10.1.1.325.9871

1995, 69(2):955. J. Virol. J Montali, S Goldstein and C BrownV M Hirsch, G Dapolito, P R Johnson, W R Elkins, W T London, R

correlates with the extent of in vivo replication.species-specific variation in pathogenicityvirus from an African green monkey: Induction of AIDS by simian immunodeficiency

http://jvi.asm.org/content/69/2/955Updated information and services can be found at:

These include:CONTENT ALERTS

morecite this article), Receive: RSS Feeds, eTOCs, free email alerts (when new articles

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on February 23, 2013 by PENN STATE UNIV

http://jvi.asm.org/D

ownloaded from

JOURNAL OF VIROLOGY, Feb. 1995, p. 955967 Vol. 69, No. 20022-538X/95/$04.0010Copyright q 1995, American Society for Microbiology

Induction of AIDS by Simian Immunodeficiency Virus from an AfricanGreen Monkey: Species-Specific Variation in Pathogenicity

Correlates with the Extent of In Vivo ReplicationVANESSA M. HIRSCH,1* GEORGE DAPOLITO,1 PHILIP R. JOHNSON,2 WILLIAM R. ELKINS,1

WILLIAM T. LONDON,3 RICHARD J. MONTALI,4 SIMOY GOLDSTEIN,1

AND CHARLES BROWN5

Immunodeficiency Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and InfectiousDiseases,1 and Division of Molecular Virology and Immunology, Department of Microbiology, Georgetown

University School of Medicine,3 Rockville, Maryland 20852; Department of Pediatrics, ChildrensHospital Research Foundation, The Ohio State University, Columbus, Ohio 432052;

Montgomery Village, Maryland 208794; and Henry M. JacksonFoundation, Rockville, Maryland 208505

Received 29 July 1994/Accepted 4 November 1994

Previous studies suggested that simian immunodeficiency viruses isolated from African green monkeys(SIVagm) are relatively nonpathogenic. The report describes the isolation and biologic and molecular char-acterization of a pathogenic SIVagm strain derived from a naturally infected African green monkey. This virusinduced an AIDS-like syndrome characterized by early viremia, frequent thrombocytopenia, severe lymphoiddepletion, opportunistic infections, meningoencephalitis, and death of five of eight macaques within 1 yearafter infection. An infectious clone derived from this isolate reproduced the immunodeficiency disease inpig-tailed (PT) macaques, providing definitive proof of the etiology of this syndrome. Although the virus washighly pathogenic in PT macaques, no disease was observed in experimentally infected rhesus macaques andAfrican green monkeys despite reproducible infection of the last two species. Whereas infection of PT macaqueswas associated with a high viral load in plasma, peripheral blood mononuclear cells, and tissues, low-levelviremia and infrequent expression in lymph nodes of rhesus macaques and African green monkeys suggest thatdifferences in pathogenicity are associated with the extent of in vivo replication. The availability of a pathogenicmolecular clone will provide a useful model for the study of viral and host factors that influence pathogenicity.

The simian immunodeficiency viruses (SIV) are a polymor-phic family of viruses that share approximately 50% amino acididentity in gag or pol genes between subgroups (20, 27). How-ever, the family can be subclassified into more closely relatedgroups on the basis of the species of origin of a specific isolate.As recently reviewed (20), five SIV groups have been presentlycharacterized: (i) SIVsm from sooty mangabeys (Cercocebusatys), (ii) SIVagm from African green monkeys (Cercopithecusaethiops), (iii) SIVmnd from mandrill monkeys, (iv) SIVsykfrom Sykes monkeys (Cercopithecus mitis), and (v) SIVcpzfrom chimpanzees (Pan troglodytes). Some of these groups canbe further subdivided; thus, the SIVsm group also includesSIVmac isolated from captive macaques (8) and human im-munodeficiency virus type 2. Similarly, the SIVagm group con-sists of at least four related subtypes isolated from the tanta-lus (SIVtan), vervet (SIVver), grivet (SIVgri), and sabaeus(SIVsab) species of African green monkeys (24, 10, 13, 14, 20,23, 24, 29). SIV is highly prevalent within naturally infectedprimates, i.e., 10 to 60% seroprevalence (2, 3, 9, 17, 33, 36) inferal African monkey populations. Despite this high seropreva-lence, there is no evidence that natural infection results inclinical disease, specifically immunodeficiency, in these animals(1, 18). This lack of disease association is apparently charac-teristic of each of the African species naturally infected in thewild.Although naturally infected sooty mangabey monkeys re-

main healthy, passage of the SIVsm virus to Asian species,such as macaques, results in an AIDS-like syndrome that issimilar in many respects to human AIDS (1, 5, 18, 26, 30, 31,34, 38, 39). Therefore, SIVsm and SIVmac infection of ma-caques has become a useful animal model for the study ofAIDS pathogenesis and for vaccine development (11). Ma-caques infected with SIVsm or SIVmac experience a period ofacute plasma- and cell-associated viremia, followed by a pro-gressive decline in the number of circulating CD4 lymphocyteswhich precedes the onset of clinical symptoms (1, 6, 18, 31, 37,41). Early signs of disease include progressive weight loss,failure to thrive, chronic diarrhea, and lymphadenopathy (7).Infected macaques eventually develop opportunistic infectionssuch as Pneumocystis carinii pneumonia, Mycobacterium aviumlymphadenitis and enteritis, candidiasis, adenovirus pancreati-tis, and disseminated cytomegalovirus infections within monthsor years of infection (5, 31, 34, 3841). A significant number ofanimals also develop symptoms of central nervous system pa-thology (40) similar to lesions observed in AIDS dementiapatients.The majority of SIV pathogenesis and vaccine studies have

utilized SIVsm or SIVmac infection of macaques. Isolates fromother SIV groups have not been characterized as extensively interms of pathogenesis, and it has been generally assumed thatSIVmnd, SIVagm, and SIVsyk are nonpathogenic both fortheir natural host and in experimentally inoculated macaques.For example, experimental inoculation of cynomolgus or rhe-sus macaques with SIVagm strains results in persistent infec-tion with a characteristically low virus load and no associateddisease (1, 4, 22, 24). A similar finding was observed for ma-

* Corresponding author. Mailing address: Immunodeficiency Vi-ruses Section, Laboratory of Infectious Diseases, NIAID, NIH, 12441Parklawn Dr., Rockville, MD 20852.

955



ownloaded from

caques inoculated with SIVsyk (20). However, generalizingabout the overall pathogenicity of the whole subgroup ofSIVagm on the basis of these limited experiments may bemisleading. For example, at least two macaques infected withSIVagm strains have developed an AIDS-like disease. Onestudy reported a pig-tailed (PT) macaque (Macaca nemestrina)infected with SIVagm155 uncloned virus that died with Pneu-mocystis pneumonia (15). In addition, SIVagm90 isolated froma naturally infected vervet monkey from the same colony asAgm155 induced a persistent CD4 depletion in experimentallyinoculated PT macaques. One of these animals (PT63) devel-oped a disseminated M. avium infection that necessitated sac-rifice at 12 months postinoculation. SIV was readily isolatedfrom tissues of this animal, and the virus was designatedSIVagm9063.The goal of the present study was to biologically and molec-

ularly characterize this PT-macaque-passaged SIVagm anddetermine whether the infection of animals induced an immu-nodeficiency syndrome. Specifically, the spleen of the immu-nodeficient PT63 was used to isolate virus that was passaged tonaive PT macaques and as a source of genomic DNA for abacteriophage lambda library. Clones derived from this librarywere subsequently analyzed on a molecular level and tested forpathogenicity in PT macaques.

MATERIALS AND METHODSVirus isolation and animal passage. The isolation of SIVagm90 has been

described in a previous report (18, 23). Briefly, virus was isolated from thenaturally infected Agm90 by cocultivation of peripheral blood mononuclear cells(PBMC) with the human CD41 cell line CEMss. The culture supernatants weremonitored for reverse transcriptase (RT) activity, harvested as cell-free virusstocks, and cryopreserved for subsequent animal studies. Two PT macaques wereinoculated intravenously with SIVagm90 stock and became persistently infected,as evidenced by seroconversion and virus isolation from PBMC. The numbers ofcirculating CD4 lymphocytes declined in both animals, and one animal (PT63)was sacrificed with a disseminated M. avium infection at 12 months postchal-lenge. Virus was isolated by cocultivation of CEMss cells with homogenates ofcryopreserved splenic tissue collected at necropsy and designated SIVagm9063.Genomic DNA isolated from the PT63 spleen-CEMss isolate was used forsubsequent molecular analysis, and cell-free supernatants were used to inoculatemacaques.Molecular cloning and analysis. Genomic DNA from the CEMss isolate of

SIVagm9063 was subjected to restriction digestion with various enzymes andSouthern blot analysis using a full-length SIVagm155-4 probe under conditionsof high stringency (21). This analysis demonstrated no internal EcoRI, BamHI,or XbaI sites in the virus genome. EcoRI-digested genomic DNA was sizeselected (9 to 20 kb) on a 10 to 40% sucrose gradient and ligated into EcoRI-digested lambda DASH II (Stratagene, La Jolla, Calif.), and the library waspackaged with Gigapak Gold (Stratagene) packaging extracts. Approximately 53 105 recombinant plaques were screened by use of the full-length SIVagm155-4probe, and four clones were purified to homogeneity (clones 2, 7, 16, and 26).Large-scale liquid cultures of each clone were produced and purified withlambda DNA, and a rough restriction map of each clone was generated. One wasa partial 59-end clone (clone 16), and the other three contained full-lengthproviral genomes. To facilitate sequence analysis, the EcoRI inserts of two of theclones (clones 2 and 7) were subcloned into pGEM-7Zf plasmid vector that hadbeen digested with EcoRI and treated with calf intestinal alkaline phosphatase(Boehringer Mannheim). The viral insert of clone 2 was further subcloned intotwo portions (59 XhoI to SphI and 39 SstI to EcoRI) and sequenced with T7polymerase (Sequenase II; U.S. Biochemical Corp.). The sequence was analyzedwith the Intelligenetics suite of programs (SEQ and GENALIGN) and thePCGene programs.Tissue culture and cells. Virus was isolated from frozen splenic tissue from

PT63 by cocultivation of splenic homogenate with CEMss cells. Cryopreservedsplenic tissue was thawed on ice and subjected to Dounce homogenization inHanks buffered saline solution to disrupt the cells from connective tissue. Thishomogenate (1 ml) was then cocultivated with CEMss cells, and the cultureswere monitored for RT activity and filtered culture supernatants were collectedat the peak of RT activity.The lambda clones were tested for infectivity by transfection of CEMss cells

and 293 cells (human embryonic kidney cells transformed with adenovirus E1aand E1b; American Type Culture Collection) by a modification of the DEAE-dextran transfection and calcium phosphate-mediated (CellPhect; Pharmacia)methods, respectively. Transfected cultures were monitored for RT activity in theculture supernatant, and cell-free supernatants were harvested and cryopre-

served at the peak of RT activity. These stocks were used to test for infectivity ofmacaque PBMC and monocyte-derived macrophages by incubation with thetarget cells for 1 h at 378C, removal of residual virus by washing with Hanksbuffered saline solution, and culture of cells in an appropriate medium (RPMI1640 with 10% interleukin-2 and 10% fetal calf serum for PBMC and RPMI 1640with 10% fetal calf serum and 10% normal macaque serum for monocyte-derivedmacrophages), as described previously for other SIV strains (19).Animal inoculations. A total of eight PT macaques were inoculated intrave-

nously with either cell-free supernatants from the CEMss isolate of SIVagm9063from the spleen of PT63 (n 5 4) or homogenates of PT63 spleen (n 5 4). Thesemacaques were seronegative for both simian T-cell lymphotrophic virus type Iand simian retrovirus, as determined by serology tests. No contemporary mock-inoculated macaques were maintained as a reference; therefore, the acute alter-ations in lymphocyte subsets, hematocrit and platelet counts were verified byusing historical data on uninfected macaques. Two rhesus macaques (Macacamulatta) and two African green monkeys (C. sabaeus) were also inoculated withthe splenic CEMss isolate. Following molecular cloning and transfection, eightPT macaques were inoculated with progeny virus of clone 2. The monkeys weremonitored for evidence of infection by periodic lymphocyte subset analysis,hematology, virus isolation from PBMC and plasma, and SIV-specific antibodies.Virus isolation from infected animals was performed by cocultivation of CEMsscells with 5 3 106 PBMC that had been cultured for 4 days in RPMI 1640 in thepresence of 10% interleukin-2 and 5 mg of phytohemagglutinin per ml. Growthof cultures was continued after cocultivation in media lacking phytohemaggluti-nin and was monitored weekly for RT activity over a 6-week period. SIV p27antigen in the plasma was detected by cross-reactivity with the SIVmac antigencapture kit (Coulter Corp., Hialeah, Fla.). Strips for Western blot (immunoblot)analysis with SIVagm90 virus lysate as the antigen were prepared. First,SIVagm90 was purified from filtered culture supernatants by centrifugation overa 20% sucrose (in phosphate-buffered saline [PBS]) cushion. The virus pelletfrom 90 ml of culture supernatant was resuspended in radioimmunoprecipitationassay buffer, mixed with sample buffer, boiled for 5 min, and loaded onto apreparative sodium dodecyl sulfate [SDS]-polyacrylamide (12%) gel.Lymphocyte immunophenotyping. Lymphocyte subsets (CD2, CD20, CD4,

and CD8) were analyzed sequentially throughout the infection by fluorescence-activated cell sorter analysis using a Coulter Epics 753 (assays were performed byFAST Systems, Inc., Gaithersburg, Md.). Monkey peripheral blood leukocyteswere stained with monoclonal antibodies conjugated to fluorescein isothiocya-nate (FITC), phycoerythrin (Becton Dickinson), or RD-1 (Coulter Immunolo-gy). Heparinized whole-blood samples were incubated for 20 min in the dark at48C in the presence of sodium azide with the appropriate monoclonal antibodyconjugate. Following staining, erythrocytes were lysed and the leukocytes werefixed in 1% paraformaldehyde and analyzed with a Flow cytometer. The mono-clonal antibodies used for PT and rhesus macaque subsets were OKT4 (FITC)(Ortho Diagnostic Systems, Raritan, N.J.) to identify CD4 lymphocytes, Leu2a(FITC) for CD8 lymphocytes, T11 (phycoerythrin) for CD2 lymphocytes (Dako,Inc.) to identify T lymphocytes, and Leu16 (FITC) to identify CD20 expressed onB lymphocytes. The same procedure was used for African green monkey lym-phocytes, with substitution of OKT4a (FITC) for CD4, GC2 (FITC) for CD8,and Leu2 (phycoerythrin) for CD2. These monoclonal antibodies were selectedon the basis of their ability to stain appropriate subsets from samples collectedfrom normal monkeys of these species. Generally, the normal range for CD4lymphocytes in PT macaques was lower than that observed in rhesus macaques.In contrast, peripheral blood of normal uninfected African green monkeys con-tained a much lower proportion of CD4, CD8, and B cells than that of either ofthe macaque species.Generation of riboprobes for in situ hybridization. Five contiguous 1.5- to

2-kb clones of SIVagm9063-2 that together spanned the entire genome werederived by PCR amplification using the full-length plasmid as a template. Thefollowing primers used for amplification incorporated a 59 BamHI site (Forward)and a 39 EcoRI site (Reverse): Agm90-AF (80), 59TACGGATCCGCGGACGGTACCAATGGGGGC 39; Agm90-AR (1620), 59GTTGAATTCTATTGGTCTTCTCCAAAGAGG 39; Agm90-BF (1620), 59 TACGGATCCCCAATAAAAACAGTCATTATT 39; Agm90-BR (3135), 59 GTTGAATTCCACTTGCCAGTAGTCTGCCCA 39; Agm90-CF (3135), 59 TACGGATCCCAAGTGAGCTGGATTCCTGAA 39; Agm90-CR (4635), 59 GTTGAATTCCCTCTTTCTGGTGTTAAATGC 39; Agm90-DF (4635), 59 TACGGATCCAAGAGGCTGGCTCTCTACTTA 39; Agm90-DR (6615), 59 GTTGAATTCAATTAAACCACAAATTTGCTG 39; Agm90-EF (6615), 59 TACGGATCCTTAATTGCCAGGGAGAGTTCT 39; and Agm90-ER (8613), 59 GTTGAATTCCAGTTTCAAATGTCATCTCCC 39. The positions of the 59 nucleotide in each primer relative tothe complete sequence of SIVagm9063-2 are shown in parentheses, and therestriction sites are underlined. The PCR products were gel purified and clonedindividually into the plasmid vector pGEM-7Zf (Promega) and were designatedclones A, B, C, D, and E. The clones were linearized with BamHI to generatetemplates for the antisense probe, which were labeled A1 through E1. EcoRI-digested plasmid was used as the template for generating the sense probe. Theselinearized templates were pooled and transcribed, utilizing Sp6 or T7 to generatean antisense RNA probe and a sense probe labeled with digoxigenin.In situ hybridization. Formalin-fixed, paraffin-embedded tissues were sec-

tioned (4- to 5-mm thickness) and placed on DEPC water-N-tris(hydromethyl)methyl-2-aminoethanesulfonic acid (TES)-coated glass slides before being dried

956 HIRSCH ET AL. J. VIROL.



ownloaded from

at room temperature overnight. The slides were then heated for 5 min and werethen washed sequentially (twice for 5 min) in a mixture of xylene, 100% ethanol,95% ethanol, and DEPC-treated water. The slides were then incubated with 5mM levamisole for 20 min, 13 SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodiumcitrate) for 2 min, and a solution containing 25 mg of proteinase K per ml in 10mM Tris (pH 7.4) and 0.2 mM CaCl2 at 378C for 10 min before further incuba-tions in 0.1 M glycine in PBS for 5 min, 13 PBS for 5 min, and 0.1 M trieth-anolamine0.25% acetic anhydride for 10 min. Slides were prehybridized inprehybridization-hybridization buffer (50% formamide, 43 SSC, 13 Denhardtssolution, 4 mM NaPO4, 0.1% SDS, 5% dextran sulfate, 250 mg of tRNA per ml,250 mg of salmon sperm DNA per ml in DEPC water) in a preheated humiditychamber under a coverslip for 15 min. The probe was added to the hybridizationbuffer to a final concentration of 2.5 ng/ml, and the slides were placed undercoverslips, sealed with rubber cement, heated to 658C for 5 min, chilled on ice,and incubated overnight at 508C. Following hybridization, the coverslips wereremoved and the sections were washed in 23 SSC50% formamide solution at508C for 5 min and then for 1 h, twice for 1 min in 23 SSC, and for 30 min in anRNase solution at 378C (RNase T1 and RNase A in 23 SSC). These washingsteps were repeated, and the slides were blocked with a buffer containing 2%horse serum, 0.3% Tween 20, 150 mM NaCl, and 100 mM Tris (pH 7.4) for 1 h.Following the blocking, the slides were incubated for 1 h with sheep anti-digoxigenin alkaline phosphatase conjugate at a 1:5,000 dilution in PBS2%horse serum, were washed twice, and were incubated with nitroblue tetrazolium5-bromo-4-chloro-3-indolylphosphate toluidinium (NBT-BCIP) substrate in thedark at room temperature for 2 h. The slides were counterstained with nuclearfast red, dehydrated, and placed under coverslips.

RESULTS

Kinetics of SIVagm infection of PT macaques. Virus wasisolated in CEMss cells from cryopreserved splenic homoge-nates collected at necropsy from PT63 and the splenic homo-genate, and the isolate (SIVagm9063) was inoculated into atotal of eight PT macaques (four per virus preparation). Thesplenic homogenate was used to avoid tissue culture selectionthat might result in viral attenuation. All eight animals becamepersistently infected, as evidenced by the isolation of virusfrom PBMC and/or seroconversion, and the outcome of infec-tion in these animals is shown in Table 1. The disease outcomedid not appear to be affected by whether animals received thehomogenate or the culture supernatant. Infection was charac-terized by an early plasma antigenemia in all of the animalsand clinically by anorexia and lethargy during the acute phaseof infection. Immunoreactivity of sequential plasma samples(Fig. 1) demonstrated seroconversion to SIVagm antigens infive animals by week 4 postinoculation, a transient response intwo animals (PT287 and PT292), and failure to seroconvert in

one animal (PT293). The levels of antigen in plasma wereassessed by antigen capture as detailed in Table 2. Generally,antigen was detected during only the acute phase of the infec-tion (after 1 to 2 weeks); however, plasma antigenemia per-sisted throughout the period of infection in a few of the ani-mals. The persistence of antigenemia correlated with thepresence or absence of SIV-specific antibody. Thus, antigen-emia was transient in the five animals that seroconverted,whereas antigenemia persisted (or fluctuated) in animals with-out SIV-specific antibody, such as PT293.The kinetics of sequential antigenemia, lymphocyte subset

alterations, and hematologic changes during the course of in-fection are detailed for four representative PT macaques inFig. 2. An acute viremia that coincided with marked hemato-logic changes was observed in all animals (Table 2). Contem-porary controls that were sham inoculated were not included inthis study; however, such alterations were not observed inprevious studies of such controls (data not shown). Hemato-logic changes included severe leukopenia, lymphopenia, mod-erate anemia, and thrombocytopenia. The lymphopenia whichaffected all subsets was coincident with antigenemia (days 7to 14). Striking hematologic alterations during the acute phaseof infection were also observed; data indicating transientthrombocytopenia coincident with plasma viremia and a con-current but slower decline in the numbers of erythrocytes(measured by changes in the hematocrit level) can be observedin Fig. 2. The mechanism of this pancytopenia was not deter-mined, but the effects may be due to a transient failure ofhematopoiesis or release from the bone marrow compartment.Whereas the changes in platelet numbers and leukocytes areclearly related to the viral infection, the intensive bleedingschedule may have contributed to the alterations in hemato-crit. In historical studies, however, the anemia observed inuninfected animals bled as intensively as these was significantlyless profound. In addition to hematologic changes, all animalswere anorexic and lethargic during the first 2 weeks of infec-tion.Whereas the kinetics of infection during the first 2 weeks of

infection were similar for all animals, the subsequent clinicaloutcome varied significantly, with progression to AIDS rangingfrom 4 months to greater than 2.5 years from inoculation. Allof the animals have evidenced either a rapid or slow decline in

TABLE 1. Summary of clinical and pathologic findings for SIVagm-infected macaques

Virus inoculuma Animal Survival (mos) Significant clinical and pathologic findings

SIVagm90 PT63 12 Dead; M. avium infection disseminated, lymphoid depletionPT59 40 Low CD4 count, no clinical disease

SIVagm9063CEMss isolate PT231 5 Dead; bacterial endocarditis (Staphylococcus aureus), with embolic showers, re-

nal, pulmonary, and brain microabscesses, severe lymphoid depletionPT250 13 Dead; pulmonary and vena caval thrombosis (awaiting histopathology)PT292 .29 Alive; low CD4 (79/ml) count, persistent antigenemia, thrombocytopeniaPT293 4 Dead; aplastic anemia, SIV meningoencephalitis, severe lymphoid depletion,

oral candidiasis, enteritis, and crypt abscesses, granulomatous pneumoniaHomogenate PT232 .29 Alive; low CD4 (99/ml) count, thrombocytopenia, proliferative osteoarthropathy,

weight loss, chronic diarrheaPT287 12 Dead; tarsal bone abscess (Proteus mirabilis, S. aureus), SIV, and protozoal me-

ningoencephalitis, severe lymphoid depletion, M. avium enteritisPT300 13 Dead; thrombocytopenia, chronic proliferative osteoarthropathy of multiple

joints (etiology unknown), follicular hyperplasia (lymphoid)PT308 24 Dead; thrombocytopenia, bacterial endocarditis, and myocarditis with fibrosis,

necrosis, moderate-to-severe generalized lymphoid depletion

a The CEMss isolate was cell-free culture supernatant from a splenic isolate of PT63 in CEMss cells. The homogenate was a filtered homogenate of the spleen ofPT63.

VOL. 69, 1995 SIV VARIATION CORRELATED WITH IN VIVO REPLICATION 957



ownloaded from

circulating CD4 lymphocytes that is generally predictive of theonset of AIDS. As observed previously with macaques inocu-lated experimentally with pathogenic SIVsm and SIVmac iso-lates, one of the eight macaques (PT293) developed a fulmi-nant infection with SIV which was associated with anineffective immune response to the viral infection and persis-tent uncontrolled viremia. The remaining animals in the studyseroconverted and at least initially appeared to have restrictedvirus replication, although eventually all of the animals ap-peared to develop immunodeficiency. The variable diseasecourse is demonstrated by the sequential parameters of fouranimals shown in Fig. 2. Fulminant infection was observed inone animal (PT293); PT293 never recovered preinoculationlymphocyte subset values, remained persistently viremic andantigenemic, experienced an abrupt decline in all lymphocyte

subsets, and was sacrificed at 20 weeks postinoculation. Incontrast, the infection in PT287 was characterized by transientplasma antigenemia and a partial recovery followed by clinicaldeterioration within 1 year of infection. As shown by Fig. 2,circulating lymphocyte levels of PT287 rebounded transientlyand then plummeted between 24 to 32 weeks postinfection,coincident with a rise in plasma antigen levels and a deterio-rating clinical condition. Relatively slow progression to AIDSwas observed for about half the animals. Two of these animals(PT232 and PT308; Fig. 2) cleared the initial plasma antigen-emia and remained clinically stable for 2 years postinoculation.However, despite their longer survival, a progressive decline inCD4 lymphocyte levels and clinical progression of these ani-mals have also been seen. For example, in PT232, a progressiveloss of CD4 lymphocytes and persistent thrombocytopenia in

FIG. 1. Sequential Western blots on plasma samples collected from the PT macaques infected with uncloned SIVagm9063. Four sequential samples are shown foreach of the eight animals: samples taken preinoculation (lanes 1), 4 weeks postinoculation (lanes 2), 8 weeks postinoculation (lanes 3), and 16 weeks postinoculation(lanes 4). The antigen on the Western blot strips was SIVagm90 purified by centrifugation through a 20% sucrose cushion. One animal, PT293, had no detectableSIV-specific antibody, and two additional animals, PT287 and PT292, had very low levels of SIV-specific antibodies.

TABLE 2. SIV p27 antigenemia levels of monkeys experimentally inoculated with uncloned SIVagm9063

Week

Antigenemia level (ng/ml) ina:

PT macaques AGM Rhesusmacaques

231 232 250 287 292 293 300 308 233 234 229 237

Preb 1 1.7 16.00 4.10 0.40 3.60 1.90 10.60 0.69 0.40 2 1.3 2.50 0.15 1.60 0.15 1.50 2.40 0.72 4 0.10 0.22 0.17 1.10 0.10 8 0.08 0.21 4.30 16 0.55 0.52 10.00 24 0.20 2.60 D 32 D 0.60 2.10 40 2.00 48 NT 56 0.52 NT 64 D D NT D

a Plasma antigenemia was measured by the SIV p27 antigen capture kit (Coulter Corp.). , SIV p27 was not detected in the plasma sample. SIV-specific antibody(SIV Ab) was detected by Western blot analysis; PT287 and PT292 exhibited transient antibody responses, PT293 exhibited no response, and all other animals exhibitedsustained responses. D, dead; NT, not tested; AGM, African green monkey.b Pre, sample taken preinoculation.




ownloaded from

FIG.2.Alterations

inlymphocyte

subsets,hematologic

parameters,virus

isolationfrom

PBMC,and

SIVp27

plasmaantigenem

iaduring

thecourse

ofinfectionoffour

PTmacaques

(PT293,PT

287,PT232,and

PT308)

infectedwithuncloned

SIVagm

9063.Parameters

forfour

animalsrepresentative

ofthe

spectrumofdisease

survivalareshow

n.PT293

isrepresentative

ofthe

fulminant

diseaseobserved

inanim

alswithanineffective

immune

response.Thearrow

sindicate

thetimeofnecropsy.T

hebar

graphsinthe

toppaneldem

onstratethe

levelsofantigen

inplasm

aforvarious

weeks

postinfection.n.t.,antigenwasnot

tested;D,dead.T

heplus

andminus

signsabove

thecolum

nsindicate

theresults

ofattem

ptstoisolate

virusfrom

53106PBMC.Theabsolute

numbers

ofcirculating

lymphocyte

subsetsare

graphedinthe

middle

panels,andthe

hematologic

alterationsare

chartedinthe

bottompanels.A

marked

panleukopeniaaffecting

allleukocytesubsets

inallanim

alswasobserved

coincidentwithapeak

ofplasm

avirem

ia.Aconcurrent

declineinplatelet

countsand

aslow

erdecline

inhem

atocritlevelsinallanim

alswerealso

observed.Follow

ingtheacute

viremia,these

parameters

returnedtonear

thebaseline

fortwoanim

als,PT232

andPT308;how

ever,thedeteriorating

clinicalcondition

ofPT287

coincidedwithadecline

inCD4,C

D8,and

Blymphocytes

priortodeath.T

hreeoftheanim

als(PT293,PT

232,andPT287)

alsoexhibited

persistentthrom

bocytopenia,andone

animal(PT

293)was

severelyanem

icprior

todeath.




ownloaded from

FIG.3.Antigenlevels,lymphocytesubsets,andhematologicparametersfortworhesusandtwoAfricangreenmonkeysexperimentallyinfectedwithSIVagmunclonedvirus.AsinFig.2,thetoppanelsshowplasma

p27antigenlevels,themiddlepanelsshowlymphocytesubsets,andthebottompanelsdepicthematologicchangesoftworhesusmacaquesandtwoAfricangreenmonkeysinfectedwithunclonedSIVagm9063.Incontrast

tothefindingsforPTmacaques(Fig.2),onlyonerhesusmacaquehaddetectableplasmaviremia.However,similarlytothePTmacaques,rhesusmacaquesexhibitedpanleukopeniaduringthefirstweekofinfection.

Lymphocytenumbersreturnedrapidlytoandremainedwithinthenormalrange.IncontrasttothePTmacaques,therhesusmacaquesexhibitednothrombocytopeniaoranemia.Noalterationswereobservedinthe

lymphocytesubsetsorhematologicparametersoftheinfectedAfricangreenmonkeys.Virusisolationfrom

PBMC(shownabovethecolumnforeachweek)waslessconsistentthanthatfrom

PBMCofPTmacaques;

bothoftheinfectedrhesusmacaquesappearedtoexperienceatransientviremia.




ownloaded from

FIG. 4. Histopathologic features of infection of PT macaques with SIVagm at end stage AIDS. (A) Mesenteric lymph node (PT293) low-magnification (35)hematoxylin and eosin (H&E) section. (B) Axillary lymph node (PT287) low-magnification (310) H&E section demonstrating follicular depletion. (C) Mesentericlymph node (PT293) H&E section demonstrating syncytial cell in sinusoids. Magnification, 342. (D) Vegetative endocardial lesion (PT231) with Gram stain.Magnification, 317. (E) Gram stain of gram-positive cocci in endocardial lesion of PT231. Magnification, 3105. (F) Brain (PT293) H&E section showing perivascularinfiltration of mononuclear cells. Magnification, 326. (G) Meninges (PT287) H&E section showing a syncytial cell. Magnification, 342. (H) Protozoal organisms in thebrain (PT287) with Gram stain. Magnification, 3170.




ownloaded from

Acrobat NotesColor plate(s) available.

Click on figure caption to view.

conjunction with weight loss are consistent with the onset ofAIDS.Pathologic lesions consistent with an immunodeficiency

syndrome. Infection of PT macaques was associated withlymphadenopathy, splenomegaly, failure to thrive, and chronicdiarrhea. Animals were sacrificed and a full necropsy was per-formed if they developed chronic persistent weight loss, diar-rhea that did not respond to supportive therapy, or clinicalevidence of an opportunistic infection or neoplasm. The out-come in terms of survival is summarized in Table 1. A spectrumof AIDS-related pathology in the necropsied PT macaques wasobserved, although a consistent feature was lymphoid deple-tion. The causes of death varied: (i) aplastic anemia and me-ningoencephalitis for PT293, (ii) bacterial endocarditis forPT231 and PT308, (iii) protozoal encephalitis and tarsal boneabscess for PT287, (iv) M. avium enteritis and lymphadenitisfor PT63, (v) pulmonary artery thrombosis for PT250, and (vi)generalized osteoarthropathy of unknown etiology for PT300.Other more-minor lesions included oral and esophageal can-didiasis (PT293), a granulomatous pneumonia (PT293 andPT287), severe enteritis with crypt abscessation (PT293), andsevere thrombocytopenia (PT293, PT231, PT287, and PT250).Meningoencephalitis with multinucleated giant cells was alsoobserved for two animals (PT293 and PT287). General lesionsincluded lymphoid depletion which varied from moderate tosevere and involved both lymphoid follicles and paracorticalregions. In some lymph nodes, there was evidence of syncytiumformation, particularly within the sinusoids. Severe generalizedlymphoid depletion was evident in tissues of PT293, the animalwith rapid disease progression. A spectrum of pathologic le-sions are depicted in Fig. 4. Thus, as with SIVmac infection ofmacaques, these animals had evidence of opportunistic infec-tions and brain lesions reminiscent of human AIDS dementiasymptoms.Whereas the lymphoid depletion and opportunistic infec-

tions observed were similar to those of human AIDS, therewere some subtle differences. First, the disease course wasmore rapid. Second, some unusual pathologic lesions, such asaplastic anemia, and proliferative osteoarthropathy, were ob-served in some animals. The etiology of these lesions is notknown, but since they are not commonly observed in unin-fected macaques they are presumed to be associated (directlyor indirectly) with SIV infection. Finally, a number of theanimals developed overwhelming bacterial infections, a mani-festation which has not generally been associated with humanAIDS. Since these syndromes have never been observed inuninfected macaques obtained from a common source (data

not shown), these infections are assumed to be due to immunedysfunction related to the SIV infection.Lack of disease in rhesus macaques and African green mon-

keys. Previous studies utilizing the SIVagm90 parental virushad demonstrated immunodeficiency in PT macaques but notrhesus macaques. To assess the species specificity of disease,two naive African green monkeys (C. sabaeus) and two rhesusmacaques were inoculated with the uncloned macaque-pas-saged isolate. All four animals became infected; however, virusisolation from sequential PBMC samples was inconsistent andthus suggestive of a low viral load. In contrast to results for theinfected PT macaques, SIV p27 antigen was not detected insequential plasma samples collected from one of the rhesusmacaques or either African green monkey (Table 2 and Fig. 3).A low level of SIV antigen was detected in plasma samplesfrom RH229 at 1 week postinoculation but not at later timepoints. Lymphocyte subsets remained within normal limits forthe infected African green monkeys. A gradual decline in CD4lymphocytes (but not CD8 cells) was observed for both in-fected rhesus macaques; however, at present (1 year postinfec-tion) the absolute numbers of CD4 lymphocytes have re-mained within normal limits for this species. The rhesusmacaques also experienced a transient lymphopenia during thefirst week of infection, whereas no definitive change in lym-phocyte subsets was observed for the African green monkeys.None of these infected rhesus macaques or African greenmonkeys have developed indications of clinical disease, includ-ing secondary symptoms such as lymphadenopathy, spleno-megaly, anemia, or thrombocytopenia, signs frequently ob-served in the PT macaques.Molecular cloning and characterization of SIVagm9063.

Molecular clones were derived to determine the relationship ofthis isolate to other vervet isolates and the etiology of theimmunodeficiency syndrome. Three full-length clones weregenerated from a bacteriophage lambda library of total cellularDNA extracted from the CEMss isolate from PT63 spleen. Thesequence of the SIVagm9063-2 provirus (;9,000 bp) was de-termined. The genome was similar in organization to that ofother previously characterized SIVagm clones: it encoded theclassical gag, pol, and env genes in addition to vif, tat, rev, nef,and vpr. As shown in Table 3, the amino acid identities of thesevarious protein products are similar to those of other SIVagmclones derived from vervet species of African green monkey.The binding motif for NF-kB within the long terminal repeat(LTR) is duplicated as in other SIVagm clones (22). Since thevirus sequence was derived from an isolate following animalpassage, the divergence from the parental Agm90 isolate wasof particular interest. The envelope and LTR sequences of theparental strain (SIVagm90) were compared with those of thePT63-passaged strain (SIVagm9063). The LTR of the Agm90isolate had been analyzed previously (22) and was 96% similarin terms of nucleotide sequence to the PT-passaged virus LTR.To assess the degree of evolution during macaque strain pas-sage, the envelope of the parental Agm90 virus was cloned andthe predicted amino acid sequence was compared to that ofclone 2. Surprisingly, the envelope genes were highly con-served, suggesting minimal evolution during macaque strainpassage.Demonstration of SIV expression in tissues. An in situ hy-

bridization technique for SIVagm mRNA was developed todetermine the tissue and cellular distributions of the virus. Thiswas necessary because SIVagm-specific antisera are not readilyavailable and no viral antigen was detectable with SIVmneE11S-specific rabbit polyclonal serum (data not shown). A series ofclones that spanned the entire genome of SIVagm9063-2 weregenerated by PCR amplification using the full-length clone as

TABLE 3. Comparison of predicted proteins of SIVagm9063-2with other vervet isolates of SIVagm

Isolates comparedSequence identity (%)

Gag Pol Vif Vpx/r Tat Rev Env Nef LTR

SIVagm9063-2 versus:SIVagm155-4 88 83 68 85 62 56 80 80 84SIVagmTYO-1 90 84 71 90 51 52 81 82 85SIVagm-3 88 84 69 88 59 62 81 83 84SIVagm90a 98 96

SIVagm155-4 versus:SIVagmTYO-1 90 79 74 84 68 63 79 82 86SIVagm-3 89 81 72 87 61 75 82 86 85SIVagm90a 84

a Only a partial sequence of SIVagm90 is available (LTR and envelope).




ownloaded from

FIG. 5. In situ hybridization for viral message using SIVagm-specific probes of lymph node, spleen, ileum, lung, and brain sections. (A) Spleen of PT293 hybridizedwith sense SIV probes (nuclear fast red counterstain), showing lack of specific hybridization. Magnification,35. (B) Mesenteric node of PT293 hybridized with antisenseprobe, demonstrating SIV-specific mRNA expression. Magnification, 35. (C) SIV-expressing cells within the gut-associated lymphoid tissue in the ileum of PT293.Magnification, 326. (D) Multinucleated cells and single cells expressing SIVagm mRNA in the mesenteric lymph node. Magnification, 385. (E) Syncytial cell in thebrain parenchyma of PT287 expressing SIV mRNA. Magnification, 385. (F) Granulomatous pneumonia of PT293 with numerous SIV-expressing multinucleated giantcells. Magnification, 342. (G) Periarteriolar sheath in the spleen of PT293 with numerous SIV-expressing cells. Magnification, 321.




ownloaded from

Acrobat NotesColor plate(s) available.

Click on figure caption to view.

a template. These products were cloned by using BamHI andEcoRI sites introduced by the PCR primers used for amplifi-cation into a plasmid containing the Sp1 and T7 promoters(pGEM-7Zf; Promega). The plasmids were linearized with

BamHI (for T7 transcription for antisense RNA) or EcoRI (forSP6 transcription for sense RNA).In situ hybridization was performed on a variety of lymphoid

and nonlymphoid tissues from two PT macaques. As shown inFig. 5, the antisense probe hybridized to numerous cells withinlymphoid tissues, lung, and brain. In contrast, no signal wasdetected in the same tissues when the sense probe was utilizedor when the antisense probe was used to examine lymph nodesections from an uninfected PT macaque. Thus, the hybridiza-tion is specific both for SIV and for message-sense RNA. Asexpected on the basis of the tropism of this virus, the signal waslocalized to lymphocytes, macrophages, and multinucleatedgiant cells (syncytial cells). The distribution was similar to thatobserved for SIVsm-SIVmac immunohistochemistry or in situhybridization (21, 37, 39): scattered infected cells were ob-served within the paracortex of lymph nodes, the periartierio-lar lymphoid sheaths of the spleen, and occasionally withinmultinucleated giant cells. In addition, viral RNA was detectedin macrophages and multinucleated giant cells within granulo-matous lesions in the lungs and in multinucleated cells withinthe brains and meninges of both animals (Fig. 5). In contrast tothe high level of viral expression in tissues of immunodeficient

FIG. 6. Alterations in absolute numbers of circulating CD4 lymphocytes and levels of SIV p27 antigenemia during the course of infection of PT macaques withcloned SIVagm9063-2. The data have been grouped into those for animals that developed AIDS (on the left), those for animals that remained healthy for approximately21 months (in the middle), and historical data on sequential samples collected from a cohort of uninfected (mock-infected) PT macaques (on the right). While noobvious trend in CD4 counts was observed for the uninfected control group, the SIVagm9063-2-infected animals all experienced a sharp decline in the number ofcirculating CD4 lymphocytes (and other subsets; data not shown) coincident with development of plasma viremia. Those animals that developed AIDS included threewhich were autopsied (Table 3) and one surviving macaque (PT491) that is immunodeficient. The top panel depicts changes in CD4 lymphocyte numbers during thecourse of infection. The CD4 counts continued to decline in those animals that developed AIDS, whereas they slowly returned to within normal limits in those animalsthat did not develop AIDS. In the panels below, the bar graphs show the SIV p27 antigen levels in plasma at the same time points. The symbol for each animal is shownbeside the bar graphs. The degree of plasma antigenemia during the acute phase of infection did not appear to correlate with the rapidity of the clinical course; thepersistence of plasma viremia, however, was a clear correlate with a poor outcome.

TABLE 4. RT activity after infection or transfection ofSIVagm9063 clones

Clone

Activity detected aftera:

Transfection of: Infection of PTmacaque cells

CEMss 293 PBMC MDM

2 1 1 1 17 2 1 2 NT26 2 2 NT NT

a CEMss cells were transfected by DEAE-dextran, and 293 cell transfectionwas calcium phosphate mediated. 1, positive RT; 2, negative RT in culturesupernatants. PBMC were infected with filtered culture supernatants from trans-fected 293 cells. Monocyte-derived macrophages (MDM) were infected withfiltered supernatant from infected PBMC. NT, not tested.




ownloaded from

PT macaques (Fig. 5), only occasional cells expressing viralmRNA (fewer than one per high-power field) were detected inlymph node biopsies obtained at 1 year postinoculation fromeither of the healthy SIVagm9063-infected rhesus macaques orthe African green monkeys.Biologic activities of SIVagm clones in vitro and in vivo.

Biologic activities of the three full-length clones were assessedby transfection of 293 and CEMss cells. Both clones 2 and 7produced RT following transient transfection of 293 cells (Ta-ble 4); however, only clone 2 was infectious following transfec-tion of CEMss cells. In addition, cell-free supernatant from 293cells transfected with clone 2 was infectious for PT macaquePBMC (within 7 to 10 days). A virus stock representing clone2 generated in macaque PBMC, which efficiently infected PTmacaque PBMC and monocyte-derived macrophages, wasused for subsequent animal studies.Infectivity and pathogenicity of SIVagm9063-2 molecularly

cloned virus was assessed following inoculation of eight PTmacaques. All the animals became persistently infected as ev-idenced by virus isolation from PBMC and were transientlyanorexic and lethargic. The cloned virus reproduced the kinet-ics of infection observed with parental uncloned virus stock.Thus, as seen by the data in Fig. 6, all the animals were acutelyantigenemic and experienced a concurrent leukopenia (onlyCD4 is graphed). All the animals also experienced a transientanemia and thrombocytopenia (data not shown). During the14 months after inoculation (Table 5), many of the animalsexperienced significant persistent thrombocytopenia, CD4 de-pletion, weight loss, anorexia, failure to thrive, or chronic di-arrhea; these clinical signs were life threatening and necessi-tated euthanasia of three macaques. Preliminary pathologicanalyses demonstrated severe lymphoid depletion, meningoen-cephalitis (n 5 1), M. avium infection (n 5 1), P. carinii pneu-monia (n 5 1), and lymphoreticular sarcoma (n 5 1). Thesedata indicate that the molecularly cloned virus induces thesame AIDS-like syndrome observed with the parental virus.One animal (PT485) developed the fulminant disease alsoobserved in one macaque infected with uncloned SIVagm.However, the progression of disease appeared to be somewhatslower than that observed with the uncloned virus and two ofthe animals have maintained normal lymphocyte subsets thatmay be predictive of long-term survival. These studies demon-strate that SIVagm isolates are capable of inducing an AIDS-like syndrome that can be definitively associated with viralinfection.

DISCUSSION

This report describes the isolation of a SIVagm strain withspecies-specific pathogenicity and the derivation of a represen-tative pathogenic molecular clone. The SIVagm9063 isolateinduced an immunodeficiency syndrome similar to that re-ported in SIVsm- and SIVmac-infected macaques (21, 30, 31,34, 3840). This finding contrasts with the previous reports ofexperimental SIVagm infection in which no disease was ob-served (1, 22, 24). A consistent acute viremia with a coincidentdecline in the levels of all lymphocyte subsets, followed by aprogressive depletion of CD4 lymphocytes, was observed forall PT macaques inoculated with this SIVagm isolate. Half ofthe study animals were euthanized within 1 year of inoculationbecause of wasting, chronic diarrhea, clinical deterioration,and/or opportunistic infections. Pathologic features includedgeneralized severe lymphoid depletion in association with op-portunistic infections and, in some cases, SIV-induced menin-goencephalitis. In situ hybridization for SIV mRNA expressionin tissues demonstrated that this syndrome was associated withhigh levels of viral expression in lymphoid and some nonlym-phoid tissues (i.e., brain and lung). Viral expression appearedto be generally restricted to lymphocytes, macrophages, andmultinucleated giant cells, similarly to the distribution ofSIVsm and SIVmac in infected animals (35, 38). Finally, amolecular clone of this virus strain reproduced the immuno-deficiency disease of the parental uncloned virus strain, thusproviding an etiologic link between the virus and the disease.Despite the derivation of increasing numbers of full-lengthinfectious SIV clones, few cloned viruses are pathogenic uponinoculation of susceptible hosts or reproduce the pathogenicpotential of uncloned viruses. Thus, this is only the third reportof a highly pathogenic SIV cloned virus and the first report ofa pathogenic SIVagm cloned virus. Other pathogenic molecu-lar clones have represented a SIVmac-SIVsm subtype. One ofthese viruses (SIVmac239) induces an AIDS-like syndrome(28), whereas the other virus, SIVsmmPBj (12, 35), induces anovel acutely lethal diarrheal syndrome (15) rather than clas-sical immunodeficiency. The reproduction of disease with theSIVagm molecularly cloned virus confirms that this syndromeresults from SIV infection and not from other adventitiousagents that might have been passaged with the parental un-cloned virus stock.Despite the profound immunosuppression observed in PT

macaques, inoculation of rhesus macaques, a related species,did not result in obvious disease. In addition, although exper-

TABLE 5. Clinical and virologic findings for macaques infected with SIVagm cloned virus

Animal Peak plasmaa

SIV p27 (ng/ml) Survival (mos) Clinical signs and pathologic findingsb

PT470 6.5 .21 Healthy; normal CD4 (1,151/ml) count, v.i. negative since 8 wks p.i.PT485 15.0 10 Dead; weight loss, chronic diarrhea, SIV Ab2, atrophic enteropathy, severe colitis,

granulomatous meningoencephalitis, lymphoid depletionPT487 7.5 13 Dead; thrombocytopenia, widely disseminated M. avium (lymph nodes, spleen, thymus,

bone marrow, liver, lung, intestine), P. carinii pneumonia, lymphoid depletion, SIVencephalitis

PT488 4.5 .21 Healthy; normal CD4 (1,161/ml) count, consistently v.i.1PT490 9.5 .21 Weight loss, chronic diarrhea, low CD4 (678/ml) count, consistently v.i.1PT491 7.5 .21 Weight loss, chronic diarrhea, low CD4 (147/ml) count, consistently v.i.1PT493 4.0 13 Dead; thrombocytopenia, metastatic lymphoreticular sarcoma, enteropathy, lymphoid

hyperplasia, pulmonary artery thrombosisPT497 7.5 .21 Healthy; normal CD4 (1,262/ml) count, v.i.1 (inconsistent)

a Peak plasma antigen levels assayed with the Coulter SIV p27 antigen capture kit.b v.i.1, positive virus isolation from 5 3 106 PBMC. CD4 numbers are the most recent values from 21 months postinoculation (p.i.). Ab2, antibody negative.




ownloaded from

imental inoculation of rhesus macaques and African greenmonkeys resulted in persistent infection, the infected animalsremained healthy. This is not the only SIV model for whichunique susceptibility of PT macaques to infection or diseasehas been observed. For example, PT macaques can be infectedwith human immunodeficiency virus type 1, albeit without theirshowing signs of disease. In addition, the acutely lethal SIVsmvariant, SIVsmmPBj, induces the acute disease in only a thirdof experimentally infected rhesus macaques, whereas this virusis uniformly lethal to PT macaques (15, 32, 35). The uniquedisease susceptibility of SIVagm9063 may partially explain pre-vious reports of attenuation of SIVagm, since most previousstudies utilized African green monkeys, rhesus macaques, orcynomolgus macaques. At least two of these species are notsusceptible to SIVagm9063-induced immunodeficiency. Thus,other SIVagm isolates (particularly those from vervet mon-keys) might be equally pathogenic if tested in an appropriateanimal model. This variation in susceptibility also underscoresthe pitfalls of designating a SIV strain attenuated, since thehost response determines at least in part the pathogenicity ofthe virus.Finally, the SIVagm animal model provides a basis to study

host variation in response to infection. This model has anadvantage over the SIVsm-SIVmac macaque models in thatboth the highly susceptible and natural host species are readilyavailable for study, whereas few sooty mangabey monkeys, thenatural host of SIVsm-SIVmac viruses, are available for exper-imental studies. The underlying mechanism(s) for the differ-ential host response to this virus is a still a matter for specu-lation. Whereas PT macaques were highly viremic during theacute phase of infection, viral replication appeared to be highlyrestricted in both rhesus macaques and African green mon-keys. Low-to-absent plasma viremia levels during the acutephase of infection in rhesus and African green monkeys sug-gest that virus replication is less efficient than that in infectedPT macaques. Thus, low-level plasma viremia was detected inonly one rhesus macaque, virus isolation was inconsistent, SIV-specific antibody levels rose more slowly than in PT macaquesdespite the absence of plasma viremia, and only rare SIV-expressing cells were observed by in situ hybridization of lymphnodes. These data are consistent with inefficient in vivo repli-cation and maintenance of a light viral load in rhesus macaquesand African green monkeys. Thus, the differential virulence ofthis virus is likely associated with the extent and efficiency of invivo replication in these three species of primate. Interestingly,in vitro replication in rhesus macaque PBMC and macro-phages was a poor predictor of in vivo pathogenicity in rhesusmacaques. Further studies will be required to delineate differ-ences in the host immune response or viral replication thatdetermine the species-specific pathogenesis of this virus.

ACKNOWLEDGMENTS

We thank Robert Chanock for his continued support; Philip M.Zack and Mark Lewis for useful discussions and consultations; RussellByrum for assistance in animal studies; and Anna Hahn, Mae RanChung, and Robert Goeken for technical assistance.

REFERENCES1. Allan, J. S. 1991. Pathogenic properties of simian immunodeficiency virusesin nonhuman primates, p. 191206. InW. Koff et al. (ed.), Annual review ofAIDS research, vol. 1. Marcel Dekker, New York.

2. Allan, J. S., P. Kanda, R. C. Kennedy, E. K. Cobb, M. Anthony, and J. W.Eichberg. 1990. Isolation and characterization of simian immunodeficiencyviruses from two subspecies of African green monkeys. AIDS Res. Hum.Retroviruses 6:275285.

3. Allan, J. S., M. Short, M. E. Taylor, S. Su, V. M. Hirsch, P. R. Johnson, G. M.Shaw, and B. H. Hahn. 1991. Species-specific diversity among simian immu-nodeficiency viruses from African green monkeys. J. Virol. 65:28162828.

4. Baier, M., A. Werner, K. Cichutek, C. Garber, C. Muller, G. Kraus, F. J.Ferdinand, S. Hartung, T. S. Papas, and R. Kurth. 1989. Molecularly clonedsimian immunodeficiency virus SIVagm3 is highly divergent from otherSIVagm isolates and is biologically active in vitro and in vivo. J. Virol.63:51195123.

5. Baskin, G. B., M. Murphey-Corb, E. A. Watson, and L. N. Martin. 1988.Necropsy findings in rhesus monkeys experimentally infected with culturedsimian immunodeficiency virus (SIV/Delta). Vet. Pathol. 25:456467.

6. Benveniste, R. E., W. R. Morton, E. A. Clark, C.-C. Tsai, H. D. Ochs, J. M.Ward, L. Kuller, W. B. Knott, R. W. Hill, M. J. Gale, and M. E. Thouless.1988. Inoculation of baboons and macaques with simian immunodeficiencyvirus/Mne, a primate lentivirus closely related to human immunodeficiencyvirus type 2. J. Virol. 62:20912101.

7. Chalifoux, L. V., D. J. Ringler, N. W. King, P. K. Sehgal, R. C. Desrosiers,M. D. Daniel, and N. L. Letvin. 1987. Lymphadenopathy in macaques ex-perimentally infected with simian immunodeficiency virus (SIV). Am. J.Pathol. 128:104110.

8. Daniel, M. D., N. L. Letvin, N. W. King, M. Kannagi, P. Sehgal, R. D. Hunt,P. Kanki, M. Essex, and R. C. Desrosiers. 1985. Isolation of a T-cell tropicHTLV-III-like retrovirus from macaques. Science 228:12011204.

9. Daniel, M. D., N. L. Letvin, P. K. Sehgal, D. K. Schmidt, D. P. Silva, K. R.Solomon, F. S. Hodi, D. J. Ringler, R. D. Hunt, N. W. King, and R. C.Desrosiers. 1988. Prevalence of antibodies to 3 retroviruses in a captivecolony of macaque monkeys. Int. J. Cancer 41:601608.

10. Daniel, M. D., Y. Li, Y. M. Naidu, P. J. Durda, D. K. Schmidt, C. D. Troup,D. P. Silva, J. J. MacKey, H. W. Kestler III, P. K. Sehgal, N. W. King, Y.Ohta, M. Hayami, and R. C. Desrosiers. 1988. Simian immunodeficiencyviruses from African green monkeys. J. Virol. 62:41234128.

11. Desrosiers, R. C., and D. J. Ringler. 1989. Use of simian immunodeficiencyviruses for AIDS research. Intervirology 30:301312.

12. Dewhurst, S., J. E. Embertson, D. C. Anderson, J. I. Mullins, and P. N. Fultz.1990. Sequence analysis and pathogenicity of molecularly cloned SIVsmm-PBj14. Nature (London) 345:636640.

13. Fomsgaard, A., V. M. Hirsch, J. S. Allan, and P. R. Johnson. 1991. A highlydivergent proviral DNA clone of SIV from a distinct species of African greenmonkey. Virology 182:397402.

14. Fukasawa, M., T. Miura, A. Hasegawa, S. Morikawa, H. Tsujimoto, K. Miki,T. Kitamura, and M. Hayami. 1988. Sequence of simian immunodeficiencyvirus from African green monkey, a new member of the HIV/SIV group.Nature (London) 333:457461.

15. Fultz, P. N., and P. M. Zack. 1994. Unique lentivirus-host interactions:SIVsmmPBj14 infection of macaques. Virus Res. 32:205225.

16. Gravell, M., W. T. London, R. S. Hamilton, G. Stone, and M. Monzon. 1989.Infection of macaque monkeys with simian immunodeficiency virus fromAfrican green monkeys: virulence and activation of latent infection. J. Med.Primatol. 18:247256.

17. Hendry, R. M., M. A. Wells, M. A. Phelan, A. L. Schneider, J. S. Epstein, andG. V. Quinnan. 1986. Antibodies to simian immunodeficiency virus in Afri-can green monkeys in Africa in 19571962. Lancet ii:455.

18. Hirsch, V. M., and P. R. Johnson. 1994. Pathogenic diversity of simianimmunodeficiency viruses. Virus Res. 32:183203.

19. Hirsch, V. M., J. E. Martin, G. Dapolito, W. R. Elkins, W. T. London, S.Goldstein, and P. R. Johnson. 1994. Spontaneous substitutions in the V3analog affect cell tropism and pathogenicity of simian immunodeficiencyvirus. J. Virol. 68:26492661.

20. Hirsch, V. M., G. Myers, and P. R. Johnson. 1993. Genetic diversity andphylogeny of primate lentiviruses, p. 221240. InW. J. W. Morrow and N. L.Haigwood (ed.), HIV molecular organization, pathogenicity and treatment.Elsevier Science Publishers, Amsterdam.

21. Hirsch, V. M., P. M. Zack, A. P. Vogel, and P. R. Johnson. 1991. Simianimmunodeficiency virus infection of macaques: end-stage disease is charac-terized by widespread distribution of proviral DNA in tissues. J. Infect. Dis.163:976988.

22. Honjo, S., T. Narita, R. Kobayashi, A. Hiyaoka, K. Fujimoto, M. Takaska, I.Sakakabara, R. Mukai, K. Ishikawa, Y. Ohata, and M. Hayami. 1990. Ex-perimental infection of African green monkeys and cynomolgus monkeyswith a SIVagm strain isolated from a healthy African green monkey. J. Med.Primatol. 19:920.

23. Johnson, P. R., A. Fomsgaard, J. Allan, M. Gravell, W. T. London, R. A.Olmsted, and V. M. Hirsch. 1990. Simian immunodeficiency viruses fromAfrican green monkeys display unusual genetic diversity. J. Virol. 64:10861092.

24. Johnson, P. R., S. Goldstein, W. T. London, A. Fomsgaard, and V. M.Hirsch. 1990. Molecular clones of SIVsm and SIVagm: experimental infec-tion of macaques and African green monkeys. J. Med. Primatol. 19:279286.

25. Johnson, P. R., M. Gravell, J. Allan, S. Goldstein, R. A. Olmsted, G. Da-polito, C. McGann, W. T. London, R. Purcell, and V. M. Hirsch. 1989.Genetic diversity among simian immunodeficiency virus from African greenmonkeys. J. Med. Primatol. 18:271277.

26. Johnson, P. R., and V. M. Hirsch. 1991. SIV Infection of macaques as amodel for AIDS pathogenesis. Int. Rev. Immunol. 8:2331.

27. Johnson, P. R., G. Myers, and V. M. Hirsch. 1991. Genetic diversity and




ownloaded from

phylogeny of non-human primate lentiviruses, p. 4762. In W. Koff et al.(ed.), Annual review of AIDS research, vol. 1. Marcel Dekker, New York.

28. Kestler, H. W., T. Kodama, D. Ringler, M. Marthas, N. Pederson, A. Lack-ner, D. Rieger, P. Sehgal, M. Daniel, N. King, and R. Desrosiers. 1990.Induction of AIDS in rhesus monkeys by molecularly cloned simian immu-nodeficiency virus. Science 248:11091112.

29. Kraus, G., A. Werner, M. Baier, D. Binniger, F. J. Ferdinand, S. Norley, andR. Kurth. 1989. Isolation of human immunodeficiency virus-related simianimmunodeficiency virus from African green monkeys. Proc. Natl. Acad. Sci.USA 86:28922896.

30. Letvin, N. L., M. D. Daniel, P. K. Sehgal, R. C. Desrosiers, R. D. Hunt, L. M.Waldron, J. J. MacKey, D. K. Schmidt, L. V. Chalifoux, and N. W. King.1985. Induction of AIDS-like disease in macaque monkeys with T-cell tropicretrovirus STLV-III. Science 230:7173.

31. Letvin, N. L., and N. W. King. 1990. Immunologic and pathologic manifes-tations of the infection of rhesus monkeys with simian immunodeficiencyvirus of macaques. J. Acquired Immune Defic. Syndr. 3:10231040.

32. Lewis, M. G., P. M. Zack, W. R. Elkins, and P. B. Jahrling. 1992. Infectionof rhesus and cynomolgus macaques with a rapidly fatal SIV (SIVsmm/PBj)isolate from sooty mangabeys. AIDS Res. Hum. Retroviruses 8:16311639.

33. Lowenstine, L. J., N. C. Pederson, J. Higgins, K. C. Pallis, A. Uyeda, P.Marx, N. W. Lerche, R. J. Munn, and M. B. Gardner. 1986. Seroepidemio-logic survey of captive old-world primates for antibodies to human andsimian retroviruses, and isolation of a lentivirus from a sooty mangabey(Cercocebus atys). Int. J. Cancer 38:563574.

34. McClure, H. M., D. C. Anderson, P. N. Fultz, A. A. Ansari, E. Lockwood, andA. Brodie. 1989. Spectrum of disease in macaque monkeys chronically in-fected with SIVsmm. Vet. Immunol. Immunopathol. 21:1324.

35. Novembre, F. N., P. R. Johnson, M. G. Lewis, D. C. Anderson, S. Klumpp,H. M. McClure, and V. M. Hirsch. 1993. Multiple viral determinants con-tribute to pathogenicity of the acutely lethal SIVsmmPBj variant. J. Virol.67:24662474.

36. Ohata, Y., T. Masuda, H. Tsujimoto, T. Ishikawa, T. Kodama, S. Morikawa,M. Nakai, S. Honjo, and M. Hayami. 1988. Isolation of simian immunode-ficiency virus from African green monkeys and seroepidemiologic survey ofthe virus in various nonhuman primates. Int. J. Cancer 41:115122.

37. Reimann, K. A., K. Tenner-Racz, P. Racz, D. C. Montefiori, Y. Yasutomi, W.Lin, B. J. Ransil, and N. L. Letvin. 1994. Immunopathogenic events in acuteinfection of rhesus monkeys with simian immunodeficiency virus of ma-caques. J. Virol. 68:23622370.

38. Ringler, D. J., M. S. Wyand, D. G. Walsh, J. J. MacKey, L. V. Chalifoux, M.Popovic, A. A. Minassen, P. K. Sehgal, R. C. Desrosiers, and N. W. King.1989. Cellular localization of simian immunodeficiency virus in lymphoidtissues. I. Immunohistochemistry and electron microscopy. Am. J. Pathol.134:373383.

39. Simon, M. A., S. J. Brodie, V. G. Sassevile, L. V. Chalifoux, R. C. Desrosiers,and D. J. Ringler. 1994. Immunopathogenesis of SIVmac. Virus Res. 32:227251.

40. Ward, J. M., T. J. OLeary, G. B. Baskin, R. Benveniste, C. A. Harris, P. L.Nara, and R. H. Rhodes. 1987. Immunohistochemical localization of humanand simian immunodeficiency viral antigens in fixed tissue sections. Am. J.Pathol. 127:199205.

41. Zhang, J., L. N. Martin, E. A. Warson, R. C. Montelaro, M. West, L. Epstein,and M. Murphey-Corb. 1988. Simian immunodeficiency virus/Delta-inducedimmunodeficiency disease in rhesus monkeys: relation of antibody responseand antigenemia. J. Infect. Dis. 158:12771286.




ownloaded from



ownloaded from

10.1.1.325.9871

Documents

infected african green

african green monkeyssivagm

extent of

simian immunodeficiencyhttp

w r elkins

infection of pt macaqueswas

lymph nodes of rhesus

p r johnson