1, aïcha daher2, kaitlin j. soye2,3, lisa b. frankel2,3...

siRNAs against TRBP inhibit HIV 1

siRNAs against the TAR RNA Binding Protein, TRBP, a Dicer cofactor,1

inhibit HIV-1 long terminal repeat expression and viral production.2

3

Helen S. Christensen1, Aïcha Daher2, Kait lin J. Soye2,3, Lisa B. Frankel2,3,‡, Marina R.4

Alexander1, Sébast ien Lainé2,3, Sylvie Bannwarth2,3,#, Chi L. Ong1, Sean W.L. Chung1,5

Shahan M. Campbell1, Damian F. J. Purcell1,*, Anne Gat ignol2,3,4,*6

1Department of Microbiology and Immunology, University of Melbourne, Parkville,7

Aust ralia; 2Virus-Cell Interact ions Laboratory, Lady Davis Inst itute for Medical8

Research; Department of 3Microbiology and Immunology, and 4Experimental Medicine,9

McGill University, Mont réal, Québec, Canada.10

11

*Equal work from AG and DP laboratories12

Corresponding authors:13

Dr. Anne Gat ignol14

Virus-Cell Interact ions Laboratory, Lady Davis Inst itute for Medical Research,15

3755 Côte Ste Catherine, Mont réal, QC, H3T 1E2, Canada.16

Tel: 1 514 340-8260 ext : 5284; Fax: 1 514 340 757617

E mail: anne.gat [email protected]

19

Dr. Damian F. J. Purcell20

Department of Microbiology and Immunology21

The University of Melbourne, Parkville 3010, Victoria, Aust ralia.22

Tel: 61 3 8344 6753; Fax: 61 3 9347 154023

E. mail: df j [email protected]

25

Present addresses: ‡ Biotech Research and Innovat ion Center, University of26

Copenhagen, Copenhagen, Denmark. # Laboratoire de Génét ique Moléculaire, Hôpital27

de l'Archet 2, Nice, France.28

Word count for the abst ract : 245; Word count for the text : 515729

ACCEPTED

Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.01511-06 JVI Accepts, published online ahead of print on 14 March 2007

on Septem

ber 12, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/


ABSTRACT1

RNA interference (RNAi) is now widely used for gene silencing in mammalian2

cells. The mechanism uses the RNA-induced silencing complex, in which Dicer, Ago23

and the HIV-1 TAR RNA binding protein, TRBP are the main components. TRBP is a4

protein that increases HIV-1 expression and replicat ion by inhibit ion of the interferon-5

induced protein kinase PKR and by increasing t ranslat ion of viral mRNA. Af ter HIV6

infect ion, TRBP could rest rict t he viral RNA through it s act ivit y in RNAi or could7

cont ribut e more t o t he enhancement of viral repl icat ion. To det ermine which8

funct ion wil l be predominant in t he virological context , we analyzed whether t he9

inhibit ion of it s expression could enhance or decrease HIV replicat ion. We have10

generated small interfering (si)RNAs against TRBP and found that they decrease HIV-111

long terminal repeat (LTR) basal expression two fold, and LTR Tat t rans-act ivated12

level up to tenfold. In the context of HIV replicat ion, siRNAs against TRBP decrease13

the expression of viral genes and inhibit viral product ion up to f ivefold. The moderate14

increase of PKR expression and act ivat ion indicates that it cont ributes part ially to viral15

gene inhibit ion. The moderate decrease of miRNA biogenesis by TRBP siRNAs suggests16

t hat in t he cont ext of HIV repl icat ion, TRBP funct ions ot her t han RNAi are17

predominant . In addit ion, siRNAs against Dicer decrease viral product ion twofold and18

impedes miRNA biogenesis. These result s suggest t hat , in t he cont ext of HIV19

replicat ion, TRBP cont ributes mainly to the enhancement of virus product ion and that20

Dicer does not mediate HIV rest rict ion by RNAi.21

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


INTRODUCTION1

RNA interference (RNAi) is a natural mechanism used by eukaryotes for gene2

silencing (27, 38, 80). While invertebrates use 23bp double-st randed (ds) RNA, called3

smal l int erfering (si) RNAs, wit h perfect complement arit y t o degrade t arget ed4

messenger RNA (mRNA) in t he RNA-induced silencing complex (RISC), vertebrates5

predominant ly use imperfect ly paired 23bp micro (mi) RNAs t o cont rol mRNA6

t ranslat ion using RISC. In the RISC complex the Dicer protein has RNAse III domains7

and generates the siRNAs, whereas Argonaute, an enzyme with RNAse H-like domains8

mediates gene silencing. The abil it y of 21-23 nt siRNAs, short hairpin (sh) RNAs and9

miRNAs to inact ivate gene expression, while avoiding the dsRNA-act ivated protein10

kinase (PKR) act ivat ion (5, 25), has allowed the use of RNAi as a tool for specif ically11

decreasing t he expression of bot h cel lular (22, 51) and viral (17, 37) genes in12

mammalian cells.13

While inact ivat ing Human Immunodef iciency Virus (HIV) genes wit h siRNA,14

shRNA and miRNAs decreases viral repl icat ion (9, 11, 16, 41, 50, 73), t he high15

mutat ion rate in the HIV genome allows the virus to readily escape this sequence16

specif ic mechanism (8, 77), highlight ing the advantages of t arget ing cellular genes17

necessary for viral replicat ion. Cellular factors required for HIV replicat ion cycle that18

have been downregulated by RNAi include cell surface receptors CD4, CCR5, CXCR419

(55, 58, 65), expression factors NF B, Cyclin T1, CDK9, SPT5, PARP1 (15, 43, 62, 74)20

and proteins involved in int racellular t raff icking and viral packaging including Staufen,21

tRNA synthetase, Arp2/ 3, Cyclophilin A and Rab9 GTPase (13, 35, 45, 53, 57). In each22

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


case, HIV replicat ion was signif icant ly decreased with minimal cell death indicat ing1

that it is a very promising approach.2

Human t rans-act ivat ion response (TAR) RNA binding proteins (TRBP)1 and TRBP23

were init ially ident if ied as proteins that bind the HIV-1 TAR RNA and act ivate the long4

terminal repeat (LTR) expression in the absence and in the presence of the viral t rans-5

act ivator Tat (24, 29, 30). The two proteins dif fer by 21 addit ional amino acids in the6

N-terminal end of TRBP2 (4). TRBPs have two double-st randed RNA binding domains7

(dsRBD), the second one containing a KR-helix mot if that mediates dsRNA binding (21,8

26, 28, 44). A third basic domain in the C-terminal end of TRBP mediates protein-9

protein interact ions (36, 47). TRBPs have a physiological role in spermatogenesis and10

growth cont rol during development (49, 81). They also bind the interferon (IFN)-11

induced dsRNA-act ivat ed prot ein kinase PKR (19). TRBPs are oncogenic upon12

overexpression, l ikely due to their associat ion with PKR (7), with the PKR act ivator13

PACT [(60);G. Laraki, A. Daher and A. Gat ignol, unpublished data] and with the tumor14

suppressor Merlin (47, 48).15

In the context of HIV-1 replicat ion, TRBP1 and TRBP2 increase viral expression16

similarly by blocking the inhibit ory ef fect of PKR on viral t ranslat ion. TRBPs also17

restore the t ranslat ion of TAR-containing RNAs by a PKR-independent pathway (2, 7,18

19, 23, 24). In t he gl ioblastoma/ ast rocytoma cell l ine U251MG, an enhanced PKR19

response blocks the t ranslat ion of HIV st ructural proteins and inhibits viral product ion20

(59). Increasing levels of TRBP rescued the expression of HIV-1 proteins and virion21

product ion. This abil it y can be explained by the low endogenous TRBP1 and TRBP222

expression in primary ast rocytes and U251MG cells, which are unable to modulate PKR23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


act ivat ion (4, 59). The specif ic low expression of TRBP1 in ast rocytes is due, at least1

in part , to a lack of the NF-Y t ranscript ion factor in these cells (3). All available data2

indicate t hat TRBP proteins cont ribute t o t he high level of HIV-1 expression and3

repl icat ion in permissive cel ls and suggest t hat reducing TRBP expression could4

decrease HIV replicat ion (2).5

Recent data in the elucidat ion of the RNAi mechanism in mammalian cells have6

shown t hat t he Dicer protein is associated both wit h Ago2, a protein f rom the7

Argonaute family, and with TRBP (14, 36, 52, 75). The use of siRNAs directed against8

TRBP in funct ional assays has shown that TRBP is involved in the RNAi mechanism as a9

Dicer partner (14, 36, 67). This act ivit y may cont ribute to the role of TRBP during10

development . This recent discovery that TRBP is involved in both the RNAi mechanism11

and HIV repl icat ion raises t he quest ion of it s role during t he early st eps of HIV12

infect ion (31). In this study, we invest igated if a decrease in TRBP or Dicer expression13

could decrease HIV-1 product ion. We targeted TRBP and Dicer mRNAs by RNAi using14

siRNAs and show t hat inhibit ing t heir expression induces a decrease in HIV-115

expression and product ion in permissive cells to dif ferent extents.16

17

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


MATERIALS AND METHODS1

siRNA synthesis2

Target sequences for TRBP and EGFP were chosen using the Ambion software3

pr ogr am and t hei r spec i f i c i t y ver i f i ed by BLAST sear ch4

(www.ncbi.nlm.nih.gov/ BLAST). The non-silencing (NS) siRNA sequence was designed5

by Qiagen t o have no homology t o any mammalian gene. The siRNA sequences6

target ing HIV-1 Tat (SF2) protein and TAR RNA were from (16) and (41) respect ively.7

siRNA sequences are indicated in Table 1. All siRNAs t ransfected alongside TRBP8

siRNAs were synthesized in vi t ro using the Si lencerTM siRNA Const ruct ion Kit (Ambion9

Inc). Their concent rat ion and integrit y were verif ied by OD and gel analysis. The NS10

and Dicer siRNAs used to assess Dicer decrease were purchased from Qiagen.11

12

Semi-quantitative RT-PCR13

Total cel l RNA was ext racted using TRIzol® reagent 48 hr af ter t ransfect ion14

(Invit rogen). cDNA was made from 3 µg of total RNA in a 20 µL react ion containing 315

µM of annealed random hexamer, 100 mM DTT, 8 unit s AMV-RT (Promega), 1.25 mM16

dNTP and 40 units RNasin (Promega) at 42ºC for 1 hr. 1 µL of the cDNA template was17

used for PCR amplif icat ion in a 20 µL react ion containing 0.2 µL phusion polymerase18

(Finnzymes), 200 µM dNTP, 0.5 µM each of forward and reverse primers and a MgCl219

concent rat ion of eit her 1.5 mM for Dicer or 2.5 mM for GAPDH ampl if icat ion20

r espec t i ve l y . Pr i mer s used t o amp l i f y GAPDH w er e21

5’ TGAAGGTCGGAGTCAACGGATTTGGT3’ and 5’ CATGTGGGCCATGAGGTCCACCAC3’ ,22

whi l e pr i mer s f or Di cer wer e 5’ CTGAGCTTAGGAGATCTGAG3’ and23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


5’ GGAACCTGAGGTTGATTAGC3’ . Condit ions for amplif icat ion were 98ºC for 30 sec;1

either 23 cycles or 27 cycles of 98ºC 10 sec, 50ºC 20 sec, and 72ºC 30 sec for GAPDH2

or Dicer respect ively. The product s were resolved on a 1.5% agarose gel and3

quant if ied using Fuj i Film Image Gauge software.4

5

Plasmids6

pLTR-Luc, pCMV1-Tat (f rom HIV-1 SF2 st rain) (19) and pEGFP-C1-TRBP2 (59)7

expression plasmids were previously described. EGFP pre-miRNA sequence was8

derived by incorporat ion of t he EGFP siRNA sequence into the stem of the miR-309

miRNA as described (9). To generate pEGFP pre-miRNA vector, a casset te expressing10

EGFP pre-miRNA f rom t he U6+27 promot er (32) was made by t wo st ep PCR as11

described (12) and l igated into the pCRII -TOPO cloning vector (Invit rogen). The12

pNL4-3 (1) and pAD8 (76) proviral plasmids were obtained from M. Mart in (Nat ional13

Inst it ut e of Al lergy and Infect ious Diseases, Nat ional Inst it ut es of Healt h, USA).14

Proviral plasmids pELI-1, pMAL-2 (61) and pROD-10 (68) were obtained from K. Peden15

(Cent re for Biological Evaluat ion and Research, FDA, USA). Proviral plasmid p89.616

(18) was obt ained t hrough t he AIDS Research and Reference Reagent Program,17

Division of AIDS, NIAID, NIH, from R. J. Collman.18

19

Cells and transfections20

HeLa cel ls (ATCC) were maintained in Dulbecco’ s modif ied Eagle’ s medium21

(DMEM; Invit rogen) supplemented with 10% Fetal Bovine Serum (FBS; Hyclone), 2 mM22

L-Glutamine and 1% penicil l in-st reptomycin (Invit rogen). For t ransfect ions followed23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


by Fluorescence Act ivated Cell Sorter (FACS) analysis, 7.5 x 104 HeLa cel ls were1

seeded in 24-well plates 16 hr prior t o co-t ransfect ion with pEGFP-C1-TRBP2 and2

siRNA using Lipofect amineTM 2000 (Invit rogen). For t ransfect ions fol lowed by3

luciferase expression assay or immunoblot , 1.6 x 105 HeLa cells were plated in 6-well4

plates 16 hr prior t o t ransfect ions with siRNAs and the LTR-Luc plasmid or siRNAs5

alone using FuGENE 6 Reagent (Roche) at a 1:3 DNA/ RNA:FuGENE rat io. Luciferase6

expression was measured 48 hr post -t ransfect ion and normalized to the same amount7

of protein as previously described (19). Transfect ions of cel ls wit h HIV proviral8

const ruct s were eit her in T25 f lasks seeded with 7.5 x 105 cel ls or 6 well plates9

seeded wit h 3.0 x 105 cel ls 24 hr prior t o co-t ransfect ion wit h siRNA using10

LipofectamineTM 2000 (Invit rogen). To cont rol for t ransfect ion ef f iciency, eit her11

pEGFP-N1 (Clontech) was co-t ransfected as a t ransfect ion ef f iciency reporter and12

assessed by FACS, or experiments were performed at least three t imes to account for13

variat ions. Large variat ions in siRNA concent rat ions among the experiments are due14

to dif ferent experimental condit ions when using FuGENE 6 TM or lipofectamine TM 2000.15

Transfect ion ef f iciency was verif ied by PCR using 4 µl of cell lysate and 250 ng of16

luciferase primers t o ampl i f y a 456 nt DNA. The Luc sense primer was 5’ -17

CTATCCTCTAGAGGATGGAACC-3’ a n d t h e an t i sense w as 5 ’ -18

CGTCTACATCGACTGAAATCCC-3’ . Amplif icat ion was performed at 94oC 2 min, (94oC19

45 sec; 55oC 45 sec; 72oC 2 min) 30 cycles, 72oC 2 min. 10% of t he react ion was20

loaded on an agarose gel. Only t ransfect ions in which the ef f iciencies vary by less21

than 5% were considered for the average value calculat ion.22

23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


FACS analysis1

Cells were analyzed for EGFP expression on a FACsort (Becton-Dickinson), using2

the Cellquest cont rol sof tware (Becton-Dickinson). Transfected cells were gated by3

green f luorescence greater than cells in a mock t ransfect ion. Relat ive f luorescence4

values were calculated as the product of the percentage of EGFP f luorescent cells5

gated and the mean f luorescence of cells gated posit ive.6

For cell viabilit y, 2 x 105 HeLa cells were seeded in 6 well plates 24 hr prior to7

t ransfect ion wit h 14 nM of siRNA or 1.8 µg of poly(I) • poly(C) (Sigma) using 1 µl8

LipofectamineTM 2000 (Invit rogen). 48 hr later, cells were harvested with t rypsin, and9

st ained wit h 7-amino-act inomycin D (7-AAD) solut ion (Pharmingen) fol lowing10

manufacturer's protocol. The non-f luorescent populat ion represent ing viable cells11

was gated and calculated as a percentage of the total populat ion.12

13

Fluorescence14

HeLa cells were plated in 12-well plates on coverslips (Fischer Scient if ic) and15

were 70% conf luent at t he t ime of t ransfect ion. 100 nM of siRNAs were co-16

t ransfect ed wit h 0.5 µg pEGFP-C1-TRBP2 using FuGENE (Roche). 48 hr post -17

t ransfect ion, the cells were washed twice in phosphate-buffered saline (PBS). The18

cells were f ixed in a 4% paraformaldehyde solut ion for 10 min at room temperature19

followed by two washes in PBS. Fixed cells were mounted in Airvol (Air Products and20

Chemicals, Allentown, PA) and the f luorescence was detected on an Olympus BX-5121

microscope.22

23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


Measurement of mRNA stability1

Cells were grown in serum-free medium in the presence of 5 µg/ ml of either2

t he t ranscript ional inhibit or Act inomycin D (ActD; Sigma) or t he same volume of3

ethanol (cont rol). Af ter various t imes of ActD t reatment , cells were harvested and4

t otal RNA was isolated using the TRIzol® isolat ion t reatment (Invit rogen). RT-PCR5

react ion was performed as previously described (4). cDNA was synthesized from 5 µg6

of total RNA using 5 pmol of TRBP ant isense-(5’ -CTCAATGAAACGCTCCAC-3’ ) or c-myc7

ant isense primer (5’ -GGGGCTGGTGCATTTTCGGTTGTTGC-3’ ). PCR amplif icat ions8

were performed in a 100 µl react ion mixture containing 250 ng of each TRBP (5’ -9

CGGGTCACCGTTGGCGAC-3’ ) or c-myc primer (5’ -GCTCCTGGCAAAAGGTCAGAGTCTGG-10

3’ ). Ant isense primers were as described above for reverse react ion. To respect the11

PCR exponent ial phase, the PCR amplif icat ions for TRBP mRNA were performed with12

23 cycles. The products were resolved on a 1.5% agarose gel.13

14

HIV Reverse Transcriptase (RT) assay15

The reverse t ranscriptase assay was performed as previously described (39).16

Each react ion contained 6 µl viral supernatant in a 30 µl RT cocktail (60 mM Tris-HCl17

(pH7.8), 75 mM KCl, 5 mM MgCl2, 0.1% (w/ v) Nonidet P-40 (NP40, Fisons), 1 mM EDTA,18

5 µg/ ml poly-A, 162.5 ng/ ml oligo(dT), 4 µM dithiothreitol (DTT), 1 µCi/ ml ( -32P)19

dTTP (PerkinElmer) and was incubated at 37°C for 2 hr. 6 µl of each react ion was20

spot t ed ont o diet hyl aminoet hyl cel lulose (DEAE) f i l t er paper (What man21

Internat ional), which was subsequent ly washed four t imes in 2X SSC (3 M NaCl, 0.3 M22

t risodium cit rate (pH7.0)) and twice in 100% ethanol (ten min per wash) before being23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


air-dried and exposed to a Fuj if ilm BAS-MS-IP 2340 imaging plate, and reading on a1

phosphorimager (FLA3000 Fuj i Phot of i lm Co. ). Quant i t at ion of samples was2

performed using Fuj i Film Image Gauge software.3

4

Immunoblotting5

48 hr post -t ransfect ion, cells were washed twice with PBS and lysed in cold6

lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA (pH 8), 10% Glycerol,7

1% NP-40) with the protease inhibitor cocktail (Roche) and with phosphatase inhibitors8

(30 mM sodium f luoride, 10 mM p-nit rophenyphosphate, 40 mM ß-glycerophosphate9

and 1 mM sodium orthovanadate) when a phospho-specif ic ant ibody was used. The10

lysates were chilled on ice and cent rifuged for 15 min. Equivalent amounts of whole11

cel l ext ract , measured by Bradford assay (Bio-Rad), were separated by sodium12

dodecyl sulfate (SDS) polyacrylamide gel elect rophoresis (PAGE). The proteins were13

t ransferred to a Hybond ECL nit rocellulose membrane (Amersham) as described (6).14

The membrane was blocked for 1 hr in 5% nonfat milk and Tris-buffered saline-0.1%15

Tween 20 (TBST) (69) or 5% BSA and 0.1% TBST for ant i PKR and ant i-P-PKR, or in 5%16

milk/ PBST for HIV serum. The membranes were incubated overnight at 4˚ C with ant i-17

TRBP672 (21) at a 1/ 500 dilut ion, with ant i Dicer 349 (36) at a 1/ 1000 dilut ion, or18

with serum from a HIV-1 subtype B pat ient at a 1/ 5000 dilut ion in the corresponding19

buffers. They were incubated for 1 hr at room temperature with a monoclonal ant i-20

act in (Chemicon) at a 1/ 10000 dilut ion. For probing PKR and phosphorylated PKR,21

t hey were incubated overnight at 4˚ C with monoclonal ant i-PKR 71/ 10 (46, 56) or22

polyclonal ant i-P-PKR (Biosource) at a 1/ 1000 dilut ion in 3% BSA/ TBST. Af t er 523

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


washes in TBST or PBST, membranes were incubated with peroxidase-conj ugated1

secondary goat ant i-rabbit ant ibody (Amersham) for TRBP, P-PKR, Dicer, goat ant i-2

mouse (Amersham) f or PKR and act in, and rabbi t ant i -human ant ibody3

(DacoCytomat ion) for HIV-1 at a 1/ 10000 dilut ion. The bands were visualized as4

described (6).5

6

Northern blot analysis.7

Total RNA was harvested using TRIzol® reagent (Invit rogen), of which 10 µg was8

resolved in a 15% denaturing polyacrylamide 7M urea gel and then t ransferred by9

elect ro-blot t ing onto a GeneScreen Plus nylon membrane (NEN Life Sciences). An10

EGFP (5’ -GGGCATCGACTTCAAGGAG-3’ ) radiolabeled ol igo probe was hybridized in11

buffer (0.5 M sodium phosphate (pH 7.2), 7% (w/ v) SDS, 1 mM EDTA) to the membrane12

overnight at 42°C. Membranes were washed twice in wash buffer 1 (1X SSC, 1% (w/ v)13

SDS) for 20 min and twice in wash buffer 2 (0.5X SSC, 0.1% (w/ v) SDS) for 40 min at14

50°C and then exposed to imaging plates for 2 days. Blots were quant if ied using Fuj i15

Film Image Gauge software.16

17

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


RESULTS1

siRNAs against TRBP decrease exogenous TRBPs2

To analyze t he ef fect of decreasing TRBP protein on HIV-1 expression and3

replicat ion, six potent ial siRNAs against TRBP were synthesized and t ransfected in4

HeLa cells. The total RNA was ext racted and assayed by semi-quant itat ive RT-PCR for5

the amount of TRBP mRNA (data not shown). Three sequences that decreased TRBP6

mRNA signif icant ly were chosen (Fig 1A) and numbered according to the nucleot ide7

sequence start ing at the init iat ing AUG of TRBP2. All t hree sequences target both8

TRBP1 and TRBP2.9

To assess the act ivit y of t he selected siRNAs in decreasing the expression of10

TRBP, HeLa cells were t ransfected with a reporter plasmid expressing EGFP-TRBP211

fusion protein and the dif ferent siRNAs (Fig 1B). Compared to the NS siRNA cont rol all12

TRBP siRNAs decreased the expression of t ransfected EGFP-TRBP2 with increasing13

act ivit ies f rom siRNA 657 to 567 and 571. To quant ify these result s and assess the14

act ivit y of the siRNAs at dif ferent concent rat ions, reporter expression was measured15

by FACS analysis (Fig 1C). All three TRBP siRNAs decreased the expression of EGFP-16

TRBP from two to fourfold when compared to the siRNA-NS cont rol. siRNA571 had the17

most potent silencing act ivit ies at the highest concent rat ion.18

19

siRNAs against TRBP decrease endogenous TRBPs20

Because newly synthesized mRNA from t ransfected plasmid may have dif ferent21

accessibil it y and stabil it y compared with the endogenous mRNA, we next assessed22

TRBP mRNA stabil it y and the act ivit y of t he siRNAs to decrease endogenous TRBPs23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


(Fig. 2). We f irst determined TRBP mRNA half-life in the Jurkat lymphocyt ic cell l ine,1

which supports HIV replicat ion (Fig. 2A). The TRBP mRNA stabilit y was measured after2

t reat ing the cells with the t ranscript ional inhibitor Act inomycin D (ActD) between 13

and 10 hr. The amount of mRNA was then analyzed by RT-PCR and compared to4

cont rol cells without ActD (Fig. 2A, top); c-myc mRNA, which is known to be very5

unstable in lymphoblastoid as well as in HeLa cells (20, 66), was used as a reference.6

The decay of TRBP and c-myc mRNAs was plot ted as the percentage of the original7

amount of mRNA at t ime 0 (Fig. 2A, bot tom). The half-life of TRBP mRNA was about 38

hr, whereas the half-l ife of c-myc mRNA was less than 1 hr indicat ing that TRBP mRNA9

is about four t imes more stable than c-myc mRNA.10

The act ivit y of siRNAs to decrease endogenous TRBP1 and TRBP2 proteins was11

t hen evaluated in HeLa cells (Fig 2B). We used an ant ibody which recognizes both12

proteins as shown previously (3). The siRNA-NS did not decrease the concent rat ion of13

the endogenous proteins, but all three TRBP siRNAs did. The siRNA567 and siRNA65714

caused a part ial decrease in endogenous TRBP, whereas siRNA571 induced an almost15

complete inhibit ion of the protein. Because some siRNAs can act ivate the interferon16

pathway (10, 72), we verif ied if t he TRBP decrease by siRNA571 could be due to a17

t ranslat ional shut down by act ivated PKR. PKR phosphorylat ion remained at the same18

weak endogenous level whet her t he cel ls were t ransfect ed by NS or siRNA57119

indicat ing that the low TRBP amount is not due to PKR-induced t ranslat ion shut -down20

(Fig 2C). Previous reports with dif ferent siRNAs target ing TRBP showed an incomplete21

loss of TRBP protein (14, 36). Therefore, siRNA571 gives rise to a higher level of22

expression inhibit ion.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


1

siRNAs against TRBP decrease the expression of the HIV-1 LTR.2

TRBP1 and TRBP2 were previously shown to inf luence HIV-1 gene expression and3

t o act in concert with Tat although at dif ferent levels (2). Therefore, we expected4

that a decrease in TRBPs would decrease HIV-1 basal LTR expression and Tat -mediated5

t rans-act ivat ion. The siRNAs directed against TRBPs were assayed on HIV-1 LTR6

expression in the absence and in the presence of Tat (Fig. 3). To bet ter evaluate their7

act ivit y, they were compared to the previously described siRNAs directed against TAR8

or Tat RNAs (16, 41). Whereas siRNA657 had lit t le act ivit y, siRNA-TAR, siRNA567 and9

siRNA571 showed a twofold inhibit ion of LTR basal expression (Fig. 3A). These results10

indicate that TRBP or TAR inact ivat ion has the same effect on LTR basal expression.11

This is consist ent wit h siRNAs-TAR that have a maximum of 50% reduct ion in a12

comparable luciferase reporter gene assay due to the t ight TAR RNA st ructure (79). In13

the context of Tat t rans-act ivat ion, siRNA657 had the same act ivit y as siRNA-TAR with14

an approximately twofold reduct ion in LTR expression, whereas siRNA567 showed a15

threefold reduct ion (Fig. 3B). The act ivit y of siRNA571 was close to that of siRNA-Tat16

wit h a t enfold reduct ion over t he NS cont rol . Overal l , t he decrease in TRBP17

expression by siRNAs result s in a 50 to 90% reduct ion of HIV-1 LTR expression in the18

presence of the Tat t ransact ivator.19

20

siRNAs against TRBP decrease HIV-1 production in transfected cells.21

The act ivit y of siRNAs against TRBP was next evaluated for t heir act ivit y t o22

decrease HIV-1 product ion. HeLa cel ls were t ransfected wit h t he previous TRBP23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


siRNAs, or another siRNA (Tat1c) target ing a region of Tat present in the HIV molecular1

clone pNL4-3. Virus product ion was monitored by RT assay and the expression of2

int racellular viral proteins evaluated by western blot (Fig. 4). In agreement with3

previous result s (16) the Tat siRNA was very ef fect ive at inhibit ing HIV-1 product ion4

with a twenty-fold reduct ion of RT act ivity (Fig. 4A). siRNAs against TRBP also showed5

high act ivit y, with siRNA567 and siRNA571 inhibit ing RT act ivit y by four to f ive-fold6

(lanes 4 and 5) and siRNA657 by twofold (lane 6). Int racel lular viral proteins,7

part icularly t he viral capsid p24, were mildly decreased with siRNA657 but highly8

decreased with siRNA567 and siRNA571 compared to the negat ive cont rol (Fig 4B).9

Unsurprisingly, target ing virtually all viral spliced mRNAs, except Nef1, one of f ive Nef10

mRNAs (63), the Tat1c siRNA abolished all viral protein product ion.11

To determine if the reduced expression of viral proteins and virion product ion12

could be ascribed to an increased PKR act ivat ion, we measured PKR expression and13

PKR act ivat ion on the same ext racts (Fig 4C). In assays with siRNA Tat , siRNA567 and14

571, PKR expression was increased twofold compared to the siRNA-NS suggest ing a15

part ial act ivat ion of the interferon pathway likely due to the concomitant presence of16

viral RNA and act ive siRNAs. In paral lel, phosphorylated PKR increased in similar17

proport ion suggest ing t hat act ivated PKR is only a moderate component of t he18

reduced HIV product ion. These resul t s demonst rat e t hat decreased levels of19

endogenous TRBP induce a signi f icant reduct ion in vi ral prot ein synt hesis.20

Subsequent ly, viral product ion is inhibited to levels comparable with direct ly reducing21

Tat expression.22

23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


siRNAs against TRBP decrease HIV production of various strains.1

One advantage to t arget cel lular factors required for HIV replicat ion is t he2

possibil i t y t o t arget many viral st rains wit h t he same sequence. We t herefore3

assessed if decreasing TRBP concent rat ion wil l also af fect t he product ion of other4

lymphot ropic (X4) or macrophage-t ropic (R5) HIV-1 st rains as well as an HIV-2 st rain.5

The HIV st rains that were assayed are summarized in Table 2. All HIV st rains showed a6

decreased virus product ion in the presence of siRNA571 compared to siRNA-NS (Fig. 5).7

The HIV-2 pROD-10 st rain showed a 40% decrease indicat ing that TRBP is also required8

to some extent for this virus. The pELI-1 (HIV-1 D clade) was the most affected with a9

90% reduct ion in virus product ion indicat ing a st rong TRBP requirement . Overall, HIV-10

1 virion product ion was reduced 60-90% by a decrease in TRBP.11

12

siRNAs against Dicer decrease HIV-1 production in transfected cells.13

To determine if t he act ivit y of siRNAs against TRBP could be ascribed to it s14

act ivit y with HIV RNA or to it s funct ion in RISC, we targeted another member of the15

RISC. It has previously been shown that reduced Dicer expression diminishes the16

act ivit y of RISC (40). We evaluated the act ivit y of siRNA against Dicer by RT-PCR and17

western blot (Fig. 6A) and found that t ransfect ion of cells with 14 nM of siRNA Dicer18

using Lipofectamine ef fect ively reduced both Dicer mRNA and protein levels. To19

assess the ef fect s t his decreased Dicer expression had on viral expression we co-20

t ransfected the HIV molecular clone pNL4-3 with siRNADicer (Fig. 6B). Surprisingly,21

HIV product ion was reduced up t o 40% suggest ing t hat t he act ivit y of t he RISC22

cont ributes to, rather than inhibits, viral product ion.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


1

siRNAs against TRBP or Dicer do not affect cell viability.2

To determine if some or al l act ivit y of siRNAs against TRBP or Dicer on HIV3

expression and product ion could be at t ributed to a non-specif ic cytotoxic ef fect we4

measured cell viabil it y of t ransfected cells. Using 7-AAD, a f luorescent dye taken up5

by non-viable cel ls, we were able t o discriminate between viable and non-viable6

t ransfected cell populat ions based on non-f luorescence (71). The result s show that7

the siRNAs do not reduce cell viabil it y at the concent rat ions used in this study, while8

the poly(I) • poly(C) cont rol signif icant ly reduced cell viabilit y (Fig. 7A).9

10

siRNAs against TRBP or Dicer decrease the processing of miRNAs against GFP.11

Because siRNA-TRBP and siRNA-Dicer affect HIV-1 product ion, this act ivity could12

be due to their funct ion in RNAi or to another funct ion. To discriminate between13

t hese, we assessed t he ext ent t o which t he respect ive siRNAs af fect t he RNAi14

pathway. Using a system reliant on the processing of a vector delivered EGFP pre-15

miRNA into mature miRNA we direct ly assessed the effects various siRNAs had on the16

product ion of EGFP miRNA species by nort hern blot . SiRNA567 and siRNA57117

decreased the miRNA processing by 23 and 41% respect ively, whereas siRNA-Dicer18

decreased it by 73% compared to the siRNA-NS. Therefore, TRBP siRNAs disrupt the19

RNAi pathway part ially while Dicer siRNA largely impedes it . 20

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


DISCUSSION1

RNAi has been widely used within the last f ive years to inhibit gene expression2

in mammalian cells. Applicat ions range from fundamental knowledge in genomics to3

t herapeut ics in disease-associat ed genes (51). In paral lel , t he int ricat e RNAi4

mechanism is being elucidated to understand how si- or miRNAs funct ion in the cells5

and recent progress has been made t o elucidate t he dif ferences between lower6

eukaryotes and mammalian cells (14, 34, 36, 52, 54). It has become clear within the7

last year that Dicer, Ago2 and TRBP are the main components of the mammalian RISC8

that t rigger either RNA cleavage or t ranslat ion inhibit ion, although other proteins have9

been ident if ied in this complex (14, 36, 52). Both TRBP1 and TRBP2 bind to Dicer in10

several assays and the two isoforms may play a similar role in the RISC (36).11

Because of the high eff iciency of siRNAs, they have been used to target viruses12

and combat viral diseases. Viruses whose repl icat ion has been silenced include13

Respiratory Syncyt ial , Inf luenza, Pol io, Herpes, Hepat it is B, Hepat it is C, Human14

Papil loma, Human Immunodef iciency viruses and a growing l ist of other viruses (17,15

37). In the choice of targets against a virus, the best one seems to be the virus it self16

because a specif ic target will less likely damage the cell. However, one concern with17

HIV is it s high mutat ion rate that induces drug resistance. Indeed, a single mismatch18

in the sequence can decrease or inhibit the act ivit y of siRNAs (41, 64). In support of19

these concerns, HIV was shown to escape RNAi by mutat ing the targeted sequence (8,20

77). The choice of a highly conserved sequence or the use of mult iple targets are21

ways to overcome this inconvenience but may also have some limitat ions. Target ing22

cel lular fact ors required for HIV repl icat ion is anot her way t o circumvent t his23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


problem. This st rategy has already been used against HIV by inhibit ing cel lular1

receptors, expression factors and factors required for viral t raf f icking and packaging.2

In each case, the inhibit ion of the targeted cellular factor decreased HIV product ion3

and did not damage the cell.4

TRBP is a cellular factor that enhances HIV replicat ion by it s act ivit y on HIV-15

gene expression and more specif ically on t ranslat ion (7, 19, 23, 24, 29). We recent ly6

showed that ast rocytes that have a low level of TRBP expression have a concomitant7

low level of HIV mRNA t ranslat ion and poor HIV replicat ion (3, 4, 33, 59). Ast rocytes8

and live Tarbp2-/ - mice (81) indicate that cells can live with low or no TRBP protein.9

Therefore, it seemed l ikely t hat inact ivat ing TRBP should be an ef fect ive way to10

decrease HIV replicat ion. The recent elucidat ion of components of RISC required for11

RNAi in mammalian cel ls showed t hat TRBP is a Dicer part ner and a necessary12

component of the RNAi mechanism (14, 36, 67). Because RNAi may be part of the cell13

react ion against viruses in mammalian cells, it became less obvious that decreasing14

TRBP may result in HIV reduced replicat ion (31, 70, 78).15

The results shown in this paper indicate that t ransfected and endogenous TRBPs16

can be effect ively decreased by RNAi, using dif ferent t ransfect ion protocols (Fig. 1-2).17

In previous cellular set t ings (14, 36), the inhibit ion was good but not complete, l ikely18

because TRBP is part of the RISC and because the mRNA and the protein are quite19

stable. Here, siRNA571 gave a high decrease in protein concent rat ion, indicat ing that20

ef fect ive inhibit ion can be achieved (Fig. 2). Because TRBP overexpression can21

increase HIV-1 LTR basal expression (19, 24, 29), we expected that it s inhibit ion may22

lower this level. The results show that inhibit ing TRBP mRNA by siRNAs decreases HIV23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


LTR basal expression (Fig. 3A) to a mild extent similar to that induced by siRNA-TAR in1

t he best case. This twofold ef fect of siRNA571 may be mainly t he result of an2

unrepressed t ranslat ion cont rol mediated by TAR (23), rather than by an increased3

PKR phosphorylat ion as siRNA571 does not act ivate PKR (Fig. 2C). In cont rast , in the4

presence of Tat , the act ivit y of siRNA571 on HIV-1 LTR t rans-act ivated expression was5

close to the act ivit y of siRNA-Tat and the weakest siRNA657 had an act ivit y similar to6

siRNA-TAR (Fig. 3B). These result s suggest t hat TRBP cont ributes t o t he t rans-7

act ivated level of HIV-1 expression to a higher extent than to the basal level, which is8

compat ible with the observed synergist ic ef fect between TRBP and Tat (29). The9

comparison between the ef f iciency of siRNA-TAR and siRNA571 on the basal and the10

t ransact ivated level suggest s t hat siRNA-TAR has a consist ent twofold decrease.11

Indeed various TAR siRNAs have been extensively studied and were shown to have a12

maximum eff iciency of 50% in a comparable luciferase gene reporter assay due to the13

highly st ructured TAR RNA prevent ing access to the siRNA-TAR (79). Because TRBP14

act s mainly t o increase t ranslat ion of mRNAs, i t is l ikely t hat by reducing it s15

concent rat ion in cells, the remaining amount is almost suff icient to t ranslate the LTR16

basal level, but in l imit ing amount to t ranslate the large amount of mRNA present17

after t rans-act ivat ion (compare Fig. 3A lane 5 with 3B lane 6).18

These result s suggest that TRBP cont ributes largely to HIV expression and we19

assayed TRBP siRNAs on HIV-1 product ion. In this context , the decreased expression20

of TRBP reduced expression of HIV-1 proteins and format ion of viral part icles (Fig. 4).21

This rest rict ion was also observed with dif ferent HIV-1 st rains and HIV-2, indicat ing22

that TRBP is a protein required for all st rains (Fig. 5). Together with studies that show23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


overexpression of TRBP can overcome the t ranslat ion and replicat ion block caused by1

act ivated PKR in lymphocytes (7) and ast rocytes (59), our result s show TRBP is2

important to HIV replicat ion. This requirement is l ikely due to all TRBP act ivit ies on3

PKR inhibit ion (7, 19), increased t ranslat ion of TAR containing RNAs (23), PACT4

inhibit ion (G. Laraki, A. Daher and A. Gat ignol, unpublished data) and possibly it s5

funct ion in RNAi (14, 36). Results in Figure 4C show a moderate increase in PKR and6

act ivated PKR with both siRNA Tat and siRNA TRBP, demonst rat ing that increased PKR7

act ivat ion only part ly cont ributes t o reduced HIV product ion. Furt hermore, t he8

act ivit y of TRBP siRNAs cannot be ascribed to a loss of cell viabilit y (Fig. 7A) and their9

modest impediment of t he miRNA biogenesis pathway (Fig. 7B) cannot explain the10

ent ire act ivit y. The results in the context of Tat t rans-act ivat ion and HIV product ion11

show comparable act ivity (Fig. 3B and 4A). Therefore, the overall results suggest that12

the act ivit y of TRBP siRNAs on HIV expression and product ion can be mainly ascribed13

t o t he TRBP funct ions other t han RNAi. This study st rongly suggests t hat , in t he14

context of HIV replicat ion, TRBP is more important to help HIV replicat ion than to15

rest rict viral RNA by RNAi as suggested by other experiments (31, 59). To determine16

more precisely if RNAi funct ion cont ributes to HIV replicat ion, we also decreased17

Dicer. Surprisingly, we did not obtain an increase in viral product ion that would have18

supported a role for RNAi in HIV rest rict ion. Instead, l ike with the TRBP siRNAs, we19

obtained a decrease in HIV-1 product ion, although to a lesser extent (Fig. 6). Because20

Dicer siRNA largely impedes miRNA processing (Fig. 7), we conclude that , in t his21

cellular and viral context , RNAi does not rest rict HIV replicat ion (31, 70, 78), rather it22

cont ributes moderately to virus product ion, suggest ing that similar to HCV, HIV uses23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


RNAi for it s own benef it rather t han being rest ricted by RNA cleavage (42). The1

mechanism by which this funct ion is accomplished, and if it can also be observed in2

lymphocytes and macrophages, which are the natural targets of HIV, remains to be3

determined.4

5

ACKNOWLEDGMENTS6

We would l ike to thank E. Meurs and W. Fil ipowicz for the ant i-PKR and the7

ant i-Dicer ant ibodies. We also thank M. Mart in, K. Peden and R. Collman for HIV8

proviral plasmids. We are grat eful t o A. Mouland and R. Ramsay for helpful9

discussions and comments. This work was supported by the Canadian Inst it ute for10

Health Research (CIHR) grant HOP38112 to AG and by Nat ional Health and Medical11

Research Council (NHMRC) of Aust ralia proj ect grant 400302 to DP and by the Early12

Career Researchers Grant Scheme to SMC. SB was supported by a CIHR postdoctoral13

fellowship. AG is the recipient of a Hugh and Helen McPherson memorial award.14

The authors declare that they have no compet ing f inancial interests.15 ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


REFERENCES1

1. Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. L. Willey, A. Rabson,2

and M. A. Martin. 1986. Product ion of acquired immunodef iciency syndrome-3

associat ed ret rovirus in human and nonhuman cel ls t ransfect ed wit h an4

infect ious molecular clone. J. Virol. 59:284-291.5

2. Bannwarth, S., and A. Gatignol. 2005. HIV-1 TAR RNA: the target of molecular6

interact ions between the virus and its host . Curr. HIV Res. 3:61-71.7

3. Bannwarth, S., S. Lainé, A. Daher, N. Grandvaux, G. Clerzius, A. C. LeBlanc,8

J. Hiscott, and A. Gatignol. 2006. Cell-specif ic regulat ion of TRBP1 promoter9

by NF-Y t ranscript ion fact or in lymphocyt es and ast rocyt es. J. Mol. Biol .10

355:898-910.11

4. Bannwarth, S. , L. Talakoub, F. Letourneur, M. Duarte, D. F. Purcell, J.12

Hiscott, and A. Gatignol. 2001. Organizat ion of the human tarbp2 gene reveals13

two promoters t hat are repressed in an ast rocyt ic cel l l ine. J. Biol. Chem.14

276:48803-48813.15

5. Bass, B. L. 2001. RNA interference. The short answer. Nature 411:428-429.16

6. Battisti, P.-L. , A. Daher, S. Bannwarth, J. Voortman, K. W. C. Peden, J.17

Hiscott, A. J. Mouland, R. Benarous, and A. Gatignol. 2003. Addit ive Act ivit y18

between the Trans-Act ivat ion Response RNA-Binding Protein, TRBP2, and Cyclin19

T1 on HIV Type 1 Expression and Viral Product ion in Murine Cells. AIDS Res.20

Hum. Ret roviruses. 19:767- 778.21

7. Benkirane, M. , C. Neuveut, R. F. Chun, S. M. Smith, C. E. Samuel, A.22

Gatignol, and K.-T. Jeang. 1997. Oncogenic potent ial of TAR RNA-binding23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


protein TRBP and it s regulatory interact ion with Protein Kinase PKR. EMBO J.1

16:611-624.2

8. Boden, D., O. Pusch, F. Lee, L. Tucker, and B. Ramratnam. 2003. Human3

immunodef iciency virus t ype 1 escape f rom RNA int erference. J. Virol .4

77:11531-11535.5

9. Boden, D., O. Pusch, R. Silbermann, F. Lee, L. Tucker, and B. Ramratnam.6

2004. Enhanced gene silencing of HIV-1 specif ic siRNA using microRNA designed7

hairpins. Nuc. Acids Res. 32:1154-1158.8

10. Bridge, A. J. , S. Pebernard, A. Ducraux, A. L. Nicoulaz, and R. Iggo. 2003.9

Induct ion of an interferon response by RNAi vectors in mammalian cells. Nat .10

Genet . 34:263-264.11

11. Capodici, J. , K. Kariko, and D. Weissman. 2002. Inhibit ion of HIV-1 infect ion12

by small interfering RNA-mediated RNA interference. J. Immunol. 169:5196-13

5201.14

12. Castanotto, D., H. Li, and J. J. Rossi. 2002. Funct ional siRNA expression from15

t ransfected PCR products. RNA 8:1454-1460.16

13. Chatel-Chaix, L. , J. F. Clement, C. Martel, V. Beriault, A. Gatignol, L.17

DesGroseillers, and A. J. Mouland. 2004. Ident if icat ion of Staufen in t he18

human immunodef iciency virus t ype 1 Gag ribonucleoprotein complex and a19

role in generat ing infect ious viral part icles. Mol. Cell. Biol. 24:2637-2648.20

14. Chendrimada, T. P., R. I. Gregory, E. Kumaraswamy, J. Norman, N. Cooch,21

K. Nishikura, and R. Shiekhattar. 2005. TRBP recruit s the Dicer complex to22

Ago2 for microRNA processing and gene silencing. Nature 436:740-744.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


15. Chiu, Y. L. , H. Cao, J. M. Jacque, M. Stevenson, and T. M. Rana. 2004.1

Inhibi t ion of human immunodef iciency virus t ype 1 repl icat ion by RNA2

interference directed against human t ranscript ion elongat ion factor P-TEFb3

(CDK9/ CyclinT1). J. Virol. 78:2517-2529.4

16. Coburn, G. A., and B. R. Cullen. 2002. Potent and specif ic inhibit ion of human5

immunodef iciency virus t ype 1 repl icat ion by RNA int erference. J. Virol .6

76:9225-9231.7

17. Colbere-Garapin, F. , B. Blondel, A. Saulnier, I. Pelletier, and K. Labadie.8

2005. Silencing viruses by RNA interference. Microbes Infect . 7:767-775.9

18. Collman, R. , J. W. Balliet, S. A. Gregory, H. Friedman, D. L. Kolson, N.10

Nathanson, and A. Srinivasan. 1992. An infect ious molecular clone of an11

unusual macrophage-t ropic and highly cyt opat hic st rain of human12

immunodeficiency virus type 1. J. Virol. 66:7517-7521.13

19. Daher, A. , M. Longuet, D. Dorin, F. Bois, E. Segeral, S. Bannwarth, P.-L.14

Battisti, D. Purcell, R. Benarous, C. Vaquero, E. F. Meurs, and A. Gatignol.15

2001. Two dimerizat ion domains in the Trans-act ivat ion response RNA-binding16

Protein (TRBP) individually reverse the Protein Kinase R inhibit ion of HIV-1 Long17

Terminal Repeat expression. J. Biol. Chem. 276:33899-33905.18

20. Dani, C., J. M. Blanchard, M. Piechaczyk, S. El Sabouty, L. Marty, and P.19

Jeanteur. 1984. Ext reme instabil it y of myc mRNA in normal and t ransformed20

human cells. Proc. Nat l. Acad. Sci. USA 81:7046-7050.21

21. Daviet, L., M. Erard, D. Dorin, M. Duarte, C. Vaquero, and A. Gatignol. 2000.22

The analysis of a binding dif ference between the two dsRNA binding domains in23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


TRBP reveals t he modular funct ion of a KR-hel ix mot if . Eur. J. Biochem.1

267:2419-2431.2

22. Dillon, C. P., P. Sandy, A. Nencioni, S. Kissler, D. A. Rubinson, and L. Van3

Parij s. 2005. RNAi as an experimental and t herapeut ic t ool t o st udy and4

regulate physiological and disease processes. Annu. Rev. Physiol. 67:147-173.5

23. Dorin, D. , M. C. Bonnet, S. Bannwarth, A. Gatignol, E. F. Meurs, and C.6

Vaquero. 2003. The TAR RNA-binding protein, TRBP, st imulates the expression7

of TAR-containing RNAs in vi t ro and in vivo independent ly of it s abil it y t o8

inhibit the dsRNA-dependent kinase PKR. J. Biol. Chem. 278:4440-4448.9

24. Duarte, M., K. Graham, A. Daher, P.-L. Battisti, S. Bannwarth, E. Segeral, K.-10

T. Jeang, and A. Gatignol. 2000. Characterizat ion of TRBP1 and TRBP2: stable11

stem-loop st ructure at the 5' end of TRBP2 mRNA resembles HIV-1 TAR and is12

not found in it s processed pseudogene. J. Biomed. Sci. 7:494-506.13

25. Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T.14

Tuschl. 2001. Duplexes of 21-nucleot ide RNAs mediate RNA interference in15

cultured mammalian cells. Nature 411:494-498.16

26. Erard, M., D. G. Barker, F. Amalric, K.-T. Jeang, and A. Gatignol. 1998. An17

Arg/ Lys-rich core pept ide mimics TRBP binding to the HIV-1 TAR RNA upper-18

stem/ loop. J. Mol. Biol. 279:1085-1099.19

27. Filipowicz, W. 2005. RNAi: the nuts and bolts of the RISC machine. Cell 122:17-20

20.21

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


28. Gatignol, A. , C. Buckler, and K.-T. Jeang. 1993. Relatedness of an RNA1

binding mot if in HIV-1 TAR RNA binding protein TRBP to human P1/ dsI kinase2

and Drosophila Staufen. Mol. Cell. Biol. 13:2193-2202.3

29. Gatignol, A. , A. Buckler-White, B. Berkhout, and K. -T. Jeang. 1991.4

Characterizat ion of a human TAR RNA-binding protein that act ivates the HIV-15

LTR. Science 251:1597-1600.6

30. Gatignol, A. , M. Duarte, L. Davie t, Y. -N. Chang, and K.-T. Jeang. 1996.7

Sequent ial steps in Tat t rans-act ivat ion of HIV-1 mediated through cellular DNA,8

RNA, and protein binding factors. Gene Expr. 5:217-228.9

31. Gatignol, A. , S. Lainé, and G. Clerzius. 2005. Dual role of TRBP in HIV10

repl icat ion and RNA interference: viral diversion of a cel lular pathway or11

evasion from ant iviral immunity? Ret rovirology 2:65.12

32. Good, P. D. , A. J. Krikos, S. X. Li, E. Bertrand, N. S. Lee, L. Giver, A.13

Ellington, J. A. Zaia, J. J. Rossi, and D. R. Engelke. 1997. Expression of small,14

therapeut ic RNAs in human cell nuclei. Gene Ther. 4:45-54.15

33. Gorry, P. R., J. L. Howard, M. J. Churchill, J. L. Anderson, A. Cunningham,16

D. Adrian, D. A. McPhee, and D. F. Purcell. 1999. Diminished product ion of17

human immunodef iciency virus t ype 1 in ast rocytes result s f rom inef f icient18

t ranslat ion of gag, env, and nef mRNAs despite eff icient expression of Tat and19

Rev. J. Virol. 73:352-361.20

34. Gregory, R. I. , T. P. Chendrimada, N. Cooch, and R. Shiekhattar. 2005.21

Human RISC couples microRNA biogenesis and post t ranscript ional gene22

silencing. Cell 123:631-640.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


35. Guo, F. , S. Cen, M. Niu, H. Javanbakht, and L. Kleiman. 2003. Specif ic1

inhibit ion of the synthesis of human lysyl-tRNA synthetase results in decreases2

in t RNA(Lys) incorporat ion, tRNA(3)(Lys) anneal ing t o viral RNA, and viral3

infect ivity in human immunodeficiency virus type 1. J. Virol. 77:9817-9822.4

36. Haase, A. D., L. Jaskiewicz, H. Zhang, S. Lainé, R. Sack, A. Gatignol, and W.5

Filipowicz. 2005. TRBP, a regulator of cellular PKR and HIV-1 virus expression,6

interacts with Dicer and funct ions in RNA silencing. EMBO Rep. 6:961-967.7

37. Haasnoot, J. , and B. Berkhout. 2006. RNA interference: it s use as ant iviral8

therapy. Handb. Exp. Pharmacol. 173:117-150.9

38. Hammond, S. M. 2005. Dicing and sl icing: t he core machinery of t he RNA10

interference pathway. FEBS Let t . 579:5822-5829.11

39. Huang, L. M., A. Joshi, R. Willey, J. Orenstein, and K.-T. Jeang. 1994. Human12

immunodef iciency viruses regulated by alt ernat ive t rans-act ivators: genet ic13

evidence for a novel non-t ranscript ional funct ion of Tat in virion infect ivit y.14

EMBO J. 13:2886-2896.15

40. Hutvagner, G., J. McLachlan, A. E. Pasquinelli, E. Balint, T. Tuschl, and P. D.16

Zamore. 2001. A cellular funct ion for the RNA-interference enzyme Dicer in the17

maturat ion of the let -7 small temporal RNA. Science 293:834-838.18

41. Jacque, J. M. , K. Triques, and M. Stevenson. 2002. Modulat ion of HIV-119

replicat ion by RNA interference. Nature 418:435-438.20

42. Jopling, C. L. , M. Yi, A. M. Lancaster, S. M. Lemon, and P. Sarnow. 2005.21

Modulat ion of hepat it is C virus RNA abundance by a l iver-specif ic MicroRNA.22

Science 309:1577-1581.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


43. Kameoka, M., S. Nukuzuma, A. Itaya, Y. Tanaka, K. Ota, K. Ikuta, and K.1

Yoshihar a. 2004. RNA int erference direct ed against Poly(ADP-Ribose)2

polymerase 1 ef f icient ly suppresses human immunodef iciency virus t ype 13

replicat ion in human cells. J. Virol. 78:8931-8934.4

44. Kharrat, A. , M. J. Macias, T. J. Gibson, M. Nilges, and A. Pastore. 1995.5

St ructure of the dsRNA binding domain of E.coli RNase III. EMBO J. 14:3572-6

3584.7

45. Komano, J., K. Miyauchi, Z. Matsuda, and N. Yamamoto. 2004. Inhibit ing the8

Arp2/ 3 complex limits infect ion of both int racellular mature vaccinia virus and9

primate lent iviruses. Mol. Biol. Cell. 15:5197-5207.10

46. Laurent, A. G., B. Krust, J. Galabru, J. Svab, and A. G. Hovanessian. 1985.11

Monoclonal ant ibodies to an interferon-induced Mr 68,000 protein and their use12

for the detect ion of double-st randed RNA-dependent protein kinase in human13

cells. Proc. Nat l. Acad. Sci. USA 82:4341-4345.14

47. Lee, J. Y., H. Kim, C. H. Ryu, J. Y. Kim, B. H. Choi, Y. Lim, P. W. Huh, Y. H.15

Kim, K. H. Lee, T. Y. Jun, H. K. Rha, J. K. Kang, and C. R. Choi. 2004. Merlin,16

a t umor suppressor, int eract s wit h t ransact ivat ion-responsive RNA-binding17

protein and inhibits it s oncogenic act ivity. J. Biol. Chem. 279:30265-30273.18

48. Lee, J. Y., H. J. Moon, W. K. Lee, H. J. Chun, C. W. Han, Y. W. Jeon, Y. Lim,19

Y. H. Kim, T. P. Yao, K. H. Lee, T. Y. Jun, H. K. Rha, and J. K. Kang. 2006.20

Merlin facil it ates ubiquit inat ion and degradat ion of t ransact ivat ion-responsive21

RNA-binding protein. Oncogene 25:1143-1152.22

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


49. Lee, K. , M. A. Fajardo, and R. E. Braun. 1996. A t est is cytoplasmic RNA-1

binding protein that has the propert ies of a t ranslat ional repressor. Mol. Cell.2

Biol. 16:3023-3034.3

50. Lee, N. S., T. Dohjima, G. Bauer, H. Li, M. J. Li, A. Ehsani, P. Salvaterra, and4

J. Rossi. 2002. Expression of small interfering RNAs targeted against HIV-1 rev5

t ranscripts in human cells. Nat . Biotechnol. 20:500-505.6

51. Leung, R. K. , and P. A. Whittaker. 2005. RNA int erference: f rom gene7

silencing to gene-specif ic therapeut ics. Pharmacol. Ther. 107:222-239.8

52. Liu, J., M. A. Carmell, F. V. Rivas, C. G. Marsden, J. M. Thomson, J. J. Song,9

S. M. Hammond, L. Joshua-Tor, and G. J. Hannon. 2004. Argonaute2 is the10

catalyt ic engine of mammalian RNAi. Science 305:1437-1441.11

53. Liu, S. , M. Asparuhova, V. Brondani, I. Ziekau, T. Klimkait , and D.12

Schumperli. 2004. Inhibit ion of HIV-1 mult iplicat ion by ant isense U7 snRNAs and13

siRNAs target ing cyclophilin A. Nuc. Acids Res. 32:3752-3759.14

54. Maniataki, E. , and Z. Mourelatos. 2005. A human, ATP-independent , RISC15

assembly machine fueled by pre-miRNA. Genes Dev. 19:2979-2990.16

55. Martinez, M. A. , A. Gutierrez, M. Armand-Ugon, J. Blanco, M. Parera, J.17

Gomez, B. Clotet, and J. A. Este. 2002. Suppression of chemokine receptor18

expression by RNA interference allows for inhibit ion of HIV-1 replicat ion. AIDS19

16:2385-2390.20

56. Meurs, E. F., Y. Watanabe, S. Kadereit, G. N. Barber, M. G. Katze, K. Chong,21

B. R. Williams, and A. G. Hovanessian. 1992. Const itut ive expression of human22

double-st randed RNA-act ivat ed p68 kinase in murine cel ls mediat es23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


phosphorylat ion of eukaryot ic init iat ion factor 2 and part ial resist ance t o1

encephalomyocardit is virus growth. J. Virol. 66:5805-5814.2

57. Murray, J. L., M. Mavrakis, N. J. McDonald, M. Yilla, J. Sheng, W. J. Bellini,3

L. Zhao, J. M. Le Doux, M. W. Shaw, C. C. Luo, J. Lippincott-Schwartz, A.4

Sanchez, D. H. Rubin, and T. W. Hodge. 2005. Rab9 GTPase is required for5

replicat ion of human immunodef iciency virus t ype 1, f iloviruses, and measles6

virus. J. Virol. 79:11742-11751.7

58. Novina, C. D., M. F. Murray, D. M. Dykxhoorn, P. J. Beresford, J. Riess, S. K.8

Lee, R. G. Collman, J. Lieberman, P. Shankar, and P. A. Sharp. 2002. siRNA-9

directed inhibit ion of HIV-1 infect ion. Nat . Med. 8:681-686.10

59. Ong, C. L. , J. C. Thorpe, P. R. Gorry, S. Bannwarth, A. Jaworowski, J. L.11

Howard, S. Chung, S. Campbell, H. S. Christensen, G. Clerzius, A. J.12

Mouland, A. Gatignol, and D. F. Purcell. 2005. Low TRBP levels support an13

innat e human immunodef iciency virus t ype 1 resist ance in ast rocyt es by14

enhancing the PKR ant iviral response. J. Virol. 79:12763-12772.15

60. Patel, R. C., and G. C. Sen. 1998. PACT, a protein act ivator of the interferon-16

induced protein kinase, PKR. EMBO J. 17:4379-4390.17

61. Peden, K. , M. Emerman, and L. Montagnier. 1991. Changes in growt h18

propert ies on passage in t issue cult ure of viruses derived f rom infect ious19

molecular clones of HIV-1LAI, HIV-1MAL, and HIV-1ELI. Virology 185:661-672.20

62. Ping, Y. H., C. Y. Chu, H. Cao, J. M. Jacque, M. Stevenson, and T. M. Rana.21

2004. Modulat ing HIV-1 replicat ion by RNA interference directed against human22

t ranscript ion elongat ion factor SPT5. Ret rovirology 1:46.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


63. Purcell, D. F. , and M. A. Mart in. 1993. Al t ernat ive spl icing of human1

immunodef iciency virus t ype 1 mRNA modulat es viral prot ein expression,2

replicat ion, and infect ivity. J. Virol. 67:6365-6378.3

64. Pusch, O., D. Boden, R. Silbermann, F. Lee, L. Tucker, and B. Ramratnam.4

2003. Nucleot ide sequence homology requirements of HIV-1-specif ic short5

hairpin RNA. Nuc. Acids Res. 31:6444-6449.6

65. Qin, X. F. , D. S. An, I. S. Chen, and D. Baltimore. 2003. Inhibit ing HIV-17

infect ion in human T cells by lent iviral-mediated delivery of small interfering8

RNA against CCR5. Proc. Nat l. Acad. Sci. USA 100:183-188.9

66. Rabbitts, P. H. , A. Forster, M. A. Stinson, and T. H. Rabbitts. 1985.10

Truncat ion of exon 1 f rom the c-myc gene result s in prolonged c-myc mRNA11

stabilit y. EMBO J. 4:3727-3733.12

67. Rossi, J. J. 2005. Mammalian Dicer f inds a partner. EMBO Rep. 6:927-929.13

68. Ryan-Graham, M. A., and K. W. Peden. 1995. Both virus and host components14

are important for the manifestat ion of a Nef- phenotype in HIV-1 and HIV-2.15

Virology 213:158-168.16

69. Sambrook, J. , E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a17

laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,18

New York.19

70. Saumet, A., and C. H. Lecellier. 2006. Ant i-viral RNA silencing: do we look like20

plants? Ret rovirology 3:3.21

71. Schmid, I. , W. J. Krall, C. H. Uittenbogaart, J. Braun, and J. V. Giorgi. 1992.22

Dead cell discriminat ion with 7-amino-act inomycin D in combinat ion with dual23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


color immunof luorescence in single laser f low cytomet ry. Cytomet ry 13:204-1

208.2

72. Sledz, C. A., M. Holko, M. J. de Veer, R. H. Silverman, and B. R. Williams.3

2003. Act ivat ion of the interferon system by short -interfering RNAs. Nat . Cell.4

Biol. 5:834-839.5

73. Song, E., S. K. Lee, D. M. Dykxhoorn, C. Novina, D. Zhang, K. Crawford, J.6

Cerny, P. A. Sharp, J. Lieberman, N. Manjunath, and P. Shankar. 2003.7

Sustained small interfering RNA-mediated human immunodeficiency virus type 18

inhibit ion in primary macrophages. J. Virol. 77:7174-7181.9

74. Surabhi, R. M., and R. B. Gaynor. 2002. RNA interference directed against viral10

and cellular targets inhibit s human immunodeficiency Virus Type 1 replicat ion.11

J. Virol. 76:12963-12973.12

75. Tahbaz, N., F. A. Kolb, H. Zhang, K. Jaronczyk, W. Filipowicz, and T. C.13

Hobman. 2004. Characterizat ion of the interact ions between mammalian PAZ14

PIWI domain proteins and Dicer. EMBO Rep. 5:189-194.15

76. Theodore, T. S., G. Englund, A. Buckler-White, C. E. Buckler, M. A. Martin,16

and K. W. Peden. 1996. Const ruct ion and characterizat ion of a stable ful l-17

lengt h macrophage- t ropic HIV t ype 1 molecular clone t hat direct s t he18

product ion of high t it ers of progeny virions. AIDS Res. Hum. Ret roviruses.19

12:191-194.20

77. Westerhout, E. M., M. Ooms, M. Vink, A. T. Das, and B. Berkhout. 2005. HIV-121

can escape f rom RNA interference by evolving an alternat ive st ructure in it s22

RNA genome. Nuc. Acids Res. 33:796-804.23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


78. Yeung, M. L. , Y. Bennasser, S. Y. Le, and K. T. Jeang. 2005. siRNA, miRNA1

and HIV: promises and challenges. Cell. Res. 15:935-946.2

79. Yoshinari, K., M. Miyagishi, and K. Taira. 2004. Ef fects on RNAi of the t ight3

st ruct ure, sequence and posit ion of t he t arget ed region. Nuc. Acids Res.4

32:691-699.5

80. Zamore, P. D., and B. Haley. 2005. Ribo-gnome: the big world of small RNAs.6

Science 309:1519-1524.7

81. Zhong, J., A. H. Peters, K. Lee, and R. E. Braun. 1999. A double-st randed RNA8

binding protein required for act ivat ion of repressed messages in mammalian9

germ cells. Nat . Genet . 22:171-174.10

11

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


FIGURE LEGEND1

2

Figure 1: siRNAs against TRBP decrease exogenous TRBP expression. A) Schematic3

representation of TRBP2 mRNA and location of the siRNAs. One µg of each siRNA4

was run on a 2% agarose gel and visual ized by ethidium bromide staining. MW5

indicat es DNA molecular weight markers. B) siRNAs against TRBP reduce the6

fluorescence of EGFP-TRBP. HeLa cells were co-t ransfected with 0.5 µg pEGFP-C1-7

TRBP2 and with 100 nM of siRNA NS, 567, 571 and 657 as indicated using FuGENE. 48h8

post -t ransfect ion cel ls were f ixed, mount ed and assayed for GFP expression by9

f luorescence. C) Titration of EGFP-TRBP by FACS after co-transfection with siRNAs.10

HeLa cells were co-t ransfected with 0.5 µg pEGFP-C1-TRBP2 and with 0 (black bar), 311

(white bars), 7 (grey bars), 14 (st riped bars) or 18 (dot ted black bars) nM of siRNA NS,12

GFP, 567, 571 and 657 as indicated using Lipofectamine. Reporter expression is13

calculated as the percentage of EGFP-TRBP2 expression in the absence of siRNA. This14

result is the average of six independent experiments ± SEM.15

16

Figure 2. siRNAs against TRBP decrease endogenous protein expression. A)17

Determination of TRBP mRNA stability. Jurkat cells were incubated with ActD (518

µg/ ml) for 1, 2, 4, 6, 8, 10 hrs. 5 µg of t otal RNA were reverse t ranscribed and19

subj ected t o PCR amplif icat ion wit h specif ic primers for TRBP and c-myc. PCR20

products were quant if ied by densitomet ric scanning of t he gel (Typhoon scanner).21

TRBP (open squares) and c-myc (sol id circles) mRNA levels were expressed as22

percentage of init ial value and plot ted against t ime after ActD t reatment . The results23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


are t he means of t wo separat e experiment s. B) siRNAs against TRBP decrease1

endogenous TRBPs. HeLa cells were t ransfected with 0 (lane 4), 20 (lanes 1,5), 402

(lanes 2,6) or 80 (lanes 3,7) nM of siRNA-NS, siRNA567, siRNA571 or siRNA657 as3

indicated using FuGENE. Cells were t ransfected with 0.5 µg pCDNA3-TRBP1 (lane 8) or4

pCDNA3-TRBP2 (lane 9). 200 (lanes 1-7) or 20 (lanes 8,9) µg of cell ext ract were5

resolved by SDS-PAGE, analyzed by immunoblot t ing with an ant ibody against TRBP and6

exposed for 1hr or against act in and exposed for 1 min. TRBP1 start codon is included7

within TRBP2 reading frame. This is a representat ive experiment of three that gave8

similar result s. C) siRNAs do not activate PKR. HeLa cells were t ransfected with 09

(lane 1) or 80 nM of siRNA-NS (lane 2) or siRNA571 (lane 3) using FuGENE. 200 µg of10

cell ext ract were resolved by SDS-PAGE, analyzed by immunoblot t ing with ant ibodies11

against phosphorylated PKR (top panel), PKR (middle panel) and act in (lower panel)12

and exposed for 1 min. This is a representat ive experiment of three that gave similar13

results.14

15

Figure 3: siRNAs against TRBP decrease the expression of the HIV-1 LTR. A) siRNAs16

against TAR and TRBP reduce HIV-1 LTR basal expression. HeLa cells were mock17

t ransfected (lane 1) or cot ransfected with 0.05 µg of LTR-Luc, and 80 nM of t he18

indicated siRNAs (lanes 2-6) using FuGENE. B) siRNAs against Tat, TAR and TRBP19

reduce HIV-1 LTR trans-activated expression. HeLa cells were mock t ransfected20

(lane 1) or cot ransfected with 0.05 µg of LTR-Luc (lanes 2-8), 0.01 µg of pCMV1-Tat21

and 80 nM of the indicated siRNAs (lanes 3-8) using FuGENE. Luciferase act ivit y is the22

rat io between the luciferase level in the presence of the siRNA versus NS normalized23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


to 100% for cel ls t ransfected wit h NS. Each value represent s t he average of 51

independent experiments ± SEM. A representat ive quant itat ive PCR on the luciferase2

gene is shown at the bot tom of each graph as a t ransfect ion cont rol.3

4

Figure 4: siRNAs against TRBP decrease HIV-1 production in transfected HeLa cells.5

A) HIV-1 RT activity in cell supernatants. HeLa cel ls were mock t ransfected or6

cot ransfected with 0.5 µg of pNL4-3 and 14 nM of siRNAs NS, Tat1c, 567, 571 or 657 as7

indicated using Lipofectamine in T25 f lask format . RT act ivit y was calculated by8

densit omet ry using the sof tware referred in methods. Each value represents t he9

average of 4 independent experiments normalized as a percentage of the siRNA-NS RT10

value ± SEM. B) HIV Protein expression in cell lysates. HeLa cells were t ransfected11

as above. 120 µg of cel l lysat es were resolved by SDS-PAGE and analyzed by12

immunoblot t ing with an ant ibody against HIV-1 and exposed for 15 min. C) Cellular13

protein expression in cell lysates. 200 µg of the above cell lysates were resolved by14

SDS-PAGE and analyzed by immunoblot t ing with ant ibodies against P-PKR, PKR, TRBP15

and act in successively. The blots were exposed for 10 min for P-PKR, 1 min for PKR16

and TRBP, and 10 sec for act in. The blots shown in B and C are representat ive data17

among 4 independent experiments.18

19

Figure 5: siRNAs against TRBP decrease production of various HIV strains in20

transfected HeLa cells. HeLa cells were cot ransfected with 0.5 µg of pNL4-3, and 1 µg21

each of pAD8, p89.6, pELI-1, pMAL-2 or pROD-10 and 14 nM of siRNAs NS or TRBP 57122

as indicated using Lipofectamine in a 6 well format . RT act ivit y was calculated as in23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


Fig. 4. Each value represents the average of 3 independent experiments normalized1

as a percentage of the NS siRNA RT value ± SEM.2

3

Figure 6: siRNAs against Dicer decrease HIV-1 production in transfected HeLa cells.4

A) siRNAs against Dicer decrease mRNA and protein levels. HeLa cells were mock5

t ransfected or t ransfected with 14 nM of siRNAs NS or 4, 8 or 14 nM siRNA Dicer as6

indicated using Lipofectamine. (Top) Semi-quant it at ive RT-PCR with primers t hat7

amplify Dicer or GAPDH mRNA as indicated. (Bottom) 200 µg of cell lysates were8

resolved by SDS-PAGE and analyzed by immunoblot t ing with ant ibodies against Dicer9

or act in as indicated. The blots were exposed for 10 min for Dicer and 10 sec for10

act in. B) HIV-1 RT activity in cell supernatants. HeLa cells were mock t ransfected or11

cot ransfected with 0.5 µg of pNL4-3 and 14 nM of siRNAs NS, Tat1c or 4, 8 or 14 nM12

siRNA Dicer as indicated using Lipofectamine in a 6 well format . RT act ivit y was13

calculat ed as in Fig. 4 and correct ed for t ransfect ion ef f iciency. Each value14

represents the average of 4 independent experiments normalized as a percentage of15

the NS siRNA RT value ± SEM.16

17

Figure 7: Effects of siRNAs against TRBP or Dicer on cell viability and RNAi. A)18

siRNAs do not affect cell viability. HeLa cells were t ransfected with no siRNA (lane19

1), 1.8 µg poly(I) • poly(C) (lane 2) or 14 nM of either siRNA NS (lanes 3,4), siRNA EGFP20

(lane 5) siRNA-Tat (lane 6), siRNA567 (lane 7), siRNA571 (lane 8) siRNA657 (lane 9), or21

siRNA-Dicer (lane 10). All siRNAs were generated from the Ambion siRNA const ruct ion22

kit , except NS2 and siRNA-Dicer, which were purchased from Qiagen. Cell viabil it y23

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


was assessed by FACS analysis of 7-AAD stained cells. The viable cell populat ion of the1

mock t ransfected cel ls was set at 100%. Each value represents t he average of 42

independent experiments ± SEM. B) miRNA biogenesis is impaired in HeLa cells3

t ransfected with siRNA567, siRNA571 or siRNA-Dicer . (Top) Schemat ic4

representat ion of the vector delivered EGFP pre-miRNA and the predicted st ructure of5

t he fully processed EGFP miRNA. The EGFP sense sequence is highlighted. (Bot tom)6

HeLa cells were cot ransfected with 0 (lane 1) or 2 µg EGFP pre-miRNA vector (lanes 2-7

5) and 14 nM of siRNA NS (lane 2) siRNA567 (lane 3), siRNA571 (lane 4) or siRNA-Dicer8

(lane 5) in 6 well plates. Expression of EGFP miRNA was determined by Northern blot9

and quant i f ied by densit omet ry. The resul t s represent t he average of t hree10

independent experiments ± SEM.11

12

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


Table 1 : Sequence of the siRNAs used in this study.1

2

Target : Sequence: Reference:

Non silencing (NS) 5' AAUUCUCCGAACGUGUCACGU 3' Qiagen

EGFP 5’ AAGGGCAUCGACUUCAAGGAG 3’ This manuscript

Tat (SF2) 5’ AACUGCUUGUAACAAUUGCUA 3’ (16)

Tat1c (NL4-3) 5’ AAGAGCUCAUCAGAACAGUCA 3’ This manuscript

TAR 5’ AGACCAGAUCUGAGCCUGGUU 3' (41)

TRBP567 5’ AAAGAAUUCACCAUGACCUGU 3’ This manuscript

TRBP571 5’ AAUUCACCAUGACCUGUCGAG 3' This manuscript

TRBP657 5’ AAAUGCUGCUUCGAGUGCACA 3’ This manuscript

Dicer 5’ ACTGCTTGAAGCAGCTCTGGA 3’ Qiagen; (40)

3

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/


Table 2 : HIV proviral plasmids targeted by siRNA571.1

2

Plasmid Clade Reference

pNL4-3 B (X4) (1)

pAD8 B (R5) (76)

p89.6 B (X4/R5) (18)

pELI-1 D (61)

pMAL2 A+D (61)

pROD-10 HIV-2 (68)

3

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

A

BsiRNA-NS siRNA567

siRNA571 siRNA657

1 567 6575' 3'

Coding sequence 3’ Untranslatedregion

5’ Untranslatedregion

571

Figure 1

C

siRNA: NS 567 571 657EGFP0

20

40

60

80

100

% E

GFP-

TRBP

exp

ress

ion

siRNA: NS 567 571 657

MW

50 -100 -

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

A 0 1 2 4 6 8 10 1 2 4 6 8 10Act. D EtOH

c-myc

TRBP

Time (h)

0

20

40

60

80

100

0 1 2 4 6 8 10Time (h) after Act. D treatment

c-mycTRBP

Perce

nt of

mRNA

rema

ining

C - NS 571P-PKR

Actin

PKR

siRNA

1 2 3

Figure 2

BsiRNA-NS TR

BP1TR

BP2siRNA567

TRBP2TRBP1

1 2 3 4 5 6 7 8 9

-

Actin

TRBP2TRBP1

siRNA571 siRNA657 TRBP1

TRBP2

1 2 3 4 5 6 7 8 9

-

Actin

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

A

0

20

40

60

80

100

Lucif

eras

e ac

tivity

(%)

- NS TAR 567 571 657siRNA:LTR-Luc: - + + + + +

1 2 3 4 5 6

Figure 3

B

0

20

406080

100

- NS Tat 567 571 657 TARsiRNA:

Lucif

eras

e ac

tivity

(%)

LTR-Luc:Tat:

- + + + + + +- - + + + + +

1 2 3 4 5 6 7 8++

NS

456 nt

456 nt

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

Figure 4

A

RT a

ctiv

ity (%

)

- NS Tat 567 571 657siRNA:pNL4-3: - + + + + +

1 2 3 4 5 6 0

20

40

60

80

100

siRNA:pNL4-3: - + + ++ +

-+- NS Tat 567 571 657

0 1 2 3 4 5 6

PKR

PKR-P

Actin

TRBPC

Bgp160env

p55gag

p39ma-ca

p24ca

250

98

64

50

36

Actin

siRNA:pNL4-3: - + + ++ +

-+- NS Tat 567 571 657

0 1 2 3 4 5 6 ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

Figure 5

0

20

40

60

80

100

pNL4-3 pAD8 p89.6 pELI-1 pMAL-2 pROD-10HIV-1 HIV-2

RT a

ctiv

ity (%

)

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

Figure 6

B

0

20

40

60

80

100

siRNA (nM):

RT a

ctiv

ity (%

)

NS Tat 4 8 14Dicer

pNL4-3: + + + + +1 2 3 4 5

A - NS 4 8 14siRNA (nM):Dicer

Actin

Dicer

1 2 3 4 5

DicermRNA

GAPDHmRNA

ACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

Figure 7

B

0

20

40

60

80

100

mock NS 567 571 DicersiRNA:

EGFP

miR

NA e

xpre

ssio

n (%

NS)

1 2 3 4 5

0 pI.pC NS NS2 EGFP Tat 567 571 657 DicerRNA:1 2 3 4 5 6 7 8 9 10

0

20

40

60

80

100

cell

viab

ility

(%)

siRNA

A

--| A ----- A GCG GGGCAUCGACUUCAAGGAGCU GUG A CGU CCCGUAGCUGAAGUUCCUCGG CAC GUU C GUAGA C

EGFPpre-miRNA

GGGCAUCGACUUCAAGGAGCUG UCCCCGUAGCUGAAGUUCCUCG

EGFPmiRNAACCEPTED

on Septem


.org/D

ownloaded from

http://jvi.asm.org/

1, aïcha daher2, kaitlin j. soye2,3, lisa b. frankel2,3...

Documents