1,2 , jack phan , merav strauss, sherrie tafuri , and ... · 1 cholesterol and cholate components...
TRANSCRIPT
![Page 1: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/1.jpg)
1
Cholesterol and cholate components of an atherogenic diet induce distinct
stages of hepatic inflammatory gene expression
Laurent Vergnes 1,2, Jack Phan 1,2, Merav Strauss, Sherrie Tafuri 3, and Karen
Reue 1,2
1Departments of Medicine and Human Genetics, University of California, Los Angeles,
CA; 2Veterans Administration Greater Los Angeles Healthcare System, Los Angeles,
CA 90073; 3Pfizer Global Research and Development, Ann Arbor Laboratories, Ann
Arbor, Michigan 48105.
Correspondence to Karen Reue, 11301 Wilshire Blvd., Building 113 Room 312, Los
Angeles, CA 90073. Email [email protected] Phone (310) 478-3711 x42171 Fax (310)
268-4981.
JBC Papers in Press. Published on August 15, 2003 as Manuscript M306022200 by guest on M
arch 13, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 2: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/2.jpg)
2
SUMMARY
Atherosclerosis in inbred mouse strains has been widely studied using an
atherogenic (Ath) diet containing cholesterol, cholic acid, and fat, but the effect of these
components on gene expression has not been systematically examined. We employed
DNA microarrays to interrogate gene expression levels in liver of C57BL/6J mice fed
five diets: mouse chow, the Ath diet, or modified versions of the Ath diet in which either
cholesterol, cholate, or fat were omitted. Dietary cholesterol and cholate produced
discrete gene expression patterns. Cholesterol was required for induction of genes
involved in acute inflammation, including three genes of the serum amyloid A family,
three major histocompatibility class II antigen genes, and various cytokine-related
genes. In contrast, cholate induced expression of genes involved in extracellular matrix
deposition in hepatic fibrosis, including five collagen family members, collagen
interacting proteins, and connective tissue growth factor. The gene expression findings
were confirmed by biochemical measurements showing that cholesterol was required
for elevation of circulating serum amyloid A, and cholate was required for accumulation
of collagen in the liver. The possibility that these gene expression changes are relevant
to atherogenesis in C57BL/6J mice was supported by the observation that the closely
related, yet atherosclerosis resistant, C57BL/6ByJ strain was largely resistant to dietary
induction of the inflammatory and fibrotic response genes. These results establish that
cholesterol and cholate components of the Ath diet have distinct proatherogenic effects
on gene expression, and suggest a strategy to study the contribution of acute
inflammatory response and fibrogenesis independently through dietary manipulation.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/3.jpg)
3
INTRODUCTION
The mouse has become established as a key animal model for studies of lipid
metabolism and atherosclerosis, due to the development of techniques for genetic
manipulation and tools for gene discovery in this species (reviewed in (1-4)). The first
studies to demonstrate that the mouse might provide a useful model for characterization
of genetic factors affecting atherosclerosis susceptibility appeared more than 30 years
ago. These studies surveyed several inbred laboratory mouse strains and
demonstrated that some strains develop early atheromatous lesions when fed
experimental diets. These diets contained high concentrations of cholesterol (5%) and
fat (30%) supplemented either with cholic acid (2%) (5), or fed in combination with
irradiation treatments (6). These early diets produced high mortality, and were
subsequently modified to reduce the concentrations of cholesterol (1.25%), fat (15%),
and cholate (0.5%). Using this modified atherogenic (Ath) diet, Paigen and others
demonstrated that fatty streak lesion formation is reproducible within a strain, and that
strains differ in their susceptibility (7,8). The C57BL/6J strain was among the most
susceptible, and has been extensively used as a model for diet-induced atherosclerosis.
Although the Ath diet has been widely used to study atherogenesis in C57BL/6J
and other mouse strains, the effects of the individual dietary components have not been
well characterized. In susceptible mouse strains, the Ath diet produces an atherogenic
lipoprotein profile and induces inflammatory gene expression in the liver. For example,
C57BL/6J mice fed the Ath diet exhibit dramatically elevated low density/very low
density lipoprotein (LDL/VLDL) and reduced high density lipoprotein (HDL) cholesterol
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/4.jpg)
4
levels (8,9). In this strain, the Ath diet also induces inflammatory and oxidative stress
genes such as serum amyloid A, monocyte chemotactic protein-1, colony-stimulating
factors, and heme oxygenase (10). It is unclear at present which component(s) of the
atherogenic diet produce the observed effects on lipoproteins and inflammation.
Furthermore, previous work indicates that reduction in the concentration of either
cholesterol or cholate in the Ath diet decreases the rate of aortic lesion formation, and
that the two components differentially affect gallstone formation and lipid accumulation
in liver (11,12). This suggests that cholesterol and cholate may have independent pro-
atherogenic effects.
To test this hypothesis, we undertook a systematic analysis of plasma lipid and
gene expression changes that occur in response to the cholesterol, cholate, and fat
components of the Ath diet. C57BL/6J mice were fed one of five diets: mouse chow,
the Ath diet, or modified versions of the Ath diet in which either cholesterol, cholate, or
fat were omitted. We examined plasma lipid profiles and used DNA microarrays to
screen the response of more than 11,000 mouse genes and expressed sequence tags
(ESTs). A comparison of gene expression levels across all five diets allowed the
identification of genes that were activated or repressed specifically by dietary
cholesterol, cholate, or fat. We identified more than 300 genes that were activated or
repressed by one of the three diet components, with more than a quarter of those
(89/316) exhibiting at least a 10-fold response to either cholesterol, cholate, or fat.
Cholesterol and cholate were found to induce expression of genes involved in different
aspects of the inflammatory response, with cholesterol being required for the acute
inflammatory response while cholate was responsible for activating genes associated
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/5.jpg)
5
with hepatic fibrosis. Biochemical measurements of representative proteins from the
acute inflammatory and fibrotic responses confirmed the gene expression data. We
further investigated the potential role of these gene expression changes in
atherogenesis by examining their expression in an atherosclerosis-resistant substrain of
C57BL/6 mice. The activation of both the inflammatory and fibrotic genes was
dramatically attenuated in the resistant mice, suggesting that their response to the Ath
diet at the level of gene transcription may be one mechanism contributing to their
resistance to diet-induced atherosclerosis. Overall, our results establish that that
cholesterol and cholate components of the Ath diet have distinct proatherogenic effects
on gene expression, which correlate with genetic differences in atherosclerosis
susceptibility in two closely related C57BL/6 mouse strains.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/6.jpg)
6
EXPERIMENTAL PROCEDURES
Mice and diets—Male C57BL/6J and C57BL/6ByJ mice were obtained from The
Jackson Laboratory (Bar Harbor, ME). Mice were fed ad libitum Purina Mouse Chow
5001, or one of four experimental diets (Teklad Research Diets, Madison, WI)
containing various combinations of cholesterol, sodium cholate, and fat (in the form of
cocoa butter). The Ath diet (Teklad TD90221) contained (by weight) 75% Purina Mouse
Chow, 7.5% cocoa butter, 1.25% cholesterol and 0.5% sodium cholate. The other three
diets were equivalent to the Ath diet, with the omission of cholesterol (TD 98232),
cholate (TD 94059), or fat (TD 98233). At 3 months of age, mice were housed
individually and fed the specified diet for 3 weeks before harvesting tissue and blood.
The care of the mice and all procedures used in this study were conducted in
accordance with the NIH animal care guidelines.
Lipid determinations—Blood was obtained after a 16-h fast. Enzymatic assays for
total cholesterol, HDL cholesterol, unesterified cholesterol, triglyceride, and free fatty
acids were performed using enzymatic assays (13). LDL/VLDL cholesterol levels were
determined as the difference between total and HDL cholesterol levels. For hepatic
cholesterol and triglyceride determinations, lipids were extracted from 100 mg tissue as
described (14).
Oligonucleotide microarray hybridization—Liver samples comprising the identical
lobe were harvested from each mouse and flash frozen in liquid nitrogen. Total RNA
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/7.jpg)
7
was prepared from mouse liver using Trizol reagent (Life Technologies, Gaithersburg,
MD). Each microarray hybridization was performed using 10 µg of total liver RNA
pooled from four mice. Oligonucleotide microarrays (MU11K) were from Affymetix
(Santa Clara, CA) and contained representations of more than 11,000 full-length mouse
genes and EST clusters. cRNA synthesis, hybridization, washing, and scanning were
performed according to standard Affymetrix protocols. Fluorometric data were
generated by Affymetrix Software and the gene chips were globally scaled to all the
probe sets with an identical target intensity value. Transformation of the fluorescent
signals into numerical values and filtering of the data was accomplished as described
(15). Only genes with an absolute expression level (expressed as average difference,
or Avg Diff, value from Affymetrix software output) above a threshold of 30 were
analyzed. Identification of genes that are activated or repressed by specific diet
components was accomplished using Microsoft EXCEL. The full set of microarrray data
is available in Supplementary Table 1.
mRNA quantitation—Confirmation of mRNA expression differences observed on
microarrays was performed by Northern blot and RT-PCR. Total liver RNA was isolated
using Trizol reagent (Invitrogen). Poly(A)+ RNA was prepared from total RNA using the
Poly(A)Tract mRNA isolation system (Promega, Madison, WI), and 2 µg loaded per lane
for Northern analysis. Hybridizations were performed as described (16) with cDNA
probes generated by RT-PCR. RT-PCR was performed using 2 µg total liver RNA
(cDNA Cycle Kit, Invitrogen). Primer sequences for examples shown in Fig. 2 were as
follows: Saa3-f, agagacatgtggcgagcctac , Saa3-r, cagcacattgggatgtttagg, W34845-f,
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/8.jpg)
8
gccaggccttcacctttcag, W34845-r, acagttcagtcacccttacaag, Col3a1-f,
cccatgactgtcccacgtaag, Col3a1-r, cagggccaatgtccacaccaa, Mup1-f,
ggcatactattatcctggcctc, Mup1-r, gatggtggagtcctggtgaga, Igfbp-f, ttctcatctctctcgtacatg,
Igfbp-r, acgcagctttccacgttcag, Gck-f, gtggccacaatgatctcctgc, Gck-r,
tcggcgacagagggtcgaaggc.
Expression levels for activated hepatic stellate cell transcripts were examined by
RT-PCR using previously published primer sets for platelet-derived growth factor
receptor β (Pdgfrb) transforming growth factor β1 (Tgfb1), collagen 1α1 (Col1a1), tissue
inhibitor of metalloproteinases-1 (Timp1), and α-smooth muscle actin (17), and TATA
box binding protein (Tbp) (18). Total RNA was treated with DNase (Ambion, Austin, TX)
to remove contaminating genomic DNA, and cDNA was prepared from 2 µg total liver
RNA. 5% of the resulting cDNA sample was amplified for 32 cycles using a Touchdown
protocol with a beginning annealing temperature of 63°C and a final annealing
temperature of 53°C (18). PCR products were analyzed by electrophoresis in agarose,
and quantitation of digital images was performed using 1D Image Analysis software
(Eastman Kodak Company, Rochester, NY).
Serum amyloid A and collagen quantitation—Serum amyloid A levels in mouse
plasma were determined by ELISA (BioSource International, Camarillo, CA). Collagen
concentration in liver was determined using the Sircol collagen assay (Accurate
Chemical & Science Corporation,Westbury, NY). Briefly, 50 mg of liver was
homogenized and total acid pepsin-soluble collagens were extracted overnight using 5
mg/ml pepsin in 500 µl 0.5 M acetic acid. One ml Sircol dye reagent was added to 100
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/9.jpg)
9
µl of each sample, in duplicate and incubated at 25°C for 30 min. After centrifugation,
the pellet was suspended in 1 ml alkalai reagent and absorbance read at 540 nm.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/10.jpg)
10
RESULTS
Effects of Ath diet components on circulating lipid levels
To investigate the effect of specific components of the Ath diet on circulating lipid
levels, C57BL/6J mice were fed a chow diet, the Ath diet, or one of three modified Ath
diets in which either cholesterol, cholate, or fat was omitted (Table 1). Compared to
chow, the Ath diet produced more than a two-fold increase in plasma cholesterol levels,
due to an increase of more than 100 mg/dL in LDL/VLDL cholesterol (Fig. 1), as
observed previously (9). In contrast to previous reports, HDL cholesterol levels were
not significantly reduced on the Ath diet. This may be a result of using male, as
opposed to female mice, and/or the shorter (3 week) duration of the diet compared to
some previous studies. The amount of unesterified cholesterol more than doubled on
the Ath diet, whereas triglyceride levels were reduced ~50%, and free fatty acid levels
were unchanged.
The diets lacking cholesterol, cholate and fat components each produced distinct
plasma lipid profiles (see Fig. 1). The omission of fat from the Ath diet did not alter
plasma cholesterol, triglyceride, or fatty acid levels compared to the complete Ath diet,
indicating that the fat added to this diet has little effect on the circulating lipid levels. In
contrast, omission of cholesterol prevented any significant increase in total cholesterol
or unesterified cholesterol above the levels on a chow diet. The cholate-free diet
produced elevated cholesterol levels that were intermediate between values on the
chow and Ath diets, and were significantly higher than the chow values. Although total
cholesterol levels were not statistically different between Ath and No Cholate diets, the
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/11.jpg)
11
distribution of cholesterol among LDL/VLDL and HDL fractions was dramatically
affected by dietary cholate. LDL/VLDL cholesterol increased 10-fold on the Ath diet, but
only 2-fold on the cholate-free diet, whereas HDL cholesterol was at it highest on the
cholate-free diet. The omission of cholesterol from the Ath diet also blunted the
increase in LDL/VLDL cholesterol levels seen with the complete diet, indicating that
cholesterol and cholate act synergistically to elicit the large increase in LDL/VLDL
cholesterol that occurs on the Ath diet. A similar diet effect was observed with hepatic
cholesterol levels. Thus, while hepatic cholesterol levels increased 6-fold on the Ath
diet, this required the inclusion of both cholesterol and cholate.
Triglyceride levels were suppressed about 2-fold on the Ath diet (Fig. 1).
Omission of either cholate or cholesterol from the Ath diet produced a significant
elevation in triglyceride levels above those seen on either chow or Ath diets, suggesting
that the two components act together to effect the reduced triglyceride levels observed
with the Ath diet. Hepatic triglyceride levels were also repressed on the Ath diet, but
omission of cholate prevented this repression. Free fatty acid levels were not
significantly affected by the Ath diet components. Thus, cholesterol and cholate
components appear to have both independent effects and synergistic effects on plasma
and hepatic lipid levels.
Cholesterol and cholate induce distinct sets of inflammatory genes
To investigate gene expression changes underlying the diet-induced alterations
in lipid levels, we performed microarray hybridization studies. Liver RNA from mice fed
each of the five diets was hybridized to Affymetrix MU11K oligonucleotide microarrays
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/12.jpg)
12
to assess the relative expression levels of thousands of mouse genes and ESTs. Data
were filtered to exclude signals below a defined threshold of absolute expression level
and to insure specificity of hybridization for perfect match vs. mismatch oligonucleotides
(see Methods) (15). Using these criteria, 7200 of the 13,104 DNA elements on the
array were scored as present in at least one diet sample. Comparison of gene
expression profiles for the two most extreme diets, chow and Ath, revealed that the
combination of cholesterol, cholate, and fat produces widespread changes in hepatic
gene expression levels. 839 genes were activated and 454 genes repressed by at least
3-fold on the Ath diet compared to basal levels on the chow diet.
A systematic comparison of expression levels among all five diets allowed the
identification of genes that are regulated by specific dietary components. Approximately
1.4% of genes represented on the array exhibited altered expression specifically in
response to cholesterol, cholate, or fat. By comparing the expression levels of genes
across all five diets, we defined six gene expression patterns with respect to regulation
by specific diet components: cholesterol activated, cholesterol repressed, cholate
activated, cholate repressed, fat activated, and fat repressed. For example,
“cholesterol activated genes” were those having at least 2-fold higher levels on all three
diets containing cholesterol (Ath, No Cholate, and No Fat diets) than on the two diets
lacking cholesterol (Chow and No Cholesterol diets). Representative expression
profiles for each of the six groups are shown in Fig. 2. A full list of genes activated or
repressed by cholesterol, cholate, or fat is given in Table 2, and a summary of each
group is given below.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/13.jpg)
13
Cholesterol regulated genes—Expression of 38 of the genes assayed was
altered by presence of dietary cholesterol, including 25 genes that were activated and
13 repressed by cholesterol (Table 2). The magnitude of activation by cholesterol was
striking, with 30% of the cholesterol-activated genes showing more than 10-fold
induction in response to cholesterol. An example of a cholesterol activated gene, serum
amyloid A3 (Saa3), showed equivalent high levels of expression on the complete Ath
diet and the No Fat diet, and lowest levels on the No Cholesterol diet (Fig. 2a). The
nearly identical expression levels on the Ath and No Fat diets indicates that fat had little
effect on expression of this group of genes, and also illustrates the consistency of gene
expression measurements across individual microarray hybridizations. Most of these
genes had expression levels on the No Cholate diet that were intermediate between
those on Ath and the No Cholesterol diets. This suggests that while cholesterol has the
strongest effect on expression of these genes, cholate plays an additive role with
cholesterol to achieve the peak expression levels.
Notable among the cholesterol-activated genes were 12 genes known to be
involved in acute inflammation and the immune response: genes of the serum amyloid
A (SAA) family (Saa2, Saa3, and Saa4), histocompatibility antigens (H2-1A-alpha, H2-
1A-beta, H2-E-beta, Ia-associated invariant chain), and additional inflammation
/immune associated genes including interleukin-2 receptor gamma (Il2rg), small
inducible cytokine B9 (Scyb9), SAM domain and HD domain 1 (Samhd1), paired-Ig-like
receptor A5 (Pira5), and galectin-3 (Lgals3) (Table 2). SAA gene expression was
induced from 7-8-fold (Saa2 and Saa4) to 37-fold (Saa3) on the Ath diet. While
omission of cholate from the diet diminished the response, cholesterol was absolutely
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/14.jpg)
14
critical for activation of SAA gene expression (Fig. 2a). Similar cholesterol requirements
were observed for the other inflammation-related genes shown in Fig. 2a, although
magnitude of expression was lower.
Genes that were repressed by dietary cholesterol included aquaporin-8, which
has been implicated in canalicular bile secretion in liver (19), Cyp17a1, a key enzyme in
C-21 steroid biosynthesis, and apolipoprotein A-IV, a component of high density
lipoproteins which has previously been shown to be repressed by the Ath diet (20). An
additional 7 novel ESTs of unknown function were also repressed by cholesterol (see
for example Fig. 2b).
Cholate regulated genes— Of the three Ath diet components examined here,
cholate affected expression levels of the greatest number of genes, with 81 genes
induced and 23 repressed by cholate (Table 2; see examples in Fig. 2c and d). Most
striking was the induction of numerous genes encoding collagen and non-collagen
extracellular matrix components. The expression and excretion of extracellular matrix
proteins is indicative of fibrogenesis, a wound healing process that occurs in response
to inflammation induced by infectious or metabolic agents (21). Five collagen genes
were activated up to 70-fold by the Ath diet: Col1a1 and Col1a2 (which encode
procollagen, type I, subunits alpha 1 and alpha 2), Col3a1 (procollagen, type III, alpha
1), Col4a1 (procollagen, type IV, alpha 1), Col6a1 (procollagen, type VI, alpha 1), and
nidogen (a glycoprotein that binds type IV collagen). Omission of cholesterol from the
diet had little effect on collagen gene expression, but omission of cholate prevented
induction (Fig. 2c). Additional cholate-activated genes involved in extracellular matrix
synthesis included nidogen and lumican, two proteins that have direct interactions with
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/15.jpg)
15
extracellular collagens, as well as vimentin, a cytoskeletal intermediate filament protein,
and Ctgf (connective tissue growth factor), which modulates extracellular matrix
secretion. Thus, dietary cholate appears to have a specific effect on activation of genes
involved in the response to chronic inflammation.
Several additional genes induced by cholate have recognized roles in lipid
metabolism. For example, cholate induced phospholipid transfer protein (Pltp), which is
involved in lipoprotein remodeling and has recently been shown to be regulated by bile
acids through the farnesoid X-activated nuclear hormone receptor (FXR) (22), Also
induced by cholate was LXRβ, an oxysterol binding nuclear hormone receptor that
activates several genes involved in cellular cholesterol efflux. Dietary cholate also
induced choline kinase and lipocalin 2, genes involved in phospholipid synthesis and
intracellular lipid transport, respectively. The list of genes repressed by cholate was less
extensive than those activated by this component (Table 2). These included chemokine
orphan receptor 1, a choline/ethanolamine kinase (Chk1), a gene implicated in very long
chain fatty acid elongation (Elovl3), and cytochrome P450, 7b1 (Cyp7b), a key enzyme
in the alternate pathway of bile acid synthesis.
Fat regulated genes—Of the Ath diet components, fat affected expression of the
fewest genes, with 6 fat-activated and 9 fat-repressed genes identified by our criteria of
at least 2-fold effects in response to fat fat across all five diets (Table 2). The
magnitude of expression of most of these genes was quite modest. A notable exception
was insulin growth factor-like binding protein-1 (Igfbp1), which was expressed at high
levels on the chow and no fat diets, but repressed on all diets containing fat (Fig. 2f).
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/16.jpg)
16
Confirmation of independent cholesterol and cholate effects on SAA and
fibrogenic gene expression
The data above demonstrated that cholesterol was required for the large
induction of SAA gene expression, whereas cholate was required for induction of
collagen gene expression. To confirm that these gene expression changes resulted in
corresponding increases in protein levels, we quantitated SAA protein levels in blood
and collagen levels in liver under the various diet conditions. In agreement with the
mRNA expression results, SAA protein levels in the circulation increased about 30-fold
on Ath compared to a chow diet. The same high SAA levels were present when cholate
was omitted from the Ath diet, but omission of cholesterol prevented any increase
above chow values (Fig. 3a). Analogously, hepatic collagen levels were elevated
specifically in diets containing cholate, regardless of the other components (Fig. 3b).
These results establish that the cholesterol and cholate-specific changes in SAA and
collagen gene expression give rise to altered protein levels as well.
Additional confirmation that the fibrotic process is activated by dietary cholate
was obtained by examining additional markers of fibrotic gene expression. The major
source of collagen and other extracellular matrix proteins in liver fibrosis is hepatic
stellate cells, a population of perisinusoidal cells comprising 15% of the resident liver
cells (23, 24). Hepatic stellate cells typically exist in a quiescent state, serving as the
principal storage site for retinoids. In response to stimuli such as bacterial infection or
inflammation, the stellate cells become activated and transform into proliferative,
fibrogenic cells. To further characterize the fibrogenic response to dietary cholate,
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/17.jpg)
17
we examined established markers of activated stellate cells via RT-PCR (17). The Ath
diet increased expression of several hepatic stellate cell markers including platelet-
derived growth factor β-receptor (Pdgfrb), tissue inhibitor of metalloproteinases-1
(Timp1), transforming growth factor β1 (Tgfb1) (see Fig. 4), and α-smooth muscle actin
(not shown). The induction of hepatic stellate cell genes was attenuated when cholate
was omitted from the diet, consistent with the observed induction of collagen and other
fibrotic genes specifically by cholate.
Attenuated response to cholesterol and cholate in an atherosclerosis resistant
C57BL/6 substrain
As described above, the Ath diet induces expression of several inflammatory
genes in C57BL/6J mice, primarily through the cholesterol and cholate components.
This raises the possibility that induction of these genes contributes to the pro-
atherogenic effect of this diet. To address this issue, we investigated whether the same
gene expression patterns occur in an atherosclerosis-resistant, but otherwise
genetically similar, mouse strain, C57BL/6ByJ. C57BL/6ByJ mice were derived from
the same original progenitor as C57BL/6J, but have been bred independently for many
years (25). Although very few DNA polymorphisms have been detected between the
two C57BL/6 substrains, the C57BL/6ByJ strain is resistant to hypercholesterolemia and
aortic lesion formation in response to the Ath diet (26). To determine whether this strain
also differs in gene expression response to cholesterol and cholate, C57BL/6ByJ mice
were fed the five diets described earlier, and expression levels of inflammatory genes
induced by cholesterol and cholate were compared with those seen for C57BL/6J.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/18.jpg)
18
C57BL/6ByJ mice were found to differ dramatically from C57BL/6J mice in gene
expression response to cholesterol. The inflammatory genes activated by cholesterol in
C57BL/6J mice were expressed at similar levels on the chow diet, but were not induced
significantly in C57BL/6ByJ by the Ath diet or other diets (Fig. 5a and b). Whereas the
SAA genes were induced 7- to 37-fold in C57BL/6J, Saa2 and Saa4 were induced only
2- to 3-fold and Saa3 was not induced at all in C57BL/6ByJ. Many other cholesterol
responsive inflammatory genes showed either no induction at all (Scyb9, Samhd1,
Pira5, Lgals, Ly6), or increased expression slightly on cholesterol-containing diets (H2-
Aa, H2-Ab1, H2-Ebi, Ii, Il2rg) (Fig. 5b). The induction of fibrosis-related gene
expression in C57BL/6ByJ was also attenuated compared to C57BL/6J, but less
dramatically than the cholesterol-responsive genes (Fig. 5c and d). Whereas nidogen,
lumican, vimentin, and Ctgf were similarly activated by cholate in both strains, most
collagen genes were either not activated at all (Col6a1, Col1a2), or activated at 25-50%
the levels seen in C57BL/6J (Col1a1, Col3a1). Thus, the two C57BL/6 substrains differ
substantially in their gene expression response to dietary cholesterol, and C57BL/6ByJ
mice also fail to induce collagen family members to the levels seen in C57BL/6J mice in
response to cholate.
The gene expression differences between C57BL/6J and C57Bl/6ByJ in SAA and
collagen were confirmed by biochemical measurements. Circulating SAA levels in
C57BL/6J mice fed the Ath diet were 5- to 8-fold higher than in C57BL/6ByJ mice (Fig.
6a). Hepatic collagen levels also remained significantly lower in the C57BL/6ByJ mice
in response to the Ath diet (Fig. 6b), consistent with the gene expression data. Thus,
the closely related C57BL/6 substrains exhibit clearly different responses to the
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/19.jpg)
19
cholesterol and cholate components of the Ath diet, at both the transcriptional and
protein levels. These findings are consistent with the possibility that attenuated
inflammatory and fibrotic gene expression contributes to the atherosclerosis resistance
in C57BL/6ByJ compared to C57BL/6J mice.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 20: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/20.jpg)
20
DISCUSSION
The atherogenic diet containing cholesterol, cholate, and fat has been used for
more than 25 years by several investigators to study the pathology and genetics of
atherosclerosis in inbred mouse strains. And while it has been shown that both
cholesterol and cholate are required to produce aortic lesions in susceptible mouse
strains in a practical period of time (12), it is not clear what effect each component
produces. To begin to address this issue, we have used microarrays to quantitate gene
expression levels in response to Ath diet components. By comparing expression
patterns on the Ath diet with those on diets in which one component was omitted, we
identified groups of genes that are activated or repressed specifically by cholesterol,
cholate, or fat. Although some genes were regulated by more than one component,
many genes were strongly induced or repressed primarily by a single dietary
component. Two key groups of genes that are likely to play a role in atherogenesis
were found to be induced by the Ath diet: (1) more than 20 genes involved in acute
inflammation/immune response, and (2) extracellular matrix proteins, characteristic of
hepatic fibrosis in response to chronic injury.
Inflammatory gene activation was dependent on the presence of cholesterol in
the diet, whereas the collagen gene family members were induced specifically by
cholate. These results extend previous observations showing that the Ath diet induces
SAA genes in C57BL/6J liver (27) by demonstrating that activation of SAA and other
acute inflammatory genes occurs largely in response to cholesterol. Furthermore, the
fact that SAA levels were elevated on the cholate-free diet demonstrates that the
dramatic elevation in LDL/VLDL seen on the Ath diet is not required to activate SAA
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 21: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/21.jpg)
21
gene expression, nor do elevated HDL levels protect against it (see Fig. 1). Likewise,
fibrotic gene expression was induced even when cholesterol was omitted from the Ath
diet, indicating that fibrosis is not dependent on elevated plasma or hepatic cholesterol
levels (Fig. 1). These results indicate that the cholesterol and cholate components of the
Ath diet have distinct proatherogenic effects, and suggest a strategy to study the
contribution of the acute inflammatory response and fibrogenesis independently through
dietary manipulation.
To evaluate the potential relationship between the Ath diet-induced expression of
inflammatory and fibrogenic genes and susceptibility to atherosclerosis, we compared
gene expression in two substrains of C57BL/6 mice, one susceptible and the other
resistant to atherosclerosis. We previously determined that C57BL/6ByJ mice fed the
Ath diet maintain lower plasma LDL/VLDL cholesterol levels than C57BL/6J (26). Here
we show that an important consequence of this may be attenuated expression in
C57BL/6ByJ of cholesterol-responsive inflammatory genes in the liver, resulting in
reduced levels of SAA in the circulation. We also observed reduced collagen gene
activation in C57BL/6ByJ. This is intriguing in light of our finding that C57BL/6ByJ mice
exhibit increased bile acid excretion compared to C57BL/6J mice (28). Thus, reduced
bile acid accumulation in B6By mice may protect these animals from fibrosis via
reduced bile acid-induced stellate cell activation and/or apoptosis (29, 30). Inhibition of
stellate cell activation has been suggested as a strategy for treatment of conditions
characterized by hepatic inflammation and fibrosis, including chronic viral hepatitis,
alcoholic liver disease, and other causes of liver cirrhosis (23,31-35). Since
C57BL/6ByJ mice are resistant to atherosclerosis and exhibit reduced hepatic fibrosis,
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 22: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/22.jpg)
22
they may provide a valuable model to establish whether inhibition of stellate cell
activation is a useful strategy for treatment of chronic viral hepatitis, alcoholic liver
disease, and other causes of liver cirrhosis.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 23: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/23.jpg)
23
REFERENCES
1. Knowles, J. W., and Maeda, N. (2000) Arterioscler. Thromb. Vasc. Biol. 20,
2336-2345 2. Fazio, S., and Linton, M. F. (2001) Front. Biosci. 6, D515-525 3. Reardon, C. A., and Getz, G. S. (2001) Curr. Opin. Lipidol. 12, 167-173 4. Sheth, S. S., Deluna, A., Allayee, H., and Lusis, A. J. (2002) Curr. Opin. Lipidol.
13, 181-189 5. Thompson, J. S. (1969) J. Atheroscler. Res. 10, 113-122 6. Vesselinovitch, D., and Wissler, R. W. (1968) J. Atheroscler. Res. 8, 497-523 7. Paigen, B., Morrow, A., Brandon, C., Mitchell, D., and Holmes, P. (1985)
Atherosclerosis 57, 65-73 8. Paigen, B., Mitchell, D., Reue, K., Morrow, A., Lusis, A. J., and LeBoeuf, R. C.
(1987) Proc. Natl. Acad. Sci. USA 84, 3763-3767 9. LeBoeuf, R. C., Doolittle, M. H., Montcalm, A., Martin, D. C., Reue, K., and Lusis,
A. J. (1990) J. Lipid Res. 31, 91-101 10. Liao, F., Andalibi, A., deBeer, F. C., Fogelman, A. M., and Lusis, A. J. (1993) J.
Clin. Invest. 91, 2572-2579 11. Nishina, P. M., Verstuyft, J., and Paigen, B. (1990) J. Lipid Res. 31, 859-869 12. Nishina, P. M., Lowe, S., Verstuyft, J., Naggert, J. K., Kuypers, F. A., and Paigen,
B. (1993) J. Lipid Res. 34, 1413-1422 13. Hedrick, C. C., Castellani, L. W., Warden, C. H., Puppione, D. L., and Lusis, A. J.
(1993) J. Biol. Chem. 268, 20676-20682 14. Carr, T.P., Andresen, C.J., and Rudel, L.L. (1993) Clin. Biochem. 26, 39-42. 15. Kersten, S., Mandard, S., Escher, P., Gonzalez, F. J., Tafuri, S., Desvergne, B.,
and Wahli, W. (2001) FASEB J 15, 1971-1978 16. Cohen, R. D., Castellani, L. W., Qiao, J.-H., Van Lenten, B. J., Lusis, A. J., and
Reue, K. (1997) J. Clin. Invest. 99, 1906-1916
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 24: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/24.jpg)
24
17. Canbay, A., Higuchi, H., Bronk, S. F., Taniai, M., Sebo, T. J., and Gores, G. J. (2002) Gastroenterol. 123, 1323-1330
18. Vergnes, L., Phan, J., Stolz, A., and Reue, K. (2003) J. Lipid Res. 44, 503-511. 19. Huebert, R. C., Splinter, P. L., Garcia, F., Marinelli, R. A., and LaRusso, N. F.
(2002) J. Biol. Chem. 277, 22710-22717 20. Baroukh, N., Ostos, M. A., Vergnes, L., Recalde, D., Staels, B., Fruchart, J.,
Ochoa, A., Castro, G., and Zakin, M. M. (2001) FEBS Lett. 502, 16-20 21. Neubauer, K., Saile, B., and Ramadori, G. (2001) Can. J. Gastroenterol. 15, 187-
193 22. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275, 39313-
39317 23. Kmiec, Z. (2001) Adv. Anat. Embryol. Cell Biol. 161, 1-151 24. Friedman, S. L. (2000) J. Biol. Chem. 275, 2247-2250 25. Bailey, D.W. (1978) In Origins of Inbred Mice. Morse, H.C.T., ed. New York:
Academic Press, pp. 197-215. 26. Mouzeyan, A., Choi, J.-H., Allayee, H., X., W., Sinsheimer, J., Phan, J.,
Castellani, L., Reue, K., Lusis, A. J., and Davis, R. C. (2000) J. Lipid Res. 41, 573-582
27. Liao, F., Andalibi, A., Qiao, J. H., Allayee, H., Fogelman, A. M., and Lusis, A. J.
(1994) J. Clin. Invest. 94, 877-884 28. Phan, J., Psearan, T., Davis, R. C., and Reue, K. (2002) J. Biol. Chem. 277, 469-
477 29. Brady, L. M., Beno, D. W. A., and Davis, B. H. (1996) Biochem. J. 316, 765-769 30. Higuchi, H., and Gores, G.J. (2003) Am. J. Physiol. Gastrointest. Liver Physiol.
284, G734-G738. 31. Bissell, D. M. (1998) J. Gastroenterol. Hepatol. 33, 295-302 32. Li, D., and Friedman, S. L. (1999) J. Gastroenterol. Hepatol. 14, 618-633 33. Marra, F. (1999) J. Hepatol. 31, 1120-1130 34. Tsukamoto, H., and Lu, S. C. (2001) FASEB J. 15, 1335-1349
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 25: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/25.jpg)
25
35. Knolle, P., Lohr, H., Treichel, U., Dienes, H. P., Lohse, A., and Gerken, G. (1995)
Z. Gastroenterol. 33, 613-620
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 26: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/26.jpg)
26
FIGURE LEGENDS
Figure 1. C57BL/6J mouse plasma and hepatic lipid levels on 5 diets. Plasma and
hepatic lipid determinations were performed after 3 weeks feeding on each of five
diets—Chow, Ath, No Cholate, No Cholesterol, and No Fat. Plasma lipid values are
given as mg/dL, and hepatic lipid values as µg/mg tissue. Values represent the average
of 5 mice (plasma lipids) or 4 mice (hepatic lipids) on each diet. Error bars indicate
standard deviation. Significantly different than Chow value: *, p<0.05; **, p<0.01.
Significantly different than Ath value: +, p<0.05; ++, p<0.01.
Figure 2. Expression levels of genes activated or repressed by dietary cholesterol,
cholate, or fat. Expression levels are taken from microarrays probed with RNA samples
pooled from 5 C57BL/6J mice on each diet. Genes were classified based on activation
or repression of at least 2-fold by cholesterol, cholate or fat across all five diets. The list
of genes in each panel is given under the corresponding heading in Table 2.
Representative Northern blots are shown below each graph, with liver samples from two
mice on each diet analyzed for the gene indicated. Fat activated genes were expressed
at a lower magnitude, so RT-PCR was used instead of Northern blot to confirm
expression levels. (a) Genes activated by cholesterol component of the diet. (b) Genes
repressed by cholesterol. (c) Genes activated by cholate. (d) Genes repressed by
cholate. (e) Genes activated by fat. (f) Genes repressed by fat. Saa3, serum amyloid
A3; W34845, mouse EST; Col3a1, procollagen, type III, alpha 1; Mup1, major urinary
protein 1; Gck, glucokinase; Igfbp1, insulin-like growth factor binding protein 1.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 27: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/27.jpg)
27
Figure 3. Circulating serum amyloid A and hepatic collagen levels in response to diet
components. (a) Plasma SAA levels (µg SAA/mL plasma) were determined by ELISA
for C57BL/6J mice fed the diets indicated for 3 weeks. *, significantly different than
Chow, p<0.05; +, significantly different than No Cholate diet, p<0.05. (b) Total acid-
pepsin soluble collagens (mg collagen/mg tissue) were quantitated in liver homogenates
of C57BL/6J mice fed the diets indicated for 3 weeks. +, significantly different than No
Cholate diet, p<0.05. For (a) and (b), values represent the mean and error bars indicate
standard deviation for 3-4 mice on each diet.
Figure 4. Hepatic stellate cell markers in C57BL/6J mice are activated in response to
dietary cholate. Hepatic stellate cell marker expression was evaluated via RT-PCR (16)
for mice on the Chow, Ath, and No Cholate diets. Expression levels of Pdgfrb (platelet
derived growth factor receptor β), Tgfb1 (transforming growth factor β1), Col1a1
(Procollagen, type I, α1), and Timp1 (Tissue inhibitor of metalloproeinases-1) were
elevated on Ath compared to the Chow diet, but activation was attenuated when cholate
was omitted from the diet. Shown are samples from two mice on each diet. Tbp (TATA
box binding protein) was amplified as a normalization control that is unaffected by strain
or diet.
Figure 5. Attenuated gene expression response to cholesterol and cholate in the
atherosclerosis-resistant C57BL/6ByJ strain. C57BL/6J and C57BL/6ByJ mice were fed
the 5 diets indicated for 3 weeks and mRNA expression levels determined by
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 28: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/28.jpg)
28
microarray hybridizations. Expression values are taken from microarrays probed with
RNA samples pooled from 5 mice of each strain on each diet. (a) Expression profile of
cholesterol-activated inflammatory genes in C57BL/6J. (b) Profile of genes shown in (a)
for the C57BL/6ByJ strain. (c) Expression profile of cholate-activated fibrotic genes in
C57BL/6J. (d) Profile of genes shown in (c) for the C57BL/6ByJ strain. Full gene
names are given in Table 2.
Figure 6. Reduced induction of serum amyloid A and hepatic collagen levels in Ath fed
C57BL/6ByJ mice. (a) Circulating SAA levels (µg SAA/mL plasma) in C57BL/6J
compared to C57BL/6ByJ mice fed the Ath diet for 3 or 16 weeks. *, strains differ
significantly, p<0.01. (b) Hepatic collagen levels (mg collagen/mg tissue) in C57BL/6J
compared to C57BL/6ByJ mice fed the Ath diet for 3 or 7 weeks. *, strains differ
significantly, p<0.05.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 29: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/29.jpg)
29
ACKNOWLEDGMENTS
We thank Ping Xu for excellent technical assistance. This work was supported by
National Institutes of Health grants HL58627 and HL28481 (K.R.) and the Philippe
Foundation, Inc. (L.V.)..
ABBREVIATIONS
The abbreviations used are: Ath, atherogenic diet; LDL/VLDL, low density/very low
density lipoprotein; HDL, high density lipoprotein; EST, expressed sequence tag; SAA,
serum amyloid A.
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 30: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/30.jpg)
30
Table 1. Composition of the five diets.
Chow Ath No Cholate No Cholesterol No Fat Cholate - + - + + Cholesterol - + + - + Fat - + + + -
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 31: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/31.jpg)
31
TABLE 2 Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat
Cholesterol Activated
AA013615 Lectin, galactose binding, soluble 3 Lgals3 Lectin/plasma membrane 0 266 104 44 318
AA027619 Lymphocyte antigen 6 complex, locus C Ly6c glycoprotein receptor 0 664 431 156 714
AA097051 Lymphocyte antigen 6 complex Ly6 glycoprotein receptor 165 935 1212 408 1025
AA097202 EST 159 420 325 147 459
AA163876 EST 1183 4509 3242 1582 4452
AA165803 EST 43 210 205 44 120
AA174982 Coronin, actin binding protein 1A Coro1a actin cytoskeleton 41 316 108 9 353
AA288442 Guanylate nucleotide binding protein 2 Gbp2 GTPase 26 375 235 28 293
AF027865 histocompatibility 2, class II antigen A, alpha H2-Aa immune response 711 16292 5399 1696 14206
ET62843 paired-Ig-like receptor A5 Pira5 defense/immunity protein 0 527 143 32 854
ET63206 fructose bisphosphatase 1 Fbp1 fructose metabolism 90 238 380 69 224
L38444 T-cell specific GTPase Tgtp GTPase 78 742 1588 158 663
M17790 serum amyloid A 4 Saa4 high-density lipoprotein 653 5298 2322 322 10641
M34815 small inducible cytokine B subfamily (Cys-X-Cys), member 9
Scyb9 immune response/inflammation response 19 933 690 11 692
U15635 SAM domain and HD domain, 1 Samhd1 immune response 144 399 324 152 412
U21795 interleukin 2 receptor, gamma chain Il2rg interleukin receptor 0 210 143 68 248
U60438 serum amyloid A 2 Saa2 immune response 1461 10031 4508 1326 14666
V01527 histocompatibility 2, class II antigen A, beta 1 H2-Ab1 immune response 0 12514 3506 560 10538
W55014 EST 0 188 194 91 183
X00496 Ia-associated invariant chain Ii defense response 879 24550 7557 2251 21398
X00958 histocompatibility 2, class II antigen E beta H2-Eb1 immune response 873 11722 3385 1284 8703
X03479 serum amyloid A 3 Saa3 immune response 215 7940 2194 127 7510
X73960 tyrosine kinase receptor 1 Tie1 protein tyrosine kinase 0 236 216 0 556
Z11886 Notch gene homolog 1, (Drosophila) Notch1 neurogenesis 74 355 381 155 353
Z19543 Calponin 2 Cnn2 actin binding 168 978 1013 289 667
Cholesterol repressed
AA039197 Protocadherin 13 Pcdh13 calcium binding 607 172 0 384 0
AA267683 Isopentenyl-diphosphate delta isomerase Idi1 cholesterol biosynthesis 250 90 123 399 119
AA415990 EST 243 52 60 196 63
AA684083 EST 145 2 0 144 28
AA717238 EST 509 147 181 436 216
AF018952 aquaporin-8 Aqp8 integral plasma membrane protein 224 98 47 258 0
M64250 apolipoprotein A-IV Apoa4 high-density lipoprotein 686 0 0 274 0
M64863 Cytochrome P450, 17 Cyp17a1 C21-steroid hormone biosynthesis 1313 39 0 375 0
U37438 CRP-ductin Crpd integral membrane protein 130 0 0 305 15
U91511 ectonucleoside triphosphate diphosphohydrolase 2 Entpd2 integral membrane protein 254 0 0 153 0
W13498 EST 567 84 79 262 92
W13697 EST 236 28 39 131 1
W34845 EST 1223 494 490 991 470
Cholate activated
AA003990 EST 5 206 0 332 130
AA011784 EST 0 228 65 521 388
AA023107 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) Sec2211 vesicle-mediated transport 0 248 46 259 129
AA024049 Vimentin Vim intermediate filament 281 1214 518 1416 1270
AA031158 EST 0 418 104 274 604
AA098332 Hemoglobin Y, beta-like embryonic chain Hbb-y oxygen transport 0 300 0 117 115
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 32: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/32.jpg)
32
Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat
AA111209 Lxrb Nr1h2 transcription regulation 0 124 25 190 106
AA117100 Leukemia-associated gene Lag intracellular signaling cascade 0 189 25 702 283
AA117701 Actin, alpha, cardiac Actc1 actin cytoskeleton 186 1303 448 1101 1484
AA123395 Secreted phosphoprotein 1 Spp1 ossification 125 505 126 388 420
AA144136 Choline kinase Chk lipid metabolism 23 291 45 311 142
AA152678 Basigin Bsg integral membrane protein 0 2176 863 2347 1949
AA163805 EST 43 190 43 154 212
AA169054 Rho, GDP dissociation inhibitor (GDI) beta Arhgdib GTPase activator 0 198 0 688 731
AA182195 EST 60 385 99 282 318
AA183642 EST 34 184 13 123 230
AA185385 EST 56 140 67 137 138
AA185911 Lymphocyte antigen 68 Ly68 defense response 140 439 131 293 744
AA265119 EST 50 115 0 264 105
AA265357 Cleavage stimulation factor, 3' pre-RNA, subunit 3 Cstf3 mRNA cleavage 0 232 57 151 134
AA271049 EST 47 199 0 161 122
AA288280 Cathepsin C Ctsc proteolysis and peptidolysis 172 347 87 367 510
AA426917 Cyclin B1, related sequence 1 Ccnb1-rs1 - 14 123 44 245 143
AA666918 IQ motif containing GTPase activating protein 1 Iqgap1 RAS GTPase activator 0 256 60 202 357
AA672846 EST 53 148 35 257 353
AF013262 lumican Lum extracellular matrix 50 176 75 197 195
AF020313 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Apbb1ip-pending
- 14 237 34 128 254
AF026072 sulfotransferase family, cytosolic, 2B, member 1 Sult2b1 Sulfotransferase protein 0 526 211 475 507
C80730 CD9 antigen Cd9 integral membrane protein 72 146 51 288 246
D10024 Annexin A2 Anxa2 calcium binding 162 1332 315 2506 868
D12907 serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1
Serpinh1 heat shock protein 117 289 122 255 345
D13664 osteoblast specific factor 2 osf2-pending skeletal development 0 215 37 289 256
D16432 Cd63 antigen Cd63 integral membrane protein 242 1878 311 1561 1739
ET63194 coxsackievirus and adenovirus receptor Cxadr integral membrane protein 0 183 59 280 212
J03857 immunoglobulin-associated beta Igb humoral immune response 70 168 60 170 253
J04694 Procollagen, type IV, alpha 1 Col4a1 basement membrane 355 975 320 776 837
J04953 gelsolin Gsn cytoskeleton 158 636 175 500 414
J05663 aldo-keto reductase family 1, member B7 Akr1b7 aldehyde reductase 22 215 0 732 557
M31885 inhibitor of DNA binding 1 Idb1 DNA binding protein 74 500 85 418 422
M38337 milk fat globule-EGF factor 8 protein Mfge8 cell adhesion molecule 804 1849 744 1975 1948
M58004 Small inducible cytokine A6 Scya6 immune response 0 456 5 113 585
M58566 zinc finger protein 36, C3H type-like 1 Zfp36l1 DNA binding protein 85 363 106 276 233
M70642 connective tissue growth factor Ctgf extracellular matrix 0 293 0 115 379
U08020 procollagen, type I, alpha 1 Col1a1 collagen 85 995 115 541 693
U12785 aldehyde dehydrogenase family 3, subfamily A1 Aldh3a1 oxidoreductase 0 558 0 142 621
U19482 small inducible cytokine A9 Scya9 immune response 936 2175 493 2447 2103
U20365 actin, gamma 2, smooth muscle, enteric Actg2 actin cytoskeleton 211 1087 521 1351 1461
U27315 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Slc25a4 integral membrane protein 74 224 88 198 298
U29396 Annexin A5 Anxa5 calcium binding 672 2256 931 2875 2315
U37226 Phospholipid transfer protein Pltp lipid metabolism 167 503 123 444 1245
U41341 S100 calcium binding protein A11 (calizzarin) S100a11 calcium binding 80 610 154 1230 497
U47543 Ngfi-A binding protein 2 Nab2 transcription regulation 0 236 0 143 151
U59761 ATPase, Na+/K+ transporting, beta 3 polypeptide Atp1b3 integral membrane protein 0 1024 109 254 913
U59807 cystatin B Cstb cysteine protease inhibitor 461 1576 631 1425 1400
U69488 G7e protein G7e - 40 203 51 586 194
U91511 ectonucleoside triphosphate diphosphohydrolase 2 Entpd2 integral membrane protein 39 819 0 328 365
W08016 cyclin D1 Ccnd1 - 458 1348 295 3464 1295
W08322 EST 782 2133 646 1985 2144
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 33: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/33.jpg)
33
Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat
W10606 ATPase inhibitor Atpi mitochondrion 0 424 112 701 407
W12140 EST 0 526 0 621 486
W13166 Lipocalin 2 Lcn2 transport 21 5968 442 1420 15733
W29265 Glutathione S-transferase, alpha 1 (Ya) Gsta1 Glutathione metabolism 1871 5174 1807 5864 5903
W30069 Myocyte-enriched calcineurin interactin protein 1 Mcip1 central nervous system development 91 223 30 218 276
W35967 D2Wsu127e - 68 307 100 254 424
W41301 syntaxin 8 Stx8 non-selective vesicle transport 0 346 114 531 425
W48388 EST 0 292 0 270 223
W75846 EST 102 253 59 479 542
W83347 IQ motif containing GTPase activating protein 1 Iqgap1 RAS GTPase activator 159 613 205 424 883
W90871 EST 89 220 46 382 242
X14194 nidogen-1 Nid1 basement membrane 4 666 36 773 548
X16834 lectin, galactose binding, soluble 3 Lgals3 629 5165 630 2102 3975
X52046 procollagen, type III, alpha 1 Col3a1 collagen 0 3940 193 2211 2738
X54966 Cathepsin B ctsB proteolysis and peptidolysis 0 228 49 186 195
X58251 Procollagen, type I, alpha 2 Col1a2 collagen 0 1403 0 426 380
X63782 lymphocyte antigen 6 complex, locus D Ly6d defense response 476 3410 666 6072 2857
X66405 procollagen, type VI, alpha 1 Col6a1 collagen 0 340 105 459 502
X67783 Vascular cell adhesion molecule 1 Vcam1 cell adhesion molecule 0 4067 333 985 3460
X97227 CD53 antigen CD53 integral membrane protein 4 246 61 176 496
Y08026 Immunity-associated protein, 38 kDa Imap38 - 0 170 59 131 159
Z11997 high mobility group box 1 Hmg1 transcription regulation 651 2018 746 1764 1535
Z31065 EST 0 220 23 352 271
Cholate repressed
AA016545 Calbindin-D9K Calb3 calcium binding 140 0 143 9 58
AA064024 Choline kinase -like Chkl Choline/ethanolamine kinase 328 116 464 55 130
AA104822 EST 388 0 314 16 79
AA124170 Activating transcription factor 4 Atf4 transcription regulation 517 64 243 88 66
AA139256 EST 773 0 246 0 0
AA168485 chemokine orphan receptor 1 Cmkor1 chemokine receptor 926 232 485 55 121
AA197627 EST 405 0 424 0 0
AA238367 EST 1073 438 1721 526 490
AA277739 EST 489 196 456 210 138
AA590086 EST 1669 225 836 162 0
D13903 protein tyrosine phosphatase, receptor type, D Ptprd protein tyrosine phosphatase 157 43 291 0 0
J04847 DNA segment, Chr 1, Pasteur Institute 1 D1Pas1 829 83 262 62 80
M27796 carbonic anhydrase 3 Car3 carbonate dehydratase 1481 686 4374 448 278
U14390 aldehyde dehydrogenase family 3, subfamily A2 Aldh3a2 aldehyde dehydrogenase (NAD+) 319 80 629 118 0
U36993 cytochrome P450, 7b1 Cyp7b1 steroid biosynthesis 3660 425 5777 224 231
U49861 deiodinase, iodothyronine, type I Dio1 thyroxine deiodinase 1410 349 1808 275 225
U60330 proteaseome (prosome, macropain) 28 subunit, 3 Psme3 proteasome activator complex 375 81 243 70 92
U97107 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3
Elovl3 - 1284 576 1224 191 261
W29533 histidine rich calcium binding protein Hrc smooth endoplasmic reticulum 364 82 275 73 17
W85336 EST 369 91 229 94 70
W90866 eukaryotic translation elongation factor 2 Eef2 protein biosynthesis 376 0 199 0 0
X03208 Major urinary protein 1 Mup1 defense response 6699 1626 13823 1636 627
Z37988 protein tyrosine phosphatase, receptor-type, F Ptprf protein tyrosine phosphatase 368 56 383 130 46
fat activated
C79929 Jumonji jmj central nervous system development 134 374 338 297 120
D17892 EST - 44 132 242 288 65
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 34: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/34.jpg)
34
Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat
L38990 Glucokinase activity Gck Glucokinase 0 129 157 151 44
U47008 Ngfi-A binding protein 1 Nab1 transcription regulation 41 331 279 154 0
X15373 inositol 1,4,5-triphosphate receptor 1 Itpr1 signal transduction 55 298 227 167 66
X81464 Translin Tsn DNA-binding protein 2 536 869 274 58
Fat
repressed
AA270743 EST 403 92 0 0 358
AA407018 thymine DNA glycosylase Tdg DNA repair enzyme 235 34 10 17 130
AA414903 EST 141 30 0 16 119
C78586 EST 117 38 35 43 155
M31314 Fc receptor, IgG, high affinity I Fcgr1 CD64 defense response 199 64 0 0 143
U27398 Xeroderma pigmentosum Group C Xpc DNA repair protein 760 95 260 188 619
U70622 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2
Edg2 integral plasma membrane protein 212 32 85 74 203
W29468 myosin light chain, phosphorylatable, fast skeletal muscle Mylpf muscle development 141 6 22 51 111
X67493 insulin-like growth factor binding protein 1 Igfbp1 regulation of cell growth 15922 7132 5719 4547 14964
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 41: 1,2 , Jack Phan , Merav Strauss, Sherrie Tafuri , and ... · 1 Cholesterol and cholate components of an atherogenic diet induce distinct stages of hepatic inflammatory gene expression](https://reader033.vdocument.in/reader033/viewer/2022041922/5e6c6c04caa03232020b434f/html5/thumbnails/41.jpg)
Laurent Vergnes, Jack Phan, Merav Strauss, Sherrie Tafuri and Karen Reuehepatic inflammatory gene expression
Cholesterol and cholate components of an atherogenic diet induce distinct stages of
published online August 15, 2003J. Biol. Chem.
10.1074/jbc.M306022200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
Supplemental material:
http://www.jbc.org/content/suppl/2003/09/15/M306022200.DC1
by guest on March 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from