1 enter the following micro-rna sequence into the box run mfold and look at the results mfold using...
TRANSCRIPT
![Page 1: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/1.jpg)
1
Enter the following Micro-RNA sequence into the box
Run MFold and look at the results
Using MFoldMFold to predict RNA secondary structure
http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form
GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC
![Page 2: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/2.jpg)
2
Constraint information
• Force bases 30-35 to be single stranded
• Is the result different?
![Page 3: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/3.jpg)
3
PSIPRED (Protein Structure Prediction Server)Secondary Structure Prediction
http://bioinf.cs.ucl.ac.uk/psipred/
1. Use the protein NP_360043.2. Paste the sequence without
the header line.3. Enter your UH email
address.4. Click the Predict button.5. View the results.
![Page 4: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/4.jpg)
4
Coil Beta Strand
Helix
![Page 5: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/5.jpg)
5
Coil
Beta StrandHelix
![Page 6: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/6.jpg)
3-D structures
![Page 7: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/7.jpg)
Retrieving and displaying a 3-D structure from PDB http://www.rcsb.org/pdb/
1. Enter the protein's name and click search2. View the protein with KiNG viewer3. Examine the information and links to
other databases
![Page 8: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/8.jpg)
8
![Page 9: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/9.jpg)
Protein visualization with FirstGlance in Jmol http://molvis.sdsc.edu/fgij/
![Page 10: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/10.jpg)
10
Secondary Structure Alpha Helices Beta strands Random coils
![Page 11: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/11.jpg)
MMDB
• NCBI's structure database is called MMDB (Molecular Modeling DataBase), and it is a subset of experimentally derived three-dimensional structures obtained from the Protein Data Bank (PDB) (excluding theoretical predictions)
• http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml
![Page 12: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/12.jpg)
VAST
• NCBI creates and maintains a database of structure alignments, called VAST, for all pairs of proteins from MMDB whose structures have some similar core regions. They are called “Structural neighbors”.
• http://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml
![Page 13: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/13.jpg)
Example
• Type "1D5R" in the query box and hit "Get." This brings up the MMDB summary page.
![Page 14: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/14.jpg)
14
![Page 15: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/15.jpg)
• The graphic is saying that the protein is composed of a single chain (A) that NCBI has parsed into two domains: the N-terminal domain 1, and C-terminal 2. Clicking on the top bar marked "Chain A" will bring up VAST neighbors based on the whole chain, while clicking on the colored regions marked "1" or "2" will show neighbors of these individual domains.
![Page 16: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/16.jpg)
16
![Page 17: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/17.jpg)
17
Click on the “1” domain to get proteins that consists of a similar structure like the PTPc domain
![Page 18: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/18.jpg)
Lets view the "3D Alignment” of 1D5R:A with 2BZL:A using the CE tool http://cl.sdsc.edu/ce.html
Crystal Structure Of The Human Protein Tyrosine Phosphatase N14 At 1.65 A Resolution
![Page 19: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/19.jpg)
19
![Page 20: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/20.jpg)
20
![Page 21: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/21.jpg)
21
The two sequences have a 20.7% sequence similarity. The root mean square deviation (RMSD) in terms of structural distance is 2.47. Now lets compare hemoglobin A (4HHB:A) and B (4HHB:B)?
![Page 22: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/22.jpg)
22
Hemoglobin A and B have a sequence similarity of 40.3 % and a root mean square deviation of 1.49.
![Page 23: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/23.jpg)
Tertiary structure prediction
• From ExPASy http://www.expasy.org/tools/, you can find links to many prediction servers:
![Page 24: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/24.jpg)
Tertiary structure prediction
• For example the HMMSTR/Rosetta server predicts protein structure from sequence (Ab initio).
![Page 25: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure](https://reader035.vdocument.in/reader035/viewer/2022062517/56649f055503460f94c1ab5d/html5/thumbnails/25.jpg)
Protein 3D structure predictionHMMSTR/Rosetta Web Server