1 short title: scyl2 genes play a role in plant cell growth · 2017/7/27 · 149 and 21 to 27%...

1

Short title: SCYL2 genes play a role in plant cell growth 1

2

Corresponding author(s) information: 3

4

Daniel P. Schachtman, Ph.D. 5

Professor and Director of Center for Biotechnology 6

University of Nebraska Lincoln 7

Department of Agronomy and Horticulture 8

Member of Center for Plant Science Innovation 9

Beadle Center E243, Lincoln, NE 68588 10

1-402-472-1448 (office) 11

1-314-799-2427 (cell) 12

E-mail address: [email protected] 13

14

Ji-Yul Jung, Ph.D. 15

Postdoctoral Researcher 16

Department of Plant Molecular Biology (DBMV) 17

University of Lausanne 18

UNIL–Sorge, Biophore Building 19

1015 Lausanne, Switzerland 20

41-21-692-4239 (office) 21

41-78-898-6322 (cell) 22

E-mail address: [email protected] 23

24

Plant Physiology Preview. Published on July 27, 2017, as DOI:10.1104/pp.17.00824

Copyright 2017 by the American Society of Plant Biologists

https://plantphysiol.orgDownloaded on January 25, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

https://plantphysiol.org

2

Article Title: 25

SCYL2 genes are involved in clathrin-mediated vesicle trafficking 26

and essential for plant growth 27

28

Ji-Yul Jung*, Dong Wook Lee, Stephen Beungtae Ryu, Inhwan Hwang, and Daniel P. 29

Schachtman* 30

31

Department of Plant Molecular Biology, University of Lausanne, Switzerland (J.J); Division 32

of Integrative Biosciences and Biotechnology, Pohang University of Science and 33

Technology, Pohang 790-784, Korea (D.W.L., I.H.); Plant Systems Engineering Research 34

Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806, 35

Korea (S.B.R.); Department of Agronomy and Horticulture, University of Nebraska Lincoln, 36

Lincoln, NE 68588, USA (D.P.S.) 37

38

One sentence summary: 39

Vesicle membrane-associated SCYL2 proteins are vital for plant development. 40

41

Footnotes 42

43

Author contributions: 44

J.J., D.P.S., D.W.L., S.B.R., and I.H. conceived and designed the experiments. J.J. and 45

D.W.L. performed the experiments. J.J. and D.W.L. analysed the data., J.J., D.P.S., .S.B.R, 46

and I.H. wrote the manuscript. 47

48

Funding information: 49

D.W.L and I.H. were supported by the Cooperative Research program for Agriculture 50

Science & Technology Development (Project No. 010953012016), Rural Development 51

Administration, Republic of Korea, S.B.R. was supported by grant (PJ01109103) from the 52

Next-Generation BioGreen 21 Program (SSAC), Korea Rural Development Administration. 53

54

Corresponding author emails: 55



3

*Address correspondence to: Ji-Yul Jung ([email protected]) and Daniel P. 56

Schachtman ([email protected]) 57

58

59



4

ABSTRACT 60

61

Protein transport between organelles is an essential process in all eukaryotic cells and is 62

mediated by the regulation of processes such as vesicle formation, transport, docking and 63

fusion. In animals, SCY1-Like2 (SCYL2) binds to clathrin and has been shown to play 64

roles in trans-Golgi network (TGN)-mediated clathrin coated vesicle (CCV) trafficking. Here 65

we demonstrate that SCYL2A and SCYL2B, which are Arabidopsis homologs of animal 66

SCYL2, are vital for plant cell growth and root hair development. Studies of the SCYL2 67

isoforms using multiple single or double loss of function alleles show that SCYL2B is 68

involved in root hair development and that SCYL2A and SCYL2B are essential for plant 69

growth and development and act redundantly in those processes. The quantitative RT-70

PCR and β-Glucuronidase (GUS)-aided promoter assay show that SCYL2A and SCYL2B 71

are differentially expressed in various tissues. We also show that SCYL2 proteins localize 72

to the Golgi, TGN, and pre-vacuolar compartment (PVC) and co-localize with clathrin 73

heavy chain1 (CHC1). Furthermore, bimolecular fluorescence complementation (BiFC) 74

and co-immunoprecipitation data show that SCYL2B interacts with CHC1 and two Soluble 75

NSF Attachment protein Receptors (SNAREs): Vesicle Transport through t-SNARE 76

Interaction11 (VTI11) and VTI12. Finally, we present evidence that the root hair tip 77

localization of Cellulose Synthase-Like D3 (CSLD3) is dependent on SCYL2B. These 78

findings suggest the role of SCYL2 genes in plant cell developmental processes via 79

clathrin-mediated vesicle membrane trafficking. 80

81

Keywords : Arabidopsis; clathrin-mediated vesicle trafficking; plant development; SCYL2, 82

83



5

INTRODUCTION 84

85

Vesicle-mediated protein transport between organelles is a fundamental process in all 86

eukaryotic cells. In many cases, newly synthesized proteins in the endoplasmic reticulum 87

(ER) are targeted to specific membranes where they function with optimal activity (Jurgens, 88

2004; Hwang and Robinson, 2009; Robinson and Neuhaus, 2016). Protein targeting 89

involves processes including the formation, transport, docking and fusion of vesicles. A 90

number of proteins such as coat proteins, ADP-ribosylation factor, and SNAREs are also 91

required for the regulation of the vesicle trafficking (Jurgens, 2004; Bassham and Blatt, 92

2008; Nielsen et al., 2008; Chen et al., 2011; Fan et al., 2015; Paez Valencia et al., 2016). 93

Depending on the species of coat proteins, vesicles can be classified into three 94

major types: coat protein-1 (COPI), coat protein-2 (COPII), and CCV. Among them, CCV is 95

formed by clathrin triskelia consisting of three clathrin heavy chains (CHCs) and three 96

clathrin light chains (CLCs). The Arabidopsis genome contains two CHC genes (CHC1 97

and CHC2) and three CLC genes (CLC1, CLC2, and CLC3) (Kitakura et al., 2011; Wang 98

et al., 2013; Paez Valencia et al., 2016). In plants CCV mediates protein trafficking from 99

the TGN to the multivesicular PVC, which fuses with the vacuole for the degradation of 100

proteins (Song et al., 2006; Hwang and Robinson, 2009; Park et al., 2013; Paez Valencia 101

et al., 2016; Robinson and Neuhaus, 2016). CCV is also known to be involved in the 102

endocytosis of proteins such as PIN-FORMED (PIN) auxin efflux carriers and 103

Brassinosteroid Insensitive1 (BRI1) receptor kinase at the plasma membrane (PM) 104

(Kitakura et al., 2011; Di Rubbo et al., 2013; Wang et al., 2013). Recently, a plant specific 105

TPLATE adaptor protein complex is shown to be essential for clathrin-mediated 106

endocytosis (Gadeyne et al., 2014; Wang et al., 2016). However, the CCV machinery in 107



6

plants is still poorly known when compared to the CCV components identified in animals 108

(Chen et al., 2011; Paez Valencia et al., 2016). 109

In animals, SCY1-LIKE 2 (SCYL2), which belongs to the SCY1-like gene family, 110

was identified as a component of the CCVs (Conner and Schmid, 2005). It was shown that 111

animal SCYL2 directly binds to both clathrin and Adaptor Protein-2 (AP2) which is an 112

adaptor protein (Conner and Schmid, 2005; Duwel and Ungewickell, 2006). SCYL2 has 113

been suggested to function as a kinase (Conner and Schmid 2005) and is found at the 114

Golgi, TGN, and endosomes in animal systems (Duwel and Ungewickell, 2006; Borner et 115

al., 2007). Moreover, SCYL2 selectively induces lysosomal degradation of Frizzled5 116

(Fzd5) which is a PM receptor involved in the Wnt signaling pathway (Terabayashi et al., 117

2009). It has also been reported that lysosomal hydrolase cathepsin D is mis-sorted in 118

SCYL2-depleted cells (Duwel and Ungewickell, 2006) and that knockdown of SCYL2 in 119

Xenopus tropicalis causes severe developmental defects (Borner et al., 2007). Recently, it 120

was shown that SCYL2 is a key regulator of neuronal function and survival in mouse brain 121

(Gingras et al., 2015; Pelletier, 2016). These data indicate that in animals SCYL2 functions 122

in clathrin-mediated vesicle trafficking between the TGN and the endosomal system with 123

an important role in cell developmental processes. 124

In this study, two Arabidopsis homologs, SCYL2A and SCYL2B, are shown to play 125

important roles in plant cell growth. SCYL2B is involved in root hair developmental 126

processes and both SCYL2A and SCYL2B are essential for plant growth and act 127

redundantly in certain developmental processes. GUS-aided promoter assay indicated that 128

SCYL2A and SCYL2B are differentially expressed in various tissues. Moreover, we found 129

that SCYL2B localizes at the Golgi, TGN, and PVC and interacts with CHC1 and two 130

SNAREs: VTI11 and VTI12. Finally, we show that SCYL2B co-localizes with SCYL2A and 131



7

CHC1 and is required for the tip localization of CSLD3 in root hairs. These data suggest 132

that the plant SCYL2 genes, new components of CCV trafficking in plants, play vital roles 133

in plant cell developmental processes. 134

135

136



8

RESULTS 137

138

SCYL2 is Conserved in Many Eukaryotes 139

140

In Arabidopsis, there are two SCYL2 genes: SCYL2A and SCYL2B which encode 913 and 141

909 amino acids, respectively. These two genes likely arose from a genome duplication, 142

as the two genes fall into two syntenic chromosomal regions (Supplemental Fig. S1; Plant 143

Genome Duplication Database, http://chibba.agtec.uga.edu/duplication/index/home; (Tang 144

et al., 2008)). Sequence alignment and phylogenetic analysis show that SCYL2 genes are 145

conserved in the genomes of many eukaryotes (Fig. 1, A and B). Comparison of amino 146

acid sequences of full-length Arabidopsis SCYL2 proteins revealed 57 to 83 % amino acid 147

identity to proteins in other plant species such as papaya, poplar, soybean, corn, and rice, 148

and 21 to 27% amino acid identity to the SCYL proteins in animal species such as human, 149

chimpanzee, dog, cow, mouse, rat, chicken, fruit fly, and mosquito (Fig. 1A). 150

151

SCYL2B Functions in Root Hair Development 152

153

To characterize the functions of SCYL2 genes in Arabidopsis, we identified several T-DNA 154

insertional mutant lines of SCYL2A and SCYL2B from Salk and Sail lines. Three scyl2a 155

alleles and four scyl2b alleles were obtained (Fig. 2). RT-PCR analysis confirmed the 156

absence of full-length transcripts of SCYL2A or SCYL2B in scyl2a or scyl2b alleles except 157

for scyl2b-2, which has a decreased amount of full-length transcripts due to the T-DNA 158

insertion of second intron in SCYL2B (Fig. 2, B and C). Four scyl2a scyl2b double mutants 159

were obtained from the crosses between scyl2a and scyl2b alleles (Fig. 2B) and RT-PCR 160



9

analysis showed that full-length transcripts of both SCYL2A and SCYL2B were absent in 161

all scyl2a scyl2b double mutants (Fig. 2C). 162

To investigate the possible role of SCYL2A and SCYL2B in plants, we analyzed 163

the phenotype of scyl2a, scyl2b, and scyl2a scyl2b double mutant alleles. Three days after 164

germination, the root hairs of scyl2b alleles and scyl2a scyl2b double mutants were shorter 165

than wild type (P < 0.05; Fig. 3, A and B left) and were as short as rhd2-4, which has been 166

shown to be a root hair defective mutant (P < 0.05; Fig. 3, A and B right). The scyl2b 167

alleles also had abnormal root hair phenotypes such as v shape, y shape, wavy shape, 168

and bulged shape (Fig. 3C). The percentage of aberrant root hairs per root was much 169

higher in scyl2b mutants than the wild type (P < 0.05; Fig. 3C). There were no defects of 170

root hairs in scyl2a alleles (Fig. 3, A and B). These data indicate that SCYL2B plays an 171

important role in polarized root hair growth. 172

173

SCYL2A and SCYL2B are Essential for Plant Growth 174

175

We further analyzed the phenotypes of roots and shoots in scyl2a, scyl2b, and scyl2a 176

scyl2b alleles. Ten days after germination scyl2a scyl2b double mutants had significantly 177

shorter primary roots and smaller shoots (P < 0.05; Fig. 4, A, B, and C) while scyl2a or 178

scyl2b single mutants had no difference in roots and shoots compared to wild type (Fig. 4, 179

A, B, and C). One month-old scyl2a scyl2b double mutants grown in soil showed a striking 180

tiny shoot phenotype (Fig. 4D). These data indicate that both SCYL2A and SCYL2B are 181

involved in plant growth and development and redundant in certain aspects of their 182

function. 183

184



10

SCYL2A and SCYL2B Expression Levels in Various Tissues 185

186

To determine in which developmental stages or tissues in Arabidopsis SCYL2A and 187

SCYL2B are highly expressed, we analyzed gene expression levels in various tissues of 188

seven day-old seedlings and one month-old plants. Quantitative RT-PCR analysis showed 189

that both SCYL2A and SCYL2B are co-expressed in all tissues tested such as roots, 190

rosette leaves, cauline leaves, stems, unopened flowers, opened flowers, and siliques (Fig. 191

5A) and that the expression of SCYL2B was about two- to three-fold higher compared to 192

that of SCYL2A (Fig. 5A). The expression level of both SCYL2A and SCYL2B was very 193

low in siliques (Fig. 5A). 194

To analyze the tissue specific expression pattern of SCYL2A and SCYL2B in 195

Arabidopsis, we monitored the GUS expression driven by the promoter of SCYL2A and 196

SCYL2B in transgenic plants. In plants carrying SCYL2Apromoter:GUS, GUS staining was 197

mainly detected in leaf mesophyll cells while very week GUS staining was seen in root 198

vascular tissues (Fig. 5B). In plants carrying SCYL2Bpromoter:GUS, strong GUS staining 199

was detected in both shoot and root vascular tissues, in root cap regions including 200

columella cells and lateral root caps, and also in some tissues of specialized cell types 201

such as trichomes, guard cells, and root hairs (Fig. 5B). 202

203

SCYL2B is Localized at The Golgi, TGN, and PVC. 204

205

To define the subcellular localization of SCYL2B in Arabidopsis, transgenic plants carrying 206

35S:YFP:SCYL2B were analyzed. YFP:SCYL2B was localized to the tips of growing root 207

hair cells (Fig. 6A and Supplemental Fig. S2). However, in mature root hairs where tip 208



11

growth was finished, the tip-localization pattern of YFP:SCYL2B disappeared (Fig. 6B and 209

Supplemental Fig. S2). In addition, YFP:SCYL2B appeared to be localized at some 210

aggregated endosomal structures (Fig. 6B). In animals, a clathrin-coated vesicle-211

associated kinase of 104 kDa (CVAK104), an Arabidopsis SCYL2A/B otholog, plays an 212

important role in vesicle trafficking and is localized at the Golgi, TGN and endosomes 213

(Duwel and Ungewickell, 2006; Borner et al., 2007). To determine subcellular localization 214

of SCYL2B, colocalization studies were performed using several fluorescent protein 215

markers for subcellular organelles such as the Golgi, TGN, PVC, PM, mitochondria, 216

plastids, and peroxisomes. In Arabidopsis leaf protoplasts and leaf epidermal cells, 217

YFP:SCYL2B was co-localized with markers for the Golgi, TGN, and PVC but not with 218

markers for mitochondria, plastids, peroxisomes, and PM (Fig. 6, Supplemental Fig. S3 219

and S4). The percentages of YFP:SCYL2B-positive spots overlapping with the Golgi, TGN, 220

and PVC organelle marker proteins were about 38%, 37%, and 26%, respectively 221

(Supplemental Table S1). The localization data of SCYL2B suggest that SCYL2B is 222

membrane localized and may be involved in vesicle membrane trafficking in plant cells. 223

224

SCYL2B Interacts with CHC1, VTI11, and VTI12. 225

226

In animals, SCYL2 acts as a component of CCVs and can interact with clathrin (Conner 227

and Schmid, 2005; Duwel and Ungewickell, 2006). To determine whether or not 228

Arabidopsis SCYL2 proteins can also bind to components of CCVs, we conducted a split 229

YFP-based bimolecular fluorescence complementation assay (BiFC). To make constructs 230

for BiFC, the N-terminal fragment of YFP (nYFP) was fused to the N-terminus of SCYL2B 231

and the C-terminal fragment of YFP (cYFP) was fused to the N-terminus of putative 232



12

SCYL2B binding candidates such as CHC1, VTI11, and VTI12. The nYFP:SCYL2B 233

construct was transiently co-expressed with cYFP fusion constructs mentioned above in 234

Nicotiana benthamiana leaf epidermal cells via agrobacterium infiltration. Clear YFP 235

fluorescence signal showing a punctate staining pattern was detected when 236

nYFP:SCYL2B was transiently co-transformed with cYFP:CHC1, cYFP:VTI11, or 237

cYFP:VTI12 (Fig. 7A). There was no YFP fluorescence signal when nYFP:SCYL2B was 238

transiently co-transformed with cYFP (Fig. 7A). Western blotting analysis using polyclonal 239

anti-GFP antibody showed that cYFP:CHC1, cYFP:VTI11, and cYFP:VTI12 were co-240

expressed well with nYFP:SCYL2B in the tobacco leaf cells (Supplemental Fig. S5). As 241

well as BiFC experiments, we also conducted co-immunoprecipitation experiments to 242

confirm the protein interaction of BiFC results. HA:CHC1, HA:VTI11, and HA:VTI12 were 243

transiently co-expressed with YFP and YFP:SCYL2B in tobacco leaf cells and then the 244

HA-tagged proteins were pulled down by anti-HA beads and probed by anti-GFP antibody. 245

YFP:SCYL2B was detected in the bound fraction of HA:CHC1, HA:VTI11, and HA:VTI12 246

whereas YFP alone was not (Fig. 7B and Supplemental Fig. S7) indicating that SCYL2B 247

interacts with CHC1, VTI11, and VTI12. We also tested the protein interaction by pulling 248

down YFP-tagged proteins first, followed by the detection of HA tagged proteins since 249

commercial anti-GFP beads called GFP-trap were also available. When YFP and 250

YFP:SCYL2B were immunoprecipitated by GFP-trap beads and then probed by anti-HA 251

antibody, HA:CHC1, HA:VTI11, and HA:VTI12 were detected in the bound fraction of 252

YFP:SCYL2B (Supplemental Fig. S6 and S7) confirming the protein interaction. However, 253

a weak signal of HA:VTI11 and HA:VTI12 was also detected in the bound fraction of YFP 254

alone despite thorough washing of beads indicating that VTI11 and VTI12 tend to bind 255

GFP-trap beads non-specifically (Supplemental Fig. S6 and S7). Taken together, these 256



13

data indicate that Arabidopsis SCYL2B interacts with a clathrin and two v-SNAREs: VTI11 257

and VTI12 in vivo. 258

259

SCYL2B Co-localizes with SCYL2A and CHC1 and is Required for Tip Localization of 260

CSLD3 in Root Hairs. 261

262

We determined the localization of SCYL2 proteins by tagging at the N- or C-terminus with 263

fluorescent proteins GFP and RFP. When N-terminal GFP tagged SCYL2B and C-terminal 264

RFP tagged SCYL2B were transiently co-expressed in tobacco leaf epidermal cells, there 265

was no difference in the localization of these proteins (Fig. 8A) suggesting that tagging 266

fluorescent proteins to SCYL2 proteins may not alter their subcellular localization. We also 267

compared the localization of GFP:SCYL2B with SCYL2A:RFP by coexpressing them in 268

tobacco cells and the results showed that there was no difference in their subcellular 269

localization (Fig. 8B). The co-localization of SCYL2A with SCYL2B suggests that SCYL2A 270

may act in a similar fashion as SCYL2B probably locating at Golgi, TGN, and PVC. 271

Since BiFC and co-immunoprecipitation data showed the interaction between 272

SCYL2B and CHC1, we also examined if they co-localize. We found that both SCYL2A 273

and SCYL2B co-localized well with CHC1 (Fig. 8, C and D) when they were co-expressed 274

transiently in tobacco leaf epidermal cells, supporting the notion that SCYL2 proteins are 275

involved in clathrin-mediated vesicle trafficking. 276

It was reported that the function of root hair tip-localized proteins such as RHO-277

RELATED PROTEIN FROM PLANTS 2 (ROP2), ROOT HAIR DEFECTIVE 2 (RHD2), 278

RAB GTPASE HOMOLOG A 4B (RABA4B), SYNTAXIN OF PLANTS 123 (SYP123), 279

PROLINE-RICH PROTEIN 3 (PRP3), and CSLD3 is important for the proper root hair tip 280



14

growth (Jones et al., 2002; Foreman et al., 2003; Preuss et al., 2004; Park et al., 2011; 281

Ichikawa et al., 2014; Rodriguez-Furlan et al., 2016). To understand the root hair tip 282

growth pathways in which SCYL2B functions, Col-0 and scyl2b mutants were transformed 283

with GFP fusion constructs including ROP2, RHD2, RABA4B, SYP123, PRP3, and CSLD3 284

genes whose expression is driven by EXPANSIN A7 (EXPA7) promoter, a root hair 285

specific promoter (Kim et al., 2006). Interestingly, the analysis of transgenic lines showed 286

that only CSLD3 is mislocalized in the root hairs of scyl2b mutants (Fig. 9 and 287

Supplemental Fig. S8) indicating that SCYL2B is important for mediating the tip 288

localization of CSLD3 proteins in root hairs. 289

290

291



15

DISCUSSION 292

293

SCYL2 is a member of the SCY1-Like protein family. SCY1 is a kinase-like protein 294

identified in Saccharomyces cerevisiae. In animals, there are three SCY1-LIKE genes: 295

SCYL1, SCYL2, and SCYL3. SCYL1 is the gene responsible for the neurodegenerative 296

mouse model mdf and plays important roles in COPI-mediated retrograde trafficking from 297

the Golgi to the ER and the regulation of the Golgi morphology (Burman et al., 2010). 298

SCYL2 is involved in the TGN-mediated CCV membrane trafficking. SCYL3 binds ezrin 299

which is a protein that mediates the interaction between transmembrane proteins and actin 300

and is implicated in regulating cell adhesion/migration complexes in migrating cells 301

(Sullivan et al., 2003). In plants there are othologs only for the animal SCYL1 and SCYL2. 302

In Arabidopsis, the gene which encodes AT2G40730 corresponds to the ortholog of animal 303

SCYL1 and two loci (AT1G22870 and AT1G71410) described in this study correspond to 304

the orthologs of animal SCYL2. 305

We showed that Arabidopsis SCYL2B localizes at the Golgi, TGN, and PVC and 306

co-localizes with SCYL2A and CHC1 (Fig. 6 and 8). Moreover, BiFC and co-307

immunoprecipitation assay showed that SCYL2B binds to CHC1 and two v-SNAREs: 308

VTI11 and VTI12 (Fig. 7). Interestingly, the analysis of SCYL2 protein sequence alignment 309

revealed a conserved clathrin binding motif (SLLDLL) at the very end of C-terminus on 310

both SCYL2A and SCYL2B (Lafer, 2002). However, based on BiFC analysis, it turned out 311

that this binding motif is not essential for the interaction between SCYL2B and CHC1 312

(Supplemental Fig. S9). For the co-immunoprecipitation experiments, we used YFP alone 313

as a negative control and YFP alone did not bind CHC, VTI11, and VTI12. Moreover, there 314



16

was no precipitation of SCYL2B in the control samples where HA-tagged proteins are 315

absent (Supplemental Fig. S7). We also had BiFC data showing that certain membrane 316

proteins such as adaptor proteins, which are involved in vesicle membrane trafficking, did 317

not interact with SCYL2B (Supplemental Fig. S10). These findings suggest that the 318

interaction between SCYL2B and proteins tested in this study is specific. 319

Our data showing SCYL2 localization and interaction indicate that Arabidopsis 320

SCYL2 proteins play a role in CCV-mediated membrane trafficking and also suggest that 321

plant SCYL2 may act in the similar manner as animal SCYL2. Animal SCYL2 is well 322

known to interact with clathrin. However, there is no report showing the interaction of 323

animal SCYL2 with SNAREs. Thus, our data showing the interaction of Arabidopsis 324

SCYL2B with two v-SNAREs are a novel finding. In animals, SCYL2 has been also 325

suggested to function as a SNARE adaptor (Hirst et al., 2015) due to the fact that there is 326

a long adaptor-like structure with a predicted coiled-coil domain at the C-terminus of 327

SCYL2 (Pelletier, 2016) and that knockdowns of animal SCYL2/CVAK104 result in 328

reduced levels of syntaxin 8 and vti1b associated with CCVs (Borner et al., 2007). These 329

findings along with our new data showing the interaction of AtSCYL2B with two v-SNAREs 330

suggest that plant SCYL2 may act as a SNARE adaptor in clathrin-mediated vesicle 331

trafficking. 332

In BiFC assays, a punctate staining pattern of YFP fluorescence was seen when 333

SCYL2B was transiently co-expressed with CHC1, VTI11, and VTI12 (Fig. 7A). Moreover, 334

a similar fluorescence pattern was observed in the co-localization studies with SCYL2 335

proteins and CHC1 (Fig. 8). Previously, it was shown that clathrin localizes at TGN and 336

PM (Blackbourn and Jackson, 1996; Dhonukshe et al., 2007; Fujimoto et al., 2010; Van 337

Damme et al., 2011) and that VTI11 localizes primarily to the TGN, with a minor portion 338



17

localized at PVC (Zheng et al., 1999; Bassham et al., 2000; Surpin et al., 2003). VTI12 is 339

also used as a TGN marker (Geldner et al., 2009). Likewise, the treatment of brefeldin A 340

(BFA) and wortmannin, endomembrane trafficking inhibitors (Hicks and Raikhel, 2010; 341

Mishev et al., 2013), induced the formation of BFA compartments and ring-like structures 342

of SCYL2B proteins (Supplemental Fig. S11). Based on the co-localization data and 343

chemical inhibitor assay, it is likely that SCYL2 proteins function with clathrin, VTI11, and 344

VTI12 mainly at TGN and/or PVC. 345

Since the localization of SCYL2 proteins was obtained by transient overexpression 346

in Arabidopsis and tobacco leaf epidermal cells, we cannot completely rule out the 347

possibility that the localization of endogenous SCYL2 could be different to that of 348

overexpressed proteins. However, we believe that the localization of SCYL2 based on 349

transient overexpression represents the actual localization of SCYL2 in the cell for the 350

following reasons. First, when SCYL2 was expressed in tobacco cells using the native 351

SCYL2B promoter or EXPA7 promoter, the localization pattern of SCYL2 was similar to 352

that of overexpressed SCYL2 (Supplemental Fig. S12). Second, the fact that animal 353

SCYL2 localizes to the Golgi, TGN and endosomes is also consistent with our findings 354

about SCYL2 localization. Lastly, the protein interaction and colocalization data showing 355

the functional relationship of SCYL2 proteins with CHC1, VTI11 and VTI12, which mainly 356

localize to the TGN and/or the PVC, also support our localization data. 357

We showed that the loss of function of SCYL2B leads to the formation of both 358

short root hairs and morphologically abnormal root hairs such as wavy hairs and branched 359

hairs (Fig. 3) indicating that SCYL2 is involved in both root hair elongation and polar tip 360

growth of root hairs. SCYL2B was located to the tips of growing root hair cells and the tip-361

localization pattern of SCYL2B disappeared in mature root hairs (Fig. 6A, 6B, and 362



18

Supplemental Fig. S2) providing further evidence for the role of SCYL2B in polar tip growth 363

of root hairs. Active membrane trafficking processes govern the polar tip growth of root 364

hairs by the regulation of endocytosis and exocytosis (Ishida et al., 2008; Lee and Yang, 365

2008). Based on the observation that SCYL2B localizes at the Golgi, TGN, and PVC (Fig. 366

6) and the fact that SCYL2B binds to and co-localizes with clathrin and SNAREs (Fig. 7 367

and 8), it is possible that SCYL2B is involved in CCV-mediated membrane trafficking in 368

polar tip growth of root hairs. In plants, the Golgi and TGN/EE play a critical role in the 369

trafficking of secretory, endocytic, and vacuolar vesicles and are also important for root 370

hair development (Hwang and Robinson, 2009). For example, RHD2, a NADPH oxidase 371

which produces ROS, is known to play an important role in root hair elongation. It was 372

shown that vesicle trafficking mediated by the Golgi and TGN/early endosomes (EE) is 373

essential for both PM targeting and function of RHD2 indicating that the proper function of 374

the Golgi and TGN/EE is important for root hair elongation (Takeda et al., 2008; Lam et al., 375

2009). The function of PVC is also known to be important for root hair tip growth. It was 376

shown that LY294002, a phosphatidylinositol 3-kinase (PI3K)-specific inhibitor, inhibits the 377

fusion of PVC/late endosomes with vacuoles leading to the significant reduction of root 378

hair length (Lee et al., 2008) supporting the role for PVC in root hair elongation. Thus, the 379

localization of SCYL2B on the Golgi, TGN, and PVC and its root hair phenotype also 380

support the roles of these endomembrane systems in the development of root hairs. 381

The localization of proteins essential for root hair tip growth indicated that SCYL2B 382

is not involved in the vesicle trafficking pathways for RHD2 and SYP123, which are 383

membrane proteins localized at the root hair tip. However, the mis-localization of CSLD3, a 384

membrane protein, in root hairs of scyl2b mutants showed that SCYL2B plays a role in the 385

vesicle trafficking pathway that mediates the PM localization of CSLD3 at the root hair tip. 386



19

Previously, it was reported that CSLD3 is localized at the Golgi, ER, and PM (Favery et al., 387

2001; Bernal et al., 2008; Zeng and Keegstra, 2008; Park et al., 2011) and it was 388

suggested that cellulose synthases (CesAs), CSLD3 homologs, may be trafficked to the 389

plasma membrane via the Golgi and TGN (Schneider et al., 2016). Taken together, these 390

findings suggest that SCYL2B may be involved in the Golgi/TGN-mediated 391

exocytosis/secretion of vesicles containing CSLD3. To determine whether SCYL2B 392

proteins are involved in endocytosis processes, we also performed uptake assay using an 393

endocytic tracer N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) 394

Hexatrienyl) Pyridinium Dibromide (FM4-64) in root hair cells of wild type and scyl2a 395

scyl2b double mutants and found no difference in FM4-64 uptake (Supplemental Fig. S13). 396

It was reported that FM4-64 uptake decreased only in chc2 mutants but not in chc1 397

mutants (Kitakura et al., 2011). Thus, it is unlikely that SCYL2 proteins, whose function 398

may be associated with CHC1 based on protein interaction studies, are involved in 399

endocytosis. Overall, based on both the subcellular localization and the binding 400

characteristics of SCYL2B proteins, we suggest that SCYL2B may act as a component of 401

clathrin-mediated vesicle membrane trafficking that regulates exocytosis/secretion 402

mediated by TGN/EE and PVC in the process of root hair tip growth. 403

We also showed that plant shoot and root growth is severely reduced in scyl2a 404

scyl2b double mutants while the only observable phenotype in the single mutants was a 405

root hair defect in scyl2b (Fig. 3 and 4). This indicates that SCYL2A and SCYL2B act 406

redundantly in most tissues and play a critical role in processes other than root hair 407

development such as plant cell growth. However, although the phenotypic data using 408

mutants indicate that there is some functional redundancy between SCYL2A and SCYL2B, 409

the GUS expression pattern suggests that the function of SCYL2A and SCYL2B is 410



20

somewhat specified to certain tissues. For example, based on GUS staining data, it seems 411

that SCYL2A has a dominant role in leaf mesophyll cells whereas SCYL2B has a dominant 412

role in vascular tissues and in certain specialized cell types such as trichomes, guard cells, 413

and root hairs where lipid membrane change occurs actively. Since GUS expression data 414

showed that SCYL2 proteins are expressed in root columella cells, trichomes, and guard 415

cells, we examined scyl2 mutants more carefully for the phenotype of these tissues and 416

found abnormal morphology of root columella cells only in scyl2a scyl2b double mutants 417

suggesting a role of SCYL2 proteins in the development of root columella cells 418

(Supplemental Fig. S14). No phenotypic difference is found in the cell types of guard cells 419

and trichomes (Data not shown). We also examined the shoot and root phenotypes of 420

several SCYL2B, HA-SCYL2B and YFP-SCYL2B overexpression lines and there were no 421

phenotypic differences in these lines when compared to WT (data not shown). 422

In animals, SCYL2 is also known as a clathrin-coated vesicle-associated kinase of 423

104 kDa (CVAK104) and has a putative Ser/Thr protein kinase domain at its N-terminus 424

(Conner and Schmid, 2005). However, animal and plant SCYL2 genes lack a number of 425

highly conserved catalytic residues within the putative kinase domain such as aspartic acid 426

which is essential in other kinases (Manning et al., 2002). It is still controversial whether or 427

not the SCYL2 has kinase activity. It was reported that in the presence of poly-L-lysine, 428

SCYL2 was able to autophosphorylate and to phosphorylate the β2-adaptin subunit of AP2 429

(Conner and Schmid, 2005) indicating that SCYL2 has an ability to phosphorylate some 430

proteins under certain circumstances. However, in another report, kinase activity was not 431

detected in immunoprecipitated or bacterially expressed SCYL2/CVAK104 (Duwel and 432

Ungewickell, 2006). We tried to express the several recombinant forms of Arabidopsis 433

SCYL2B with 6xHis- or GST- tags in E.coli to find out whether it had a kinase activity, but 434



21

failed to express the protein possibly due to the instability of the protein. In a systematic 435

comparison study using 1,019 Arabidopsis protein kinases, Arabidopsis SCYL2 genes 436

have been classified as unclustered kinases (Wang et al., 2003). It may be possible to 437

speculate that Arabidopsis SCYL2 proteins may be kinases that regulate membrane 438

trafficking by phosphorylating CCV components. More detailed studies such as phospho-439

proteomic approaches using mutant alleles and mutagenesis approaches of the putative 440

kinase domain will be required to demonstrate that SCYL2 is a protein kinase. 441

In conclusion, the data presented here provide evidence that SCYL2 genes play 442

an important role in plant cell growth and may be involved in clathrin-mediated vesicle 443

trafficking. Additional studies will be required to pinpoint the precise function of the SCYL2 444

genes. The identification of other binding partners of the SCYL2 proteins and investigation 445

about the possibility that SCYL2 proteins act as a kinase will be a next step towards 446

revealing the detailed roles of the SCYL2 genes in plant membrane trafficking and 447

developmental processes. 448

449



22

MATERIALS AND METHODS 450

451

Plant Materials and Growth Conditions 452

453

Arabidopsis plants used in this study were in the Columbia background. Seeds were 454

sterilized in 70% (v/v) ethanol and 0.05% (v/v) Triton X-100 and then planted on 10 cm-455

diameter sterile plates containing ammonium free complete nutrient agar medium (Jung et 456

al., 2009). After stratification of the seeds at 4°C for 2~3 days, the plates were transferred 457

to the growth chamber at 22°C with a 16-h daylength at 200 µmol·m–2s–1. Seedlings were 458

grown vertically. Three- to 10-day-old seedlings grown on plates were used throughout the 459

study. In addition, plants were also grown on soil under the same conditions. Unless 460

otherwise stated, all experiments in this study were repeated at least twice with similar 461

results. 462

463

Characterization of T-DNA Insertion Mutants and RT-PCR 464

465

T-DNA Insertional Salk and Sail lines were obtained from the ABRC stock center 466

(Columbus, Ohio). Homozygous Salk and Sail lines for scyl2a and scyl2b alleles were 467

isolated by PCR-based genotyping using the following primers: 5’-468

CAAACCACATGAAGCTCAGTATTC-3’ and 5’-GATTATCTAAAGCTGCTGAAGATGC-3’ for 469

scyl2a-1, 5’-CTCGATGGTCAGGTAATGCTTGATAC-3’ and 5’-470

GTTGGTACTGATGTCCGGTTCGATGACT-3’ for scyl2a-2, 5’-471

CAGGAAAATAGAGGAAAAAAGAGGAGTT-3’ and 5’-472



23

TCACAATAGATCTAACAAAGATGGCTGT-3’ for scyl2a-3, 5’- 473

GCATGTTATCCAAATTCCCAGCCTG-3’ and 5’-474

AACAAGTTGCAGAAAGAGAGAGAGGTG-3’ for scyl2b-1, 5’-475

GCGCTTGGTAATGTTGAGAATGTGG-3’ and 5’-AGTGGAACGATTGCATGTTATCCA-3’ 476

for scyl2b-2, 5’-TCCGAAGTGACGCTAGGTTACGTGCT-3’ and 5’-477

AACGATCTACGGCAGTACACCGTTG-3’ for scyl2b-3, and 5’-478

GAATTCACAGCAGAACATGTGCT-3’ and 5’-479

TCATAATAGATCCAATAGAGATGGTTGTGAACCA-3’ for scyl2b-4. To check whether or 480

not the transcripts of SCYL2A and SCYL2B are produced in scyl2a, scyl2b, and double 481

mutant alleles, RNA was extracted from the mutant alleles with a previously described 482

method (Onate-Sanchez and Vicente-Carbajosa, 2008), and was reverse-transcribed to 483

cDNA. Then, RT-PCR was conducted with the cDNA and the following primers: 5’-484

TCCTGGTCTCGCTTGGAAGCTTTA-3’ and 5’-TGCTGCTTTGAACCATTTGGCTTAG-3’ 485

for SCYL2A, 5’-CACCATGTCGATAAACATGAAAACATTTACTCAAGCTC-3’ and 5’-486

TCATAATAGATCCAATAGAGATGGTTGTGAACCA-3’ for SCYL2B. As a control gene, β-487

tubulin (TUB2, AT5G62690) was amplified with the primers 5'-488

GCCAATCCGGTGCTGGTAACA-3' and 5'- CATACCAGATCCAGTTCCTCCTCCC-3'. PCR 489

amplification was performed with 37 cycles and visualized using ethidium bromide after 490

separation on agarose gels. 491

492

Phylogenetic Analysis and Similarity Matrix 493

494

Alignment of protein sequences was performed with ClustalW in Mega4. A phylogenetic 495

tree was constructed using Neighbor-joining, Poisson correction, pairwise deletion, and 496



24

bootstrap values with 10,000 replicates in Mega4. The similarity matrix was generated 497

using pairwise sequence comparison of 16 sequences to determine the p-distance, the 498

number of amino acid substitutions per site. Protein sequence identity is shown as (1 - p-499

distance)*100. 500

501

Root Hair Length Measurement and Root Hair Phenotype Analysis 502

503

Photographs of three-day old roots grown in the complete nutrient plates were taken using 504

a Nikon SMZ1500 microscope and a Q-Imaging Retiga cooled 12-bit camera. Root hair 505

length was measured by using NIH ImageJ software program in two separate regions of 506

roots: 2 mm region below hypocotyls and 2 mm region starting 0.5 mm above the root hair 507

differentiation zone. Fifteen root hairs per each root were measured avoiding root hairs 508

that were growing into the medium and ten roots per genotype were used for root hair 509

length measurements. Two independent experiments were performed and similar results 510

were obtained. The number of abnormal root hairs was counted based on five different 511

categories: normal shape, v shape, y shape, wavy shape, and bulged shape. About 70 to 512

100 root hairs per each seedling were counted in 5 mm region starting 0.5 mm above the 513

root hair differentiation zone and ten seedlings were used in the analysis. Data were 514

displayed as percentages of each root hair class in wild type and scyl2b-3. 515

516

Phenotype Assay 517

518

Photographs of ten-day old plants grown in the complete nutrient plates were taken for 519

primary root length measurement and subjected to shoot fresh weight measurement. For 520



25

each mutant, ten seedlings per plate were grown, and six replicate plates were used. For 521

the measurement of primary root length, fifty roots per each mutant were used. Shoot fresh 522

weight was measured by bulking 10 plants from each of six plates. Statistical significance 523

was evaluated with a Student’s t test. Two independent experiments were performed and 524

similar results were obtained. 525

526

Quantitative Real-Time PCR analysis 527

528

Various tissues from seven-day-old seedlings or one-month-old plants were harvested and 529

total RNA was isolated as described previously (Onate-Sanchez and Vicente-Carbajosa, 530

2008). RNA was quantified and treated with RQ RNase-free DNase I (Promega). DNase-531

treated RNA was tested for genomic DNA contamination, and the quality of total RNA was 532

determined by agarose gel electrophoresis. Two and a half micrograms of DNA-free RNA 533

was then reverse transcribed using the First-Stand Synthesis System (Invitrogen). 534

Quantitative real-time RT-PCR analysis was performed using the StepOnePlus Real-Time 535

PCR system (Applied Biosystems) and Platinum SYBR Green qPCR SuperMix-UDG 536

(Invitrogen). To analyze the expression of SCYL2A and SCYL2B by real-time qPCR, 537

primers 5’-TCAAACCACAGTCCAGGAGGTTACAG-3’ and 5’-538

TCAAGCGCCTGAACAACATGAACC-3’ were used for SCYL2A gene and primers 5’- 539

AGTACAGGAAGTTACGGGACCAAAG-3’ and 5’- 540

AGCGGCTCCGTAACTAAAGCCATAGC-3’ were used for SCYL2B gene. For the 541

normalization of SCYL2A and SCYL2B transcripts, ACTIN7 gene (AT5G09810) was 542

amplified with the primers 5'-ACCACTACCGCAGAAC-3' and 5'-GCTCATACGGTCAGCA-543

3' and was used as an internal control. Statistical differences in SCYL2A and SCYL2B 544



26

transcript levels between samples were evaluated by a Student’s t test using ΔΔCt values 545

(Yuan et al., 2006). Three biological replicates were used to generate means and statistical 546

significance. 547

548

Plasmid Construction and Plant Transformation 549

550

To generate the vector constructs used in this study, the open reading frame of full-length 551

genes was amplified by PCR using NEB Phusion polymerase and the following primers: 552

sense 5'-CACCATGTCGATTAATATGAGAACGCTAA-3' and antisense 5'-553

TCACAATAGATCTAACAAAGATGGC-3' for SCYL2A (AT1G22870), sense 5'-554

CACCATGTCGATTAATATGAGAACGCTAA-3' and antisense 5'-555

CAATAGATCTAACAAAGATGGC-3' for SCYL2A without a stop codon, sense 5'- 556

CACCATGTCGATAAACATGAAAACATTTACTCAAGCTC-3' and antisense 5'-557

TCATAATAGATCCAATAGAGATGGTTGTGAACCA-3' for SCYL2B (AT1G71410), sense 5'- 558

CACCATGTCGATAAACATGAAAACATTTACTCAAGCTC-3' and antisense 5'-559

TAATAGATCCAATAGAGATGGTTGTGAACCA-3' for SCYL2B without a stop codon, sense 560

5’- CACCATGGCGGCTGCTAACGCGCCCATCATTATG-3’ and antisense 5’-561

TTAGTAGCCGCCCATCGGTGGCATTCCA-3’ for CHC1 (AT3G11130), sense 5’-562

CACCATGAGTGACGTGTTTGATGGATAT-3’ and antisense 5’-563

TTACTTGGTGAGTTTGAAGTACAAGATGAT-3’ for VTI11 (AT5G39510), sense 5’-564

CACCATGAGCGACGTATTTGAAGGGTACGAGCGT-3’ and antisense 5’-565

TTAATGAGAAAGCTTGTATGAGATGATCAA-3’ for VTI12 (AT1G26670), sense 5’-566

CACCATGAATCCCTTTTCTTCT-3’ and antisense 5’-TCACAACCCGCGAGGGAA-3’ for 567

AP-1 (AT1G23900), sense 5’-CACCATGACCGGAATGAGAGGTCTCTCCGTA-3’ and 568



27

antisense 5’-TTAAAGTAAGCCAGCGAGCATAGCTCC-3’ for AP-2 (AT5G22770), sense 569

5’-CACCATGTCGTCGTCTTCCACTTCTATAATG-3’ and antisense 5’-570

TCACAAGAGAAAATCTGGAATTATAAC-3’ for AP-3 (AT1G48760). The PCR products 571

were inserted into pENTR/D-TOPO following the manufacturer's instructions (Invitrogen). 572

The inserts were sequenced to make sure that no changes were introduced by PCR. The 573

SCYL2B gene in pENTR/D-TOPO was introduced into the destination plasmid 574

pEARLYGATE104:N-YFP or pEARLYGATE101:N-HA to yield pEARLYGATE:YFP(or 575

HA):SCYL2B, which allows the expression of fusion proteins with YFP or HA tag at the N-576

terminal position under control of the cauliflower mosaic virus 35S promoter. For the 577

colocalization study between SCYL2 proteins and CHC1 in tobacco leaf epidermal cells, 578

genes of SCYL2A, SCYL2B, and CHC1 in pENTR/D-TOPO were cloned into either 579

pMDC43:N-GFP vector or pB7WGR2:N-RFP to generate overexpression vectors with N-580

terminal fluorescent protein fusion genes. The SCYL2A/2B without stop codons were 581

cloned into pMDC83:C-GFP vector and pB7RWG2:C-RFP to yield C-terminal GFP (and 582

RFP)-fused SCYL2A/2B overexpression vectors. 583

To generate the pGreenII:SCYL2A/2Bpromoter:GUS plasmids, pGreenII:GUS 584

plasmid (Hellens et al., 2000) was first digested by NcoI and HindIII restriction enzymes. 585

Then, DNA fragments containing SCYL2A and SCYL2B promoter regions (about 1.5 kb) 586

were amplified by PCR using NEB Phusion polymerase and the following primers: sense 587

5'-ATTATAAGAACACTACCTTGATCCTTTGCAAGTATTGGA-3' and antisense 5'-588

TACAGGACGTAACACCATTTTTTTTTGTCAGAATTTAACTGTTTCTCCA-3' for SCYL2A 589

promoter, sense 5’-ATTATAAGAACACTAATTCATCTCTTTGGTCAGTTACGT-3’ and 590

antisense 5’-TACAGGACGTAACACCATTTCTGCTGGATCCAATTACTCC-3’ for SCYL2B 591

promoter. The digested plamid and PCR-amplified DNA fragments were recombined by 592



28

using a commercially available In-Fusion multiple DNA assembly cloning method 593

(Clontech Laboratories) to yield pGreenII:SCYL2A/2Bpromoter:GUS plasmids. Transgenic 594

Arabidopsis plants carrying pEARLYGATE:YFP:SCYL2B and pGreenII:GUS plasmids 595

containing SCYL2A and SCYL2B promoters were generated by Agrobacterium-mediated 596

transformation and T2 or T3 transgenic lines were used in this study. 597

To generate the pMDC43:EXPA7promoter:N-GFP plasmids carrying various N-terminal GFP 598

fused genes which encode proteins with root hair tip localization, the 35S promoter of 599

pMDC43 vector was replaced with the 1.5 Kb promoter of EXPA7 by the recombination of 600

pMDC43 DNA fragments digested with HindIII and KpnI and PCR-amplified DNA 601

fragments using primers 5’-602

CGACGGCCAGTGCCAAAGCTTAATTAGGGTCCAAGGTTTGTTC-3’ and 5’-603

CATTTTTTCTACCGGTACCTCTAGCCTCTTTTTCTTTATTCTTA-3’. Then, the open 604

reading frame of full-length genes of ROP2, RABA4B, RHD2, CSLD3, SYP123, and PRP3 605

was PCR-amplified using the following primers: sense 5'-606

CCGGTACCGAATTCGATGGCGTCAAGGTTTATAAAGTGT-3' and antisense 5'-607

ATATCTCGAGTGCGGTCACAAGAACGCGCAACGGTTCTT-3' for ROP2 (AT1G20090), 608

sense 5’-CCGGTACCGAATTCGATGGCCGGAGGAGGCGGATAC-3’ and antisense 5’-609

ATATCTCGAGTGCGGTCAAGAAGAAGTACAACAAGTGCT-3’ for RABA4B (AT4G39990), 610

sense 5'-CCGGTACCGAATTCGATGTCTAGAGTGAGTTTTGAAGTG-3' and antisense 5'- 611

ATATCTCGAGTGCGGTTAGAAATTCTCTTTGTGGAAGGA-3' for RHD2 (AT5G51060), 612

sense 5’-CCGGTACCGAATTCGATGGCGTCTAATAATCATTTCATG-3’ and antisense 5’-613

ATATCTCGAGTGCGGTCATGGGAAAGTGAAAGATCCTCC-3’ for CSLD3 (AT3G03050), 614

sense 5'-CCGGTACCGAATTCGATGAACGATCTTATCTCAAGCTCA-3' and antisense 5'-615

ATATCTCGAGTGCGGTCAAGGTCGAAGTAGAGTGTTAAA-3' for SYP123 (AT4G03330), 616



29

sense 5’-CCGGTACCGAATTCGATGGCGATCACACGCTCCTCCT-3’ and antisense 5’-617

ATATCTCGAGTGCGGTCAGTATTTGGGAGTGGCGGG-3’ for PRP3 (AT3G62680) and 618

recombined with pENTR2B (Invitrogen) DNA fragments amplified by PCR using primers 5’-619

CCGCACTCGAGATATCTAGAC-3’ and 5’-CGAATTCGGTACCGGATC-3’. The resulting 620

pENTR2B vectors with genes were recombined with the destination plasmid 621

pMDC43:EXPA7promoter plasmid to yield the GFP-fusion genes in pMDC43:EXPA7promoter 622

plasmids and T2 transgenic plants in the background of Col-0 and scyl2b mutants were 623

generated and used for the root hair tip localization study. 624

625

GUS Histochemical Assay 626

627

Staining for GUS activity was carried out as described previously (Harrison et al., 2006). 628

Briefly, about 2-week old plants grown on plates were dipped in GUS solution and 629

vacuum-infiltrated for 20 min. Samples were then incubated for 2 days at 37°C, cleared in 630

70% v/v ethanol and mounted in water prior to examination. GUS-stained tissues and 631

plants shown in this paper represent the typical results of at least two independent lines for 632

each construct. 633

634

Protein Interaction Assay 635

636

For BiFC assay, genes in pENTR/D-TOPO were introduced into the destination plasmid 637

pSITE-BiFC-C1nec or pSITE-BiFC-C1cec to yield nYFP- or cYFP- fusion constructs 638

(Martin et al., 2009). Then, tobacco leaves were infiltrated with agrobacterium carrying the 639

BiFC constructs as described previously (Sparkes et al., 2006). Three days after 640



30

agrobacterium infiltration, YFP fluorescence images were obtained from tobacco leaf 641

epidermal cells. The expression level of nYFP- or cYFP- fusion proteins in tobacco leaf 642

epidermal cells was detected by western blotting using rabbit polyclonal Anti-GFP antibody 643

(ab290, abcam, UK). For co-immunoprecipitation assay, four week-old tobacco leaves 644

were co-infiltrated with agrobacterium carrying the HA- and YFP fusion genes. Three days 645

after infiltration, leaves were frozen, ground, and protein-extracted in the extraction buffer 646

(250 mM Suc, 20 mM HEPES, pH 7.4, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM 647

EGTA, 1% Nonidet P-40, 0.1% Na-deoxycholate, 1 mM phenylmethylsulfonyl fluoride, 648

EDTA-free protease inhibitor cocktail complete (Roche), and 10 mM NaF). The total 649

protein extracts were centrifuged at 10,000g for 10 min to remove cell debris and the 650

supernatant was incubated with anti-HA magnetic beads (Pierce) or GFP-Trap beads 651

(ChromoTek) for 2 h at 4°C. Beads were washed four times in the extraction buffer 652

containing 0.1% Nonidet P-40, then washed once with the same extraction buffer without 653

detergent. The protein beads were boiled in loading buffer and the beads were removed. A 654

quarter of the elutes and 10 g protein from total lysates (input fraction) were loaded and 655

run on a 4-12% ExpressPlus PAGE Gel (Genscript, USA) and were transferred with 100V 656

for 1 h by a wet transfer method to an Amersham Hybond-P PVDF membrane (GE 657

healthcare). Membranes was washed briefly in PBST buffer (10 mM phosphate buffer pH 658

7.2, 150 mM NaCl, 0.2% Tween-20) and blocked in PBST buffer with 1% BSA (Sigma) for 659

1 h. The membrane was incubated overnight at 4°C with either rabbit polyclonal Anti-GFP 660

antibody (1:7,500 dilution, ab290, abcam, UK) or rat monoclonal Anti-HA High affinity 661

antibody (1:7,500 dilution, Roche) in the PBST with 1% BSA, washed three times, and 662

incubated with either goat anti-rabbit IgG-HRP or goat anti-rat IgG-HRP (Santa Cruz 663

Biotechnology, USA, 1:7,500 dilution) in the PBST with 1% BSA at room temperature. After 664



31

washing the membrane, signal was detected using the Western Bright Sirius HRP 665

Substrate (Advansta, USA) and a GE healthcare ImageQuant RT ECL Imager. 666

667

Fluorescent Organelle Markers and Microscopy 668

669

Monomeric RFP (mRFP):SCAMP1 (TGN marker) and mRFP:AtVSR2 (PVC marker) were 670

kindly provided from Liwen Jiang (Chinese University of Hong Kong). mRFP:SCAMP1 was 671

used as a marker for both TGN and PM since it localizes to these two compartments (Lam 672

et al., 2007). The other organelle markers used in this study were obtained from the 673

Arabidopsis stock centers (http://www.arabidopsis.org) and are also described on the web 674

site (http://www.bio.utk.edu/cellbiol/markers) and a paper published previously (Nelson et 675

al., 2007). For the colocalization studies, Arabidopsis leaf protoplasts were generated 676

using three week-old plants and transformed with plasmids by polyethylene glycol (PEG) 677

solution based on a previously described method (Yoo et al., 2007). Fluorescence signals 678

were observed 24 h to 48 h after the PEG transformation. Images were taken using a 679

Zeiss LSM 510 Meta confocal laser-scanning microscope equipped with C-Apochromat 680

40x N.A. 1.2 water immersion lens (Zeiss, Jena, Germany). For the colocalization studies 681

using YFP and CFP signals, 514 nm excitation wavelength with 535-590 nm emission filter 682

and 458 nm excitation wavelength with 480-520 nm emission filter were used, respectively. 683

For the colocalization studies using YFP and RFP signals, 488 nm excitation wavelength 684

with 500-550 nm emission filter and 543 nm excitation wavelength with 565-615 nm 685

emission filter were used, respectively. Images obtained by confocal microscope were 686

processed using NIH ImageJ software to remove low-level background fluorescence and 687

to enhance contrast for the increase of signal intensity. For colocalization images shown in 688


http://www.bio.utk.edu/cellbiol/markers


32

Fig. 6, YFP images were rendered in green color and CFP or RFP images were rendered 689

in magenta color. Root hairs of transgenic Arabidopsis plants expressing YFP:SCYL2B 690

were observed under a Nikon Eclipse E800 widefield microscope and a 40×/1.3 NA oil-691

immersion lens with appropriate YFP filters and images were processed using imageJ 692

software. 693

694

Chemical Inhibitor and FM4-64 Uptake Assay 695

696

For chemical inhibitor assay, four week-old tobacco leaves were infiltrated with 697

agrobacterium carrying the 35S:GFP:SCYL2B fusion gene. Three days after infiltration, 698

tobacco leaf discs with 1 cm diameter were incubated in water containing either 50 µM 699

BFA or 30 µM wortmannin. Two hours after the incubation, GFP fluorescent images were 700

taken using a Zeiss LSM 700 confocal laser-scanning microscope (Zeiss, Jena, Germany). 701

Two independent experiments were performed and about five leaf discs are used for each 702

sample. For FM4-64 uptake assay, about seven day-old seedlings of Col-0 and scyl2a-3 703

scyl2b-3 double mutants grown on ammonium free complete nutrient agar medium (Jung 704

et al., 2009) were incubated with the same agar-free nutrient solution containing 2 M FM 705

4-64 dye for 5, 30, and 60 min. Then, fluorescent images were taken under a Zeiss LSM 706

700 confocal laser-scanning microscope using 488 nm excitation wavelength with 585-610 707

nm emission filter. Two independent experiments were performed and about five to ten 708

seedlings were observed for each sample. 709

710

Accession Numbers 711

712



33

Sequence data from this article can be found in the Arabidopsis Genome Initiative or 713

GenBank/EMBL databases under the following accession numbers: SCYL2A 714

(AT1G22870), SCYL2B (AT1G71410), CHC1 (AT3G11130), VTI11 (AT5G39510), VTI12 715

(AT1G26670), ROP2 (AT1G20090), RABA4B (AT4G39990), RHD2 (AT5G51060), CSLD3 716

(AT3G03050), SYP123 (AT4G03330), PRP3 (AT3G62680), AP-1 (AT1G23900), AP-2 717

(AT5G22770), and AP-3 (AT1G48760) 718

719

Supplemental Data 720

721

The following materials are available in the online version of this article. 722

Supplemental Figure S1. The segmental duplication of SCYL2 genes in Arabidopsis. 723

Supplemental Figure S2. Tip localization of SCYL2B in growing root hairs.. 724

Supplemental Figure S3. SCYL2B is not localized at peroxisomes, mitochondria, plastids, 725

and PM. 726

Supplemental Figure S4. SCYL2B is localized at the Golgi, TGN, and PVC in Arabidopsis 727

leaf epidermal cells. 728

Supplemental Figure S5. Western blotting analysis to show the expression level of 729

nYFP:SCYL2B with cYFP, cYFP:CHC1, cYFP:VTI11, and cYFP:VTI12 in tobacco leaf 730

epidermal cells. 731

Supplemental Figure S6. Coimmunoprecipitation of SCYL2B with CHC1, VTI11, and 732

VTI12 using GFP trap beads. 733

Supplemental Figure S7. Full scans of immunoblots. 734

Supplemental Figure S8. CSLD3 is mislocalized in root hairs of scyl2b mutants. . 735

Supplemental Figure S9. A clathrin binding motif (SLLDLL) on SCYL2B does not affect 736



34

the interaction between SCYL2B and CHC1. 737

Supplemental Figure S10. SCYL2B does not interact with adaptor proteins. 738

Supplemental Figure S11. Effect of brefeldin A (BFA) and wortmannin, endomembrane 739

trafficking inhibitors, on the localization of SCYL2B in tobacco leaf epidermal cells. 740

Supplemental Figure S12. Comparison of localization pattern of SCYL2B expressed by 741

various promoters in tobacco leaf epidermal cells. 742

Supplemental Figure S13. FM4-64 uptake assay in Col-0 and scyl2a-3 scyl2b-3 double 743

mutants. 744

Supplemental Figure S14. SCYL2 proteins function in the development of root columella 745

cells in Arabidopsis. 746

Supplemental Table S1. Percentages of YFP:SCYL2B-positive spots overlapped with 747

organelle marker proteins. 748

749

ACKNOWLEDGEMENTS 750

751

We thank Howard Berg (Donald Danforth Plant Science Center) for microscopy 752

assistance; Liwen Jiang for providing fluorescent organelle markers; Sandeep Tata for the 753

preparation of tobacco plants for BiFC assay; Yves Poirier for supporting experimental 754

works. Inhwan Hwang and Dong Wook Lee were supported by the Cooperative Research 755

program for Agriculture Science & Technology Development (Project No. 010953012016), 756

Rural Development Administration, Republic of Korea. Stephen Beungtae Ryu was 757

supported by grant (PJ01109103) from the Next-Generation BioGreen 21 Program (SSAC), 758

Korea Rural Development Administration. 759

760



35

AUTHOR CONTRIBUTIONS 761

762

J.J., D.P.S., D.W.L., S.B.R., and I.H. conceived and designed the experiments. J.J. and 763

D.W.L. performed the experiments. J.J. and D.W.L. analysed the data., J.J., D.P.S., .S.B.R, 764

and I.H. wrote the manuscript. 765

766



36

Figures and Legends 767

768

Figure 1. SCYL2 is conserved in eukaryotes. 769

A, A similarity matrix is shown to represent the percentage of amino acid identity between 770

species across the SCYL2 proteins. B, Neighbor-joining phylogenetic tree showing the 771

relationship between SCYL2 proteins from eukaryote species. The numbers above the 772

nodes are percentages of bootstrap confidence levels from 10,000 replicates. Branch 773

length represents the number of amino acid changes per site in accordance with the scale 774

bar. Species of SCYL2 proteins in (A) and (B) are Arabidopsis thaliana, Carica papaya, 775

Populus trichocarpa, Glycine max, Zea mays, Oryza sativa japonica, Homo sapiens, Pan 776

troglodytes, Canis lupus familiaris, Bos Taurus, Mus musculus, Rattus norvegicus, Gallus 777

gallus, Drosophila melanogaster, and Anopheles gambiae. 778

Figure 2. Gene structure of SCYL2A and SCYL2B and location of T-DNA insertions. 779

A, A schematic diagram shows the positions of T-DNA insertions in scyl2a and scyl2b 780

alleles. Black boxes represent exons. Lines between black boxes represent introns. White 781

boxes represent UTR regions. White triangles indicate T-DNA insertion sites. The position 782

of primers that are used in (C) to check the presence of full-length transcripts of SCYL2A 783

or SCYL2B is indicated by arrows. B, Salk and Sail lines used to isolate scyl2a and scyl2b 784

alleles and their T-DNA locations indicated. Four different double mutants were obtained 785

between scyl2a and scyl2b mutants. C, RT-PCR analysis of SCYL2A and SCYL2B 786

transcripts in wild type, single, and double mutants. The position of primers used is shown 787

in (A). A β-tubulin gene (TUB2) was used as a positive control for the RT-PCR. All scyl2a 788

and scyl2b alleles are knock-out mutants, except for scyl2b-2, which has a decreased level 789

of full-length transcripts. Single PCR reactions were performed with cDNA from individual 790



37

plants of each genotype. 791

Figure 3. SCYL2B functions in root hair development. 792

A, Light microscope images showing root hair length of wild-type Col-0, scyl2a, scyl2b, 793

and scyl2a scyl2b double mutant alleles. Three-day-old roots were used for the 794

measurement of root hair length in (A) and (B). Scale = 0.5 mm. B, Root hair length of 795

seedlings of wild-type Col-0, scyl2a, scyl2b, and scyl2a scyl2b double mutant alleles. Root 796

hair length was measured in two separate regions of root: 2 mm region below hypocotyls 797

(left graph and middle panel) and 2 mm region starting 0.5 mm above the root hair 798

differentiation zone (right graph and middle panel). Fifteen root hairs per each seedling 799

were measured and ten seedlings per genotype were used for root hair length 800

measurements (n = 10 seedlings, means ± SE). C, Abnormal root hairs in scyl2b-3. Root 801

hairs in scyl2b-3 were classified into five classes based on their phenotype (normal, v 802

shape, y shape, wavy, and bulged). Representative images of each class are shown (Left). 803

Percentages of each root hair class were determined in WT plants and scyl2b-3 (Right). 804

About 70 to 100 root hairs per each seedling were counted in 5 mm regions starting 0.5 805

mm above the root hair differentiation zone (n = 10 seedlings, means ± SE). At least two 806

independent experiments were performed. 807

808

Figure 4. SCYL2A and SCYL2B are important in plant growth and development. 809

A, Images of ten-day-old wild-type Col-0, scyl2a-1, scyl2b-1, and scyl2a-1 scyl2b-1 double 810

mutants. Scale = 0.5 cm. B, Primary root length of the wild type and scyl2 knockouts. 811

Values are mean ± SE from 50 roots. C, Shoot fresh weights the wild type and scyl2 812

knockouts. Values are mean ± SE from 10 seedlings per replicate (n = 6 replicates). D, 813

Image of one month-old wild-type Col-0, scyl2a-1 scyl2b-1, and scyl2a-3 scyl2b-3. Scale = 814



38

1 cm. 815

816

Figure 5. SCYL2A and SCYL2B expression levels in various tissues. 817

A, Quantitative real-time PCR analysis of SCYL2A and SCYL2B expression in various 818

tissues. Tissue from 7-day-old plants and 1 month-old plants were used in this analysis. 819

The levels of SCYL2A and SCYL2B transcripts were normalized to ACTIN7. Three 820

biological replicates were used and error bars represent SE. B, Spatial localization of 821

SCYL2A and SCYL2B. Histochemical localization of GUS activity in plants carrying 822

SCYL2Apromoter:GUS (Left) and SCYL2Bpromoter:GUS (Right). About 2 week-old plants grown 823

on plates were used for the visualization of GUS activity. Arrows indicate GUS staining. 824

Figure 6. SCYL2B is localized at the Golgi, TGN, and PVC . 825

A, YFP:SCYL2B is tip localized in growing root hairs. B, The tip localization pattern 826

disappears in mature root hairs. Root hairs of transgenic Arabidopsis plants expressing 827

YFP:SCYL2B were observed under wide-field fluorescent microsope. Scale = 10 μm. C to 828

E, Localization of SCYL2B in various subcellular organelles. Arabidopsis leaf protoplasts 829

were co-transformed with YFP:SCYL2B and indicated constructs which encode protein 830

markers for the Golgi (C), TGN (D), and PVC (E). The localization of SCYL2B was 831

examined by the detection of YFP, CFP, and RFP signal under confocal microscope. 832

White color indicates strong colocalization. Arrows indicate some spots showing 833

colocalization. Scale = 20 μm. 834

835



39

836

Figure 7. SCYL2B interacts with CHC1, VTI11, and VTI12. 837

A, BiFC assay showing in vivo interactions of SCYL2B with CHC1, VTI11, and VTI12. 838

nYFP:SCYL2B construct was transiently co-expressed with cYFP fusion constructs such 839

as CHC1, VTI11, and VTI12 in tobacco leaf epidermal cells via agrobacterium infiltration. 840

Bright field images and YFP fluorescence images are shown. Scale = 10 μm. B, 841

Coimmunoprecipitation of SCYL2B with CHC1, VTI11, and VTI12. YFP and YFP:SCYL2B 842

constructs were transiently co-expressed with HA:CHC1, HA:VTI11, and HA:VTI12 in 843

tobacco leaf epidermal cells. HA-tagged fusion proteins were co-immunoprecipitated by 844

anti-HA antibody-conjugated magnetic beads and probed with anti-GFP antibody. 845

IP,immunoprecipitation; Input, total protein extracts before IP; Bound, bound fraction after 846

IP. 847

Figure 8. SCYL2B colocalizes with SCYL2A and CHC1. 848

A to D, Colocalization of SCYL2B with SCYL2A and CHC1. Tobacco leaf epidermal cells 849

were co-infiltrated with Agrobacterium strains carrying constructs: GFP:SCYL2B and 850

SCYL2B:RFP (A), GFP:SCYL2B and SCYL2A:RFP (B), GFP:SCYL2B and RFP:CHC1 (C), 851

and GFP:SCYL2A and RFP:CHC1 (D). The localization of fluorescent proteins was 852

examined by the detection of GFP and RFP signal under confocal microscope. 853

Representative images of each sample are shown. White color indicates strong 854

colocalization. Arrows indicate some spots showing colocalization. Scale = 10 μm. 855

856



40

857

Figure 9. CSLD3 is mislocalized in root hairs of scyl2b mutants. . 858

Localization of proteins which are known to function at the root hair tip was observed in the 859

background of Col-0 and scyl2b-3 mutants. The expression of N-terminal GFP fusion 860

proteins of ROP2, RHD2, RABA4B, SYP123, PRP3, and CSLD3 was driven by EXPA7 861

promoter, a root hair specific promoter. For each gene construct, at least 5 independent T2 862

transgenic plants were used in two independent experiments that yielded similar results. 863

Root hairs of transgenic plants were observed under confocal microsope. A white arrow 864

indicates the difference of GFP:CSLD3 localization. Scale = 10 μm. 865

866



41

LITERATURE CITED 867

Bassham DC, Blatt MR (2008) SNAREs: cogs and coordinators in signaling and development. 868 Plant Physiol 147: 1504-1515 869

Bassham DC, Sanderfoot AA, Kovaleva V, Zheng H, Raikhel NV (2000) AtVPS45 complex 870 formation at the trans-Golgi network. Mol Biol Cell 11: 2251-2265 871

Bernal AJ, Yoo CM, Mutwil M, Jensen JK, Hou G, Blaukopf C, Sorensen I, Blancaflor EB, 872 Scheller HV, Willats WG (2008) Functional analysis of the cellulose synthase-like genes 873 CSLD1, CSLD2, and CSLD4 in tip-growing Arabidopsis cells. Plant Physiol 148: 1238-1253 874

Blackbourn HD, Jackson AP (1996) Plant clathrin heavy chain: sequence analysis and restricted 875 localisation in growing pollen tubes. J Cell Sci 109 ( Pt 4): 777-786 876

Borner GH, Rana AA, Forster R, Harbour M, Smith JC, Robinson MS (2007) CVAK104 is a 877 novel regulator of clathrin-mediated SNARE sorting. Traffic 8: 893-903 878

Burman JL, Hamlin JN, McPherson PS (2010) Scyl1 regulates Golgi morphology. PLoS One 5: 879 e9537 880

Chen X, Irani NG, Friml J (2011) Clathrin-mediated endocytosis: the gateway into plant cells. Curr 881 Opin Plant Biol 14: 674-682 882

Conner SD, Schmid SL (2005) CVAK104 is a novel poly-L-lysine-stimulated kinase that targets the 883 beta2-subunit of AP2. J Biol Chem 280: 21539-21544 884

Dhonukshe P, Aniento F, Hwang I, Robinson DG, Mravec J, Stierhof YD, Friml J (2007) 885 Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis. Curr 886 Biol 17: 520-527 887

Di Rubbo S, Irani NG, Kim SY, Xu ZY, Gadeyne A, Dejonghe W, Vanhoutte I, Persiau G, 888 Eeckhout D, Simon S, Song K, Kleine-Vehn J, Friml J, De Jaeger G, Van Damme D, 889 Hwang I, Russinova E (2013) The clathrin adaptor complex AP-2 mediates endocytosis of 890 brassinosteroid insensitive1 in Arabidopsis. Plant Cell 25: 2986-2997 891

Duwel M, Ungewickell EJ (2006) Clathrin-dependent association of CVAK104 with endosomes 892 and the trans-Golgi network. Mol Biol Cell 17: 4513-4525 893

Fan L, Li R, Pan J, Ding Z, Lin J (2015) Endocytosis and its regulation in plants. Trends Plant Sci 894 20: 388-397 895

Favery B, Ryan E, Foreman J, Linstead P, Boudonck K, Steer M, Shaw P, Dolan L (2001) 896 KOJAK encodes a cellulose synthase-like protein required for root hair cell morphogenesis 897 in Arabidopsis. Genes Dev 15: 79-89 898

Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, 899 Brownlee C, Jones JD, Davies JM, Dolan L (2003) Reactive oxygen species produced by 900 NADPH oxidase regulate plant cell growth. Nature 422: 442-446 901

Fujimoto M, Arimura S, Ueda T, Takanashi H, Hayashi Y, Nakano A, Tsutsumi N (2010) 902 Arabidopsis dynamin-related proteins DRP2B and DRP1A participate together in clathrin-903 coated vesicle formation during endocytosis. Proc Natl Acad Sci U S A 107: 6094-6099 904

Gadeyne A, Sanchez-Rodriguez C, Vanneste S, Di Rubbo S, Zauber H, Vanneste K, Van 905 Leene J, De Winne N, Eeckhout D, Persiau G, Van De Slijke E, Cannoot B, Vercruysse 906 L, Mayers JR, Adamowski M, Kania U, Ehrlich M, Schweighofer A, Ketelaar T, Maere S, 907 Bednarek SY, Friml J, Gevaert K, Witters E, Russinova E, Persson S, De Jaeger G, 908 Van Damme D (2014) The TPLATE adaptor complex drives clathrin-mediated endocytosis 909 in plants. Cell 156: 691-704 910

Geldner N, Denervaud-Tendon V, Hyman DL, Mayer U, Stierhof YD, Chory J (2009) Rapid, 911 combinatorial analysis of membrane compartments in intact plants with a multicolor marker 912 set. Plant J 59: 169-178 913

Gingras S, Earls LR, Howell S, Smeyne RJ, Zakharenko SS, Pelletier S (2015) SCYL2 Protects 914 CA3 Pyramidal Neurons from Excitotoxicity during Functional Maturation of the Mouse 915 Hippocampus. J Neurosci 35: 10510-10522 916

Harrison SJ, Mott EK, Parsley K, Aspinall S, Gray JC, Cottage A (2006) A rapid and robust 917



42

method of identifying transformed Arabidopsis thaliana seedlings following floral dip 918 transformation. Plant Methods 2: 19 919

Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and 920 flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42: 921 819-832 922

Hicks GR, Raikhel NV (2010) Advances in dissecting endomembrane trafficking with small 923 molecules. Curr Opin Plant Biol 13: 706-713 924

Hirst J, Edgar JR, Borner GH, Li S, Sahlender DA, Antrobus R, Robinson MS (2015) 925 Contributions of epsinR and gadkin to clathrin-mediated intracellular trafficking. Mol Biol 926 Cell 26: 3085-3103 927

Hwang I, Robinson DG (2009) Transport vesicle formation in plant cells. Curr Opin Plant Biol 12: 928 660-669 929

Ichikawa M, Hirano T, Enami K, Fuselier T, Kato N, Kwon C, Voigt B, Schulze-Lefert P, 930 Baluska F, Sato MH (2014) Syntaxin of plant proteins SYP123 and SYP132 mediate root 931 hair tip growth in Arabidopsis thaliana. Plant Cell Physiol 55: 790-800 932

Ishida T, Kurata T, Okada K, Wada T (2008) A genetic regulatory network in the development of 933 trichomes and root hairs. Annu Rev Plant Biol 59: 365-386 934

Jones MA, Shen JJ, Fu Y, Li H, Yang Z, Grierson CS (2002) The Arabidopsis Rop2 GTPase is a 935 positive regulator of both root hair initiation and tip growth. Plant Cell 14: 763-776 936

Jung JY, Shin R, Schachtman DP (2009) Ethylene mediates response and tolerance to potassium 937 deprivation in Arabidopsis. Plant Cell 21: 607-621 938

Jurgens G (2004) Membrane trafficking in plants. Annu Rev Cell Dev Biol 20: 481-504 939 Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT (2006) Functional 940

conservation of a root hair cell-specific cis-element in angiosperms with different root hair 941 distribution patterns. Plant Cell 18: 2958-2970 942

Kitakura S, Vanneste S, Robert S, Lofke C, Teichmann T, Tanaka H, Friml J (2011) Clathrin 943 mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis. Plant 944 Cell 23: 1920-1931 945

Lafer EM (2002) Clathrin-protein interactions. Traffic 3: 513-520 946 Lam SK, Cai Y, Tse YC, Wang J, Law AH, Pimpl P, Chan HY, Xia J, Jiang L (2009) BFA-induced 947

compartments from the Golgi apparatus and trans-Golgi network/early endosome are 948 distinct in plant cells. Plant J 60: 865-881 949

Lam SK, Siu CL, Hillmer S, Jang S, An G, Robinson DG, Jiang L (2007) Rice SCAMP1 defines 950 clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in 951 tobacco BY-2 cells. Plant Cell 19: 296-319 952

Lee Y, Bak G, Choi Y, Chuang WI, Cho HT (2008) Roles of phosphatidylinositol 3-kinase in root 953 hair growth. Plant Physiol 147: 624-635 954

Lee YJ, Yang Z (2008) Tip growth: signaling in the apical dome. Curr Opin Plant Biol 11: 662-671 955 Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S (2002) The protein kinase 956

complement of the human genome. Science 298: 1912-1934 957 Martin K, Kopperud K, Chakrabarty R, Banerjee R, Brooks R, Goodin MM (2009) Transient 958

expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition 959 of protein localization, movement and interactions in planta. Plant J 59: 150-162 960

Mishev K, Dejonghe W, Russinova E (2013) Small molecules for dissecting endomembrane 961 trafficking: a cross-systems view. Chem Biol 20: 475-486 962

Nelson BK, Cai X, Nebenfuhr A (2007) A multicolored set of in vivo organelle markers for co-963 localization studies in Arabidopsis and other plants. Plant J 51: 1126-1136 964

Nielsen E, Cheung AY, Ueda T (2008) The regulatory RAB and ARF GTPases for vesicular 965 trafficking. Plant Physiol 147: 1516-1526 966

Onate-Sanchez L, Vicente-Carbajosa J (2008) DNA-free RNA isolation protocols for Arabidopsis 967 thaliana, including seeds and siliques. BMC Res Notes 1: 93 968

Paez Valencia J, Goodman K, Otegui MS (2016) Endocytosis and Endosomal Trafficking in Plants. 969



43

Annu Rev Plant Biol 67: 309-335 970 Park M, Song K, Reichardt I, Kim H, Mayer U, Stierhof YD, Hwang I, Jurgens G (2013) 971

Arabidopsis mu-adaptin subunit AP1M of adaptor protein complex 1 mediates late secretory 972 and vacuolar traffic and is required for growth. Proc Natl Acad Sci U S A 110: 10318-10323 973

Park S, Szumlanski AL, Gu F, Guo F, Nielsen E (2011) A role for CSLD3 during cell-wall synthesis 974 in apical plasma membranes of tip-growing root-hair cells. Nat Cell Biol 13: 973-980 975

Pelletier S (2016) SCYL pseudokinases in neuronal function and survival. Neural Regen Res 11: 976 42-44 977

Preuss ML, Serna J, Falbel TG, Bednarek SY, Nielsen E (2004) The Arabidopsis Rab GTPase 978 RabA4b localizes to the tips of growing root hair cells. Plant Cell 16: 1589-1603 979

Robinson DG, Neuhaus JM (2016) Receptor-mediated sorting of soluble vacuolar proteins: myths, 980 facts, and a new model. J Exp Bot 67: 4435-4449 981

Rodriguez-Furlan C, Salinas-Grenet H, Sandoval O, Recabarren C, Arrano-Salinas P, Soto-982 Alvear S, Orellana A, Blanco-Herrera F (2016) The Root Hair Specific SYP123 Regulates 983 the Localization of Cell Wall Components and Contributes to Rizhobacterial Priming of 984 Induced Systemic Resistance. Front Plant Sci 7: 1081 985

Schneider R, Hanak T, Persson S, Voigt CA (2016) Cellulose and callose synthesis and 986 organization in focus, what's new? Curr Opin Plant Biol 34: 9-16 987

Song J, Lee MH, Lee GJ, Yoo CM, Hwang I (2006) Arabidopsis EPSIN1 plays an important role in 988 vacuolar trafficking of soluble cargo proteins in plant cells via interactions with clathrin, AP-1, 989 VTI11, and VSR1. Plant Cell 18: 2258-2274 990

Sparkes IA, Runions J, Kearns A, Hawes C (2006) Rapid, transient expression of fluorescent 991 fusion proteins in tobacco plants and generation of stably transformed plants. Nat Protoc 1: 992 2019-2025 993

Sullivan A, Uff CR, Isacke CM, Thorne RF (2003) PACE-1, a novel protein that interacts with the 994 C-terminal domain of ezrin. Exp Cell Res 284: 224-238 995

Surpin M, Zheng H, Morita MT, Saito C, Avila E, Blakeslee JJ, Bandyopadhyay A, Kovaleva V, 996 Carter D, Murphy A, Tasaka M, Raikhel N (2003) The VTI family of SNARE proteins is 997 necessary for plant viability and mediates different protein transport pathways. Plant Cell 998 15: 2885-2899 999

Takeda S, Gapper C, Kaya H, Bell E, Kuchitsu K, Dolan L (2008) Local positive feedback 1000 regulation determines cell shape in root hair cells. Science 319: 1241-1244 1001

Tang H, Bowers JE, Wang X, Ming R, Alam M, Paterson AH (2008) Synteny and collinearity in 1002 plant genomes. Science 320: 486-488 1003

Terabayashi T, Funato Y, Fukuda M, Miki H (2009) A coated vesicle-associated kinase of 104 kDa 1004 (CVAK104) induces lysosomal degradation of frizzled 5 (Fzd5). J Biol Chem 284: 26716-1005 26724 1006

Van Damme D, Gadeyne A, Vanstraelen M, Inze D, Van Montagu MC, De Jaeger G, Russinova 1007 E, Geelen D (2011) Adaptin-like protein TPLATE and clathrin recruitment during plant 1008 somatic cytokinesis occurs via two distinct pathways. Proc Natl Acad Sci U S A 108: 615-1009 620 1010

Wang C, Hu T, Yan X, Meng T, Wang Y, Wang Q, Zhang X, Gu Y, Sanchez-Rodriguez C, 1011 Gadeyne A, Lin J, Persson S, Van Damme D, Li C, Bednarek SY, Pan J (2016) 1012 Differential Regulation of Clathrin and Its Adaptor Proteins during Membrane Recruitment 1013 for Endocytosis. Plant Physiol 171: 215-229 1014

Wang C, Yan X, Chen Q, Jiang N, Fu W, Ma B, Liu J, Li C, Bednarek SY, Pan J (2013) Clathrin 1015 light chains regulate clathrin-mediated trafficking, auxin signaling, and development in 1016 Arabidopsis. Plant Cell 25: 499-516 1017

Wang D, Harper JF, Gribskov M (2003) Systematic trans-genomic comparison of protein kinases 1018 between Arabidopsis and Saccharomyces cerevisiae. Plant Physiol 132: 2152-2165 1019

Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for 1020 transient gene expression analysis. Nat Protoc 2: 1565-1572 1021



44

Yuan JS, Reed A, Chen F, Stewart CN, Jr. (2006) Statistical analysis of real-time PCR data. BMC 1022 Bioinformatics 7: 85 1023

Zeng W, Keegstra K (2008) AtCSLD2 is an integral Golgi membrane protein with its N-terminus 1024 facing the cytosol. Planta 228: 823-838 1025

Zheng H, von Mollard GF, Kovaleva V, Stevens TH, Raikhel NV (1999) The plant vesicle-1026 associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network 1027 to the prevacuolar compartment. Mol Biol Cell 10: 2251-2264 1028

1029



1

Figure 1. SCYL2 is conserved in eukaryotes.

A, A similarity matrix is shown to represent the percentage of amino acid identity between

species across the SCYL2 proteins. B, Neighbor-joining phylogenetic tree showing the

relationship between SCYL2 proteins from eukaryote species. The numbers above the nodes

are percentages of bootstrap confidence levels from 10,000 replicates. Branch length

represents the number of amino acid changes per site in accordance with the scale bar.

Species of SCYL2 proteins in (A) and (B) are Arabidopsis thaliana, Carica papaya, Populus



2

trichocarpa, Glycine max, Zea mays, Oryza sativa japonica, Homo sapiens, Pan troglodytes,

Canis lupus familiaris, Bos Taurus, Mus musculus, Rattus norvegicus, Gallus gallus, Drosophila

melanogaster, and Anopheles gambiae.



1

Figure 2. Gene structure of SCYL2A and SCYL2B and location of T-DNA insertions.

A, A schematic diagram shows the positions of T-DNA insertions in scyl2a and scyl2b alleles.

Black boxes represent exons. Lines between black boxes represent introns. White boxes

represent UTR regions. White triangles indicate T-DNA insertion sites. The position of primers

that are used in (C) to check the presence of full-length transcripts of SCYL2A or SCYL2B is

indicated by arrows. B, Salk and Sail lines used to isolate scyl2a and scyl2b alleles and their T-

DNA locations indicated. Four different double mutants were obtained between scyl2a and

scyl2b mutants. C, RT-PCR analysis of SCYL2A and SCYL2B transcripts in wild type, single,

and double mutants. The position of primers used is shown in (A). A β-tubulin gene (TUB2) was

used as a positive control for the RT-PCR. All scyl2a and scyl2b alleles are knock-out mutants,

except for scyl2b-2, which has a decreased level of full-length transcripts. Single PCR reactions

were performed with cDNA from individual plants of each genotype.



1



2

Figure 3. SCYL2B functions in root hair development.

A, Light microscope images showing root hair length of wild-type Col-0, scyl2a, scyl2b, and

scyl2a scyl2b double mutant alleles. Three-day-old roots were used for the measurement of root

hair length in (A) and (B). Scale = 0.5 mm. B, Root hair length of seedlings of wild-type Col-0,

scyl2a, scyl2b, and scyl2a scyl2b double mutant alleles. Root hair length was measured in two

separate regions of root: 2 mm region below hypocotyls (left graph and middle panel) and 2 mm

region starting 0.5 mm above the root hair differentiation zone (right graph and middle panel).

Fifteen root hairs per each seedling were measured and ten seedlings per genotype were used

for root hair length measurements (n = 10 seedlings, means ± SE). C, Abnormal root hairs in

scyl2b-3. Root hairs in scyl2b-3 were classified into five classes based on their phenotype

(normal, v shape, y shape, wavy, and bulged). Representative images of each class are shown

(Left). Percentages of each root hair class were determined in WT plants and scyl2b-3 (Right).

About 70 to 100 root hairs per each seedling were counted in 5 mm regions starting 0.5 mm

above the root hair differentiation zone (n = 10 seedlings, means ± SE). At least two

independent experiments were performed.



1

Figure 4. SCYL2A and SCYL2B are important in plant growth and development.

A, Images of ten-day-old wild-type Col-0, scyl2a-1, scyl2b-1, and scyl2a-1 scyl2b-1 double

mutants. Scale = 0.5 cm. B, Primary root length of the wild type and scyl2 knockouts. Values

are mean ± SE from 50 roots. C, Shoot fresh weights the wild type and scyl2 knockouts. Values

are mean ± SE from 10 seedlings per replicate (n = 6 replicates). D, Image of one month-old

wild-type Col-0, scyl2a-1 scyl2b-1, and scyl2a-3 scyl2b-3. Scale = 1 cm.



1



2

Figure 5. SCYL2A and SCYL2B expression levels in various tissues.

A, Quantitative real-time PCR analysis of SCYL2A and SCYL2B expression in various tissues.

Tissue from 7-day-old plants and 1 month-old plants were used in this analysis. The levels of

SCYL2A and SCYL2B transcripts were normalized to ACTIN7. Three biological replicates were

used and error bars represent SE. B, Spatial localization of SCYL2A and SCYL2B.

Histochemical localization of GUS activity in plants carrying SCYL2Apromoter:GUS (Left) and

SCYL2Bpromoter:GUS (Right). About 2 week-old plants grown on plates were used for the

visualization of GUS activity. Arrows indicate GUS staining.



1



2

Figure 6. SCYL2B is localized at the Golgi, TGN, and PVC .

A, YFP:SCYL2B is tip localized in growing root hairs. B, The tip localization pattern disappears

in mature root hairs. Root hairs of transgenic Arabidopsis plants expressing YFP:SCYL2B were

observed under wide-field fluorescent microsope. Scale = 10 μm. C to E, Localization of

SCYL2B in various subcellular organelles. Arabidopsis leaf protoplasts were co-transformed

with YFP:SCYL2B and indicated constructs which encode protein markers for the Golgi (C),

TGN (D), and PVC (E). The localization of SCYL2B was examined by the detection of YFP,

CFP, and RFP signal under confocal microscope. White color indicates strong colocalization.

Arrows indicate some spots showing colocalization. Scale = 20 μm.



1



2

Figure 7. SCYL2B interacts with CHC1, VTI11, and VTI12.

A, BiFC assay showing in vivo interactions of SCYL2B with CHC1, VTI11, and VTI12.

nYFP:SCYL2B construct was transiently co-expressed with cYFP fusion constructs such as

CHC1, VTI11, and VTI12 in tobacco leaf epidermal cells via agrobacterium infiltration. Bright

field images and YFP fluorescence images are shown. Scale = 10 μm. B,

Coimmunoprecipitation of SCYL2B with CHC1, VTI11, and VTI12. YFP and YFP:SCYL2B

constructs were transiently co-expressed with HA:CHC1, HA:VTI11, and HA:VTI12 in tobacco

leaf epidermal cells. HA-tagged fusion proteins were co-immunoprecipitated by anti-HA

antibody-conjugated magnetic beads and probed with anti-GFP antibody.

IP,immunoprecipitation; Input, total protein extracts before IP; Bound, bound fraction after IP.



1



2

Figure 8. SCYL2B colocalizes with SCYL2A and CHC1.

A to D, Colocalization of SCYL2B with SCYL2A and CHC1. Tobacco leaf epidermal cells were

co-infiltrated with Agrobacterium strains carrying constructs: GFP:SCYL2B and SCYL2B:RFP

(A), GFP:SCYL2B and SCYL2A:RFP (B), GFP:SCYL2B and RFP:CHC1 (C), and GFP:SCYL2A

and RFP:CHC1 (D). The localization of fluorescent proteins was examined by the detection of

GFP and RFP signal under confocal microscope. Representative images of each sample are

shown. White color indicates strong colocalization. Arrows indicate some spots showing

colocalization. Scale = 10 μm.



1

Figure 9. CSLD3 is mislocalized in root hairs of scyl2b mutants. .

Localization of proteins which are known to function at the root hair tip was observed in the

background of Col-0 and scyl2b-3 mutants. The expression of N-terminal GFP fusion proteins of

ROP2, RHD2, RABA4B, SYP123, PRP3, and CSLD3 was driven by EXPA7 promoter, a root

hair specific promoter. For each gene construct, at least 5 independent T2 transgenic plants

were used in two independent experiments that yielded similar results. Root hairs of transgenic

plants were observed under confocal microsope. A white arrow indicates the difference of

GFP:CSLD3 localization. Scale = 10 μm.



Parsed CitationsBassham DC, Blatt MR (2008) SNAREs: cogs and coordinators in signaling and development. Plant Physiol 147: 1504-1515

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bassham DC, Sanderfoot AA, Kovaleva V, Zheng H, Raikhel NV (2000) AtVPS45 complex formation at the trans-Golgi network. Mol BiolCell 11: 2251-2265


Bernal AJ, Yoo CM, Mutwil M, Jensen JK, Hou G, Blaukopf C, Sorensen I, Blancaflor EB, Scheller HV, Willats WG (2008) Functionalanalysis of the cellulose synthase-like genes CSLD1, CSLD2, and CSLD4 in tip-growing Arabidopsis cells. Plant Physiol 148: 1238-1253


Blackbourn HD, Jackson AP (1996) Plant clathrin heavy chain: sequence analysis and restricted localisation in growing pollen tubes. JCell Sci 109 ( Pt 4): 777-786


Borner GH, Rana AA, Forster R, Harbour M, Smith JC, Robinson MS (2007) CVAK104 is a novel regulator of clathrin-mediated SNAREsorting. Traffic 8: 893-903


Burman JL, Hamlin JN, McPherson PS (2010) Scyl1 regulates Golgi morphology. PLoS One 5: e9537Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chen X, Irani NG, Friml J (2011) Clathrin-mediated endocytosis: the gateway into plant cells. Curr Opin Plant Biol 14: 674-682Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Conner SD, Schmid SL (2005) CVAK104 is a novel poly-L-lysine-stimulated kinase that targets the beta2-subunit of AP2. J Biol Chem280: 21539-21544


Dhonukshe P, Aniento F, Hwang I, Robinson DG, Mravec J, Stierhof YD, Friml J (2007) Clathrin-mediated constitutive endocytosis ofPIN auxin efflux carriers in Arabidopsis. Curr Biol 17: 520-527


Di Rubbo S, Irani NG, Kim SY, Xu ZY, Gadeyne A, Dejonghe W, Vanhoutte I, Persiau G, Eeckhout D, Simon S, Song K, Kleine-Vehn J,Friml J, De Jaeger G, Van Damme D, Hwang I, Russinova E (2013) The clathrin adaptor complex AP-2 mediates endocytosis ofbrassinosteroid insensitive1 in Arabidopsis. Plant Cell 25: 2986-2997


Duwel M, Ungewickell EJ (2006) Clathrin-dependent association of CVAK104 with endosomes and the trans-Golgi network. Mol BiolCell 17: 4513-4525


Fan L, Li R, Pan J, Ding Z, Lin J (2015) Endocytosis and its regulation in plants. Trends Plant Sci 20: 388-397Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Favery B, Ryan E, Foreman J, Linstead P, Boudonck K, Steer M, Shaw P, Dolan L (2001) KOJAK encodes a cellulose synthase-likeprotein required for root hair cell morphogenesis in Arabidopsis. Genes Dev 15: 79-89

Pubmed: Author and TitleCrossRef: Author and Title https://plantphysiol.orgDownloaded on January 25, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Bassham DC%2C Blatt MR %282008%29 SNAREs%3A cogs and coordinators in signaling and development%2E Plant Physiol 147%3A 1504%2D1515&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bassham DC, Blatt MR (2008) SNAREs: cogs and coordinators in signaling and development. Plant Physiol 147: 1504-1515

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bassham&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SNAREs: cogs and coordinators in signaling and development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SNAREs: cogs and coordinators in signaling and development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bassham&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bassham DC%2C Sanderfoot AA%2C Kovaleva V%2C Zheng H%2C Raikhel NV %282000%29 AtVPS45 complex formation at the trans%2DGolgi network%2E Mol Biol Cell 11%3A 2251%2D2265&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bassham DC, Sanderfoot AA, Kovaleva V, Zheng H, Raikhel NV (2000) AtVPS45 complex formation at the trans-Golgi network. Mol Biol Cell 11: 2251-2265

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bassham&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=AtVPS45 complex formation at the trans-Golgi network&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=AtVPS45 complex formation at the trans-Golgi network&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bassham&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bernal AJ%2C Yoo CM%2C Mutwil M%2C Jensen JK%2C Hou G%2C Blaukopf C%2C Sorensen I%2C Blancaflor EB%2C Scheller HV%2C Willats WG %282008%29 Functional analysis of the cellulose synthase%2Dlike genes CSLD1%2C CSLD2%2C and CSLD4 in tip%2Dgrowing Arabidopsis cells%2E Plant Physiol 148%3A 1238%2D1253&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bernal AJ, Yoo CM, Mutwil M, Jensen JK, Hou G, Blaukopf C, Sorensen I, Blancaflor EB, Scheller HV, Willats WG (2008) Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2, and CSLD4 in tip-growing Arabidopsis cells. Plant Physiol 148: 1238-1253

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bernal&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bernal&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Blackbourn HD%2C Jackson AP %281996%29 Plant clathrin heavy chain%3A sequence analysis and restricted localisation in growing pollen tubes%2E J Cell Sci 109 %28 Pt 4%29%3A 777%2D786&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Blackbourn HD, Jackson AP (1996) Plant clathrin heavy chain: sequence analysis and restricted localisation in growing pollen tubes. J Cell Sci 109 ( Pt 4): 777-786

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Blackbourn&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Blackbourn&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Borner GH%2C Rana AA%2C Forster R%2C Harbour M%2C Smith JC%2C Robinson MS %282007%29 CVAK104 is a novel regulator of clathrin%2Dmediated SNARE sorting%2E Traffic 8%3A 893%2D903&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Borner GH, Rana AA, Forster R, Harbour M, Smith JC, Robinson MS (2007) CVAK104 is a novel regulator of clathrin-mediated SNARE sorting. Traffic 8: 893-903

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Borner&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=CVAK104 is a novel regulator of clathrin-mediated SNARE sorting&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=CVAK104 is a novel regulator of clathrin-mediated SNARE sorting&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Borner&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Burman JL%2C Hamlin JN%2C McPherson PS %282010%29 Scyl1 regulates Golgi morphology%2E PLoS One 5%3A e9537&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Burman JL, Hamlin JN, McPherson PS (2010) Scyl1 regulates Golgi morphology. PLoS One 5: e9537

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Burman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Scyl1 regulates Golgi morphology.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Scyl1 regulates Golgi morphology.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Burman&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chen X%2C Irani NG%2C Friml J %282011%29 Clathrin%2Dmediated endocytosis%3A the gateway into plant cells%2E Curr Opin Plant Biol 14%3A 674%2D682&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chen X, Irani NG, Friml J (2011) Clathrin-mediated endocytosis: the gateway into plant cells. Curr Opin Plant Biol 14: 674-682

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-mediated endocytosis: the gateway into plant cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-mediated endocytosis: the gateway into plant cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Conner SD%2C Schmid SL %282005%29 CVAK104 is a novel poly%2DL%2Dlysine%2Dstimulated kinase that targets the beta2%2Dsubunit of AP2%2E J Biol Chem 280%3A 21539%2D21544&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Conner SD, Schmid SL (2005) CVAK104 is a novel poly-L-lysine-stimulated kinase that targets the beta2-subunit of AP2. J Biol Chem 280: 21539-21544

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Conner&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=CVAK104 is a novel poly-L-lysine-stimulated kinase that targets the beta2-subunit of AP2&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=CVAK104 is a novel poly-L-lysine-stimulated kinase that targets the beta2-subunit of AP2&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Conner&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Dhonukshe P%2C Aniento F%2C Hwang I%2C Robinson DG%2C Mravec J%2C Stierhof YD%2C Friml J %282007%29 Clathrin%2Dmediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis%2E Curr Biol 17%3A 520%2D527&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Dhonukshe P, Aniento F, Hwang I, Robinson DG, Mravec J, Stierhof YD, Friml J (2007) Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis. Curr Biol 17: 520-527

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dhonukshe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dhonukshe&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Di Rubbo S%2C Irani NG%2C Kim SY%2C Xu ZY%2C Gadeyne A%2C Dejonghe W%2C Vanhoutte I%2C Persiau G%2C Eeckhout D%2C Simon S%2C Song K%2C Kleine%2DVehn J%2C Friml J%2C De Jaeger G%2C Van Damme D%2C Hwang I%2C Russinova E %282013%29 The clathrin adaptor complex AP%2D2 mediates endocytosis of brassinosteroid insensitive1 in Arabidopsis%2E Plant Cell 25%3A 2986%2D2997&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Di Rubbo S, Irani NG, Kim SY, Xu ZY, Gadeyne A, Dejonghe W, Vanhoutte I, Persiau G, Eeckhout D, Simon S, Song K, Kleine-Vehn J, Friml J, De Jaeger G, Van Damme D, Hwang I, Russinova E (2013) The clathrin adaptor complex AP-2 mediates endocytosis of brassinosteroid insensitive1 in Arabidopsis. Plant Cell 25: 2986-2997

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Di&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The clathrin adaptor complex AP-2 mediates endocytosis of brassinosteroid insensitive1 in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The clathrin adaptor complex AP-2 mediates endocytosis of brassinosteroid insensitive1 in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Di&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Duwel M%2C Ungewickell EJ %282006%29 Clathrin%2Ddependent association of CVAK104 with endosomes and the trans%2DGolgi network%2E Mol Biol Cell 17%3A 4513%2D4525&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Duwel M, Ungewickell EJ (2006) Clathrin-dependent association of CVAK104 with endosomes and the trans-Golgi network. Mol Biol Cell 17: 4513-4525

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Duwel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-dependent association of CVAK104 with endosomes and the trans-Golgi network&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-dependent association of CVAK104 with endosomes and the trans-Golgi network&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Duwel&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fan L%2C Li R%2C Pan J%2C Ding Z%2C Lin J %282015%29 Endocytosis and its regulation in plants%2E Trends Plant Sci 20%3A 388%2D397&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fan L, Li R, Pan J, Ding Z, Lin J (2015) Endocytosis and its regulation in plants. Trends Plant Sci 20: 388-397

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Endocytosis and its regulation in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Endocytosis and its regulation in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fan&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Favery B%2C Ryan E%2C Foreman J%2C Linstead P%2C Boudonck K%2C Steer M%2C Shaw P%2C Dolan L %282001%29 KOJAK encodes a cellulose synthase%2Dlike protein required for root hair cell morphogenesis in Arabidopsis%2E Genes Dev 15%3A 79%2D89&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Favery B, Ryan E, Foreman J, Linstead P, Boudonck K, Steer M, Shaw P, Dolan L (2001) KOJAK encodes a cellulose synthase-like protein required for root hair cell morphogenesis in Arabidopsis. Genes Dev 15: 79-89


Google Scholar: Author Only Title Only Author and Title

Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, Brownlee C, Jones JD, Davies JM, DolanL (2003) Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature 422: 442-446


Fujimoto M, Arimura S, Ueda T, Takanashi H, Hayashi Y, Nakano A, Tsutsumi N (2010) Arabidopsis dynamin-related proteins DRP2B andDRP1A participate together in clathrin-coated vesicle formation during endocytosis. Proc Natl Acad Sci U S A 107: 6094-6099


Gadeyne A, Sanchez-Rodriguez C, Vanneste S, Di Rubbo S, Zauber H, Vanneste K, Van Leene J, De Winne N, Eeckhout D, Persiau G,Van De Slijke E, Cannoot B, Vercruysse L, Mayers JR, Adamowski M, Kania U, Ehrlich M, Schweighofer A, Ketelaar T, Maere S,Bednarek SY, Friml J, Gevaert K, Witters E, Russinova E, Persson S, De Jaeger G, Van Damme D (2014) The TPLATE adaptor complexdrives clathrin-mediated endocytosis in plants. Cell 156: 691-704


Geldner N, Denervaud-Tendon V, Hyman DL, Mayer U, Stierhof YD, Chory J (2009) Rapid, combinatorial analysis of membranecompartments in intact plants with a multicolor marker set. Plant J 59: 169-178


Gingras S, Earls LR, Howell S, Smeyne RJ, Zakharenko SS, Pelletier S (2015) SCYL2 Protects CA3 Pyramidal Neurons fromExcitotoxicity during Functional Maturation of the Mouse Hippocampus. J Neurosci 35: 10510-10522


Harrison SJ, Mott EK, Parsley K, Aspinall S, Gray JC, Cottage A (2006) A rapid and robust method of identifying transformedArabidopsis thaliana seedlings following floral dip transformation. Plant Methods 2: 19


Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector forAgrobacterium-mediated plant transformation. Plant Mol Biol 42: 819-832


Hicks GR, Raikhel NV (2010) Advances in dissecting endomembrane trafficking with small molecules. Curr Opin Plant Biol 13: 706-713Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hirst J, Edgar JR, Borner GH, Li S, Sahlender DA, Antrobus R, Robinson MS (2015) Contributions of epsinR and gadkin to clathrin-mediated intracellular trafficking. Mol Biol Cell 26: 3085-3103


Hwang I, Robinson DG (2009) Transport vesicle formation in plant cells. Curr Opin Plant Biol 12: 660-669Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ichikawa M, Hirano T, Enami K, Fuselier T, Kato N, Kwon C, Voigt B, Schulze-Lefert P, Baluska F, Sato MH (2014) Syntaxin of plantproteins SYP123 and SYP132 mediate root hair tip growth in Arabidopsis thaliana. Plant Cell Physiol 55: 790-800


Ishida T, Kurata T, Okada K, Wada T (2008) A genetic regulatory network in the development of trichomes and root hairs. Annu RevPlant Biol 59: 365-386


Jones MA, Shen JJ, Fu Y, Li H, Yang Z, Grierson CS (2002) The Arabidopsis Rop2 GTPase is a positive regulator of both root hairhttps://plantphysiol.orgDownloaded on January 25, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Favery&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=KOJAK encodes a cellulose synthase-like protein required for root hair cell morphogenesis in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=KOJAK encodes a cellulose synthase-like protein required for root hair cell morphogenesis in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Favery&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Foreman J%2C Demidchik V%2C Bothwell JH%2C Mylona P%2C Miedema H%2C Torres MA%2C Linstead P%2C Costa S%2C Brownlee C%2C Jones JD%2C Davies JM%2C Dolan L %282003%29 Reactive oxygen species produced by NADPH oxidase regulate plant cell growth%2E Nature 422%3A 442%2D446&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, Brownlee C, Jones JD, Davies JM, Dolan L (2003) Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature 422: 442-446

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Foreman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Reactive oxygen species produced by NADPH oxidase regulate plant cell growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Reactive oxygen species produced by NADPH oxidase regulate plant cell growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Foreman&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fujimoto M%2C Arimura S%2C Ueda T%2C Takanashi H%2C Hayashi Y%2C Nakano A%2C Tsutsumi N %282010%29 Arabidopsis dynamin%2Drelated proteins DRP2B and DRP1A participate together in clathrin%2Dcoated vesicle formation during endocytosis%2E Proc Natl Acad Sci U S A 107%3A 6094%2D6099&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fujimoto M, Arimura S, Ueda T, Takanashi H, Hayashi Y, Nakano A, Tsutsumi N (2010) Arabidopsis dynamin-related proteins DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. Proc Natl Acad Sci U S A 107: 6094-6099

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujimoto&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis dynamin-related proteins DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis dynamin-related proteins DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujimoto&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gadeyne A%2C Sanchez%2DRodriguez C%2C Vanneste S%2C Di Rubbo S%2C Zauber H%2C Vanneste K%2C Van Leene J%2C De Winne N%2C Eeckhout D%2C Persiau G%2C Van De Slijke E%2C Cannoot B%2C Vercruysse L%2C Mayers JR%2C Adamowski M%2C Kania U%2C Ehrlich M%2C Schweighofer A%2C Ketelaar T%2C Maere S%2C Bednarek SY%2C Friml J%2C Gevaert K%2C Witters E%2C Russinova E%2C Persson S%2C De Jaeger G%2C Van Damme D %282014%29 The TPLATE adaptor complex drives clathrin%2Dmediated endocytosis in plants%2E Cell 156%3A 691%2D704&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gadeyne A, Sanchez-Rodriguez C, Vanneste S, Di Rubbo S, Zauber H, Vanneste K, Van Leene J, De Winne N, Eeckhout D, Persiau G, Van De Slijke E, Cannoot B, Vercruysse L, Mayers JR, Adamowski M, Kania U, Ehrlich M, Schweighofer A, Ketelaar T, Maere S, Bednarek SY, Friml J, Gevaert K, Witters E, Russinova E, Persson S, De Jaeger G, Van Damme D (2014) The TPLATE adaptor complex drives clathrin-mediated endocytosis in plants. Cell 156: 691-704

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gadeyne&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The TPLATE adaptor complex drives clathrin-mediated endocytosis in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The TPLATE adaptor complex drives clathrin-mediated endocytosis in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gadeyne&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Geldner N%2C Denervaud%2DTendon V%2C Hyman DL%2C Mayer U%2C Stierhof YD%2C Chory J %282009%29 Rapid%2C combinatorial analysis of membrane compartments in intact plants with a multicolor marker set%2E Plant J 59%3A 169%2D178&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Geldner N, Denervaud-Tendon V, Hyman DL, Mayer U, Stierhof YD, Chory J (2009) Rapid, combinatorial analysis of membrane compartments in intact plants with a multicolor marker set. Plant J 59: 169-178

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Geldner&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid, combinatorial analysis of membrane compartments in intact plants with a multicolor marker set&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid, combinatorial analysis of membrane compartments in intact plants with a multicolor marker set&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Geldner&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gingras S%2C Earls LR%2C Howell S%2C Smeyne RJ%2C Zakharenko SS%2C Pelletier S %282015%29 SCYL2 Protects CA3 Pyramidal Neurons from Excitotoxicity during Functional Maturation of the Mouse Hippocampus%2E J Neurosci 35%3A 10510%2D10522&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gingras S, Earls LR, Howell S, Smeyne RJ, Zakharenko SS, Pelletier S (2015) SCYL2 Protects CA3 Pyramidal Neurons from Excitotoxicity during Functional Maturation of the Mouse Hippocampus. J Neurosci 35: 10510-10522

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gingras&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SCYL2 Protects CA3 Pyramidal Neurons from Excitotoxicity during Functional Maturation of the Mouse Hippocampus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SCYL2 Protects CA3 Pyramidal Neurons from Excitotoxicity during Functional Maturation of the Mouse Hippocampus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gingras&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Harrison SJ%2C Mott EK%2C Parsley K%2C Aspinall S%2C Gray JC%2C Cottage A %282006%29 A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation%2E Plant Methods 2%3A 19&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Harrison SJ, Mott EK, Parsley K, Aspinall S, Gray JC, Cottage A (2006) A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods 2: 19

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Harrison&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Harrison&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hellens RP%2C Edwards EA%2C Leyland NR%2C Bean S%2C Mullineaux PM %282000%29 pGreen%3A a versatile and flexible binary Ti vector for Agrobacterium%2Dmediated plant transformation%2E Plant Mol Biol 42%3A 819%2D832&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42: 819-832

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hellens&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hellens&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hicks GR%2C Raikhel NV %282010%29 Advances in dissecting endomembrane trafficking with small molecules%2E Curr Opin Plant Biol 13%3A 706%2D713&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hicks GR, Raikhel NV (2010) Advances in dissecting endomembrane trafficking with small molecules. Curr Opin Plant Biol 13: 706-713

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hicks&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Advances in dissecting endomembrane trafficking with small molecules&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Advances in dissecting endomembrane trafficking with small molecules&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hicks&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hirst J%2C Edgar JR%2C Borner GH%2C Li S%2C Sahlender DA%2C Antrobus R%2C Robinson MS %282015%29 Contributions of epsinR and gadkin to clathrin%2Dmediated intracellular trafficking%2E Mol Biol Cell 26%3A 3085%2D3103&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hirst J, Edgar JR, Borner GH, Li S, Sahlender DA, Antrobus R, Robinson MS (2015) Contributions of epsinR and gadkin to clathrin-mediated intracellular trafficking. Mol Biol Cell 26: 3085-3103

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hirst&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Contributions of epsinR and gadkin to clathrin-mediated intracellular trafficking&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Contributions of epsinR and gadkin to clathrin-mediated intracellular trafficking&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hirst&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang I%2C Robinson DG %282009%29 Transport vesicle formation in plant cells%2E Curr Opin Plant Biol 12%3A 660%2D669&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hwang I, Robinson DG (2009) Transport vesicle formation in plant cells. Curr Opin Plant Biol 12: 660-669

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hwang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transport vesicle formation in plant cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transport vesicle formation in plant cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hwang&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ichikawa M%2C Hirano T%2C Enami K%2C Fuselier T%2C Kato N%2C Kwon C%2C Voigt B%2C Schulze%2DLefert P%2C Baluska F%2C Sato MH %282014%29 Syntaxin of plant proteins SYP123 and SYP132 mediate root hair tip growth in Arabidopsis thaliana%2E Plant Cell Physiol 55%3A 790%2D800&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ichikawa M, Hirano T, Enami K, Fuselier T, Kato N, Kwon C, Voigt B, Schulze-Lefert P, Baluska F, Sato MH (2014) Syntaxin of plant proteins SYP123 and SYP132 mediate root hair tip growth in Arabidopsis thaliana. Plant Cell Physiol 55: 790-800

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ichikawa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Syntaxin of plant proteins SYP123 and SYP132 mediate root hair tip growth in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Syntaxin of plant proteins SYP123 and SYP132 mediate root hair tip growth in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ichikawa&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ishida T%2C Kurata T%2C Okada K%2C Wada T %282008%29 A genetic regulatory network in the development of trichomes and root hairs%2E Annu Rev Plant Biol 59%3A 365%2D386&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ishida T, Kurata T, Okada K, Wada T (2008) A genetic regulatory network in the development of trichomes and root hairs. Annu Rev Plant Biol 59: 365-386

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ishida&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A genetic regulatory network in the development of trichomes and root hairs&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A genetic regulatory network in the development of trichomes and root hairs&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ishida&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


initiation and tip growth. Plant Cell 14: 763-776Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jung JY, Shin R, Schachtman DP (2009) Ethylene mediates response and tolerance to potassium deprivation in Arabidopsis. Plant Cell21: 607-621


Jurgens G (2004) Membrane trafficking in plants. Annu Rev Cell Dev Biol 20: 481-504Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT (2006) Functional conservation of a root hair cell-specific cis-element in angiosperms with different root hair distribution patterns. Plant Cell 18: 2958-2970


Kitakura S, Vanneste S, Robert S, Lofke C, Teichmann T, Tanaka H, Friml J (2011) Clathrin mediates endocytosis and polar distributionof PIN auxin transporters in Arabidopsis. Plant Cell 23: 1920-1931


Lafer EM (2002) Clathrin-protein interactions. Traffic 3: 513-520Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lam SK, Cai Y, Tse YC, Wang J, Law AH, Pimpl P, Chan HY, Xia J, Jiang L (2009) BFA-induced compartments from the Golgi apparatusand trans-Golgi network/early endosome are distinct in plant cells. Plant J 60: 865-881


Lam SK, Siu CL, Hillmer S, Jang S, An G, Robinson DG, Jiang L (2007) Rice SCAMP1 defines clathrin-coated, trans-golgi-locatedtubular-vesicular structures as an early endosome in tobacco BY-2 cells. Plant Cell 19: 296-319


Lee Y, Bak G, Choi Y, Chuang WI, Cho HT (2008) Roles of phosphatidylinositol 3-kinase in root hair growth. Plant Physiol 147: 624-635Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee YJ, Yang Z (2008) Tip growth: signaling in the apical dome. Curr Opin Plant Biol 11: 662-671Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S (2002) The protein kinase complement of the human genome. Science 298:1912-1934


Martin K, Kopperud K, Chakrabarty R, Banerjee R, Brooks R, Goodin MM (2009) Transient expression in Nicotiana benthamianafluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta. Plant J 59: 150-162


Mishev K, Dejonghe W, Russinova E (2013) Small molecules for dissecting endomembrane trafficking: a cross-systems view. ChemBiol 20: 475-486


Nelson BK, Cai X, Nebenfuhr A (2007) A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis andother plants. Plant J 51: 1126-1136

Pubmed: Author and Title https://plantphysiol.orgDownloaded on January 25, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Jones MA%2C Shen JJ%2C Fu Y%2C Li H%2C Yang Z%2C Grierson CS %282002%29 The Arabidopsis Rop2 GTPase is a positive regulator of both root hair initiation and tip growth%2E Plant Cell 14%3A 763%2D776&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jones MA, Shen JJ, Fu Y, Li H, Yang Z, Grierson CS (2002) The Arabidopsis Rop2 GTPase is a positive regulator of both root hair initiation and tip growth. Plant Cell 14: 763-776

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jones&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis Rop2 GTPase is a positive regulator of both root hair initiation and tip growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis Rop2 GTPase is a positive regulator of both root hair initiation and tip growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jones&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Jung JY%2C Shin R%2C Schachtman DP %282009%29 Ethylene mediates response and tolerance to potassium deprivation in Arabidopsis%2E Plant Cell 21%3A 607%2D621&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jung JY, Shin R, Schachtman DP (2009) Ethylene mediates response and tolerance to potassium deprivation in Arabidopsis. Plant Cell 21: 607-621

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jung&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene mediates response and tolerance to potassium deprivation in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene mediates response and tolerance to potassium deprivation in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jung&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Jurgens G %282004%29 Membrane trafficking in plants%2E Annu Rev Cell Dev Biol 20%3A 481%2D504&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jurgens G (2004) Membrane trafficking in plants. Annu Rev Cell Dev Biol 20: 481-504

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jurgens&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Membrane trafficking in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Membrane trafficking in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jurgens&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim DW%2C Lee SH%2C Choi SB%2C Won SK%2C Heo YK%2C Cho M%2C Park YI%2C Cho HT %282006%29 Functional conservation of a root hair cell%2Dspecific cis%2Delement in angiosperms with different root hair distribution patterns%2E Plant Cell 18%3A 2958%2D2970&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT (2006) Functional conservation of a root hair cell-specific cis-element in angiosperms with different root hair distribution patterns. Plant Cell 18: 2958-2970

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Functional conservation of a root hair cell-specific cis-element in angiosperms with different root hair distribution patterns&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Functional conservation of a root hair cell-specific cis-element in angiosperms with different root hair distribution patterns&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kitakura S%2C Vanneste S%2C Robert S%2C Lofke C%2C Teichmann T%2C Tanaka H%2C Friml J %282011%29 Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis%2E Plant Cell 23%3A 1920%2D1931&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kitakura S, Vanneste S, Robert S, Lofke C, Teichmann T, Tanaka H, Friml J (2011) Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis. Plant Cell 23: 1920-1931

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kitakura&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kitakura&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lafer EM %282002%29 Clathrin%2Dprotein interactions%2E Traffic 3%3A 513%2D520&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lafer EM (2002) Clathrin-protein interactions. Traffic 3: 513-520

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lafer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-protein interactions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin-protein interactions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lafer&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lam SK%2C Cai Y%2C Tse YC%2C Wang J%2C Law AH%2C Pimpl P%2C Chan HY%2C Xia J%2C Jiang L %282009%29 BFA%2Dinduced compartments from the Golgi apparatus and trans%2DGolgi network%2Fearly endosome are distinct in plant cells%2E Plant J 60%3A 865%2D881&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lam SK, Cai Y, Tse YC, Wang J, Law AH, Pimpl P, Chan HY, Xia J, Jiang L (2009) BFA-induced compartments from the Golgi apparatus and trans-Golgi network/early endosome are distinct in plant cells. Plant J 60: 865-881

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lam&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=BFA-induced compartments from the Golgi apparatus and trans-Golgi network/early endosome are distinct in plant cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=BFA-induced compartments from the Golgi apparatus and trans-Golgi network/early endosome are distinct in plant cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lam&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lam SK%2C Siu CL%2C Hillmer S%2C Jang S%2C An G%2C Robinson DG%2C Jiang L %282007%29 Rice SCAMP1 defines clathrin%2Dcoated%2C trans%2Dgolgi%2Dlocated tubular%2Dvesicular structures as an early endosome in tobacco BY%2D2 cells%2E Plant Cell 19%3A 296%2D319&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lam SK, Siu CL, Hillmer S, Jang S, An G, Robinson DG, Jiang L (2007) Rice SCAMP1 defines clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in tobacco BY-2 cells. Plant Cell 19: 296-319

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lam&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rice SCAMP1 defines clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in tobacco BY-2 cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rice SCAMP1 defines clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in tobacco BY-2 cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lam&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee Y%2C Bak G%2C Choi Y%2C Chuang WI%2C Cho HT %282008%29 Roles of phosphatidylinositol 3%2Dkinase in root hair growth%2E Plant Physiol 147%3A 624%2D635&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee Y, Bak G, Choi Y, Chuang WI, Cho HT (2008) Roles of phosphatidylinositol 3-kinase in root hair growth. Plant Physiol 147: 624-635

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of phosphatidylinositol 3-kinase in root hair growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of phosphatidylinositol 3-kinase in root hair growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee YJ%2C Yang Z %282008%29 Tip growth%3A signaling in the apical dome%2E Curr Opin Plant Biol 11%3A 662%2D671&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee YJ, Yang Z (2008) Tip growth: signaling in the apical dome. Curr Opin Plant Biol 11: 662-671

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tip growth: signaling in the apical dome&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tip growth: signaling in the apical dome&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Manning G%2C Whyte DB%2C Martinez R%2C Hunter T%2C Sudarsanam S %282002%29 The protein kinase complement of the human genome%2E Science 298%3A 1912%2D1934&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S (2002) The protein kinase complement of the human genome. Science 298: 1912-1934

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Manning&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The protein kinase complement of the human genome&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The protein kinase complement of the human genome&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Manning&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Martin K%2C Kopperud K%2C Chakrabarty R%2C Banerjee R%2C Brooks R%2C Goodin MM %282009%29 Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization%2C movement and interactions in planta%2E Plant J 59%3A 150%2D162&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Martin K, Kopperud K, Chakrabarty R, Banerjee R, Brooks R, Goodin MM (2009) Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta. Plant J 59: 150-162

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Martin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Martin&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mishev K%2C Dejonghe W%2C Russinova E %282013%29 Small molecules for dissecting endomembrane trafficking%3A a cross%2Dsystems view%2E Chem Biol 20%3A 475%2D486&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mishev K, Dejonghe W, Russinova E (2013) Small molecules for dissecting endomembrane trafficking: a cross-systems view. Chem Biol 20: 475-486

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mishev&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Small molecules for dissecting endomembrane trafficking: a cross-systems view&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Small molecules for dissecting endomembrane trafficking: a cross-systems view&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mishev&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nelson BK%2C Cai X%2C Nebenfuhr A %282007%29 A multicolored set of in vivo organelle markers for co%2Dlocalization studies in Arabidopsis and other plants%2E Plant J 51%3A 1126%2D1136&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nielsen E, Cheung AY, Ueda T (2008) The regulatory RAB and ARF GTPases for vesicular trafficking. Plant Physiol 147: 1516-1526Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Onate-Sanchez L, Vicente-Carbajosa J (2008) DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques.BMC Res Notes 1: 93


Paez Valencia J, Goodman K, Otegui MS (2016) Endocytosis and Endosomal Trafficking in Plants. Annu Rev Plant Biol 67: 309-335Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Park M, Song K, Reichardt I, Kim H, Mayer U, Stierhof YD, Hwang I, Jurgens G (2013) Arabidopsis mu-adaptin subunit AP1M of adaptorprotein complex 1 mediates late secretory and vacuolar traffic and is required for growth. Proc Natl Acad Sci U S A 110: 10318-10323


Park S, Szumlanski AL, Gu F, Guo F, Nielsen E (2011) A role for CSLD3 during cell-wall synthesis in apical plasma membranes of tip-growing root-hair cells. Nat Cell Biol 13: 973-980


Pelletier S (2016) SCYL pseudokinases in neuronal function and survival. Neural Regen Res 11: 42-44Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Preuss ML, Serna J, Falbel TG, Bednarek SY, Nielsen E (2004) The Arabidopsis Rab GTPase RabA4b localizes to the tips of growingroot hair cells. Plant Cell 16: 1589-1603


Robinson DG, Neuhaus JM (2016) Receptor-mediated sorting of soluble vacuolar proteins: myths, facts, and a new model. J Exp Bot67: 4435-4449


Rodriguez-Furlan C, Salinas-Grenet H, Sandoval O, Recabarren C, Arrano-Salinas P, Soto-Alvear S, Orellana A, Blanco-Herrera F(2016) The Root Hair Specific SYP123 Regulates the Localization of Cell Wall Components and Contributes to Rizhobacterial Primingof Induced Systemic Resistance. Front Plant Sci 7: 1081


Schneider R, Hanak T, Persson S, Voigt CA (2016) Cellulose and callose synthesis and organization in focus, what's new? Curr OpinPlant Biol 34: 9-16


Song J, Lee MH, Lee GJ, Yoo CM, Hwang I (2006) Arabidopsis EPSIN1 plays an important role in vacuolar trafficking of soluble cargoproteins in plant cells via interactions with clathrin, AP-1, VTI11, and VSR1. Plant Cell 18: 2258-2274


Sparkes IA, Runions J, Kearns A, Hawes C (2006) Rapid, transient expression of fluorescent fusion proteins in tobacco plants andgeneration of stably transformed plants. Nat Protoc 1: 2019-2025


Sullivan A, Uff CR, Isacke CM, Thorne RF (2003) PACE-1, a novel protein that interacts with the C-terminal domain of ezrin. Exp CellRes 284: 224-238

Pubmed: Author and Title https://plantphysiol.orgDownloaded on January 25, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://search.crossref.org/?page=1&rows=2&q=Nelson BK, Cai X, Nebenfuhr A (2007) A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J 51: 1126-1136

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nelson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nelson&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nielsen E%2C Cheung AY%2C Ueda T %282008%29 The regulatory RAB and ARF GTPases for vesicular trafficking%2E Plant Physiol 147%3A 1516%2D1526&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nielsen E, Cheung AY, Ueda T (2008) The regulatory RAB and ARF GTPases for vesicular trafficking. Plant Physiol 147: 1516-1526

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nielsen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The regulatory RAB and ARF GTPases for vesicular trafficking&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The regulatory RAB and ARF GTPases for vesicular trafficking&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nielsen&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Onate%2DSanchez L%2C Vicente%2DCarbajosa J %282008%29 DNA%2Dfree RNA isolation protocols for Arabidopsis thaliana%2C including seeds and siliques%2E BMC Res Notes 1%3A 93&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Onate-Sanchez L, Vicente-Carbajosa J (2008) DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques. BMC Res Notes 1: 93

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Onate-Sanchez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Onate-Sanchez&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Paez Valencia J%2C Goodman K%2C Otegui MS %282016%29 Endocytosis and Endosomal Trafficking in Plants%2E Annu Rev Plant Biol 67%3A 309%2D335&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Paez Valencia J, Goodman K, Otegui MS (2016) Endocytosis and Endosomal Trafficking in Plants. Annu Rev Plant Biol 67: 309-335

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Paez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Endocytosis and Endosomal Trafficking in Plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Endocytosis and Endosomal Trafficking in Plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Paez&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Park M%2C Song K%2C Reichardt I%2C Kim H%2C Mayer U%2C Stierhof YD%2C Hwang I%2C Jurgens G %282013%29 Arabidopsis mu%2Dadaptin subunit AP1M of adaptor protein complex 1 mediates late secretory and vacuolar traffic and is required for growth%2E Proc Natl Acad Sci U S A 110%3A 10318%2D10323&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park M, Song K, Reichardt I, Kim H, Mayer U, Stierhof YD, Hwang I, Jurgens G (2013) Arabidopsis mu-adaptin subunit AP1M of adaptor protein complex 1 mediates late secretory and vacuolar traffic and is required for growth. Proc Natl Acad Sci U S A 110: 10318-10323

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mu-adaptin subunit AP1M of adaptor protein complex 1 mediates late secretory and vacuolar traffic and is required for growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mu-adaptin subunit AP1M of adaptor protein complex 1 mediates late secretory and vacuolar traffic and is required for growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Park S%2C Szumlanski AL%2C Gu F%2C Guo F%2C Nielsen E %282011%29 A role for CSLD3 during cell%2Dwall synthesis in apical plasma membranes of tip%2Dgrowing root%2Dhair cells%2E Nat Cell Biol 13%3A 973%2D980&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park S, Szumlanski AL, Gu F, Guo F, Nielsen E (2011) A role for CSLD3 during cell-wall synthesis in apical plasma membranes of tip-growing root-hair cells. Nat Cell Biol 13: 973-980

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A role for CSLD3 during cell-wall synthesis in apical plasma membranes of tip-growing root-hair cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A role for CSLD3 during cell-wall synthesis in apical plasma membranes of tip-growing root-hair cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Pelletier S %282016%29 SCYL pseudokinases in neuronal function and survival%2E Neural Regen Res 11%3A 42%2D44&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pelletier S (2016) SCYL pseudokinases in neuronal function and survival. Neural Regen Res 11: 42-44

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pelletier&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SCYL pseudokinases in neuronal function and survival&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SCYL pseudokinases in neuronal function and survival&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pelletier&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Preuss ML%2C Serna J%2C Falbel TG%2C Bednarek SY%2C Nielsen E %282004%29 The Arabidopsis Rab GTPase RabA4b localizes to the tips of growing root hair cells%2E Plant Cell 16%3A 1589%2D1603&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Preuss ML, Serna J, Falbel TG, Bednarek SY, Nielsen E (2004) The Arabidopsis Rab GTPase RabA4b localizes to the tips of growing root hair cells. Plant Cell 16: 1589-1603

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Preuss&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis Rab GTPase RabA4b localizes to the tips of growing root hair cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis Rab GTPase RabA4b localizes to the tips of growing root hair cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Preuss&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Robinson DG%2C Neuhaus JM %282016%29 Receptor%2Dmediated sorting of soluble vacuolar proteins%3A myths%2C facts%2C and a new model%2E J Exp Bot 67%3A 4435%2D4449&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Robinson DG, Neuhaus JM (2016) Receptor-mediated sorting of soluble vacuolar proteins: myths, facts, and a new model. J Exp Bot 67: 4435-4449

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Robinson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Receptor-mediated sorting of soluble vacuolar proteins: myths, facts, and a new model&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Receptor-mediated sorting of soluble vacuolar proteins: myths, facts, and a new model&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Robinson&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Rodriguez%2DFurlan C%2C Salinas%2DGrenet H%2C Sandoval O%2C Recabarren C%2C Arrano%2DSalinas P%2C Soto%2DAlvear S%2C Orellana A%2C Blanco%2DHerrera F %282016%29 The Root Hair Specific SYP123 Regulates the Localization of Cell Wall Components and Contributes to Rizhobacterial Priming of Induced Systemic Resistance%2E Front Plant Sci 7%3A 1081&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rodriguez-Furlan C, Salinas-Grenet H, Sandoval O, Recabarren C, Arrano-Salinas P, Soto-Alvear S, Orellana A, Blanco-Herrera F (2016) The Root Hair Specific SYP123 Regulates the Localization of Cell Wall Components and Contributes to Rizhobacterial Priming of Induced Systemic Resistance. Front Plant Sci 7: 1081

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rodriguez-Furlan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Root Hair Specific SYP123 Regulates the Localization of Cell Wall Components and Contributes to Rizhobacterial Priming of Induced Systemic Resistance.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Root Hair Specific SYP123 Regulates the Localization of Cell Wall Components and Contributes to Rizhobacterial Priming of Induced Systemic Resistance.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rodriguez-Furlan&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schneider R%2C Hanak T%2C Persson S%2C Voigt CA %282016%29 Cellulose and callose synthesis and organization in focus%2C what%27s new%3F Curr Opin Plant Biol 34%3A 9%2D16&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schneider R, Hanak T, Persson S, Voigt CA (2016) Cellulose and callose synthesis and organization in focus, what's new? Curr Opin Plant Biol 34: 9-16

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schneider&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cellulose and callose synthesis and organization in focus, what's new&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cellulose and callose synthesis and organization in focus, what's new&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schneider&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Song J%2C Lee MH%2C Lee GJ%2C Yoo CM%2C Hwang I %282006%29 Arabidopsis EPSIN1 plays an important role in vacuolar trafficking of soluble cargo proteins in plant cells via interactions with clathrin%2C AP%2D1%2C VTI11%2C and VSR1%2E Plant Cell 18%3A 2258%2D2274&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Song J, Lee MH, Lee GJ, Yoo CM, Hwang I (2006) Arabidopsis EPSIN1 plays an important role in vacuolar trafficking of soluble cargo proteins in plant cells via interactions with clathrin, AP-1, VTI11, and VSR1. Plant Cell 18: 2258-2274

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Song&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Song&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sparkes IA%2C Runions J%2C Kearns A%2C Hawes C %282006%29 Rapid%2C transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants%2E Nat Protoc 1%3A 2019%2D2025&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sparkes IA, Runions J, Kearns A, Hawes C (2006) Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat Protoc 1: 2019-2025

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sparkes&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sparkes&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sullivan A%2C Uff CR%2C Isacke CM%2C Thorne RF %282003%29 PACE%2D1%2C a novel protein that interacts with the C%2Dterminal domain of ezrin%2E Exp Cell Res 284%3A 224%2D238&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Surpin M, Zheng H, Morita MT, Saito C, Avila E, Blakeslee JJ, Bandyopadhyay A, Kovaleva V, Carter D, Murphy A, Tasaka M, Raikhel N(2003) The VTI family of SNARE proteins is necessary for plant viability and mediates different protein transport pathways. Plant Cell15: 2885-2899


Takeda S, Gapper C, Kaya H, Bell E, Kuchitsu K, Dolan L (2008) Local positive feedback regulation determines cell shape in root haircells. Science 319: 1241-1244


Tang H, Bowers JE, Wang X, Ming R, Alam M, Paterson AH (2008) Synteny and collinearity in plant genomes. Science 320: 486-488Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Terabayashi T, Funato Y, Fukuda M, Miki H (2009) A coated vesicle-associated kinase of 104 kDa (CVAK104) induces lysosomaldegradation of frizzled 5 (Fzd5). J Biol Chem 284: 26716-26724


Van Damme D, Gadeyne A, Vanstraelen M, Inze D, Van Montagu MC, De Jaeger G, Russinova E, Geelen D (2011) Adaptin-like proteinTPLATE and clathrin recruitment during plant somatic cytokinesis occurs via two distinct pathways. Proc Natl Acad Sci U S A 108: 615-620


Wang C, Hu T, Yan X, Meng T, Wang Y, Wang Q, Zhang X, Gu Y, Sanchez-Rodriguez C, Gadeyne A, Lin J, Persson S, Van Damme D, LiC, Bednarek SY, Pan J (2016) Differential Regulation of Clathrin and Its Adaptor Proteins during Membrane Recruitment forEndocytosis. Plant Physiol 171: 215-229


Wang C, Yan X, Chen Q, Jiang N, Fu W, Ma B, Liu J, Li C, Bednarek SY, Pan J (2013) Clathrin light chains regulate clathrin-mediatedtrafficking, auxin signaling, and development in Arabidopsis. Plant Cell 25: 499-516


Wang D, Harper JF, Gribskov M (2003) Systematic trans-genomic comparison of protein kinases between Arabidopsis andSaccharomyces cerevisiae. Plant Physiol 132: 2152-2165


Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. NatProtoc 2: 1565-1572


Yuan JS, Reed A, Chen F, Stewart CN, Jr. (2006) Statistical analysis of real-time PCR data. BMC Bioinformatics 7: 85Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zeng W, Keegstra K (2008) AtCSLD2 is an integral Golgi membrane protein with its N-terminus facing the cytosol. Planta 228: 823-838Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zheng H, von Mollard GF, Kovaleva V, Stevens TH, Raikhel NV (1999) The plant vesicle-associated SNARE AtVTI1a likely mediatesvesicle transport from the trans-Golgi network to the prevacuolar compartment. Mol Biol Cell 10: 2251-2264



http://search.crossref.org/?page=1&rows=2&q=Sullivan A, Uff CR, Isacke CM, Thorne RF (2003) PACE-1, a novel protein that interacts with the C-terminal domain of ezrin. Exp Cell Res 284: 224-238

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sullivan&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sullivan&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Surpin M%2C Zheng H%2C Morita MT%2C Saito C%2C Avila E%2C Blakeslee JJ%2C Bandyopadhyay A%2C Kovaleva V%2C Carter D%2C Murphy A%2C Tasaka M%2C Raikhel N %282003%29 The VTI family of SNARE proteins is necessary for plant viability and mediates different protein transport pathways%2E Plant Cell 15%3A 2885%2D2899&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Surpin M, Zheng H, Morita MT, Saito C, Avila E, Blakeslee JJ, Bandyopadhyay A, Kovaleva V, Carter D, Murphy A, Tasaka M, Raikhel N (2003) The VTI family of SNARE proteins is necessary for plant viability and mediates different protein transport pathways. Plant Cell 15: 2885-2899

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Surpin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The VTI family of SNARE proteins is necessary for plant viability and mediates different protein transport pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The VTI family of SNARE proteins is necessary for plant viability and mediates different protein transport pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Surpin&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Takeda S%2C Gapper C%2C Kaya H%2C Bell E%2C Kuchitsu K%2C Dolan L %282008%29 Local positive feedback regulation determines cell shape in root hair cells%2E Science 319%3A 1241%2D1244&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Takeda S, Gapper C, Kaya H, Bell E, Kuchitsu K, Dolan L (2008) Local positive feedback regulation determines cell shape in root hair cells. Science 319: 1241-1244

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Takeda&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Local positive feedback regulation determines cell shape in root hair cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Local positive feedback regulation determines cell shape in root hair cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takeda&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tang H%2C Bowers JE%2C Wang X%2C Ming R%2C Alam M%2C Paterson AH %282008%29 Synteny and collinearity in plant genomes%2E Science 320%3A 486%2D488&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tang H, Bowers JE, Wang X, Ming R, Alam M, Paterson AH (2008) Synteny and collinearity in plant genomes. Science 320: 486-488

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Synteny and collinearity in plant genomes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Synteny and collinearity in plant genomes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tang&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Terabayashi T%2C Funato Y%2C Fukuda M%2C Miki H %282009%29 A coated vesicle%2Dassociated kinase of 104 kDa %28CVAK104%29 induces lysosomal degradation of frizzled 5 %28Fzd5%29%2E J Biol Chem 284%3A 26716%2D26724&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Terabayashi T, Funato Y, Fukuda M, Miki H (2009) A coated vesicle-associated kinase of 104 kDa (CVAK104) induces lysosomal degradation of frizzled 5 (Fzd5). J Biol Chem 284: 26716-26724

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Terabayashi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A coated vesicle-associated kinase of 104 kDa (CVAK104) induces lysosomal degradation of frizzled 5 (Fzd5)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A coated vesicle-associated kinase of 104 kDa (CVAK104) induces lysosomal degradation of frizzled 5 (Fzd5)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Terabayashi&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Van Damme D%2C Gadeyne A%2C Vanstraelen M%2C Inze D%2C Van Montagu MC%2C De Jaeger G%2C Russinova E%2C Geelen D %282011%29 Adaptin%2Dlike protein TPLATE and clathrin recruitment during plant somatic cytokinesis occurs via two distinct pathways%2E Proc Natl Acad Sci U S A 108%3A 615%2D620&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Van Damme D, Gadeyne A, Vanstraelen M, Inze D, Van Montagu MC, De Jaeger G, Russinova E, Geelen D (2011) Adaptin-like protein TPLATE and clathrin recruitment during plant somatic cytokinesis occurs via two distinct pathways. Proc Natl Acad Sci U S A 108: 615-620

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Adaptin-like protein TPLATE and clathrin recruitment during plant somatic cytokinesis occurs via two distinct pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Adaptin-like protein TPLATE and clathrin recruitment during plant somatic cytokinesis occurs via two distinct pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang C%2C Hu T%2C Yan X%2C Meng T%2C Wang Y%2C Wang Q%2C Zhang X%2C Gu Y%2C Sanchez%2DRodriguez C%2C Gadeyne A%2C Lin J%2C Persson S%2C Van Damme D%2C Li C%2C Bednarek SY%2C Pan J %282016%29 Differential Regulation of Clathrin and Its Adaptor Proteins during Membrane Recruitment for Endocytosis%2E Plant Physiol 171%3A 215%2D229&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang C, Hu T, Yan X, Meng T, Wang Y, Wang Q, Zhang X, Gu Y, Sanchez-Rodriguez C, Gadeyne A, Lin J, Persson S, Van Damme D, Li C, Bednarek SY, Pan J (2016) Differential Regulation of Clathrin and Its Adaptor Proteins during Membrane Recruitment for Endocytosis. Plant Physiol 171: 215-229

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Differential Regulation of Clathrin and Its Adaptor Proteins during Membrane Recruitment for Endocytosis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Differential Regulation of Clathrin and Its Adaptor Proteins during Membrane Recruitment for Endocytosis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang C%2C Yan X%2C Chen Q%2C Jiang N%2C Fu W%2C Ma B%2C Liu J%2C Li C%2C Bednarek SY%2C Pan J %282013%29 Clathrin light chains regulate clathrin%2Dmediated trafficking%2C auxin signaling%2C and development in Arabidopsis%2E Plant Cell 25%3A 499%2D516&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang C, Yan X, Chen Q, Jiang N, Fu W, Ma B, Liu J, Li C, Bednarek SY, Pan J (2013) Clathrin light chains regulate clathrin-mediated trafficking, auxin signaling, and development in Arabidopsis. Plant Cell 25: 499-516


http://scholar.google.com/scholar?as_q=Clathrin light chains regulate clathrin-mediated trafficking, auxin signaling, and development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Clathrin light chains regulate clathrin-mediated trafficking, auxin signaling, and development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang D%2C Harper JF%2C Gribskov M %282003%29 Systematic trans%2Dgenomic comparison of protein kinases between Arabidopsis and Saccharomyces cerevisiae%2E Plant Physiol 132%3A 2152%2D2165&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang D, Harper JF, Gribskov M (2003) Systematic trans-genomic comparison of protein kinases between Arabidopsis and Saccharomyces cerevisiae. Plant Physiol 132: 2152-2165


http://scholar.google.com/scholar?as_q=Systematic trans-genomic comparison of protein kinases between Arabidopsis and Saccharomyces cerevisiae&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Systematic trans-genomic comparison of protein kinases between Arabidopsis and Saccharomyces cerevisiae&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoo SD%2C Cho YH%2C Sheen J %282007%29 Arabidopsis mesophyll protoplasts%3A a versatile cell system for transient gene expression analysis%2E Nat Protoc 2%3A 1565%2D1572&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc 2: 1565-1572

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yoo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoo&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yuan JS%2C Reed A%2C Chen F%2C Stewart CN%2C Jr%2E %282006%29 Statistical analysis of real%2Dtime PCR data%2E BMC Bioinformatics 7%3A 85&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yuan JS, Reed A, Chen F, Stewart CN, Jr. (2006) Statistical analysis of real-time PCR data. BMC Bioinformatics 7: 85

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yuan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Statistical analysis of real-time PCR data.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Statistical analysis of real-time PCR data.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yuan&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zeng W%2C Keegstra K %282008%29 AtCSLD2 is an integral Golgi membrane protein with its N%2Dterminus facing the cytosol%2E Planta 228%3A 823%2D838&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zeng W, Keegstra K (2008) AtCSLD2 is an integral Golgi membrane protein with its N-terminus facing the cytosol. Planta 228: 823-838

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zeng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=AtCSLD2 is an integral Golgi membrane protein with its N-terminus facing the cytosol&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=AtCSLD2 is an integral Golgi membrane protein with its N-terminus facing the cytosol&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zeng&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zheng H%2C von Mollard GF%2C Kovaleva V%2C Stevens TH%2C Raikhel NV %281999%29 The plant vesicle%2Dassociated SNARE AtVTI1a likely mediates vesicle transport from the trans%2DGolgi network to the prevacuolar compartment%2E Mol Biol Cell 10%3A 2251%2D2264&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zheng H, von Mollard GF, Kovaleva V, Stevens TH, Raikhel NV (1999) The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment. Mol Biol Cell 10: 2251-2264

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zheng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zheng&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1


1 short title: scyl2 genes play a role in plant cell growth · 2017/7/27 · 149 and 21 to 27%...

Documents