1 regulation of itam positive receptors: role of il-12 and il - blood

1

Regulation of ITAM positive receptors: Role of IL-12 and IL-18

John R. Ortaldo, Robin Winkler-Pickett, Jon Wigginton, Meagan Horner, Earl W. Bere,

Anna T. Mason, Narayan Bhat, James Cherry, Michael Sanford, Deborah L. Hodge, and

Howard A. Young

From the Laboratory of Experimental Immunology, and Pediatric Oncology Branch, National

Cancer Institute-Center for Cancer Research, and SAIC Frederick, Frederick, MD 21702-1201

Correspondence should be addressed to Dr. Howard Young, , NCI-CCR, Bldg. 560, Rm. 31-93,

Frederick, MD 21702-1201, (301) 846-1323, Fax: (301) 846-1673, Email: [email protected]

The content of this publication does not necessarily reflect the views or policies of the Department

of Health and Human Services, nor does mention of trade names, commercial products, or

organizations imply endorsement by the U.S. Government.

This research was supported [in part] by the Intramural Research Program of the NIH, National

Cancer Institute, Center for Cancer Research.

Animal care was provided in accordance with the procedures outlined in the “Guide for the Care

and Use of Laboratory Animals” (National Institutes of Health Publication No. 86-23, 1985).

Blood First Edition Paper, prepublished online October 25, 2005; DOI 10.1182/blood-2005-04-1579

Copyright © 2005 American Society of Hematology

For personal use only.on April 11, 2019. by guest www.bloodjournal.orgFrom

http://www.bloodjournal.org/

http://www.bloodjournal.org/site/subscriptions/ToS.xhtml

2

Author Statement:

Designed experiments, analyzed data, and wrote manuscript: John R. Ortaldo and Howard A.

Young,

Provided new vital reagents: Jon Wigginton,

Performed the research: Robin Winkler-Pickett, Meagan Horner, Earl W. Bere, Anna T. Mason,

Narayan Bhat, James Cherry, Michael Sanford, and Deborah L. Hodge

The publisher or recipient acknowledges the right of the U.S. Government to retain a nonexclusive,

royalty-free license in and to any copyright covering the article.




3

Abstract

Our previous studies have identified mechanisms by which cytokine production,

blocked by Ly49G2 receptor crosslinking, can be overridden. In this manuscript, we have

analyzed the regulation of other ITAM positive receptor signaling on NK, NKT and T cells

and characterized the biochemical pathways involved in this signaling. Our studies

demonstrate that crosslinking of NKG2D and NK1.1 results in a synergistic NK IFN-γ

response when combined with IL-12 or IL-18. Examination of NKT and T cell responses

demonstrated that cross-linking of NKG2D and CD3 resulted in potent synergy when

combined with IL-12, and to a lesser degree with IL-18. We have now found that both the

p38 MAP kinase and the ERK dependent signal transduction pathways are required for the

synergistic response. Further mechanistic examination of the synergy indicated a potent

upregulation of total IFN-γ mRNA in both the nuclear and cytoplasmic compartment but

mRNA half-life was not affected. Fifteen minutes of IL-12 pretreatment was sufficient to

result in maximal synergistic activation indicating that the response of the cells to the IL-12

signal is rapid and immediate. Thus our data demonstrates that multiple convergent signals

maximize the innate immune response by triggering complimentary biochemical signaling

pathways.




4

Introduction

Murine NK cells express multiple Ly49 receptors 1-5 that either inhibit or activate NK cell

functions including cytolysis and cytokine secretion. A functionally similar family of molecules

exists on human NK cells, i.e. the killer cell immunoglobulin-like receptors (KIRs). The inhibitory

Ly49 receptors, (Ly49A, C, G and I), inhibit NK cell function upon binding of class I ligands on

target cells.6-8 These Ly49 inhibitory receptors as well as inhibitory KIRs contain cytoplasmic

immune receptor tyrosine-based inhibitory motifs (ITIMs) that are phosphorylated upon

stimulation, leading to the recruitment of SHP-1 phosphatase and attenuation of intracellular

signals. In contrast, the ITAM associated activating receptors, (e.g. Ly49D and Ly49H), mobilize

intracellular 2+Ca, induce cytokine mRNA and protein production and mediate reverse antibody

dependent cellular cytotoxicity (ADCC) in the presence of specific mAbs.9-12

Circulating NK cells expressing activating Ly49s also express co-receptor paired inhibitory

Ly49s. Thus effector cells that express the activating Ly49D receptor that binds H2-Dd as a ligand,

also co-express, at very high levels, the inhibitory Ly49G2 or Ly49A 13-15 receptors, that also bind

H2-Dd and inhibit the activating function. Based on this co-expression, engagement of activating

Ly49 NK receptors in vivo appears constantly at odds with inhibitory forces. Our previous studies

demonstrated that crosslinking of activating Ly49D murine NK cell receptors can potently

synergize with IL-12 for selective and synergistic production of IFN-γ, both in vitro and in vivo.

Importantly, IL-12 was the key signal needed for over-riding the inhibitory receptor blockade for

cytokine production.

Since there are numerous co-receptor systems in the T cell system that require two signals

to induce sufficient cellular activation, we postulated that other NK cell receptors may require two

positive signals to override the ever vigilant inhibitory receptor blockade. Thus, we sought to

examine a model where the secretory function of activating receptors in addition to the Ly49




5

family, might be triggered by co-receptor function. Furthermore, as reported here, we have now

characterized the biochemical pathways required for the expression of IFN-γ in response to

multiple, yet distinct, extracellular signals.

Materials and Methods

Reagents

Alpha (α) GalCer (KRN7000) was graciously provided by the Kirin Brewery Company, Limited,

Tokyo, Japan. The ceramide reagents were first dissolved in DMSO, then diluted in PBS

containing 0.5% Tween 20. Control diluent or PBS was used as a control for all studies. MAP

kinase inhibitors SB203580 (source) and U0126 (source) were used at a final concentration of

1uM.

Cell lines

The B cell lines (A20 and A20/CD1d generously provided by M. Kronenberg, La Jolla Inst., San

Diego, CA), were pretreated with various reagents for 30 minutes at 37°C, washed and mixed with

sorted populations, and supernatants were collected for analysis after specified culture time.

NK cell isolation

Liver NK cells were isolated from C57BL/6 (B6) mice as previously described.14 Liver

mononuclear cells were used either untreated (15-25% CD3-, NK1.1+) or after in vivo IL-2

treatment (35-70% CD3-, NK1.1+), followed by lineage depletion (with CD3, CD19 and CD24)

(>90% CD3-, NK1.1+) and/or after in vitro expansion with IL-2 (6000 IU/ml recombinant IL-2

(Chiron Corp., ) as previously described.16 In vivo IL-2 treatment was as previously described

using a plasmid containing the murine IL-2 gene.17




6

Antibodies used

The monoclonal antibodies 4E5 (Ly49D), 3D10 (Ly49H), and 3A10 (NKG2D) were

previously described 11 or were provided by Dr. Wayne Yokoyama (Washington University). Rat

IgG (Becton Dickinson/Pharmingen, San Jose, CA) was used as a control for flow cytometric and

functional studies. Rabbit F(ab’)2 anti-rat IgG was used as a crosslinking reagent. CD19 F or APC,

NK1.1-PE or APC, DX-5-PE and CD3,-PercP (Becton Dickinson/Pharmingen, San Jose, CA) as

well as 4E5-FITC were used for flow cytometric analysis.

Flow cytometry analysis (FCA)

Cells were stained as previously described 16 and analyzed on a either as FACSort or a LSR

flow cytometer (Becton Dickinson, San Jose, CA). Cells were directly stained using FITC-,

phycoerythrin (PE-), Per-CP- and APC-labeled primary abs. The BD™ CBA Phospho Flex Set

(Becton Dickinson, San Jose, CA) is a bead-based immunoassay measuring mouse signal regulated

kinases (p38, ERK1/2) was analyzed in denatured cell lysate samples.

Cytokine measurement

Cytokines were measured using IFN-γ and chemokine ELISA kits (R&D Systems,

Minneapolis, MN). Cell stimulations were performed at cell concentrations of 1-5x106 cells/ml.

Antibodies were added at a concentration of 1 :g/106 cells for 30 minutes at 4ΕC. Cells were then

washed and plated on 24-well Costar (Corning, NY) plates that were pre-coated with 2 :g/well

rabbit F(ab’)2 anti-rat IgG and blocked with media containing 10% fetal calf serum. Unless

otherwise stated, samples were collected after 5-6 hours incubation (37°C, 5% CO2) and were

measured in duplicate against the standard curve of the assay and reported as pg/ml. In all assays,

the standard deviation was less than 5 pg/ml.




7

Ribonuclease protection assay

The multiprobe RNAse Protection Assay (RPA) was performed utilizing the mck-1 or mck-

5 template set (Pharmingen, San Diego, CA). Total cellular RNA was extracted utilizing Trizol

(Life Technologies, Gaithersburg, MD) and 1-5 :g of total mRNA was hybridized with a 33-P UTP

labeled RNA probe (1 x 106 cpm/sample) prepared according to the manufacturer's directions

(Pharmingen, La Jolla, CA) using the Pharmingen RiboQuant In Vitro Transcription kit. Following

hybridization, the samples were treated with RNAse A and T1 according to the procedure provided

by Pharmingen. The RNAse was inactivated and precipitated utilizing a master cocktail containing

200 :l Ambion (Austin, TX) RNAse inactivation reagent, 50 :l ethanol, 5 :g yeast tRNA and 1 :l

Ambion GycoBlue co-precipitate per RNA sample. The samples were mixed well, incubated at -

70ΕC for 15 minutes and centrifuged at 14,000 rpm for 15 minutes at room temperature. The

pellets were suspended in 3 :l of Pharmingen sample buffer and subjected to polyacrylamide gel

electrophoresis as recommended by the manufacturer (Pharmingen).

Quantification of variant forms of Nkg2d mRNA

Specific forward and common reverse primers for quantification of short and long forms of Nkg2d

mRNA were designed using Primer Pick 3 program (http://frodo.wi.mit.edu/cgi-

bin/primer3/primer3_www.cgi.) from the published mRNA sequences for the long (Genbank

accession: AF054819) and short form (Genbank accession: AF030313) of Nkg2d mRNA. Nkg2d R

5' ctc gaa caa cga aca ttg ga 3’(R); Nkg2d long form specific L 5’gcattgattcgtgatcgaaa 3’ (L);

Nkg2d short form specific S 5’ acaagaaaca ggatctccct (S) [see supplemental Figure 1 for location of

the primers].




8

Generation of positive controls for real time PCR assays

For isolating the cDNA segment specific for the long form of the Nkg2d mRNA, the previously

published 18 forward primer (P2 primer: 5’caggaagcagaggcagattatctc) was used. Plasmid DNA

containing cDNA segments specific for the long and short form of the Nkg2d mRNA was isolated

as follows. Amplicons were isolated from RNA obtained from either spleen or IL-2 treated spleen.

cDNA were synthesized using the Superscript III kit from Invitrogen following the manufacturer’s

protocol using either oligodT or the Nkg2d R primer listed above. Amplicons were amplified by

PCR using P2/R and S/R primers using Advantage2 polymerase from BD Biosciences. PCR

conditions used were 94ΕC for 2 min, 30 cycles of 94ΕC for 30 seconds, 60ΕC for 30 seconds, and

72ΕC for 60 seconds and a final extension at 72ΕC for 7 minutes. Both cDNA fragments were

cloned into the Topo TA cloning vector (Invitrogen) and the cDNA inserts in the plasmid DNA

were verified by DNA sequencing (data not shown).

Real time PCR assays

For quantification of the variant form of Nkg2d mRNA, plasmid DNA isolated as described above

was used to generate a standard curve. The real-time PCR assays for Nkg2d plasmid DNA or

cDNA were carried out in 10 :l reactions using primers S/R and L/R primers, SYBR Green master

mix (Qiagen Inc.) and run on an ABI 7900 (Applied Biosystems, Inc., Foster City, CA, USA). PCR

conditions used were: 95ΕC for 15 minutes, 40 cycles of 95ΕC for 15 seconds, 60ΕC for 1 minute;

then a dissociation curve: 95ΕC for 15 seconds, 60ΕC for 15 seconds and then a 2% ramp rate to

95ΕC for 15 seconds. The standard, mouse glyceraldehyde-3-phosphate dehydrogenase (Gapd)

plasmid DNA, was purchased from Serologicals (Gaithersburg, MD, USA). The real-time PCR

assays for Gapd plasmid DNA were carried out in 10 :l reactions using the mouse Gapd control kit




9

(Applied Biosystems) and run on an ABI 7900. PCR conditions used were: 95ΕC for 15 minutes,

40 cycles of 95ΕC for 15 seconds, 60ΕC for 1 minute, then a dissociation curve: 95ΕC for 15

seconds, 60ΕC for 15 seconds and then a 2% ramp rate to 95ΕC for 15 seconds. Sensitivity and

linear dynamic range were checked on the serial dilutions (10 to 106 copies/reaction) of Nkg2d

short and long and Gapd plasmid DNA and found to be >.99% efficient with a slope of -3.6. The

Nkg2d short form of mRNA expression was normalized to the Gapd expression in multiplex and

quantified with its own standard curve, >.97% efficiency with a slope of -3Α8. Similarly Nkg2d

long form of mRNA had > .97% efficiency and a slope of -3.5.

Nuclear and cytoplasmic fractionation and RNA isolation

Approximately 5x107 NK cells were pelleted by centrifugation at 1200 rpm in a Sorvall H1000B

rotor, washed once in PBS, resuspended in 3 ml of homogenization buffer (15 mM Hepes, pH 7.4,

0.3 M sucrose, 60 mM KCl, 15 mM NaCl, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine, 0.5

mM spermidine, 1 mM phenylmethylsulfonylfluoride (PMSF) and 0.6% NP40) and lysed by

incubation on ice for 5 minutes. The homogenate was centrifuged at 800 X g for 5 minutes at 4°C.

The resulting pellet was washed twice in 2 ml of nuclei wash buffer (homogenization buffer

without detergent) and centrifuged at 800 X g for 5 minutes at 4°C and used immediately for

nuclear RNA isolation by addition of Trizol to the pellet. Cytoplasmic RNA extraction was

performed following cell lysis and centrifugation by addition of Trizol LS to the supernatant

fraction.




10

Results

ITAM contaning receptor- cytokine synergy

Based on our previous studies, we examined additional ITAM associated receptors present

on NK cells for their ability to synergize with cytokines following ligation. Utilizing both

untreated mouse liver NK cells or purified NK cells (after magnetic depletion of lineage positive

cells), specific receptor ligation was performed with antibodies specific for Ly49H and NKG2D.

Figures 1A and 1B demonstrate a representative experiment examining the mRNA expression and

secretion of IFN-γ, respectively, after crosslinking Ly49H with or without IL-12. Similar to what

has been observed with Ly49D, the DAP associated Ly49H receptor exhibited strong synergy for

IFN-γ mRNA and cytokine production compared to either cytokine or receptor crosslinking alone.

Next we examined the effects of crosslinking the DAP associated NKG2D after crosslinking with

NKG2D specific mAb 3D10 (Figure 1C and 1D). Unlike Ly49D and H, receptor crosslinking

NKG2D alone did not result in significant IFN-γ secretion unless IL-12 was added. Based on these

results, we examined the effects of crosslinking the TcR-associated receptor using the NKT rich

liver leukocytes, since the conical ITAM bearing receptor is CD3. We observed strong synergy for

IFN-γ cytokine production when the receptor was cross-linked in the presence of IL-12 compared

to either cytokine or receptor crosslinking alone (Figure 1E and 1F). Thus, with all classes of

ITAM bearing receptors examined, a potent co-stimulatory signal could be observed with IL-12

(Figure 1) or IL-18 (not shown). Furthermore, crosslinking of NK1.1 (linked to the signaling

chain, FcγR), also demonstrated similar synergy with IL-12 and IL-18 (not shown).




11

Figure 1. Synergy of IFN-γ induction by ITAM bearing receptors. Liver lymphocyte receptor




12

crosslinking was performed with anti-Ly49H (3D10; panel A, B); anti-NKG2D (3A10; panel C,

D); and anti-CD3 (500A2; panel E, F). The IFN-γ mRNA (panels A, C, E) and protein (panels B,

D, F) expression were evaluated at 1.5, 3 and/or 5 hours. RPA evaluation of IFN-γ mRNA was

normalized to control GAPDH. Values are representative of 3 experiments.

In vitro analysis of NKG2D gene expression in spleen and liver NK cells

As the association of the short form of NKG2D with DAP12 is critical for the triggering of

cytokine gene expression, we believe it is important to confirm the presence of sufficient short form

in the NK cells to support our data. Our results indicate that the short form of the Nkg2d mRNA

level increased by 5 and 19 fold in IL-2 treated spleen and liver NK- cells respectively, while the

long form of the Nkg2d mRNA increased by 3 and 10 fold respectively. Since DAP12 associates

with shorter form of Nkg2d, our data support the in vitro data that resting fresh liver NK cells

contain sufficient DAP12 associated NKG2D to exhibit synergy with IL-12 as measured by IFN-γ

production (see Supplemental Data)

Regulatory role of NKRs in cytokine gene expression

Our previous studies 17,19 demonstrated that IFN-γ was predominately induced by IL-12

when Ly49D was co-engaged. In order to examine whether IFN-γ might alter production or co-

stimulation of other cytokines upon NKR ligation, we performed the IL-12 co-stimulation in IFN-γ

deficient mice (GKO). The representative results of several experiments are shown in Figure 2. In

B6 mice, MIP1α and MIP1β were strongly increased by Ly49, NK1.1 and NKG2D crosslinking.

IL-10 mRNA was increased to a lesser degree while IL-13 mRNA was only weakly increased.

When GKO mice were evaluated, a strong TH2 bias was observed. NKRs strongly increased




13

MIP1α and MIP1β, whereas IL-10 and IL-13 had high basal levels of mRNA that were only

modestly increased by NKR ligation (Figure 2, panel A). Co-treatment with IL-12 did not

significantly alter the expression of any of these genes. When cytokine protein levels were

analyzed, the results indicated that IFN-γ does not alter the response of NK cells to receptor




14




15

Figure 2. IL-12 synergy in GKO mice. Lymphocytes were obtained from liver of untreated B6

mice and stimulated with the specific anti-NKRs. Cells were evaluated for IFN-γ mRNA (panel A)

and cytokine production of IL-13 and MIP1α in 3 hour supernatants (panels B-C. Values are

representative of 3 experiments.

crosslinking with respect to other chemokine/cytokine production (Figure 2; panel B&C) in either

the presence or absence of IL-12. Of possible interest is the strong synergy also observed in MIP1a

production when IL-12 is combined with cross-linking NKRs. This was not seen in the GKO

mouse and may indicate a role for IFN-γ in this synergy. This observation awaits further analysis.

Regulatory role of IL-12 in NKT cells

Since the liver is a rich source of NKT cells and our data with anti-CD3 crosslinking

indicated that TcR-ITAM ligation synergizes with IL-12, we examined the response of NKT cells

to co-stimulation. Ligation of the TCR receptor resulted in production of IFN-γ, TNFα, and IL-2

production (Figure 3; panel A). As expected, cytokine stimulation was rapid and direct, with

mRNA increases being observed by 1 hour and maximal by 3 hours followed by rapid protein

expression in culture supernatants. Similar to the NK cells, IL-12 synergy was only seen with

respect to IFN-γ expression (Figure 3, panel B), as TNFα (panel B), and IL-2 (panel C) expression

was not affected by the addition of IL-12 (Figure 3, panels B and D). Identical results were

obtained when primary NKT cells were stimulated with αgalactosyl ceramide (αGalCer) (Figure 3;

panel D) in the presence or absence of IL-12. Thus IL-12 appears to also be a key cytokine for

maximizing the response of NKT cells to cell surface receptor cross-linking.




16

Effects of IL-12 and IL-18 on the synergistic response

To further evaluate the synergistic response, we sought to determine if multiple interactions with

different co-stimulatory cytokines would result in even a greater response to NKR activation.

Therefore, a dosing checkerboard of IL-12 and IL-18 was added to NK cells either pretreated with

Figure 3. IL-12 synergy with TcR on NKT cells. Highly purified NKT cells were sorted from

untreated liver lymphocytes (CD3+, NK1.1+), then expanded for 4-5 days in IL-2. Cells were

evaluated for synergy as described above using anti-CD3. IFN-γ mRNA (panel A) or cytokines




17

TNFα, and IFN-γ (panel B) or IL-2 (panel C) were measured in 1 and 3 hours supernatants,

respectively in panels B-D. Values are representative of 3 experiments. In panel D, liver NKT

cells were obtained from untreated B6 mice and stimulated with the specific ligand αGalCer after

loading into a CD1d positive cell line A20. Cells were evaluated for synergy of cytokine

production with IL-12 and αGalCer at 3 hours. TNFα, IFN-γ or IL-2 was measured in 3 hour

supernatants. Values are representative of 3 experiments.

control IgG or anti-Ly49D (4E5) antibodies. As expected, IL-12 and IL-18 demonstrated potent

co-stimulation without NKR crosslinking for IFN-γ production in NK cells; however when doses of

IL-18 reached 0.1 ng/ml, limiting activation by IL-12 was observed at 1 and 0.1 ng/ml (Table 1 see

IFN-γ production in control IgG). However, when these same sub-optimal co-stimulating doses of

IL-12 and IL-18 were analyzed with NK cells stimulated through the Ly49D NKR, strong, near

maximal IFN-γ production was observed (29,000 and 25,200 pg/ml; bolded values) compared to

the 10 ng treatment results. Thus these physiological levels of IL-12 and IL-18 could sensitize NK

cells to produce a greatly enhanced response to ligation of NKRs.

Receptor crosslinking: Synergy other cytokines

With the recent emergence of other IL-12 family members, we sought to evaluate whether

IL-23 and IL-27 would result in similar co-stimulation as IL-12. Figure 4; panel A depicts a typical

result with these cytokines and crosslinking of Ly49D. Both IL-23 and IL-27 co-stimulated IFN-γ

production upon Ly49D ligation, but they were quantitatively less potent that IL-12. In contrast to

IL-12, the cytokines alone did not result in significant levels of IFN-γ (not shown). In addition, we




18

sought to determine if other cytokines that interacted with NK cells at the time of NKR ligation and

IL-12 interaction might alter subsequent synergy. Therefore, NK cells were pretreated with other

inflammatory cytokines such as IFN-α, IFN-∃, IFN-γ, IL-1, IL-10, IL-13 and TNFα. None of these

cytokines demonstrated a strong and consistent alteration in the ability of IL-12 to synergize with

NKR ligation for the production of IFN-γ (not shown) nor did they synergize with receptor

crosslinking when cytokine expression was analyzed.




19

Figure 4. IL-12, 23, 27 regulation of ITAM receptors. Panel A. IL-23 and IL-27 synergy of




20

IFN-γ induction by NK receptors. Enriched NK cells were evaluated for synergy with media, IL-

12, IL-23 and IL-27 by addition into the assay for 4 hours after pre-coating with anti-Ly49D (4E5).

Values are representative of 3 experiments. Panel B. Reversal of the dominant inhibitory signal

by IL-12. Highly enriched Ly49G2+ NK cells were expanded for 4 days with IL-2 after selection

by antibody coated magnetic beads. Cells were depleted of CD3, CD19 and CD24, then selected

into Ly49G2+ subsets. Cells were >95% Ly49G2+, 52% Ly49D+, 88% NKG2D+ and >95%

NK1.1+. NK cells were pre-coated with NKR antibodies, then crosslinked for 4 hours with or

without IL-12. Values are representative of 2 experiments. Panel C. In vivo evaluation of

NKG2D synergy with IL-12. B6 mice were injected intra-splenically with either Baf3 or Rae/γ

expressing Baf3 cells (5x105 cells). After 15 minutes, mice had their spleens surgically removed.

After 1 hour, mice were injected intra-peritoneally with 10 ng of IL-12 protein and serum was

collected for indicated times to 48 hours. Serum was evaluated for cytokine production using CBA

Th1/Th2 kit (Becton-Dickinson). Values represent mean and standard error (S.E.) with 5 mice per

group.

Inhibitory receptors and IL-12

Our previous studies 17 demonstrated that IL-12 can override the the ability of Ly49G2 to

inhibit Ly49D activator. Since Ly49G2+ NK cells also co-express NKG2D and NK1.1 in addition

to being 50-60% Ly49D+, we examined whether IL-12 could also co-regulate their inhibition. As

shown in Figure 4; panel B, the co-treatment with IL-12 strongly stimulated IFN-γ production

regardless of whether Ly49G2 was co-engaged. The co-engagement of Ly49G2 on cells not

treated with IL-12 demonstrated a 50-70% inhibition of IFN-γ production, regardless of which

activating receptor was crosslinked. Thus, the co-stimulation with IL-12 with activating receptors




21

results in the dimunition of the ability of multiple inhibitory receptors to attenuate the NK cell

cytokine response.

In vivo synergy

In order to determine if the synergy of IL-12 with the NKG2D NKRs examined in this study

occurred in vivo, B6 mice were injected intrasplenically (a route which results in rapid migration of

tumor cells to the liver; a rich environment for NK and NKT cells) with cells that did or did not

express Rae/γ, an NKG2D ligand and then injected with IL-12 protein As shown in Figure 4C,

when either the parent tumor line (Baf3), the Rae/γ expressing Baf3, or IL-12 was injected alone,

less than 10pg/ml of IFN-γ was detected in the serum. However, when Rae/@ expressing Baf3

cells were injected with IL-12, significant levels of IFN-γ were detected at 24 hours. These results

indicate that the in vivo response to the NKG2D receptor-ligand interaction can be significantly

enhanced upon exposure to IL-12.

Role of IL-12 in the synergistic response

The potent synergy that is observed in vitro and in vivo 17 for NKR activation and

production of cytokines suggests an important regulatory role for IL-12 in vivo. Therefore we

evaluated whether pretreatment of NK cells with IL-12 (Figure 5A) or IL-18 (not shown) would

result in subsequent synergy if NKRs were subsequently ligated. Cells were pretreated with IL-12

for 15 to 60 minutes at 37ΕC, stimulated on ice with anti-Ly49D (4E5), then evaluated for co-

stimulation of IFN-γ. As shown in Figure (5A), the pretreatment for as little at 15 minutes resulted

in near maximal production of IFN-γ at 4 hours compared to IL-12 being added during the assay.

Furthermore, the activation of phospho-STAT4 by IL-12 was similar in the presence or absence of




22

cross-linking (not shown). These results suggested that a brief encounter with co-stimulatory

cytokine in vivo is sufficient to result in potent subsequent synergy with NKRs. We next

determined how long the cells retained their sensitivity following IL-12 treatment as cells were

treated with IL-12 for 30 minutes, followed by delayed NKR crosslinking (Figure 5B). The results

demonstrated synergy with IL-12 was still observed even if NKR crosslinking was delayed 2-3

hours. However synergy was lost if crosslinking was delayed for 4-6 hours.




23

Figure 5. Pretreatment with IL-12 and response NKR activation. Panel A. Liver lymphocytes

were obtained from untreated liver cells from B6 mice. Cells were pre-treated with IL-12 at 37ΕC

for specified times. Cells were washed, chilled, then coated with anti-NKRs for 20 minutes. Cells

were then washed and cultured for 4 hours. Control (“In Assay”) had IL-12 added at time of assay

initiation and IL-12 remained in assay for 4 hours. Panel B. Delayed NKR activation. Liver




24

enriched NK cells (>90% NK1.1+) were pretreated at 37ΕC with IL-12, then held for specified

times, where the cells were coated with anti-Ly49D or anti-NKG2D at 4ΕC for 15 minutes, then

washed and cross-linked on plastic dishes coated with anti-rat or anti-hamster secondary antibodies.

Supernatants were collected at 4-5 hours.

We next investigated the role of STAT4 in the synergistic response by comparing the response in

BALB/c WT and STAT4 KO mice using NKRs; NKG2D and Ly49L (Data not shown). All

synergy whether between IL-2 and IL-12 or NKR and IL-12, was ablated in cells from the STAT4

KO mice demonstrating the obligatory role for STAT4 in priming the cells for a maximal response

to NKR cross-linking.

Effects on IFN-γ mRNA

To investigate whether a possible mechanism for the observed synergy was stabilization of the

IFN-γ mRNA, we analyzed mRNA half-life following the treatments alone or in combination

(Figure 6A). With all three treatments (NKR, IL-12 and combination) the half-life of IFN-γ mRNA

was between 1-2 hours indicating that the increased production of IFN-γ was not due to effects on

mRNA stability. Previous studies from our laboratory have demonstrated that IL-12 causes an

accumulation of IFN-γ unprocessed mRNA in the nucleus that is processed and driven out of the

nucleus by co-stimulation with IL-2. Using this model and probes that uniquely recognized

unprocessed mRNA (detecting intron-exon boundries), we examined the effects of co-stimulation

on IFN-γ mRNA processing and cellular compartmentalization. The results (Figure 6B; suppl.

Figure 2) indicated that IL-12 plus Ly49D stimulation resulted in a synergistic increase in




25

cytoplasmic IFN-γ mRNA with a 10-25 fold increase over that observed in untreated cells. The

examination of nuclear RNA indicated that similar and parallel increases in both Exon3-Intron3

and Exon1-Intron1 and Exon3 and Exon1 containing RNAs occurred, demonstrating that IL-12

plus Ly49D treatment increased nuclear accumulation of both unprocessed and processed forms of




26

Figure 6. Evaluation of mRNA for IFN-γ. In panel A IFN-γ message was analyzed. Liver

enriched NK cells (>90% NK1.1+) were coated with anti-Ly49D at 4ΕC for 15 minutes, washed,

then pretreated at 37ΕC with IL-12. Cells were washed and actinomycin D was added and cell

lysates were evaluated for IFN-γ mRNA. Values are expressed relative to mRNA level at 30

minutes prior to actinomycin D addition (100%) and were derived from digital evaluation of RPA

for IFN-γ+ relative to L32 control RNA. Values are representative of 2 experiments.

In panel B, nuclear versus cytoplasmic mRNA for IFNγ was analyzed. NK cells were lysed

and fractionated as described in materials and methods. RPA was performed on nuclear and

cytoplasmic RNAs using [33P]UTP labeled exon 1-intron 1 (E1-I1), exon 3-intron 3 (E3-I3), and

L32 rRNA riboprobes. The exon-intron probes hybridize and protect unspliced nuclear IFN-γ pre-

mRNA whereas the exon portion of the exon-intron probes recognize only the spliced form of the

IFN-γ mRNA in both the nucleus and cytoplasm. L32 was used as a control for RNA input

between samples. (Results from a representative RPA are shown in supplemental Figure 2.) Lanes

from left to right represent the following: nontreated (NT), LY49D crosslinked (49D), IL-12

activated (IL-12), and LY49D plus IL-12 (D/12) co-activated NK cells. Graphical representation

of the quantitation performed by ImageQuaNT analysis on the image shown in Figure 6B. The

normalized mRNA values correspond to the accumulation of exon-intron and exon only IFN-γ

mRNA relative to L32 mRNA in the nuclear (top) and cytoplasmic (bottom) compartments.

the IFN-γ mRNA. Additionally, nucleocytoplasmic transport of the IFN-γ mRNA was not altered

as similar increases in both nuclear and cytoplasmic accumulation of IFN-γ mRNA was observed

following IL-12 plus Ly49D treatment.




27

Analysis of the biochemical pathways involved in the synergistic response

Since previous studies have shown an important role for p38 in the IL-12 signaling pathway, we

sought to examine to potential addition role for erk (p42/p44) in the synergistic responses. Several

recent studies20-23 have shown a direct role for DAP12 signaling via PLCγ and Erk. NK cells were

stimulated with control Ig, anti-Ly49D with or without IL-12 and phospho-Erk and p38 were

analyzed by flow cytometry. As expected IL12 alone markedly increased p38 (shown at 20

minutes; Figure 7A) and marginally increased phospho-Erk (shown at 30 minutes). However,

increased phospho-Erk and p38 is observed upon antibody crosslinking and the levels of these

phosphoproteins are increased and sustained upon addition of IL12 (Figure 7; panel B). Similar

results were seen with NKG2D, except that antibody alone was minimally activating for phospho-

Erk (data not shown). This result is consistent with our observation that NKG2D cross linking by

itself was not sufficient for production of IFN-γ. To directly test if the synergistic response was

due to the activation of both signal transduction pathways, we analyzed the effects of p38 and Erk

inhibitors on the combined treatments. As shown in Figure 7C, the synergistic response between

NKR crosslinking and IL12 was completely abrogated by blocking both MAP kinases whereas

either inhibitor alone had only partial effects. As expected, the response to IL12 alone was blocked

by p38 inhibitors. Collectively these data indicate that synergy between the MAP kinases p38 and

Erk is essential for the NKR synergy with IL12.




28




29

Figure 7. Analysis of MAP kinases. NK cells stimulated through their NKRs in the presence or

absence of IL-12 are shown. Panel A utilizes a flow cytometric analysis of phospho-Erk or p38

when cells were unstimulated (shaded histogram) or stimulated through Ly49D alone (dotted

histogram) or with IL12 (heavy line histogram). Panel B examines the kinetic changes in phospho-

Erk and –p38 in cells stimulated with IL12 only ( ); with anti-Ly49D ( ) alone or in

combination with IL12 ( ). Panel C examines the IFN-γ production from fresh liver NK cells at

16hrs after stimulation with IL12, NKRs or their combinations. Cells were stimulated after no

treatment (NT; solid bar), in the presence of the p38 inhibitor (SB203580;cross-hatched bar ) ; the

erk inhibitor (U0126; hatched bar) or both (shaded bar).

Discussion

Our previous studies with NK cells demonstrated that co-stimulation of ITAM bearing

Ly49D and IL-12 resulted in an override of inhibitory signals when cells expressing both inhibitory

and activating receptors are presented with ligand. This synergy is mediated by and dependent

upon Ly49D-expressing NK cells and resulted in significant systemic expression of IFN-γ. Thus

triggering of the activating Ly-49 receptors initiates microbial, antiviral, and antitumor immunity

and simultaneous treatment with IL-12 provides a mechanism for the release of activating Ly49

receptors from the inhibitory receptor blockade.17 These results have important implications in the

biology of NK cells and their receptors, since small amounts of inflammatory cytokines like IL-12

could result in in vivo activation of activating Ly49D receptors when occurring in an inflammatory

environment.

In the present study, we demonstrate that other innate and adaptive cells that express ITAM

bearing receptors also respond to IL-12 through enhanced expression of IFN-γ. In NK cells, we

demonstrate here that Ly49H (a DAP12 associated receptor), NKRp1, (a TcRζ associated

receptor), NKG2D, (a DAP10 and DAP12 associated receptor) demonstrated potent synergy with




30

IL-12 and IL-18 in the induction of IFN-γ both alone and in the presence of an inhibitory ITIM

signal. In addition, we have found that co-stimulation with IL-12 results in greatly enhanced IFN-γ

production upon cross-linking of T cells and NKT cells with CD3 (a TcRζ associated receptor) or

αGalCer). The IL-12 signaling is STAT4 dependent and does result in much higher levels of total

IFN-γ mRNA. However we did not observe either an increase in the IFN-γ mRNA half-life or

transport of the mRNA from the nucleus to the cytoplasm. Another interesting aspect of this

synergy is the restricted association to expression of the Th1 cytokine, IFN-γ. IFN-γ-KO mice

demonstrated only a minimal co-stimulation response with respect to IL-13 and MIP1α expression

when activating NKRs were crosslinked. Similarly with T cells, the cellular response to IL-12 co-

stimulation was restricted to IFN-γ and was not observed for TNFα or IL-2. Furthermore our data

demonstrates that the synergy observed requires activation through both the p38 and Erk pathways

and demonstrates how these pathways converge at a single point, i.e. enhanced expression of the

IFN-γ gene.

The synergy observed with NKG2D, previously reported to be a DAP10 associated

receptor9,18 in primary NK cells, could be attributed to a low frequency of DAP12 associated

NKG2D receptors. This is an important point and as a result of our analysis we determined that the

reported methods to analyze expression of the mRNA of these two forms was confusing18. As

demonstrated in the supplemental data, the in vivo activation of NK cells with IL-2 resulted in a

dramatic shift in DAP12 association of NKG2D consistent with previous reports18. Thus the

expression of IFN-γ in response to NKG2D crosslinking is dependent upon association with

DAP12,

We believe that our data reflects conditions that are very relevant to the in vivo host

response as only a short (15 minutes) pretreatment with IL-12 can result in maximal activation of




31

the synergy with cross-linking of the ITAM bearing receptors. This data indicates that new protein

synthesis is not required following IL-12 treatment and that post transcriptional modifications of

proteins, including transcription factors, may be a result of the brief IL-12 treatment. This may

result in enhanced recruitment of AP-1 to the IFN-γ promoter as has been reported in in vitro

models24. Consistent with this model is the fact that Ly49 cross-linking does result in increased

AP-1 activity (McVicar DW – personal communication). In addition, NKR activation kinetics

(Figure 5B) indicated that once lymphocytes were activated with IL-12, they remain sensitive to

cross-linking for up to 3 hours. This has important in vivo implications since cells that are in an

inflammatory environment can receive co-stimulation in a number of ways, but the outcome would

be release from inhibitory signals as long as both cytokine and ITAM receptor signals are received

in a proximal time frame. Secondly, our demonstration that multiple combinations of IL-12, IL-18

and ITAM receptor signal experiments can result in an optimal response when utilizing picogram

levels of cytokines, reflects the in vivo condition where IL-12 and IL-18 might be simultaneously

or sequentially released from effector cells such as macrophages. Finally, the in vivo experiments

with tumor cells expressing Rae/γ substantiate our in vitro data and indicate that synergy with

cytokines like IL-12 can occur in inflammatory in vivo environments.

These studies have provided novel results regarding the in vivo function of all potential

ITAM bearing receptors. These data support the contention that the in vivo regulation of inhibitory

and activating receptors occurs not only in NK cells but also in T cells and NKT cells and can be

co-regulated by stimulation with inflammatory cytokines including, IL-12, IL-23, IL-27 and IL-18.

These results are consistent with a model whereby the immune systems ability to regulate innate

and adaptive responses is to maximize the IFN-γ response when multiple “warning” signals are

received in inflammatory sites.




32

Acknowledgment: The authors would like to thank Tim Back, John Wine, and Erin Lincoln for

their support in animal care and experimentation. The authors thank Jeff Subleski for his assistance

in the generation of mouse specific RPA probes for IFN-( .




33

References

1. Leibson PJ. MHC-recognizing receptors: they're not just for T cells anymore. Immunity.

1995;3:5-8.

2. Yokoyama WM. Natural killer cell receptors. Curr Opin Immunol. 1995;7:110-120.

3. Long EO, Colonna M, Lanier LL. Inhibitory MHC class I receptors on NK and T cells: a

standard nomenclature. Immunol Today. 1996;17:100.

4. Long EO, Burshtyn DN, Clark WP et al. Killer cell inhibitory receptors: diversity,

specificity, and function. Immunol Rev. 1997;155:135-144.

5. Takei F, Brennan J, Mager DL. The Ly-49 family: genes, proteins, and recognition of class

I MHC. Immunol Rev. 1998;155:67-77.

6. Raulet DH, Correa I, Corral L, Dorfman J, Wu MF. Inhibitory effects of class I molecules

on murine NK cells: speculations on function, specificity and self-tolerance. Semin

Immunol. 1995;7:103-107.

7. Mason LH, Gosselin P, Anderson SK et al. Differential tyrosine phosphorylation of

inhibitory versus activating Ly-49 receptor proteins and their recruitment of SHP-1

phosphatase. J Immunol. 1997;159:4187-4196.

8. Ortaldo J, McVicar DW. Murine NK receptors: Ly-49 expression, function and intracellular

signaling. In: Sitkovsky MV, Henkart PA, eds. Cytotoxic Cells: Basic Mechanisms and

Medical Applications. Lippincott, Williams and Wilkins; 1999:45-63.




34

9. Lanier LL. NK cell receptors. Annu Rev Immunol. 1998;16:359-393.

10. Mason LH, Anderson SK, Yokoyama WM et al. The Ly-49D receptor activates murine

natural killer cells. J Exp Med. 1996;184:2119-2128.

11. Mason LH, Willette-Brown J, Anderson SK et al. Cutting Edge: Characterization of an

associated 16-kDa tyrosine phosphoprotein required for Ly-49D signal transduction. J

Immunol. 1998;160:4148-4152.

12. Smith KA, Wu J, Bakker ABH, Phillips JH, Lanier LL. Ly49D and Ly49H associate with

mouse DAP12 and form activating receptors. J Immunol. 1998;161:7-10.

13. George TC, Mason LH, Ortaldo JR, Kumar V, Bennett M. Positive recognition of MHC

class I molecules by the Ly49D receptor of murine NK cells. J Immunol. 1999;162:2035-

2043.

14. Ortaldo JR, Winkler-Pickett R, Willette-Brown J et al. Structure/function relationship of

activating Ly-49D and inhibitory Ly- 49G2 NK receptors. J Immunol. 1999;163:5269-5277.

15. Ortaldo JR, Winkler-Pickett R, Wiegand G. Activating Ly-49D NK receptors: expression

and function in relation to ontogeny and Ly-49 inhibitor receptors. J Leukoc Biol.

2000;68:748-756.

16. Ortaldo JR, Winkler-Pickett R, Mason AT, Mason LH. The Ly-49 family: regulation of

cytotoxicity and cytokine production in murine CD3+ cells. J Immunol. 1998;160:1158-

1165.




35

17. Ortaldo JR, Young HA. Expression of IFN-gamma upon triggering of activating Ly49D NK

receptors in vitro and in vivo: costimulation with IL-12 or IL-18 overrides inhibitory

receptors. J Immunol. 2003;170:1763-1769.

18. Diefenbach A, Tomasello E, Lucas M et al. Selective associations with signaling proteins

determine stimulatory versus costimulatory activity of NKG2D. Nat Immunol.

2002;3:1142-1149.

19. Ortaldo JR, Mason LH, Gregorio TA, Stoll J, Winkler-Pickett RT. The Ly-49 family:

regulation of cytokine production in murine NK cells. J Leukoc Biol. 1997;62:381-388.

20. Snyder MR, Nakajima T, Leibson PJ, Weyand CM, Goronzy JJ. Stimulatory killer Ig-like

receptors modulate T cell activation through DAP12-dependent and DAP12-independent

mechanisms.J Immunol. 2004 Sep 15;173(6):3725-31.

21. Snyder MR, Lucas M, Vivier E, Weyand CM, Goronzy JJ. Selective activation of the c-Jun

NH2-terminal protein kinase signaling pathway by stimulatory KIR in the absence of

KARAP/DAP12 in CD4+ T cells. J Exp Med. 2003 Feb 17;197(4):437-49.

22. Jiang K, Zhong B, Gilvary DL, Corliss BC, Vivier E, Hong-Geller E, Wei S, Djeu JY.

Syk regulation of phosphoinositide 3-kinase-dependent NK cell function. J Immunol. 2002

Apr 1;168(7):3155-64.

23. McVicar DW, Taylor LS, Gosselin P, Willette-Brown J, Mikhael AI, Geahlen RL,

Nakamura MC, Linnemeyer P, Seaman WE, Anderson SK, Ortaldo JR, Mason LH.




36

DAP12-mediated signal transduction in natural killer cells. A dominant role for the Syk

protein-tyrosine kinase. J Biol Chem. 1998 Dec 4;273(49):32934-42.

24. Park WR, Nakahira M, Sugimoto N, Bian Y, Yashiro-Ohtani Y, Zhou XY, Yang YF,

Hamaoka T, Fujiwara H. A mechanism underlying STAT4-mediated up-regulation of IFN-

gamma induction inTCR-triggered T cells Int Immunol. 2004 Feb;16(2):295-302.




37

Table 1. Combinatorial synergy between Ly49D receptor, IL-12 and IL-18

Control IgG Pretreatment* Anti-Ly49D (4E5) Pretreatment IL-18 Dose [ng/ml] IL-18 Dose [ng/ml]

IL-12 0 10 1 0.1 0 10 1 0.1

Dose[ng/ml]____________________________________________________________________________

0 2 16 15 6.4 22 1244 127.8 56.9

10 2 19900 21300 20300 1544 31400 34300 34500

1 8 18400 23100 2364 104 32900 30100 **29000

0.1 12 17400 18900 0 23 27300 27700 25200

Difference from control IgG

0 20 1228 113 51

10 1542 11500 13000 14200

1 96 14500 7000 26636

0.1 12 9900 8800 25200_____________________________________________________________________________________

For personal use only.

on April 11, 2019.

by guest

ww

w.bloodjournal.org

From



38

* Liver lymphocytes were obtained from untreated B6 mice, pre-treated with IL-12 or IL-18 at specified

doses at 37ΕC for 30 minutes. Cells were washed, chilled, then coated with anti-NKRs for 20 minutes.

Cells were then washed and cultured for 4 hours.

** Bolded values represent dose combinations where strong synergy was observed

For personal use only.

on April 11, 2019.

by guest

ww

w.bloodjournal.org

From



39




doi:10.1182/blood-2005-04-1579Prepublished online October 25, 2005;

Narayan Bhat, James Cherry, Michael Sanford, Deborah L Hodge and Howard A YoungJohn R Ortaldo, Robin Winkler-Pickett, Jon Wigginton, Meagan Horner, Earl W Bere, Anna T Mason, Regulation of ITAM positive receptors: role of IL-12 and IL-18

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

digital object identifier (DOIs) and date of initial publication. indexed by PubMed from initial publication. Citations to Advance online articles must include final publication). Advance online articles are citable and establish publication priority; they areappeared in the paper journal (edited, typeset versions may be posted when available prior to Advance online articles have been peer reviewed and accepted for publication but have not yet

Copyright 2011 by The American Society of Hematology; all rights reserved.Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of


http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

http://www.bloodjournal.org/site/subscriptions/index.xhtml





1 regulation of itam positive receptors: role of il-12 and il - blood

Documents