovirus and Avihepatovirus genera of 75 Picornaviridae, in Seal Picornavirus 1 and in Turkey hepatitis virus (8, 14, 21, 26, 35, 37, 73). 76 The presence of related IRESs in unrelated viruses suggests that these elements may have been 77 exchanged by recombination (21). HP-like IRESs bind directly to eIF3 and to the ribosomal 40S 78 subunit, promoting 48S initiation complex formation without the factors that are required for 79 cap-dependent recruitment of 43S preinitiation complexes to mRNA (eIFs 4A, 4B, 4E or 4G) or 80 for scanning (eIF1 and eIF1A) (10, 57-58, 66, 69). 81


.org/D

ownloaded from

http://jvi.asm.org/

4

The three other structurally-defined classes of IRES all occur in picornavirus 5’ UTRs, 82 that have a modular organization in which the origin of replication (ori) is followed by the IRES. 83 Type 1 IRESs occur only in the Enterovirus genus (5). They are ~450nt long, contain five 84 domains (II to VI) and their 3’-borders are marked by a Yn-Xm-AUG motif in which Yn, a 85 pyrimidine tract (n = 8-10nt), is separated by a spacer (m = 18-20 nt) from an AUG triplet (29, 86 63). This motif is the presumed point of ribosomal entry onto the 5’ UTR (64) and is separated 87 from the initiation codon by a non-conserved spacer (<30 nt in rhinoviruses, but >150 nt in 88 poliovirus). Conserved, functionally important nucleotides occur at the base of domain II, in the 89 cruciform domain IV (including a GNRA tetraloop and a C-rich loop in adjacent apical arms), 90 and in the central loop and basal half of domain V (3, 5, 11, 19). This region of domain V 91 interacts specifically with eIF4G and eIF4A, an associated RNA helicase, which together 92 promote recruitment of 43S complexes to the IRES (11). 93 Type 2 IRESs occur in the Aphthovirus, Cardiovirus and Parechovirus genera (5); 94 divergent members occur in the Erbovirus and Human cosavirus genera (23, 34). They are ~450 95 nt long and also have a 3’-terminal Yn-Xm-AUG motif, but in contrast to Type 1 IRESs, the 96 AUG triplet may be the initiation codon. Their five principal domains (H, I, J-K and L) are 97 unrelated to domains in Type 1 IRESs, with the exception of domain I which, like domain IV of 98 Type 1 IRESs, contains a C-rich loop and a functionally important GNRA tetraloop (5). 99 However, in contrast to domain IV of Type 1 IRESs, domain I in Type 2 IRESs has a patriarchal 100 cross (i.e. double-barred) conformation and the stem-loops in which these motifs are located are 101 not adjacent. Initiation on the IRESs of encephalomyocarditis virus (EMCV), a cardiovirus, and 102 foot-and-mouth disease (FMDV), an aphthovirus, requires the specific binding of eIF4G and 103 eIF4A to the Y-shaped J-K domain (65, 68), an interaction that is dependent on a conserved 104


.org/D

ownloaded from

http://jvi.asm.org/

5

sequence/structural motif at the apex of domain J (4, 9, 39, 94). The IRESs from some EMCV 105 isolates require only eIF4G/eIF4A to recruit a 43S complex consisting of eIF3, eIF2-106 GTP/initiator tRNA and a 40S subunit to the initiation codon to form a 48S complex (62, 65). 107 Type 2 IRESs can therefore function without eIF4E and factors implicated in ribosomal 108 scanning, such as eIF1 and eIF1A, although some additionally require one or more IRES trans-109 acting factors (ITAFs), which are cellular RNA-binding proteins, such as the pyrimidine tract-110 binding protein (PTB) (54). All Type 1 IRESs that have been characterized to date are dependent 111 on ITAFs which, apart from PTB, are distinct from those used by Type 2 IRESs (54). 112 The type 3 IRES occurs only in Hepatitis A virus (HAV); its ~410 nt long core comprises 113 two major domains (IV and V) followed by a Yn-Xm-AUG motif, but its function is significantly 114 enhanced by the upstream ~175nt-long domains II and III (7). There are major structural and 115 mechanistic differences between it, Type 1 and Type 2 IRESs, such as in the length and sequence 116 of core structural elements and the HAV IRES’ exceptional requirement for the cap-binding 117 protein eIF4E (2). 118 The existence of these structurally and mechanistically distinct classes of IRES raises the 119 question of whether other unrelated IRESs remain to be identified. To address this possibility, we 120 recently characterized the 5’ UTR of Aichi virus (AV), a member of the Kobuvirus genus that 121 causes acute gastroenteritis in humans (13), and found that it contains a ~410 nt-long IRES (Fig. 122 1) that is structurally distinct from the different classes of IRES described above (95). The AV 123 IRES also has distinct factor requirements: unlike all other IRESs that have been characterized to 124 date, 48S complex formation on it is dependent on DHX29 (95), a ribosome-associated DExH-125 box helicase that has been implicated in correct accommodation of structured mRNA in the 126 mRNA-binding channel of the 40S subunit (1). The Kobuvirus genus currently comprises six 127


.org/D

ownloaded from

http://jvi.asm.org/

6

accepted or proposed species: bovine kobuvirus (BKV), canine kobuvirus (CKoV), Mouse 128 kobuvirus (MKoV), sheep kobuvirus (SKV), AV and PKV (33, 41, 67, 74, 90, 93), and is 129 distantly related to Salivirus A (formerly known as Klassevirus) (of the proposed Salivirus genus 130 (17, 25, 42, 81)) and to Turdivirus 2 (TV2) and Turdivirus 3 (TV3) (of the proposed 131 Paraturdivirus genus (89)). 132 Previous analyses had identified a Yn-Xm-AUG motif in the AV 5’ UTR (n=7; m=11) 133 and in two SV-A isolates (Y12-X8-AUG and Y12-X4-AUG) that included the initiation codon, 134 which was taken as an indication that these viruses contain type 2 IRESs (17, 42, 91). However, 135 the BKV and TV3 5’ UTRs contain divergent Y7-X37-AUG and Y6-X34-AUG motifs, 136 respectively (89, 90), and several reports had noted that the secondary structures of these 5’ 137 UTRs were unknown (81), could not be determined (90) or were not similar to those of 138 cardioviruses and aphthoviruses (17, 74, 89). We therefore re-analyzed these elements using 139 methods that had previously been used to identify HP-like IRESs in diverse picornaviruses and 140 to model the structure of the AV IRES (21, 95) and identified AV-like IRES structures in each of 141 these genomes. The extensive similarities between these predicted structures and the 142 experimentally verified AV IRES indicate that these RNA elements constitute a novel class of 143 viral IRES. 144 145 146 147 148 149


.org/D

ownloaded from

http://jvi.asm.org/

7

MATERIALS AND METHODS 150 SEQUENCES 151 Sequences were analyzed from the Aichi virus strains A846/88 (GenBank accession 152 numbers AB040749 and AB010145), BAY/1/03/DEU (AY747174), Goiania/GO/03/01/Brazil 153 (DQ028632), Chshc7 (FJ890523), D/VI2169/2004 (GQ927704), D/VI2359/2004 (GQ927705), 154 D/VI2321/2004 (GQ927706), D/VI2582/2004 (GQ927707), D/VI2524/2004 (GQ927708), 155 D/VI2528/2004 (GQ927709), D/VI2287/2004 (GQ927711), D/VI2244/2004 (GQ927712) and 156 D/VI2535/2004 (GQ927710); Bovine kobuvirus strain U-1 (AB084788); Canine kobuvirus 157 AN211D (JN387133); Canine kobuvirus PC0082 (JN088541); Mouse kobuvirus (JF755427); 158 Porcine kobuvirus strains swine/S-1-HUN/2007/Hungary (EU787450), swine/K-30-159 HUN/2008/Hungary (GQ249161), pig/JY-2010a/CHN/Y-1-CHI (GU292559) and pig/Ch-160 kobu/2008/CHN (GU298977); Salivirus A isolates NG-J1 (GQ179640), 02394-01 (GQ184145), 161 SH1 (China) (GU245894) and 1-9 (GU376738-GU376746); Sheep kobuvirus (GU245693.2); 162 Turdivirus 2 (TV2) strains 10717 (GU182408) and 007167 (GU182409); Turdivirus 3 (TV3) 163 strains 10878 (GU182410) and 00742 (GU182411). 164 165 SEQUENCE ALIGNMENT 166 Viruses containing AV IRES-like sequences in their 5’ UTRs were identified using BLAST 167 searches (http://www.ncbi.nlm.nih.gov/BLAST/) of the GenBank database. For short (11-nt) 168 sequences, the parameters used were as follows: E (expect) 1 000, word size 7, reward 169 match/mismatch 1/-3, gap extension 5, gap penalty 2. Searches done with long sequences 170 >100nt) used the following parameters: E 10, word size 11, reward match/mismatch 1/-1, gap 171 extension 0, gap penalty 2. Searches done using more stringent parameters (e.g. match/mismatch 172


.org/D

ownloaded from

http://jvi.asm.org/

8

2/-3, gap extension 5, gap penalty 2) identified shorter segments of the same sequences. 173 Nucleotide sequences were aligned with CLUSTAL-W2 174 (http://www.ebi.ac.uk/Tools/msa/clustalw2/), using the default parameters (DNA weight matrix: 175 CLUSTALW; gap open penalty: 10.0, gap extension penalty: 0.01). 176 177 MODELING OF SECONDARY AND TERTIARY RNA STRUCTURES 178

Secondary structure elements were modeled using complementary probabilistic (Pfold: 179 http://www.daimi.au.dk/~compbio/pfold/) (36) and posterior decoding approaches 180 (CentroidFold: http://www/crna/org/centroidfold) (80), and were verified and refined by free 181 energy minimization using Mfold (http://mfold.rna.albany.edu/?q=mfold) (96) and RNAfold 182 (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) (17), in all instances using default parameters. 183 Computational analysis was in all cases done using series of overlapping viral RNA sequences 184 because of the limits on the number of nucleotides that can processed via these web servers. 185 Tertiary structures in picornavirus 5’ UTRs were modeled using pKnotsRG 186 (http://bibiserv.techfak.uni-bielefeld.de/pknotsrg/submission.html) (72). 187

188 Assembly and Analysis of Initiation Complexes 189 A vector for transcription of SV-A nt. 1-1498 mRNA was made (GenScript) by inserting 190 DNA into pUC57 that corresponds to a 5’-terminal T7 promoter, two G residues and a variant of 191 SV-A nt 1-1498 (GenBank GQ184145) followed by two UAA stop codons. The SV-A sequence 192 contained single substitutions that eliminated a BamH1 restriction site at nt. 1241-1246 and 193 introduced AUG triplets at positions corresponding to codons 137, 179, 212, 221, 237, and 253 194 of the 259 amino acid-long SV-A LΔVP0 coding sequence. Further mutations were introduced 195


.org/D

ownloaded from

http://jvi.asm.org/

9

into this SV-A transcription vector by NorClone Biotech Laboratories (London, Ontario). SV-A 196 mRNA was transcribed from this vector, and AV and EMCV IRES-containing mRNAs were 197 transcribed from previously described vectors (15, 95) using T7 RNA polymerase. 40S subunits 198 and native eIF2 and eIF3 were purified from rabbit reticulocyte lysate (Green Hectares, Oregon 199 WI), and recombinant eIF1, eIF1A, eIF4A (wt), eIF4AR362Q, eIF4G736-1115 (‘eIF4Gm’) and 200 mutant variants thereof, PTB, DHX29 and E. coli methionyl tRNA synthetase were expressed 201 and purified from E. coli as described (38, 43, 57, 62, 65, 83). tRNAMet

i was transcribed in vitro 202 using T7 RNA polymerase and a previously described vector (60) and was aminoacylated using 203 recombinant E. coli methionyl tRNA synthetase (43). 48S complexes were assembled on SV-A, 204 AV and EMCV mRNA transcripts and analyzed by primer extension using avian myeloblastosis 205 virus reverse transcriptase and 32P-labeled primers 5’- GAAAGAAGATGAGTGAGGAG-3’ 206 (complementary to SV-A nt. 788-807), 5’-GCCTATCATAGCAGTCAAGG-3’ (complementary 207 to AV nt 790-809) or 5’-GTCAATAACTCCTCTGG-3' (complementary to EMCV nt 957-974) 208 as appropriate, essentially as described (70). 209 210 In vitro translation 211 Monocistronic SV-A mRNAs (0.1 μg) were translated using the Flexi RRL System 212 (Promega) (20 μl reaction volume) supplemented with 0.5 mCi/ml [35S]methionine (43.5 213 TBq/mmol) for 60 min at 37oC. Purified recombinant eIF4AR362Q (56) was added to translation 214 reactions as described (95). Translation products were analyzed by electrophoresis using 215 NuPAGE 4%–12% Bis-Tris-Gel (Invitrogen), followed by autoradiography. 216 217 218


.org/D

ownloaded from

http://jvi.asm.org/

10

Directed hydroxyl radical cleavage 219 Wild type and a panel of single-syteine mutant forms of eIF4G736-1115 (“eIF4Gm”) were 220 derivatized with Fe(II)-BABE as described (38, 39) by incubating 3,000 pmol of a protein with 1 221 mM Fe(II)-BABE in 100 μl buffer containing 80 mM HEPES (pH 7.5), 300 mM KCl and 10% 222 glycerol for 30 min at 37°C. Derivatized proteins were separated from unincorporated reagent by 223 buffer exchange on Microcon YM-30 filter units and stored at –80°C. 224 To investigate hydroxyl radical cleavage, 5 pmol wt or mutant SV-A mRNA (nt 1-1498) 225 were incubated at 37°C for 10 min in 50 μl buffer A (20 mM HEPES (pH 7.6), 100 mM KCl, 2.5 226 mM MgCl2, and 5% glycerol) with 10 pmol [Fe(II)-BABE]-eIF4Gm in the presence of 10 pmol 227 unmodified eIF4A. To generate hydroxyl radicals, reaction mixtures were supplemented with 228 0.05% H2O2 and 5 mM ascorbic acid and incubated on ice for 10 min. Reactions were quenched 229 by adding 20 mM thiourea. Sites of hydroxyl radical cleavage were determined by primer 230 extension using AMV RT and the [32P]-labeled primer 5’- GAAAGAAGATGAGTGAGGAG-3’ 231 (complementary to SV-A nt. 788-807). cDNA products were resolved in a 6% sequencing gel. 232 233 234 235 236 237 238 239


.org/D

ownloaded from

http://jvi.asm.org/

11

RESULTS 240 Sequence similarities between the Aichi virus IRES and other picornavirus 5’ UTRs 241 The AV IRES (nt 338-747) consists of three major domains designated I, J and K, the 242 Yn-Xm-AUG motif and domain L, which contains the initiation codon (Fig. 1 (95)). In BLAST 243 searches of viral mRNAs in the non-redundant Genbank nucleotide database (July 2011), the 244 sequences that most closely matched this element occurred in the 5’ UTRs of other AV isolates 245 (97-99% identity over the entire sequence), in SV-A 5’ UTRs (72% identity with AV nt 342-246 732) and in the BKV 5’ UTR (71% identity with AV nt 484-722). Subsequent analysis identified 247 matches with mouse kobuvirus (67) (80% identity between MKoV nt 1-610 and AV nt. 144-248 732), canine kobuvirus isolate AN211D (41) (73% identity between CKoV isolate AN211D nt 1-249 539 and AV nt. 189-724), the closely related Canine kobuvirus isolate PC0082 (33) (76% 250 identity between CaKV nt 1-690 and AV nt 33-724) and sheep kobuvirus (SKV (75)) (69% 251 identity between SKV nt 410-644 and AV nt 484-710). 252 The apex of AV domain K contains two highly conserved sequences, AGGUACCCC (nt 253 662-670) and GGGAUCUGA (nt 691-689) that form a functionally important base-paired motif 254 (95). BLAST searches of picornavirus 5’ UTRs with these and flanking nucleotides identified 12 255 other AV isolates, SV-A, BKV, CKoV/CaKV, MKoV, SKV, two TV3 isolates, >225 256 Aphthovirus and >175 Cardiovirus isolates. Slightly divergent variants of this motif, differing at 257 one or two positions in each strand, were identified in eleven cosavirus isolates (data not shown). 258 The same bipartite motif is a functionally important element in Type 2 IRESs (4, 9), and its 259 presence in the TV3 5’ UTR prompted us to identify picornavirus sequences that are related to 260 this 5’ UTR. 261


.org/D

ownloaded from

http://jvi.asm.org/

12

The 5’ UTRs of TV3 strains 00742 and 1087 are 94% identical over their entire length, 262 and are ~65% identical to nt 157-523 and nt 157-584 of the 5’ UTRs of TV2 strains 007617 and 263 10717, respectively. Shorter sequences related to the TV3 5’ UTR occur in the 5’ UTRs of Aichi 264 viruses (nt 585-716; 62-63% identity), BKV (nt 572-670; 66% identity), SV-A (nt 655-712; 70% 265 identity), and Saffold and other cardioviruses (49-74nt; 70-75% identity). These matching 266 sequences are located in the apex of domain J of the cardiovirus IRES (5), whereas the larger 267 Aichi virus sequences mapped to the 3’-terminal half of domain J and the adjacent region of 268 domain K. Homology between these regions of kobuvirus, SV-A and turdivirus 5’ UTRs and 269 Type 2 IRESs will be discussed below. 270 271 Three distinct subgroups of AV-like IRESs 272 BLAST searches thus identified extensive related elements in the 5’ UTRs of members of 273 three genera of Picornaviridae. Pairwise comparisons confirmed that the AV (744 nt long) and 274 SV-A (718 nt long) 5’ UTRs are 68% identical over their latter two thirds (AV nt 293-744) as 275 reported (17): moreover, sequence identity of over 50% extends for ~300 nt into the coding 276 region. Similarly, MKoV and CKoV 5’ UTRs are highly homologous to the AV 5’ UTR over 277 their entire length (see above), and are both followed by coding sequences that are ~70% 278 identical to ~300nt of the equivalent AV coding sequence. 279

Nucleotides 315-675 of the 807 nt long BKV 5’ UTR are 64% identical to AV nt 347-280 726, nt 410-644 of the 797 nt-long SKV 5’ UTR are 68% identical to AV nt 484-720, and nt 281 204-499 of the 643 nt long TV3 5’ UTR are 54% identical to AV nt 431-729. BKV and SKV 5’ 282 UTRs are 82% identical over their entire length, and similarly, TV2 and TV3 5’ UTRs align well 283 with each other (60% identity over the entire 5’ UTR), with the exception of a 26 nt-long 5’-284


.org/D

ownloaded from

http://jvi.asm.org/

13

terminal sequence present only in the latter (which implies that the TV2 5’ UTR is incomplete), 285 and several insertions, for example of 16nt and 15nt in the TV2 5’ UTR at the equivalent of TV3 286 nt 139 and nt l45. The 5’ UTRs of BKV and SKV on the one hand, and of TV2 and TF3 on the 287 other, are therefore more closely related to each other than to the AV 5’ UTR. BKV, SKV and 288 TV3 5’ UTRs contain insertions of ~ 120, 120 and 150 nt upstream of the initiation codon, 289 respectively, relative to AV and SV-A 5’ UTRs. 290 291 The mosaic nature of Kobuvirus, Salivirus and Paraturdivirus 5’ UTRs 292 The 5’-terminal regions of AV and BKV 5’ UTRs form a domain that in AV has been 293 found to be required for replication and encapsidation (51, 78, 89). It consists of a series of 5’-294 terminal hairpins (A, C) and a pseudoknot encompassing hairpin B, corresponding to AV nt 1-295 116 (Fig. 2A) and BKV nt. 1-124 (Fig. 2E) (17, 51, 78, 90). The equivalent SKV structure is 296 similar to that of BKV, except that the apex of hairpin B is truncated (Fig. 2C). The 5’-terminal 297 regions of SV-A 5’ UTRs may be incomplete, but despite limited sequence similarity with these 298 Kobuvirus sequences, can also form structures equivalent to the hairpin B pseudoknot and to 299 hairpin C (25, 42). The CKoV-PC0082 sequence is likely also incomplete, but is similarly 300 capable of forming equivalent structures (Fig. 2B). The equivalent 5'-terminal regions of Porcine 301 kobuvirus (PKV) and of TV3 genomes also have the potential to form three similar terminal 302 hairpins, the first of which are closely related to hairpin A of the AV 5’ UTR and the second of 303 which forms part of pseudoknots that are comparable to those of AV and SV-A (Figs 2D, 2F). 304 As noted previously, the PKV 5’ UTR downstream of this element does not resemble 5’ UTRs 305 from members of the Kobuvirus genus but instead aligns with segments of picornavirus 5’ UTRs 306 that have the potential to adopt HP IRES-like structures (73, 93). 307


.org/D

ownloaded from

http://jvi.asm.org/

14

The region adjacent to the 5’ UTR in each of these genomes encodes a leader (L) protein, 308 which ranges in size from 53 amino acid residues in TV2 to 195 amino acid residues in PKV and 309 which, apart from MKoV and CKoV, share low sequence identity with the AV L protein. 310 However, the L proteins of BKV, SKV and PKV are similar in size (188-195 amino acids in 311 length), share significant (38-56%) pairwise sequence identity and in the case of BKV and PKV, 312 contain a C-X2-C-X21-C-X2-H zinc finger motif that closely resembles the C-X2-C-X21-C-X2-C 313 zinc finger motif in the AV, MKoV and CKoV L proteins. SV-A, TDV2 and TDV3 L proteins 314 are much shorter, and do not contain zinc finger motifs. BKV/SKV and PKV therefore contain 315 similar ori noncoding and L protein coding sequences flanking two completely unrelated types 316 of IRES, the presence of which is indicative of recombination leading to lateral gene transfer, as 317 suggested previously to account for the presence of related HP-like IRESs in unrelated viruses 318 (21). 319 These picornavirus 5’ UTRs therefore all contain similar 5’-terminal elements that are 320 likely required for replication and encapsidation, followed by an IRES that may either be HP-like 321 (in PKV) or that has a sequence related to that of the AV IRES (BKV, CKoV, MKoV, SV-A, 322 SKV, TV2 and TV3), which may in turn be followed by unrelated spacer elements (BKV/SKV 323 and TV3) (Fig. 3) and divergent L coding sequences. 324 325 Structural model of the Salivirus A IRES 326 The data described above indicate that BKV, SV-A, TV2 and TV3 5’ UTRs contain 327 sequences that are related to the AV IRES. Structural models of these 5’ UTRs were derived 328 using the same complementary methods that had previously been used to obtain models of 329 picornavirus HP-like IRESs (21) and of the AV IRES (95). The models of these IRESs that were 330


.org/D

ownloaded from

http://jvi.asm.org/

15

derived in this way are supported by the results of chemical and enzymatic probing, validating 331 this approach (14, 87, 95). 332 To derive a model of the SV-A 5’ UTR, analysis was initially limited to the complete or 333 near-complete 5’ UTR sequences of SV-A isolate 02394-01 and the closely related SH1 and NG-334 J1 isolates, and was then extended to include 9 partial SV-A 5’ UTR sequences (17, 42, 81). 335 Sequences were aligned and then analyzed using Pfold (36), which applies an explicit 336 evolutionary model to aligned sequences to generate a probabilistic structural model of RNAs. 337 These results were then validated using CentroidFold, a posterior decoding approach (70), and 338 by free energy minimization e.g. Mfold (18, 96). Individual structural elements identified using 339 these approaches are listed in Table 1. Pfold identified all major structural elements except for 340 domain C, domain G and the base of domain J (which were modeled using Mfold, and in the 341 case of domain B, also with pknotsRG) and subdomain Ja (which was identified using 342 CentroidFold). Domain A is absent, confirming that the SV-A sequence is likely incomplete at 343 its 5’-terminus (17). The SV-A 5’ UTR downstream of the putative ori (domains B, C and the 344 pseudoknot) comprises five small hairpins (domains D’-G’ and H), a ~90 nt-long Y-shaped 345 domain (I), the ~200 nt-long cruciform domain J, and a ~100 nt-long interrupted hairpin (domain 346 K) which is separated by a pyrimidine tract from the ~70 nt-long hairpin domain L, which 347 contains the initiation codon (Fig. 4). To maintain a standardized nomenclature, elements that are 348 related to segments of the AV 5’ UTR are named in the same way, whereas unrelated elements 349 are also named sequentially from the putative ori, but are designated as divergent domains by an 350 apostrophe, starting with domain D’. Domains D’-G’ (nt 122-254) are structurally distinct from 351 equivalent domains in the AV IRES, but consistent with the high level of sequence homology 352 downstream of nt 293 with the AV 5’ UTR (see above), the structure of this region of the SV-A 353


.org/D

ownloaded from

http://jvi.asm.org/

16

5’ UTR closely resembles that of the AV 5’ UTR, with only minor differences, such as the 354 presence of an additional 5 base-pair helix at the base of domain I (Figs. 1, 4). Sequence 355 alignments indicate that the only significant insertions (of 4-5nt) or deletions (of 3 nt) in this 356 domain relative to AV domain I occur at its borders (data not shown). Sequence identity is 357 concentrated in domains H, J, K and L (Fig. 1) but the structures of other regions, such as 358 domain I and the domain J apex, are maintained by extensive compensatory mutations (Figs. 1, 359 4). 360 361 Structural model of the Bovine kobuvirus IRES 362 The observation that the BKV and TV2/TV3 5’ UTRs contain sequences that resemble 363 elements of the AV IRES prompted us to use the complementary approaches described above to 364 derive structural models of these 5’ UTRs downstream of the putative ori. This approach 365 identified 5 additional major domains in the BKV 5’ UTR (Table 1). As for SV-A, domains in 366 the BKV 5’ UTR that are related to elements in the AV 5’ UTR are named in the same way, 367 whereas two unrelated elements which form hairpin-like structures interrupted by small internal 368 loops (Fig. 5A) are (in this case) designated domains D’ and E’. Although their sizes are similar 369 to those of the domains D-H that occur between the AV ori and IRES elements, their sequences 370 are distinct from those of these AV domains. Domain I (120nt long) is significantly larger than 371 the equivalent domain in the AV IRES (~80nt long), but like it adopts a Y-shaped structure, 372 whereas domains J (184 nt) and K (117 nt) are comparable in size and structure to equivalent 373 elements in the AV IRES, and there is significant sequence homology between them (see below). 374 The ~180nt-long pyrimidine-rich region downstream of BKV domain K includes the initiation 375


.org/D

ownloaded from

http://jvi.asm.org/

17

codon (AUG809), but neither its sequence nor its potential structure resemble domain L of AV 376 and SV-A. 377 378 Structural model of the Turdivirus IRES 379 The 5’ UTRs of TV2 and TV3 are closely related except for minor relative insertions and 380 deletions, and their sequences were therefore aligned and used to derive a structural model for 381 only one of them. TV3 was chosen because its 5’ UTR is apparently complete, so that a model 382 would complement the intact 5’-terminal domains A-C and pseudoknot (Fig. 2B). These putative 383 ori sequences are followed immediately by a domain that is similar in size (87 nt) to domain I of 384 the AV IRES, has 44% sequence identity to it but diverges somewhat from its regular Y-shaped 385 conformation (Fig. 6). The size and structure of the downstream domains J (196 nt) and K (89 nt) 386 are comparable to equivalent elements in the AV IRES and there is a high degree of sequence 387 homology between them (see below). TV3 domain K is followed immediately by a 19 nt-long 388 pyrimidine (Yn) tract, but there is no sequence or structural similarity between the part of the TV 389 5’ UTR between the Yn tract and the initiation codon (AUG647) and either the equivalent 390 noncoding region of the BKV 5’ UTR or the proximal coding region of the AV genome. 391 In addition to similar 5’-terminal ori structures, BKV and TV2/TV3 5’ UTRs therefore 392 also contain large segments that closely resemble the essential J and K domains of the AV IRES, 393 and they are all flanked by related elements, namely the upstream Y-shaped domain I and the 394 downstream Yn tract. However, these BKV and TV 5’ UTRs differ from the closely related AV 395 and SV-A 5’ UTRs in that the ori and domain I are over 100 nt closer in the BKV 5’ UTR than 396 in the AV 5’ UTR and there is almost no separation between them in the TV3 5’ UTR; 397 moreover, both BKV and TV3 lack an equivalent of AV domain L and instead contain large 398


.org/D

ownloaded from

http://jvi.asm.org/

18

insertions between the domain K/Yn tract tandem and the initiation codon. The structural and 399 sequence homology between the core AV IRES (domains I, J and K) and these other 400 picornavirus elements suggests that they are likely functional IRESs, but are separated from the 401 initiation codon by a spacer that can vary significantly in length and sequence. Interestingly, 402 these spacers do not contain AUG triplets, and thus resemble the spacers found at the same 403 relative location in Type 1 IRESs, which also vary in length and sequence, and lack AUG triplets 404 (5). 405 406 Conservation of structure in picornavirus AV-like IRESs 407

Several picornaviruses have recently been reported with 5’ UTRs that are closely related 408 to either Aichivirus or to Bovine kobuvirus IRESs, including mouse kobuvirus (MKoV) (67), 409 sheep kobuvirus (SKV) (75) and the closely related canine kobuvirus isolate AN211D (41) and 410 canine aichivirus isolate JN088541 (33). Since these sequences were not used to build the 411 structural models of AV and KBV IRESs, their compatibility with them was used as a test of 412 their validity. 413

The few insertions or deletions in MKoV and CKoV IRESs relative to the AV IRES, and 414 in the SKV IRES relative to the BKV IRES mapped either to unpaired regions, or occurred in 415 tandem in both strands of helical elements, thus leading to increases in the length of helices in 416 domains Ja, Jc and the apex of domain K in the MKoV IRES, and in domains Ja, Jb and Jc of the 417 CKoV IRES (Figure 7A, B). Further pair-wise comparisons of MKoV and CKoV IRESs with the 418 AV IRES (Figs. 1, 7A, 7B) and of the SKV IRES with the BKV IRES (Figure 5A, B) indicated 419 that in each case, ~83% of nucleotide differences were covariant (e.g., A - U ⇔ G - C double 420 substitutions), neutral (e.g., A - U ⇔ G - U and G - U ⇔ G - C transitions) or occurred in 421


.org/D

ownloaded from

http://jvi.asm.org/

19

unpaired regions (Table 3). These differences would thus not disrupt base-pairing in predicted 422 helices. A few nucleotide differences between each pair IRESs would disrupt base-pairing 423 (‘disruptive’ differences e.g., A - U ⇔ A - C), but interestingly, many of these nucleotide 424 differences were located in regions of weak base-pairing, and in the immediate proximity of 425 substitutions that would lead to the appearance of new base-pairs. Accordingly, the nucleotide 426 differences observed in these IRESs would tend both to maintain the base-pairing of helical 427 elements and preserve the potential for intrinsic flexibility of weakly base-paired regions. The 428 potential for additional base-pairing was also noted in MKoV and CKoV IRESs at the base of 429 domain L, which may thus be longer than in the AV IRES. The frequencies of compensatory 430 mutations in these IRESs were higher, and of disruptive mutations lower than those in a control 431 set of viral IRES domains with a similar GC content generated by random evolution in silico 432 (21). The observed pattern of sequence variation in AV-like and BKV/SKV IRESs provides 433 strong support for the proposed pattern of folding of the entire IRES and for the existence of the 434 proposed individual structural elements. 435 436 Sequence and structural similarities between AV-like IRESs and their relationships with 437 other IRESs 438 Detailed sequence and structural comparisons between the 5’ UTR elements described 439 above were undertaken to identify their distinguishing characteristics and any similarities with 440 other IRESs. This analysis (see below) showed that these elements constitute a distinct, coherent 441 group. 442 Domain H occurs in the AV, MKoV, CKoV and SV-A 5’ UTRs, and is highly conserved 443 (Fig. 1). Interestingly, the sequence of its apical stem-loop (e.g. AV nt 307-324) is identical to 444


.org/D

ownloaded from

http://jvi.asm.org/

20

that of domain III of some Type 1 IRESs, including those of isolates of Coxsackievirus (CV) B3, 445 CV-B4, Echovirus (EV) 21 and EV-30 (data not shown). Despite its strong conservation, domain 446 H enhances but is not required for AV IRES function, at least in cell-free extracts (95). This 447 finding parallels observations that domain III is lacking in some Type 1 IRESs, and that it is not 448 required by the Type 1 poliovirus IRES (12). The strong sequence conservation in domain H 449 suggests that it may either have an accessory role in IRES function that is apparent only in cells 450 or during viral infection, or that it is involved in some other aspect of viral multiplication. 451 Aichi virus Domain I does not have obvious sequence or structural homologues in other 452 classes of IRES, but it is a well-conserved element of the 5’ UTRs of SV-A, MKoV, CKoV and 453 of other AV isolates (Fig. 1). Moreover, it has significant sequence homology with Domain I of 454 BKV (54% identity), SKV (60% identity) and TV3 (47% identity), which all adopt folds that are 455 related to that of Domain I in AV, MKoV, CKoV and SV-A IRESs. This domain is thus an 456 element that distinguishes AV-like IRESs from other viral IRESs. 457 Systematic pair-wise comparisons of AV, BKV, CKoV, MKoV, SV-A, TV2 and TV3 458 sequences showed that sequence identity in the J-K domain region ranged from 94% for the 459 closely related SV-A to 52% for BKV and TV2 (Table 2). This level of sequence conservation is 460 comparable to that in Type 1 and Type 2 IRESs, which can also diverge from each other in 461 pairwise comparisons by as much as 50% but nevertheless contain related structures (e.g. (5)). 462 There is ~22% absolute conservation of nucleotides within the strongly conserved J and K 463 domains in the eight AV-like IRESs characterized here (which in total comprised over 30 464 sequences), and these conserved residues are concentrated in only a few locations. They include 465 the four-way helical junction and a sub-apical helical region in domain J that is required for AV 466 IRES function (95), the major internal loop of domain K and the apex of this domain (Fig. 1). As 467


.org/D

ownloaded from

http://jvi.asm.org/

21

noted above, the conserved apical region of domain K of AV-like IRESs shares significant 468 homology with the apex of domain J of Type 2 IRESs: both contain a conserved bipartite motif 469 (Figs. 8E-K) that is located at a similar distance from the base of the domain and the adjacent 470 polypyrimidine tract in the different IRESs. This motif is a functionally important element in 471 Type 2 IRESs (4, 9) and is critical for the activity of the AV IRES (95): it is a key determinant of 472 eIF4G’s interaction with both classes of IRES. Although eIF4G also binds specifically to domain 473 V of Type 1 IRESs (11), there is no obvious similarity between the sequence or structure of this 474 region and the apical regions of domain J of Type 2 IRESs and domain K of AV-like IRESs 475 (compare Figs. 8L and 8E-K). 476 Whereas these observations point to a specific similarity between Type 2 and AV-like 477 IRESs, the structure of the apical cruciform region of domain J in the latter (Figs. 8A, 8B) is 478 quite distinct from the structure of the apical region of domain I of Type 2 IRESs (Fig. 8D) and 479 instead resembles the structure of the corresponding apical region of domain IV in Type 1 IRESs 480 such as those of enterovirus 71 (Fig. 8C) and CVB3 (3). Similarities include the overall 481 cruciform pattern of folding, the sizes of the Jb subdomain and of its equivalent in Type 1 IRESs, 482 and the presence in both of a GRNA tetraloop at the apex of this subdomain in a similar 483 structural context, viz. adjacent to a five base-hair hairpin and a 5-6 nt-long internal bulge. 484 However, neither this internal bulge nor the apical loop of subdomain Ja on AV-like IRESs are 485 C-rich, in contrast to the corresponding “loop B” and “loop A” equivalents in Type 1 IRESs (Fig. 486 8C), which are binding sites for the poly(rC) binding protein 2, an ITAF (16). Moreover, 487 subdomains Ja and Jc are significantly smaller than the equivalent hairpins in Type 1 IRESs 488 (compare Figs. 8A-C), The implication that there may be functional differences between these 489 apical cruciform regions of Type 1 and AV-like IRESs is supported by the observations that 490


.org/D

ownloaded from

http://jvi.asm.org/

22

whereas substitution of conserved nucleotides in the apical tetraloop severely impairs Type 1 491 IRES function (32), equivalent substitutions did not reduce the efficiency of initiation on the AV 492 IRES (95). 493 494 Initiation on the Salivirus A IRES is dependent on eIF4A and requires specific binding of 495 eIF4G 496 Initiation on each class of IRES occurs by a distinct mechanism and thus has distinct 497 initiation factor requirements. Salivirus A is representative of the Aichi-like class of IRESs 498 identified here, and we therefore characterized aspects of the mechanism of initiation on it and 499 compared them with initiation on other IRESs. Initiation on mRNAs that require eIF4F (or its 500 eIF4A and eIF4G subunits) for recruitment of 43S complexes (such as the Type 1 PV IRES and 501 the Type II EMCV IRES) is inhibited by dominant negative eIF4AR362Q mutant (56), whereas 502 initiation by mechanisms that are eIF4A-independent (such as on the CSFV IRES) is not (59, 503 66). Translation of SV-A mRNA in rabbit reticulocyte lysate was completely abrogated by 504 inclusion of eIF4AR362Q in translation reactions (Fig. 9B, lanes 2, 5), indicating that this IRES is 505 strongly dependent on eIF4A/eIF4G. 506

The requirement for eIF4G/eIF4A in initiation on Type I IRESs, Type II IRESs and the 507 AV IRES in each case involves specific binding of eIF4G to the IRES in a manner that is 508 enhanced by eIF4A (21, 44, 62, 65, 95). The ability of eIF4Gm to bind specifically to the SV-A 509 IRES was characterized using the directed hydroxyl radical probing technique, in which Fe(II) 510 tethered to unique surface-exposed cysteine residues on eIF4Gm via the linker 1-(p-511 bromoacetamidobenzyl)-EDTA (BABE) is used to generate hydroxyl radicals that cleave the 512 IRES in its immediate vicinity. Cleavage sites were then mapped by primer extension inhibition. 513


.org/D

ownloaded from

http://jvi.asm.org/

23

eIF4Gm consists of five pairs of stacked α-helices (48), and we used a cysteine-less (Cys-less) 514 variant and two previously validated eIF4Gm mutants with single surface-exposed cysteines (11, 515 39, 94, 95): a substitution mutant with a novel cysteine at residue 829 (located between helices 516 2b and 3a) and a D928→D928C insertion mutant, designated C929, with a novel cysteine residue 517 located after helix 4b)(numbering as in the revised sequence NM_182917). Hydroxyl radicals 518 from Cys829 cleaved the SV-A IRES in ternary eIF4Gm/eIF4A/IRES complexes at nts 626-627, 519 637-638, 645, 681 and strongly at nts 663-666, and hydroxyl radicals from C929 cleaved the 520 IRES at nts 649-656 (Fig. 9D). These sites of cleavage mapped to opposite sides of domain K 521 (Fig. 9C), overlapping the conserved motif identified near the apex of this domain that is 522 identical to a determinant of eIF4G’s interaction with Type II IRESs (Fig. 1; Figs. 8E-8K). 523

Disruption of this element in SV-A (Mut1) mRNA abrogated both its translation (Fig. 524 9B, lanes 2, 3; Fig. 9C), and its cleavage by Fe(II)-eIF4Gm (Fig. 9D, compare lanes 2, 3 and 5, 525 6). These results are directly comparable to the results of mutation of this conserved element in 526 the AV IRES (95), and similarly suggest that the loss of function of the mutant SV-A IRES in 527 promoting translation initiation is due to loss of its ability to bind stably to eIF4G. 528 529 Initiation on the Salivirus A IRES is dependent on DHX29. 530 A distinguishing characteristic of initiation on the AV IRES is its strong dependence on 531 the DExH-box protein DHX29 (Fig. 10B, lanes 2-5; (95)). DHX29 almost abrogates initiation on 532 IGR and HP-like IRES, whereas on the Type 2 EMCV IRES, it promotes 48S complex 533 formation at AUG826, which is upstream of the initiation codon for the viral polyprotein 534 (AUG834) ((71), Figure 10A, lanes 1, 3). The function of DHX29 in initiation is to ensure that 535 structured mRNA is properly unwound and accommodated in the mRNA-binding cleft of the 536


.org/D

ownloaded from

http://jvi.asm.org/

24

40S subunit (1, 71), and in the case of the AV IRES, its dependence on DHX29 is due to 537 sequestration of the initiation codon in Domain L, a stable hairpin. Our analysis of the SV-A 538 IRES indicated that it has a similar structure (Fig. 4), suggesting that it, too, might be dependent 539 on DHX29. 540 This was tested by in vitro reconstitution of 48S complex formation on the SV-A IRES 541 from individual purified components of the translation apparatus, using primer extension 542 inhibition to map the position of this complex on the mRNA. Aminoacylated initiator tRNA, 543 ribosomal 40S subunits, and eIFs 1, 1A, 2, 3, 4A, 4B and 4F, with or without PTB, led to a very 544 low level of 48S complex formation at AUG722 on the SV-A IRES, (Fig. 10C, lanes 1-3). 48S 545 complex formation was strongly enhanced by inclusion of DHX29 (Fig. 10C, lanes 1, 4, 5). The 546 presence of PTB in initiation reactions enhanced toeprints at nt. 686-688, which map to a helical 547 element in domain K (Fig. 10C, lanes 3, 5; Fig. 10F, lanes 3, 5). Binding of PTB to the AV IRES 548 led to the appearance of toeprints at an identical location (95). 549 To determine whether the sequestration of the SV-A initiation codon in Domain L, a 550 stable hairpin (ΔG = -23.3 kcal/mol), accounts for the requirement for DXH29, we characterized 551 the effect of a disruptive mutation that reduced the stability of the residual domain to ΔG = -14.3 552 kcal/mol (SV-A Mut2) (Figs. 10D, E). These substitutions enhanced SV-A IRES-mediated 553 translation in RRL (Fig.9B, lanes 2, 4), and in vitro reconstitution of initiation on SV-A Mut2 554 mRNA yielded a greater level of 48S complex formation than on the equivalent wild-type 555 mRNA, and importantly, 48S complex formation was independent of DHX29 (Fig.10F, compare 556 lanes 2-5). 557


.org/D

ownloaded from

http://jvi.asm.org/

25

Taken together, these observations indicate that the factor requirements for initiation on 558 the SV-A IRES correspond to the requirements for initiation on the AV IRES, but differ from the 559 requirements for initiation on Type 2, IGR and HP-like IRESs. 560 Discussion 561 Structural and functional analyses indicate that the 5’ UTR of Aichi virus, the type 562 member of the Kobuvirus genus of picornaviruses, contains an IRES that has a structure and 563 which uses a mechanism that are in many respects distinct from those of established classes of 564 IRES (95). Sequence analysis and modeling of secondary structures reported here have now 565 identified elements in the 5’ UTRs of BKV, CKoV, MKoV and SKoV (also members of the 566 Kobuvirus genus), SV-A (of the proposed Salivirus genus) and TV types 2 and 3 (members of 567 the proposed Paraturdivirus genus) that are closely related to the AV IRES and that together 568 constitute a new class of IRES. Further members of this group will likely be identified, such as 569 tortoise testivirus 1 (which on the basis of the 115 nt preceding the initiation codon, has a 5’ 570 UTR that is related to that of AV) (22). 571 572 Sequence and structural characteristics of AV-like IRESs 573 AV-like IRESs contain unique structural elements (domain I, the basal region of domain 574 K and domain L), elements that are either highly homologous or structurally related to elements 575 in Type 1 IRESs (i.e. the apical hairpin of AV domain H and the apical cruciform region of 576 domain J), an element (the apex of AV domain K) that is highly homologous to an element in 577 Type 2 IRESs, and elements that have direct sequence/structural counterparts in Type 1 and 578 Type 2 IRESs (such as the GNRA tetraloop) or in Type 1, Type 2 and Type 3 IRESs (the Yn 579 tract). The essential core of the AV IRES consists of domains I, J, K and the adjacent Yn tract 580


.org/D

ownloaded from

http://jvi.asm.org/

26

(95), and these domains constitute the most highly conserved elements of the different AV-like 581 IRESs identified here. Domains H and L are highly conserved in all AV, CKoV, MKoV and SV-582 A isolates (Fig. 1) but the former is divergent and the latter does not occur at all in BKV and 583 TV2/TV3 5’ UTRs. It may thus be appropriate to assign these IRESs to two sub-classes. 584 Sequence identity within the core of AV-like IRESs is high, and is concentrated in discrete 585 locations that include the apical cruciform region of domain J and the apical region of domain K 586 (Fig. 1). 587 Specific functions have been assigned to several elements in AV-like IRESs, including 588 some that distinguish them from other classes of IRES (95). The well-conserved Domain I (Fig. 589 1) contains binding sites for PTB, which enhances initiation on the AV IRES. Domain K of AV-590 like IRESs has a structure that in its entirety is also distinct from other domains in members of 591 established IRES groups, although it does contain a conserved apical element that is identical to 592 a motif in Type 2 IRESs (Fig. 8). Data reported here for SV-A (Fig. 9) and elsewhere for the AV 593 IRES (95) revealed that this motif is a key determinant of the interaction of these IRESs with 594 eIF4G, and is essential for their function. The fact that this motif has the same key role of 595 binding eIF4G during initiation on Type II IRESs constitutes a point of significant similarity 596 between these two types of IRES (4, 9, 39, 94, 95). Footprinting and directed hydroxyl radical 597 probing experiments have shown that the basal region of domain K, which is not related to any 598 part of the Type 2 IRES, constitutes a second major site of interaction with PTB, and that PTB 599 interacts with this and other parts of the AV IRES (95) in a way that is distinct from its modes of 600 binding to Type 1 and Type 2 IRESs (30, 31). Domain L in AV, CKoV, MKoV and SV-A IRESs 601 contains the initiation codon for the viral polyprotein, and data reported here (Fig. 10) and 602 elsewhere (95) indicate that this domain’s stability accounts for the AV and SV-A IRES’s 603


.org/D

ownloaded from

http://jvi.asm.org/

27

unusual requirement for DHX29, a DExH-box protein that has been implicated in correct 604 accommodation of structured mRNA in the mRNA-binding channel of the 40S subunit for 605 scanning through highly structured 5’ UTRs (1, 71, 81). This requirement for DHX29 is in 606 contrast to all other IRESs that have been characterized to date (71). A further point of difference 607 concerns domain J of AV-like IRESs, which has a global fold that resembles domain IV of Type 608 1 IRESs, and to a lesser extent, Domain I of Type 2 IRESs. The specific role of these large 609 central domains in internal initiation is not known, but mutational analyses have established that 610 the requirement for conserved sequence elements within them differs. AV IRES function 611 depends on the integrity of subdomain Jb, which contains a highly conserved central element 612 (Fig. 1), but not on the sequence of its GNRA tetraloop (95) whereas the activities of Type 1 and 613 Type 2 IRESs depend strongly on the nature of the sequence of this tetraloop motif (32, 45, 76). 614 Taken together, there are therefore global structural and mechanistic similarities between 615 Type 1, Type 2 and AV-like IRESs that distinguish them from IGR IRESs and HP-like IRESs, 616 but there are also clear differences between AV-like IRESs and the other two major classes of 617 picornavirus IRESs that justify the classification of them into separate groups. 618 619 Recombination as a source of diversity in viral IRESs 620 Recombination enables genetic diversity to be generated rapidly over a broad sequence 621 space, and it therefore contributes significantly to the divergence and evolution of many viruses. 622 In picornaviruses, recombination occurs primarily, but not exclusively in regions of the genome 623 encoding non-structural proteins and is usually limited to members of the same or closely related 624 species (82). One factor that likely accounts for the majority of viable picornavirus recombinants 625 deriving from parental strains with high levels of sequence identity is the requirement for the 626


.org/D

ownloaded from

http://jvi.asm.org/

28

maintenance of sequence-specific interactions between viral proteins, or between viral proteins 627 and RNA. Recombinants that disrupt interactions within a protein or RNA structure or assembly 628 are likely to be rapidly lost from viral populations by purifying selection. On the other hand, 629 exchange of modular elements between genomes leading to the appearance of viable 630 recombinants with novel combinations of characteristics (6) may be more feasible if such 631 elements do not interact extensively with sequences elsewhere in the genome. In the case of 632 RNA, such elements would be ‘self contained’ in the sense of adopting the same optimal 633 structure whether they exist in isolation or as part of a longer sequence (85). IRESs fit this 634 criterion, and function in the absence of interaction with other elements of the genome: indeed, a 635 key test for their activity is for them to mediate initiation in the context of synthetic dicistronic 636 mRNAs in which they are flanked by heterologous sequences (5). 637 We have previously suggested that the presence of related HP-like IRES elements in 638 distinct, deeply branched genera of Picornaviridae and in distinct genera of Flaviviridae, 639 juxtaposed against unrelated coding sequences, suggest that IRES ‘modules’ have been 640 exchanged between these viruses by recombination (21), which might represent an example of 641 lateral gene transfer (24). The observation that the genomes of BKV and SKV on the one hand, 642 and PKV on the other contain structurally and mechanistically distinct IRES elements located in 643 between related noncoding ori and coding L protein sequences (Fig.3; 73, 75) provide further 644 strong support for the hypothesis that IRESs could be considered as independent functional 645 modules that can be transferred between related or unrelated genomes. The example of 646 BKV/SKV and PKV may be an extreme case in which unrelated elements in picornaviruses have 647 been exchanged by recombination, but the possibility that related IRESs can be exchanged 648 between kobuviruses is supported by the recent determination that the Aichi virus isolate Chshc7 649


.org/D

ownloaded from

http://jvi.asm.org/

29

has a mosaic structure in which nt 261-852 (i.e. the IRES and part of the L coding region) may 650 derive from a different isolate than the remainder of the genome (20). Moreover, the observation 651 that the core AV-like IRES elements identified here are located at positions relative to the ori or 652 the initiation codon that are in each case unique further supports the possibility that 653 recombination may occur in the 5’ UTR to exchange functional noncoding RNA elements 654 between viruses from different genera. Thus the spacer between ori and domain I of the IRES 655 ranges in length from 5 nt (TV3) to ~240 nt (SV-A) in the examples considered here, and even in 656 the closely related AV and SV-A differs in terms of length and sequence, whereas at the 3’-657 border of the IRES, the initiation codon maybe part of a conventional Yn-Xm-AUG motif, or 658 may, as in BKV and TV3, be separated by a long spacer. Significantly, a growing number of 659 interspecies and intraspecies recombination events involving picornavirus 5’ UTRs has been 660 reported (e.g. 27, 46, 49, 55, 84, 92). The suggestion that IRES elements can be exchanged in 661 toto between picornavirus genomes by recombination does not preclude the possibility that this 662 mechanism might also lead to the transfer of individual IRES domains between genomes. In this 663 respect, the identification of homology between the apical regions of domain J in AV-like IRESs 664 and domain J in cardio- and aphthovirus IRESs, which are otherwise distinct, is particularly 665 intriguing: this region includes the highly conserved eIF4G-binding motif and in some instances 666 extends over as much as 74 nt. 667 Analysis of the genomes of plant and other RNA viruses provides additional support for 668 the hypothesis that terminal noncoding RNA regions of viral genomes contain functional, 669 independently folded structural elements that can be transferred between species, genera and 670 even families by recombination. There is direct evidence for recombinational transfer of the 671 ~300 nt-long 3’ UTR of grapevine chrome mosaic virus RNA-1 to tomato black ring virus RNA-672


.org/D

ownloaded from

http://jvi.asm.org/

30

2 (40), and a similar phenomenon could account for the presence of structurally related and 673 functionally exchangeable translational enhancers known as Barley yellow Dwarf virus 674 (BYDV)-like translation elements in the 3’ UTRs of members of Luteovirus, Dianthovirus, 675 Necrovirus and Umbravirus genera (50, 86) and of sequence- and structurally-related 3'-cap-676 independent translational enhancer (3'CITE) in the 3’ UTRs of members of Tombusvirus, 677 Aureusvirus and Carmovirus genera (53), and of the stem-loop-2-like motif (s2m) in the 3’ end 678 of the genome of some species in Astroviridae, Caliciviridae, Coronaviridae and Picornaviridae 679 (37, 77). 680 681 682 683 684 Acknowledgements 685 This work was supported by the National Institutes of Health grant AI-51340. 686 687 688 689 690 691 692 693 694 695


.org/D

ownloaded from

http://jvi.asm.org/

31

696 697 698 References 699 1. Abaeva, I.S., A. Marintchev, V.P. Pisareva, C.U. Hellen, and T.V. Pestova. 2011. 700 Bypassing of stems versus linear base-by-base inspection of mammalian mRNAs during 701 ribosomal scanning. EMBO J. 30:115-129. 702 2. Ali, I.K., L. McKendrick, S.J. Morley, and R.J Jackson. 2001. Activity of the hepatitis 703 A virus IRES requires association between the cap-binding translation initiation factor 704 (eIF4E) and eIF4G. J. Virol. 75:7854-7863. 705 3. Bailey, J.M., and W.E. Tapprich. 2007. Structure of the 5' nontranslated region of the 706 Coxsackievirus B3 genome: Chemical modification and comparative sequence analysis. 707 J. Virol. 81:650-668. 708 4. Bassili, G., E. Tzima, Y. Song, L. Saleh, K. Ochs, and M. Niepmann. 2004. Sequence 709 and secondary structure requirements in a highly conserved element for foot-and-mouth 710 disease virus internal ribosome entry site activity and eIF4G binding. J. Gen. Virol. 711 85:2555-2565. 712 5. Belsham, G.J., and R.J. Jackson. 2000. Translation initiation on picornavirus RNA. in 713 ‘Translational control of gene expression’, pp869-900. eds. Sonenberg N, Hershey JWB, 714 Mathews MB. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 715 6. Botstein, D. 1980. A theory of modular evolution for bacteriophages. Ann. NY Acad. 716 Sci. 354:484-490. 717


.org/D

ownloaded from

http://jvi.asm.org/

32

7. Brown, E.A., A.J. Zajac, and S.M. Lemon. 1994. In vitro characterization of an internal 718 ribosomal entry site (IRES) present within the 5' nontranslated region of hepatitis A virus 719 RNA: comparison with the IRES of encephalomyocarditis virus. J. Virol. 68:1066-1074. 720 8. Chard, L.S., M.E. Bordeleau, J. Pelletier, J. Tanaka, and G.J. Belsham. 2006. 721 Hepatitis C virus-related internal ribosome entry sites are found in multiple genera of the 722 family Picornaviridae. J. Gen. Virol. 87:927-936. 723 9. Clark, A.T., M.E. Robertson, G.L. Conn, and G.J. Belsham. 2003. Conserved 724 nucleotides within the J domain of the encephalomyocarditis virus internal ribosome 725 entry site are required for activity and for interaction with eIF4G. J. Virol. 77:12441-726 12449. 727 10. de Breyne, S., Y. Yu, T.V. Pestova, and C.U. Hellen. 2008. Factor requirements for 728 translation initiation on the Simian picornavirus internal ribosomal entry site. RNA 729 14:367-380. 730 11. de Breyne, S., Y. Yu, A. Unbehaun, T.V. Pestova, and C.U.T. Hellen. 2009. Direct 731 functional interaction of initiation factor eIF4G with type 1 internal ribosomal entry sites. 732 Proc. Natl. Acad. Sci. USA 106:9197-9202. 733 12. Dildine, S.L., and B.L. Semler. 1989. The deletion of 41 proximal nucleotides reverts a 734 poliovirus mutant containing a temperature-sensitive lesion in the 5' noncoding region of 735 genomic RNA. J. Virol 63:847-862. 736 13. Drexler, J.F., S. Baumgarte, L.K. de Souza Luna, M. Eschbach-Bludau, A.N. 737

Lukashev, and C. Drosten. 2011. Aichi virus shedding in high concentrations in 738 patients with acute diarrhea. Emerg Infect Dis. 17:1544-1548. 739


.org/D

ownloaded from

http://jvi.asm.org/

33

14. Easton, L.E., N. Locker, and P.J. Lukavsky. 2009. Conserved functional domains and 740 a novel tertiary interaction near the pseudoknot drive translational activity of hepatitis C 741 virus and hepatitis C virus-like internal ribosome entry sites. Nucleic Acids Res. 37:5537-742 5549. 743 15. Evstafieva, A.G., T.Y. Ugarova, B.K. Chernov, and I.N. Shatsky. 1991. A complex 744 RNA sequence determines the internal initiation of encephalomyocarditis virus RNA 745 translation. Nucleic Acids Res. 19:665-671. 746 16. Gamarnik, A.V., and R. Andino. 2000. Interactions of viral protein 3CD and poly(rC) 747 binding protein with the 5' untranslated region of the poliovirus genome. J. Virol. 748 74:2219-2226. 749 17. Greninger, A.L., Runckel, C., Chiu, C.Y., Haggerty, T., Parsonnet, J., Ganem, D., 750 and J.L. DeRisi. 2009. The complete genome of klassevirus - a novel picornavirus in 751 pediatric stool. Virol J. 6:82. 752 18. Gruber, A.R., R. Lorenz, S.H. Bernhart, R. Neuböck, and I.L. Hofacker. The Vienna 753 RNA websuite. Nucleic Acids Res. 36:W70-4. 754 19. Haller, A.A., and B.L. Semler. 1992. Linker scanning mutagenesis of the internal 755 ribosome entry site of poliovirus RNA. J. Virol. 66:5075-5086. 756 20. Han, X., W. Zhang, Y. Xue, and S. Shao. 2011. Sequence analysis reveals mosaic 757

genome of Aichi virus. Virol J. 8:390. 758 21. Hellen, C.U., and S. de Breyne. 2007. A distinct group of hepacivirus/pestivirus-like 759 internal ribosomal entry sites in members of diverse picornavirus genera: evidence for 760 modular exchange of functional noncoding RNA elements by recombination. J. Virol. 761 81:5850-5863. 762


.org/D

ownloaded from

http://jvi.asm.org/

34

22. Heuser, W., E. Kaleta, K. Giesow, G.M. Keil, and N.J. Knowles. 2010. Genome 763 sequence of virus “X”, a picornavirus isolated from a spur-thighed tortoise (Testudo 764 graeca). EUROPIC 2010: 16th meeting of the European Study Group on the Molecular 765 Biology of Picornaviruses, St. Andrews, Scotland, 11-16th September 2010. Abstract 766 H15. 767 23. Hollister, J.R., A. Vagnozzi, N.J. Knowles, and E. Rieder. 2008. Molecular and 768 phylogenetic analyses of bovine rhinovirus type 2 shows it is closely related to foot-and-769 mouth disease virus. Virology 373:411-425. 770 24. Holmes, E.C. 2009. The evolution and emergence of RNA viruses. Oxford Series in 771 Ecology and Evolution (OSEE). Oxford University Press, Oxford, UK. 772 25. Holtz, L.R., S.R. Finkbeiner, G. Zhao, C.D. Kirkwood, R. Girones, J.M. Pipas, and 773 D. Wang. 2009. Klassevirus 1, a previously undescribed member of the family 774 Picornaviridae, is globally widespread. Virol J. 6:86. 775 26. Honkavuori, K.S., Shivaprasad, H.L., Briese, T., Street, C., Hirschberg, D.L., 776 Hutchison, S.K., and Lipkin, W.I. 2011. Novel picornavirus in Turkey poults with 777 hepatitis, California, USA. Emerg. Infect. Dis. 17:480-487. 778 27. Huang, T., W. Wang, M. Bessaud, P. Ren, J. Sheng, H. Yan, J. Zhang, X. Lin, Y. 779 Wang, F. Delpeyroux, and V. Deubel. 2009. Evidence of recombination and genetic 780 diversity in human rhinoviruses in children with acute respiratory infection. PLoS One 781 4:e6355. 782 28. Jackson, R.J., C.U.T. Hellen, and T.V. Pestova. 2010. The mechanism of eukaryotic 783 translation initiation and principles of its regulation. Nat. Rev. Mol. Cell. Biol. 11:113-784 127. 785


.org/D

ownloaded from

http://jvi.asm.org/

35

29. Jang, S.K., T.V. Pestova, C.U.T. Hellen, G.W. Witherell, and E. Wimmer. 1990. 786 Cap-independent translation of picornavirus RNAs: structure and function of the internal 787 ribosomal entry site. Enzyme 44:292-309. 788 30. Kafasla, P., N. Morgner, T.A. Pöyry, S. Curry, C.V. Robinson, and R. J. Jackson. 789 2009. Polypyrimidine tract binding protein stabilizes the encephalomyocarditis virus 790 IRES structure via binding multiple sites in a unique orientation. Mol. Cell 34:556-568. 791 31. Kafasla, P., N. Morgner, C.V. Robinson, and R.J. Jackson. 2010. Polypyrimidine 792 tract-binding protein stimulates the poliovirus IRES by modulating eIF4G binding. 793 EMBO J. 29:3710-3722. 794 32. Kaminski, A., S.L. Hunt, C.L. Gibbs, and R.J. Jackson. 1994. Internal initiation of 795 mRNA translation in eukaryote. In: Setlow JK, ed. Genetic engineering, Vol. 16, New 796 York: Plenum Press pp 115-155. 797 33. Kapoor, A., P. Simmonds, E.J. Dubovi, N. Qaisar, J.A. Henriquez, J. Medina, S. 798

Shields, and W.I. Lipkin. 2011. Characterization of a canine homolog of human 799 Aichivirus. J. Virol. 85:11520-11525. 800

34. Kapoor, A., J. Victoria, P. Simmonds, E. Slikas, T. Chieochansin, A. Naeem, S. 801 Shaukat, S. Sharif, M.M. Alam, M. Angez, C. Wang, R.W. Shafer, S. Zaidi, and E. 802 Delwart. 2008a. A highly prevalent and genetically diversified Picornaviridae genus in 803 South Asian children. Proc. Natl. Acad. Sci. USA 105:20482-20487. 804 35. Kapoor, A., J. Victoria, P. Simmonds, C. Wang, R.W. Shafer, R. Nims, O. Nielsen, 805 and E. Delwart. 2008b. A highly divergent picornavirus in a marine mammal. J. Virol. 806 82:311-320 807 36. Knudsen, B. and J. Hein. (2003) Pfold: RNA secondary structure prediction using 808


.org/D

ownloaded from

http://jvi.asm.org/

36

stochastic context-free grammars. Nucleic Acids Res. 31:3423-3428. 809 37. Kofstad, T., and C.M. Jonassen. 2011. Screening of feral and wood pigeons for viruses 810

harbouring a conserved mobile viral element: characterization of novel astroviruses and 811 picornaviruses. PLoS ONE 6(10): e25964. 812

38. Kolupaeva, V.G., S. de Breyne, T.V. Pestova, and C.U. Hellen. 2007. In vitro 813 reconstitution and biochemical characterization of translation initiation by internal 814 ribosomal entry. Methods Enzymol. 430: 409-439. 815 39. Kolupaeva, V.G., I.B. Lomakin, T.V. Pestova, and C.U. Hellen. 2003. Eukaryotic 816 initiation factors 4G and 4A mediate conformational changes downstream of the 817 initiation codon of the encephalomyocarditis virus internal ribosomal entry site. Mol. 818 Cell. Biol. 23:687-698. 819 40. Le Gall, O., T. Candresse, and J. Dunez. 1995. Transfer of the 3' non-translated region 820 of grapevine chrome mosaic virus RNA-1 by recombination to tomato black ring virus 821 RNA-2 in pseudorecombinant isolates. J. Gen. Virol. 76:1285-1289. 822 41. Li, L., Pesavento, P.A., Shan, T., Leutenegger, C.M., Wang, C., and E.L. Delwart. 823

2011. Viruses in diarrhetic dogs include novel kobuviruses and sapoviruses. J. Gen. 824 Virol. 92: 2534-2541. 825

42. Li, L., J. Victoria, A. Kapoor, O. Blinkova, C. Wang, F. Babrzadeh, C.J. Mason, P. 826 Pandey, H. Triki, O. Bahri, B.S. Oderinde, M.M. Baba, D.N. Bukbuk, J.M. Besser, 827 J.M. Bartkus, and E.L. Delwart. 2009. A novel picornavirus associated with 828 gastroenteritis. J. Virol. 83:12002-12006. 829


.org/D

ownloaded from

http://jvi.asm.org/

37

43. Lomakin, I.B., N.E. Shirokikh, M.M. Yusupov, C.U. Hellen, T.V. Pestova. 2006. The 830 fidelity of translation initiation: reciprocal activities of eIF1, IF3 and YciH. EMBO J. 25: 831 196-210. 832 44. Lomakin, I. B., C. U. T. Hellen, and T. V. Pestova. 2000. Physical association of 833

eukaryotic initiation factor 4G (eIF4G) with eIF4A strongly enhances binding of eIF4G 834 to the internal ribosomal entry site of encephalomyocarditis virus and is required for 835 internal initiation of translation. Mol. Cell. Biol. 20:6019–6029. 836

45. López de Quinto, S., and E. Martínez-Salas. 1997. Conserved structural motifs located 837 in distal loops of aphthovirus internal ribosome entry site domain 3 are required for 838 internal initiation of translation. J. Virol. 71:4171-4175. 839 46. Lukashev, A.N., V.A. Lashkevich, O.E. Ivanova, G.A. Koroleva, A.E. Hinkkanen, 840 and J. Ilonen. 2005. Recombination in circulating Human enterovirus B: independent 841 evolution of structural and non-structural genome regions. J. Gen. Virol. 86:3281-3290. 842 47. Lukavsky, P.J. 2009. Structure and function of HCV IRES domains. Virus Res. 843 139:166-171. 844 48. Marcotrigiano, J., I. B. Lomakin, N. Sonenberg, T. V. Pestova, C. U. T. Hellen, and 845

S. K. Burley. 2001. A conserved HEAT domain within eIF4G directs assembly of the 846 translation initiation machinery. Mol. Cell 7:193–203. 847

49. McIntyre, C.L., E.C. McWilliam Leitch, C. Savolainen-Kopra, T. Hovi, and P. 848 Simmonds. 2010. Analysis of genetic diversity and sites of recombination in human 849 rhinovirus species C. J. Virol. 84:10297-10310. 850 50. Meulewaeter, F., R. van Lipzig, A.P. Gultyaev, C.W. Pleij, D. Van Damme, M. 851 Cornelissen, and G. van Eldik. 2004. Conservation of RNA structures enables TNV and 852


.org/D

ownloaded from

http://jvi.asm.org/

38

BYDV 5’ and 3’ elements to cooperate synergistically in cap-independent translation. 853 Nucleic Acids Res. 32:1721-1730. 854 51. Nagashima, S., J. Sasaki, and K. Taniguchi. 2005. The 5'-terminal region of the Aichi 855 virus genome encodes cis-acting replication elements required for positive- and negative-856 strand RNA synthesis. J. Virol. 79:6918-6931. 857 52. Nakashima, N. and T. Uchiumi. 2009. Functional analysis of structural motifs in 858 dicistroviruses. Virus Res. 139:137-147. 859 53. Nicholson, B.L., B. Wu, I. Chevtchenko, and K.A. White. 2010. Tombusvirus 860 recruitment of host translational machinery via the 3' UTR. RNA 16:1402-1419. 861 54. Niepmann M. 2009. Internal translation initiation of picornaviruses and hepatitis C virus. 862 Biochim. Biophys. Acta 1789:529-541. 863 55. Oberste, M.S., S. Peñaranda, and M.A. Pallansch. 2004. RNA recombination plays a 864

major role in genomic change during circulation of coxsackie B viruses. J. Virol. 865 78:2948-2955. 866

56. Pause, A., N. Methot, Y. Svitkin, W.C. Merrick, and N. Sonenberg. 1994. Dominant 867 negative mutants of mammalian translation initiation factor eIF-4A define a critical role 868 for eIF-4F in cap-dependent and cap-independent initiation of translation. EMBO J. 869 13:1205–1215. 870

57. Pestova, T.V., S.I. Borukhov, and C.U. Hellen. 1998. Eukaryotic ribosomes require 871 initiation factors 1 and 1A to locate initiation codons. Nature 394:854-859. 872 58. Pestova, T.V., S. de Breyne, A.V. Pisarev, I.S. Abaeva, and C.U.T. Hellen. 2008. 873 eIF2-dependent and eIF2-independent modes of initiation on the CSFV IRES: a common 874 role of domain II. EMBO J. 27:1060-1072. 875


.org/D

ownloaded from

http://jvi.asm.org/

39

59. Pestova, T.V., and C.U.T. Hellen. 1999. Internal initiation of translation of bovine viral 876 diarrhea virus RNA. Virology 258:249-256. 877 60. Pestova, T.V., and C.U.T. Hellen. 2001. Preparation and activity of synthetic 878 unmodified mammalian tRNAi(Met) in initiation of translation in vitro. RNA 7:1496-879 1505. 880 61. Pestova, T.V., and C.U.T. Hellen. 2003. Translation elongation after assembly of 881 ribosomes on the Cricket paralysis virus internal ribosomal entry site without initiation 882 factors or initiator tRNA. Genes Dev. 17:181-186. 883 62. Pestova, T.V., C.U.T. Hellen, and I.N. Shatsky. 1996. Canonical eukaryotic initiation 884 factors determine initiation of translation by internal ribosomal entry. Mol. Cell. Biol. 885 16:6859-6569. 886 63. Pestova, T.V., C.U. Hellen, and E. Wimmer. 1991. Translation of poliovirus RNA: role 887 of an essential cis-acting oligopyrimidine element within the 5’ nontranslated region and 888 involvement of a cellular 57-kilodalton protein. J. Virol. 65:6194-6204. 889 64. Pestova, T.V., C.U. Hellen, and E. Wimmer. 1994. A conserved AUG triplet in the 5’ 890 nontranslated region of poliovirus can function as an initiation codon in vitro and in vivo. 891 Virology 204:729-737. 892 65. Pestova, T.V., I.N. Shatsky, and C.U.T. Hellen. 1996. Functional dissection of 893 eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit 894 are sufficient to mediate internal entry of 43S preinitiation complexes. Mol. Cell. Biol. 895 16:6870-6878. 896 66. Pestova, T.V., I.N. Shatsky, S.P. Fletcher, R.J. Jackson, and C.U.T. Hellen. 1998. A 897 prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon 898


.org/D

ownloaded from

http://jvi.asm.org/

40

during internal translation initiation of hepatitis C and classical swine fever virus RNAs. 899 Genes Dev. 12:67-83. 900 67. Phan, T.G., B. Kapusinszky, C. Wang, R.K. Rose, H.L. Lipton, and E.L. Delwart. 901

2011. The fecal viral flora of wild rodents. PLoS Pathog. 7:e1002218. 902 68. Pilipenko, E.V., T.V. Pestova, V.G. Kolupaeva, E.V. Khitrina, A.N. Poperechnaya, 903 V.I. Agol, and C.U.T. Hellen. 2000. A cell cycle-dependent protein serves as a template-904 specific translation initiation factor. Genes Dev. 14:2028-2045. 905 69. Pisarev, A.V., L.S. Chard, Y. Kaku, H.L. Johns, I.N. Shatsky, and G.J. Belsham. 906 2004. Functional and structural similarities between the internal ribosome entry sites of 907 hepatitis C virus and porcine teschovirus, a picornavirus. J. Virol. 78:4487-4497. 908 70. Pisarev, A.V., A. Unbehaun, C.U. Hellen, T.V. Pestova. 2007. Assembly and analysis 909

of eukaryotic translation initiation complexes. Methods Enzymol. 430: 147-177. 910 71. Pisareva, V.P., A.V. Pisarev, A.A. Komar, C.U. Hellen, and T.V. Pestova. 2008. 911 Translation initiation on mammalian mRNAs with structured 5’ UTRs requires DExH-912 box protein DHX29. Cell 135:1237-1250. 913 72. Reeder, J., P. Steffen, and R. Giegerich. 2007. pknotsRG: RNA pseudoknot folding 914 including near-optimal structures and sliding windows. Nucleic Acids Res. 35:W320-4. 915 73. Reuter, G., A. Boldizsár, and P. Pankovics. 2009. Complete nucleotide and amino acid 916 sequences and genetic organization of porcine kobuvirus, a member of a new species in 917 the genus Kobuvirus, family Picornaviridae. Arch. Virol. 154:101-108. 918 74. Reuter, G., A. Boros, and P. Pankovics. 2011. Kobuviruses - a comprehensive review. 919 Rev. Med. Virol. 21:32-41. 920


.org/D

ownloaded from

http://jvi.asm.org/

41

75. Reuter, G., A. Boros, P. Pankovics, and L. Egyed. 2010. Kobuvirus in domestic sheep, 921 Hungary. Emerg. Infect. Dis. 16:869-870. 922

76. Robertson, M.E., R.A. Seamons, and G.J. Belsham. 1999. A selection system for 923 functional internal ribosome entry site (IRES) elements: analysis of the requirement for a 924 conserved GNRA tetraloop in the encephalomyocarditis virus IRES. RNA 5:1167-1179. 925 77. Robertson, M.P., H. Igel, R. Baertsch, D. Haussler, M. Ares Jr., and W.G. Scott. 2005. 926

The structure of a rigorously conserved RNA element within the SARS virus genome. 927 PLoS Biol. 3:e5. 928

78. Sasaki, J., Y. Kusuhara, Y. Maeno, N. Kobayashi, T. Yamashita, K. Sakae, N. 929 Takeda, and K. Taniguchi. 2001. Construction of an infectious cDNA clone of Aichi 930 virus (a new member of the family Picornaviridae) and mutational analysis of a stem-931 loop structure at the 5’ end of the genome. J. Virol. 75:8021-8030. 932 79. Sasaki, J., and K. Taniguchi. 2003. The 5'-end sequence of the genome of Aichi virus, a 933 picornavirus, contains an element critical for viral RNA encapsidation. J. Virol. 77:3542-934 3548. 935 80. Sato, K., M. Hamada, K. Asai, and T. Mituyama. 2009. CENTROIDFOLD: a web 936 server for RNA secondary structure prediction. Nucleic Acids Res. 37:W277-80. 937 81. Shan, T., C. Wang, L. Cui, Y. Yu, E. Delwart, W. Zhao, C. Zhu, D. Lan, X. Dai, and 938 X. Hua. 2010. Picornavirus salivirus/klassevirus in children with diarrhea, China. Emerg. 939 Infect. Dis. 16:1303-1305. 940 82. Simmonds, P. 2006. Recombination and selection in the evolution of picornaviruses and 941 other Mammalian positive-stranded RNA viruses. J. Virol. 80:11124-11140. 942


.org/D

ownloaded from

http://jvi.asm.org/

42

83. Skabkin, M.A., Skabkina, O.V., Dhote, V., Komar, A.A., Hellen, C.U., and Pestova, 943 T.V. 2010. Activities of Ligatin and MCT-1/DENR in eukaryotic translation initiation 944 and ribosomal recycling. Genes Dev. 24:1787-1801. 945 84. Smura, T., S. Blomqvist, A. Paananen, T. Vuorinen, Z. Sobotová, V. Bubovica, O. 946 Ivanova, T. Hovi, and M. Roivainen. 2007. Enterovirus surveillance reveals proposed 947 new serotypes and provides new insight into enterovirus 5’-untranslated region evolution. 948 J. Gen. Virol. 88:2520-2526. 949 85. Wagner, A., and P.F. Stadler. 1999. Viral RNA and evolved mutational robustness. J. 950 Exp. Zool. 285:119-127. 951 86. Wang, Z., J.J. Kraft, A.Y. Hui, and W.A. Miller. 2010. Structural plasticity of Barley 952 yellow dwarf virus-like cap-independent translation elements in four genera of plant viral 953 RNAs. Virology 402:177-186. 954 87. Willcocks, M.M., N. Locker, Z. Gomwalk, E. Royall, M. Bakshesh, G.J. Belsham, N. 955 Idamakanti, K.D. Burroughs, P.S. Reddy, P.L. Hallenbeck, and L.O. Roberts. 2011. 956 Structural features of the Seneca Valley virus internal ribosome entry site element; a 957 picornavirus with a pestivirus-like IRES. J. Virol. 85: 4452-4461. 958 88. Wilson, J.E., T.V. Pestova, C.U.T. Hellen, and P. Sarnow. 2000. Initiation of protein 959 synthesis from the A site of the ribosome. Cell 102:511-520. 960 89. Woo, P.C., S.K. Lau, Y. Huang, C.S. Lam, R.W. Poon, H.W. Tsoi, P. Lee, H. Tse, 961 A.S. Chan, G. Luk, K.H. Chan, and K.Y. Yuen. 2010. Comparative analysis of six 962 genome sequences of three novel picornaviruses, turdiviruses 1, 2 and 3, in dead wild 963 birds, and proposal of two novel genera, Orthoturdivirus and Paraturdivirus, in the family 964 Picornaviridae. J. Gen. Virol. 91:2433-2448. 965


.org/D

ownloaded from

http://jvi.asm.org/

43

90. Yamashita, T., M. Ito, Y. Kabashima, H. Tsuzuki, A. Fujiura, and K. Sakae. 2003. 966 Isolation and characterization of a new species of kobuvirus associated with cattle. J. 967 Gen. Virol. 84:3069-3077. 968 91. Yamashita, T., K. Sakae, H. Tsuzuki, Y. Suzuki, N. Ishikawa, N. Takeda, T. 969 Miyamura, and S. Yamazaki. 1998. Complete nucleotide sequence and genetic 970 organization of Aichi virus, a distinct member of the Picornaviridae associated with 971 acute gastroenteritis in humans. J. Virol. 72:8408-8412. 972 92. Yozwiak, N.L., P. Skewes-Cox, A. Gordon, S. Saborio, G. Kuan, A. Balmaseda, D. 973

Ganem, E. Harris, and J.L. DeRisi. 2010. Human enterovirus 109: a novel interspecies 974 recombinant enterovirus isolated from a case of acute pediatric respiratory illness in 975 Nicaragua. J. Virol. 84:9047-9058. 976

93. Yu, J.M., Z.Q. Xu, B.W. Li, Q. Zhang, S.X. Cui, M. Jin, and Z.J. Duan. 2011. 977 Analysis and characterization of the complete genome of a member of a new species of 978 kobuvirus associated with swine. Arch. Virol. 156:747-751. 979 94. Yu, Y., I.S. Abaeva, A. Marintchev, T.V. Pestova, and C.U.T. Hellen. 2011. 980 Common conformational changes induced in type 2 picornavirus IRESs by cognate trans-981 acting factors. Nucleic Acids Res. 39: 4851-4865. 982 95. Yu, Y., T. Sweeney, Y. Kafasla, R.J. Jackson, T.V. Pestova, and C.U.T Hellen. 983 2011. The mechanism of translation initiation on Aichi Virus RNA mediated by a novel 984 type of picornavirus IRES. EMBO J. 30: 4423-4436 985 96. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. 986 Nucleic Acids Res. 31: 3406-3415. 987 988


.org/D

ownloaded from

http://jvi.asm.org/

44

989 990 991 Figure Legends 992 Figure 1. Model of the structure of the 5’ UTR and adjacent coding region of Aichi virus 993 downstream of domains A-C and the pseudoknot. This model was derived as described (95) 994 and domains/subdomains are labeled sequentially from D to L. Nucleotides shown against cyan 995 circles are conserved in all or all but one of the AV, CKoV, MKoV and SV-A sequences listed in 996 Materials and Methods; nucleotides shown against orange circles, which are deliberately limited 997 to the highly conserved domains I and J, match these criteria and are also present in all currently 998 available BKV, SKV, TV2 and TV3 sequences. The AV initiation codon AUG745 is boxed. 999 1000 Figure 2. Secondary and tertiary 5’-terminal structures of (A) Aichi virus (GenBank accession 1001 number AB040749), (B) Canine Kobuvirus (GenBank accession number JN088541), (C) Sheep 1002 kobuvirus (Genbank Accession number GU245693), (D) Porcine kobuvirus (GenBank accession 1003 number EU787450) and (E) Bovine kobuvirus (GenBank accession number AB084788) and (F) 1004 Paraturdivirus 3 strain 10878 (Genbank accession number GU182410), predicted using 1005 pKnotsRG (72). This model of a segment of the AV 5’ UTR and analogous data concerning the 1006 BKV 5’ UTR have been described elsewehere (17, 90)). Domains A, B and C are labeled, and 1007 nucleotides are numbered. 1008 1009 Figure 3. Schematic representations of the 5’ UTRs and adjacent coding regions of porcine 1010 kobuvirus, SV-A (isolate 02394-01), Aichi virus, canine kobuvirus isolate PC0082, mouse 1011


.org/D

ownloaded from

http://jvi.asm.org/

45

kobuvirus, bovine kobuvirus, sheep kobuvirus and turdivirus 3 (strain 10878). 5’ UTRs are 1012 divided into domains, and are shaded to show those that are structurally related to domains A, B, 1013 C and the pseudoknot that constitute the 5’-terminal ori region of Aichi virus (17) (grey), domain 1014 H (dark blue), domain I, J and K (light blue) and domain L (purple). The ori region, domains H, 1015 I, J, K and L are labeled, and the initiation codon for each polyprotein and the nucleotides that 1016 make up each domain of the 5’ UTR are indicated. The 5’ UTRs of SV-A 5’ UTR (Genbank 1017 accession number GQ184145) (17), canine kobuvirus (Genbank # JN088541) and mouse 1018 kobuvirus (Genbank # JF755427) are suspected to be incomplete. 1019 1020 Figure 4. Model of the structure of the 5’ UTR and adjacent coding region of Salivirus A 1021 downstream of domains B, C and the pseudoknot, derived as described in the text. Domains are 1022 labeled D’-G’ and H-L, and the initiation codon for the viral protein (AUG722) is boxed. 1023 Nucleotides are numbered at 50 nucleotide intervals, and every twentieth nucleotide starting 1024 from nt 160 is marked by a small solid circle. 1025 1026 Figure 5. Models of the structure of the 5’ UTR and adjacent coding region of (A) bovine 1027 kobuvirus and (B) sheep kobuvirus downstream of domains B, C and the pseudoknot, derived as 1028 described in the text. Domains are labeled D’, E’ and Ia-K, and the initiation codon for the viral 1029 protein (BKV AUG809; SKV AUG798) is boxed. Nucleotides are numbered at 50 nucleotide 1030 intervals, and every twentieth nucleotide starting from nt 160 is marked by a small solid circle. 1031 To maintain the continuity of nomenclature for this group of IRESs, we have designated the first 1032 two hairpins as domains D’ and E’ whereas elements that are related to segments of the AV 5’ 1033 UTR are designated as subdomains/domains Ia, Ib, Ja, Jb, Jc and K. The predicted structural 1034


.org/D

ownloaded from

http://jvi.asm.org/

46

elements between domain K and the initiation codon are not shown, and the omitted nucleotides 1035 (BKV nt 681-798; SKV nt 671-788) are represented by ellipses. Nucleotide differences between 1036 BKV and SKV are classified as indicated on the inset key and are shown on the SKV model. 1037 1038 Figure 6. Model of the structure of the 5’ UTR and adjacent coding region of Turdivirus 3 1039 (strain 10878) 1 downstream of domains B, C and the pseudoknot, derived as described in the 1040 text. Domains are labeled Ia-K, and the initiation codon for the viral polyprotein (AUG647) is 1041 boxed. Nucleotides are numbered at 50 nucleotide intervals, and every twentieth nucleotide 1042 starting from nt 120 is marked by a small solid circle. Nucleotides 518-646 between the 1043 pyrimidine (Yn) tract and the initiation codon have been omitted and are represented by ellipses. 1044 1045 Figure 7. Models of the structures of the 5’ UTR and adjacent coding region of (A) mouse 1046 kobuvirus (MKoV) downstream of domain E and (B) canine kobuvirus (CKoV) isolate AN211D 1047 downstream of domain F. The nomenclature of domains is as in Figure 1, and the initiation 1048 codons for the viral polyproteins (MKoV AUG611 and CKoV AUG562) are boxed. Nucleotides 1049 are numbered at 50 nucleotide intervals, and every twentieth nucleotide starting from MKoV nt 1050 120 and CKoV nt 80 is marked by a small solid circle. Nucleotide differences between (A) 1051 MKoV and AV and (B) CKoV and AV are classified as indicated on the inset key. 1052 1053 Figure 8. Conservation of sequence and structure in apical regions of picornavirus 5’ UTR 1054 domains. Models of apical regions of (A) Aichi virus domain J, (B) Bovine kobuvirus domain J, 1055 (C) Enterovirus 71 (EV71) domain IV, (D) EMCV domain I, (E) Turdivirus 3 domain K, (F) 1056 Saffold vius domain J, (G) Bovine kobuvirus domain K, (H) Aichivirus domain K, (I) Salivirus 1057


.org/D

ownloaded from

http://jvi.asm.org/

47

A domain K, (J) EMCV domain J, (K) Foot-and-mouth disease virus (FMDV) domain J and (L) 1058 EV71 domain V. Panels are annotated to show (A, B) the GNRA tetraloop in domain J of the AV 1059 and BKV 5’ UTRs, (C) the ‘Loop A’, ‘Loop B’ and GNRA loops in domain IV of the EV71 1060 IRES and (D) the GNRA, CRAAAA and ACCC loops in domain I of the EMCV IRES. The 1061 nucleotides that make up the conserved discontinuous sequence motif present in domain J of 1062 Type 2 IRESs and domain K of AV-like IRESs are in red, and are indicated by square brackets. 1063 1064 Figure 9. Interaction of the Salivirus A IRES with eIF4G. (A) Model of the SV-A IRES, with 1065 domain K in bold. (B) The activity of SV-A mRNA in the presence of eIF4A(R362Q) (lane 5) or 1066 containing destabilizing mutations in domain K (Mut1) (lane 3) or domain L (Mut2) (lane 4) in 1067 comparison with wt SV-A mRNA (lane 2), assayed by translation in RRL. (C) Secondary 1068 structure of SV-A IRES domain K, showing the conserved motif (bracket) that in the EMCV 1069 IRES is required for interaction with eIF4G. The destabilizing AGGU→UCCA mutation in this 1070 motif in SV-A (Mut1) mRNA is indicated. Domain K has been annotated to show sites of 1071 hydroxyl radical cleavage from unique surface-exposed cysteine residues on eIF4Gm (panel D), 1072 color-coded as in the inset key. (D) Primer extension analysis of directed hydroxyl radical 1073 cleavage of wt and Mut2 SV-A IRESs from Fe(II)-tethered eIF4Gm in the presence of eIF4A. 1074 1075 Figure 10. Initiation on the Salivirus A IRES is dependent on DHX29. Toeprinting analysis 1076 of 48S complex formation on (A) EMCV, (B) Aichivirus, (C) wt SV-A and (F) Mut2 SV-A 1077 mRNAs in reaction mixtures containing 40S subunits, eIFs 1, 1A, 2, 3, 4A, 4B, 4F, initiator 1078 tRNA, PTB and DHX29, as indicated. AUG codons are indicated on the left hand side and 1079 toeprints that correspond to 48S complexes are indicated on the right. Lanes C/T/A/G depict 1080


.org/D

ownloaded from

http://jvi.asm.org/

48

corresponding DNA sequences. (D) Model of the SV-A IRES, with domain L in bold and (E) 1081 structures of the L domain of the wt SV-A IRES and a SV-A IRES mutant containing 1082 destabilizing substitutions in domain L. 1083


.org/D

ownloaded from

http://jvi.asm.org/

TABLE 1. Structural elements identified using Pfold, CentroidFold and Mfold in

Salivirus A, Bovine kobuvirus and Turdivirus 3 5’UTRs a

Results for indicated virus and method

Structural element b

Salivirus A Bovine Kobuvirus Turdivirus 3 Pfold Centroid Mfold Pfold Centroid Mfold Pfold Centroid Mfold

A NA NA NA + + + + + B + + + + + + + + C + + + + + + + D (D’) + + + + + + E (E’) + + + + + F (F’) + + + G (G’) + H + + + Ia + + + + + + Ib + + + + + + + Ja + + + + + Jb + + + + + + + + + Jc + + + + + + + + K + + + + + + + + + L + + + a Structural elements are as indicated in Figs. 4, 5A and 6. NA, not applicable.

b Structural elements A - L are named according to the nomenclature used for domains and sub-domains in the Aichivirus 5’UTR, as indicated in Figs. 1 and 2A; domains D’-G’ refer to domains in Salivirus A and Bovine kobuvirus 5’UTRs, as indicated in Figs. 4 and 5A.


.org/D

ownloaded from

http://jvi.asm.org/

TABLE 2. Comparison of nucleotide sequence identities between J and K domains of the

5’UTR of Aichivirus and related picornaviruses

A

ichivirus S

alivirus A

02394-01

Salivirus A

N

G-J1

Bovine

Kobuvirus

Sheep

Kobuvirus

Mouse

Kobuvirus

Canine

Kobuvirus

Turdivirus 2

Turdivirus 3

Pairwise nucleotide identity (%)

Turdivirus 3 [10878] (nt 202-494)

56 56 55 57 57 55 55 63 -

Turdivirus 2 [10717] (nt 215-507)

56 53 53 52 56 56 53 -

Canine Kobuvirus (nt 241-544)

76 66 66 67 64 77 -

Mouse Kobuvirus (nt 292-594)

65 50 65 63 65 -

Sheep Kobuvirus (nt 364-668)

64 63 63 68 -

Bovine Kobuvirus (nt 376-675)

67 67 64 -

Salivirus A [NG-J1] (nt 307-605)

73 94 -

Salivirus A [02394-01] (nt 433-623)

75 -

Aichivirus (nt 433-729)

-


.org/D

ownloaded from

http://jvi.asm.org/

TABLE 3. Relative frequencies of different categories of nucleotide differences in AV,

BKV, CKoV, MKoV and SKV 5’ UTRs

Picornavirus 5’ UTR fragments used for

comparisons

Number (%) of nucleotide differences in indicated category

Total Covariant Neutral Unpaired Additional Disruptive

BKV nt 143-675

SKV nt 131-667

83 32 (39) 8 (10) 30 (36) 6 (7) 7 (8)

AV nt 223-790

CKoV-AN211d nt 68-606

139 60 (43) 18 (13) 37 (27) 17 (12) 7 (5)

AV nt 26-790

MKoV nt 68-606

116 53 (46) 13 (11) 30 (26) 15 (13) 3 (3)

CKoV-AN211d

nt 70-610

CKoV (US-PC0082)

nt 231-761

18 0 2 (11) 10 (56) 5 (28) 1 (5)


.org/D

ownloaded from

http://jvi.asm.org/

AichivirusAB040749

Ia

Ib

Jb

JcJa

K

200

700650

350

400

750

450

600

250

300

500

550

H

G

F

E

795

Sweeney et al.Figure 1


.org/D

ownloaded from

http://jvi.asm.org/

1

02

03

54

08

49

501

621

GA

AA

AG

GG

GG

UG

GG

GG

GG

CGCCCCCUCACCCUCUUUUC

C G G U G G C C

GCCCGGCCACCG

CU

CC

A

CC

AU

CCG

GA

UG

G

UG

GA

G

G G G C

UUU

CUCG

A C C CG

UU

A

CU

C

UUC G

C

UU

GA A C A U

AACA

UUCCCAU

Porcine Kobuvirus

1

02

03

54

07

08

09 501

711 031

241G

AA

AA

GG

GG

GU

GG

GG

GG

GC

GCCCCCUCACCCUCUUUUC

C G G C G G C G C

GUUCGCGUCGUCG

GU

CU

GG

A

CC

AA

G

GC

CG

GU

CU

UG

G

UC

CG

GA

C

G A A C

UUU

UUCG

A U

UA

A

UU

C

CAC U C

U CAA

C

UU

A A A U A CAAA

CUCAGUCCUC

UU

Bovine Kobuvirus

C

1

11

23

24

06

07

08 09

001 011

021

GA

AA

GG

GG

G

CC

GG

CG

GG

CCCGUCGG

CCCUCUUUC

CG

UC

C

GC

CG

CG

GA

CG

GU

GG

CA

GG

UU

GU

GC

GCGCAACC

UGCUAC

GC

GG

U

C

GCA

AUA

U

A A

UUA

AAUU

C

UU

AG

C

U A AUG

AU

CCCUGCCC

Paraturdivirus 3

D

Sweeney et al. Figure 2

1

20

30

45

70

80

94

106

124

GA

AA

AG

GG

GG

UG

GG

GG

GG


C G G C G G C G C

GUUCGCGUCGUCG

GCCUGGAACC

AUGC A U

G G UU C C G G G C G A A C

UUU

UUCG

A A

UAA

C

C

UUC G

C

C

AA A U A C

AA

CCCAGA

1

02

03

54

07

08

39

401

421

GA

AA

AG

GG

GG

UG

GG

GG

GG


C G G U G G U C U G

UCCCGGACCACCG

CUCC

CAGUUC

G A AC U G

G G A GG G G

UUU

CUCG

G

UUA

AUU

C

UUC G

C

U UC

GA A U U A A

AC C

ACCCAUA

Aichivirus A B Canine Kobuvirus

Sheep Kobuvirus

E F 1

14

40

50

61

74

92C G G U G G U C

CCCAGACCACCG

UC

CU

CC

CA

GU

UCGAA

CUG

GGAG

GA

U G G G

UCACGCAC

UU

UUC

C G GAA

AUU

C

UUC G

C

U UC

A U U A A ACACCCACU

hairpin A

hairpin B

hairpin B

pseudoknot (hairpin C)

pseudoknot (hairpin C)


.org/D

ownloaded from

http://jvi.asm.org/

Bovinekobuvirus

1-130 AUG808 253-373

Aichi-like IRES ori 376-560 568-675

J I K

Porcinekobuvirus

Aichivirus

AUG576 284

HP-like IRES ori 1-119

AUG745

Aichi-like IRES ori 1-116 300-31 341-420 433-623 627-729

H L K J I

Salivirus AAUG718

Aichi-like IRES ori 265-98 307-390

H

402-596 601-702

L K J I

1-65

Turdivirus 3 1-110

Aichi-like IRES 115-200 406-494 AUG647

202-398

ori J I K


Sheepkobuvirus

1-118 AUG798243-360

Aichi-like IRESori364-549 557-667

JI KAichi-like IRES

Canine kobuvirus

AUG713

Aichi-like IRESori260-92 302-379

H

412-589 593-695

LKJI

1-84

Mousekobuvirus

AUG611

Aichi-like IRES159-90 200-279

H

292-488 491-594

LKJI


.org/D

ownloaded from

http://jvi.asm.org/



.org/D

ownloaded from

http://jvi.asm.org/

Bovine KobuvirusAB084788

150

680

650

809

600

200

300350

250

400

450

500

550

Jb

Jc

A

Ja

K

Ib

Ia D’

E’

Kobuvirus Sheep TB3/HUN/2009GU245693

Neutral, unpairedor compensatoryForms new base-pairDisrupts base-pair

Ia

Ib

Jb

JcJa

K

150

200

131

250

300

600

650

350

400

500

450

550

670 798

B

D’

E’



.org/D

ownloaded from

http://jvi.asm.org/

300

250 350

150

200

111 400

450

500 647 517

Ia

Ia K

Ja

Jb

Jc


Turdivirus 3 (Strain 10878) GU182410


.org/D

ownloaded from

http://jvi.asm.org/

68

+

100

350

400

500

H

600

Jb

JcJa

L

K

G

Ia

Ib

150

200

250

300

450

550

-

+

-

+

+

+

+

+

+

Neutral, unpaired or compensatoryForms new base-pair

Disrupts base-pair

+-

Insertion

Deletion

650

600

550

500

100

150

200

250

300

350

400

450

G

Ia

Ib

Jb

JcJa

L

K

HF

-

-

+

Canine KobuvirusJN387133.1

Mouse KobuvirusJF755427

A B

++++

++

+

+



.org/D

ownloaded from

http://jvi.asm.org/

EV71

GNRA

EMCV

EV71

Bovine Kobuvirus

GNRA

Aichivirus

GNRA

GNRA

CRAAA

ACCC

Aichivirus EMCV Salivirus A Bovine Kobuvirus

Saffold virus

FMDV Turdivirus 3

E F G

500

L K J I H

A B C D


Loop A

Loop B


.org/D

ownloaded from

http://jvi.asm.org/

K

SV-A

C

Moc

k

1

wt

2 3 4

Mut

1

Mut

2

5

L∆VP0

wt (

+ eI

F4A

)

R36

2Q

A

B

Cys

-less

C82

9C

929

SV-A(wt)

SV-A(Mut1)

Cys

-less

C82

9C

929

eIF4Gm

C GT A 1 32 4 5 6

681

663-666

637-638

626-627

K

614

650

691

649-656

650

700

600

eIF4G1 (C829)eIF4G1 (C929)

K

UCCA

SV-A(Mut1)

D



.org/D

ownloaded from

http://jvi.asm.org/


EMCV IRES A

5 4 3 T C 2 1 A G

AUG826 AUG834

48S (AUG826) 48S (AUG834)

mRNA eIFs 1/1A/2/3/4A/4B/4F 40S subunits, Met-tRNA PTB DHX29

+ + + +

+ + +

+ + + +

+

+ + + + +

C786

AUG

48S

SV-A IRES (wt) mRNA eIFs 1/1A/2/3/4A/4B/4F 40S subunits, Met-tRNA PTB DHX29

+ + +

+

+ + + +

+ + + + +

+ + + +

749

700

573

650

600

GGU686-688

C

5 4 3 T C 2 1 A G


+ + +

+

+ + + +

+ + + + +

+ + + +

SV-A IRES (Mut2) F

GGU686-688

48S

750

AUG

700

5 4 3 T C 2 1 A G

650

600


+ + +

+

+ + + +

+ + + + +

+ + + +

48S

C T G A 5 4 3 2 1 783

AUG 750

700

650

600

Aichvirus IRES B

SV-A (wt)

SV-A (Mut 2)

D E

L


.org/D

ownloaded from

http://jvi.asm.org/

1 2 a distinct class of internal ribosomal entry site (ires) in

Documents