(12) united states patent us 8,030,473 b2 carrington et al ... · ers so as to form perfect or...

(12) United States Patent Carrington et al.

US008030473B2

US 8,030,473 B2 Oct. 4, 2011

(10) Patent N0.: (45) Date of Patent:

METHOD TO TRIGGER RNA INTERFERENCE

(54)

(75) Inventors: James C. Carrington, Corvallis, OR (US); Edwards Allen, O’Fallon, MO (Us)

(73) Assignee: State of Oregon acting by and through the State Board of Higher Education on behalf of Oregon State University, Corvallis, OR (U S)

Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 764 days.

(21)

(22)

App1.No.: 11/334,776

Filed: Jan. 6, 2006

(65) Prior Publication Data

US 2006/0174380 A1 Aug. 3, 2006

Related US. Application Data

Provisional application No. 60/642,126, ?led on Jan. 7, 2005.

(60)

Int. Cl. C12N 15/113 C12N 15/63 (2010.01) C12N 15/82 (2010.01) US. Cl. ................... .. 536/245; 536/24.1; 536/231;

435/3201; 435/468; 800/285; 800/278; 800/295 Field of Classi?cation Search ...................... .. None

See application ?le for complete search history.

(51) (2010.01)

(52)

(58)

(56) References Cited

U.S. PATENT DOCUMENTS

B1 10/2002 Falco et al. A1 * 7/2003 Zhu et a1. .................... .. 800/288

A1 * 11/2003 Rottmann et a1. . . 800/278

A9 1/2004 Harper et al. A1 * 3/2004 Cullen et a1. ................ .. 435/455

A1 * 3/2004 Turner et al. .................. .. 514/44

A1 5/2004 Beach et al. 2004/ 0261149 A1 12/2004 Fauquet et a1. 2007/0130653 A1 6/2007 Baulcombe et al.

FOREIGN PATENT DOCUMENTS

2007/039454 4/2007

OTHER PUBLICATIONS

Allen et a1 2005 Cell 121:207-221, provided in Applicant IDS.* Parizotto et al 2004 Genes and Development 18:2237-2242.* Montgomery et al., “Speci?city of ARGONAUTE7-miR390 Inter action and Dual Functionality in TASS Trans-Acting siRNA Forma tion,” Cell, 122:128-141 (Apr. 4, 2008). Gutierrez-Nava et al., “Arti?cial trans-acting siRNAs confer consis tent and effective gene silencing,” Plant Physiology, 10.1 104/ 108. 118307 (Apr. 25, 2008). Khvorova et al., “Functional siRNAs and miRNAs Exhibit Strand Bias,” Cell, 115:209-216, 2003. Montgomery et al., “AGO 1 -miR1 73 complex initiates phased siRNA formation in plants,” PNAS, 105(51):20055-20062, 2008.

6,459,019 2003/0135888 2003/0221211 2004/0009476 2004/0053411 2004/0053876 2004/0086884

WO

Rajagopalan et al., “A diverse and evolutionarily ?uid set of microRNAs in Arabidopsis thaliana,” Genes & Development, 20:3407-3425, 2006. Rand et al., “Biochemical identi?cation of Argonaute 2 s the sole protein required for RNA-induced silencing complex activity,” PNAS, 101(40):14385-14389, 2004. Schwartz et al., “Asymmetry in the Assembly of the RNAi Enzyme Complex,” Cell, 115: 199-208, 2003. Song et al., “The crystal structure of the Argonaute2 PAZ domain reveals an RNA binding motif in RNAi effector complexes,” Nature Structure Biology, 10(12): 1026-1032, 2003. Song et al., “Crystal Structure of Argonaute and Its Implications for RISC Sliver Activity,” Science, 305:1434-1437, 2004. Allen et al., “Conserved trans-acting siRNAs regulate ARF genes,” Abstract for talk given on Jan. 12, 2005, at Keystone Symposium “Diverse Roles of RNA in Gene Regulation”. Allen et al., “miRNA-directed phasing during trans-acting si RNA biogenesis in plants,” Poster displayed on Jan. 9, 2005, at Keystone Symposium “Diverse Roles of RNA in Gene Regulation”. Allen et al., “Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana,”Nature Genetics, 36:1282-1290 (Dec. 2004). Allen et al., “microRNA-Directed Phasing during Trans-Acting siRNA Biogenesis in Plants,” Cell, 121:207-221 (Apr. 2005). Ambros, “The functions of animal microRNAs,” Nature, 431:350 355 (Sep. 2004). Ambros et al., “A uniform system for microRNA annotation,” RNA, 9:277-279 (2003). Baulcombe, “RNA silencing in plants,” Nature, 431:356-363 (Sep. 2004). Benfey, “MicroRNA is here to stay,” Nature, 425:244-245 (Sep. 2003). Carrington, “Small RNAs and Arabidopsis. A Fast Forward Look,” Plant Physiology, 138:565-566 (Jun. 2005). Carrington et al., “Role of MicroRNAs in Plant and Animal Development,” Science, 301:336-338 (Jul. 2003). Chan et al., “RNA Silencing Genes Control de Novo DNA Methyla tion,” Science, 303:1336 (Feb. 2004). Chapman et al., “Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step,” Genes & Development, 18: 1 179-1 186 (2004). Dugas et al., “MicroRNA regulation of gene expression in plants,” Current Opinion in Plant Biology, 7:512-520 (2004). Grey et al., “Identi?cation and Characterization of Human Cytomegalovirus-Encoded MicroRNAs,” J. of Virology, 79:12095 12099 (Sep. 2005). Gustafson et al., “ASRP: the Arabidopsis Small RNA Project Data base,” Nucleic Acids Research, 33:D637-D640 (2005).

(Continued) Primary Examiner * Brent T Page

(74) Attorney, Agent, or Firm * Klarquist Sparkman, LLP.

(57) ABSTRACT A method to generate siRNAs in vivo is described, as are constructs and compositions useful in the method. The method does not depend on the use of DNA or synthetic constructs that contain inverted duplications or dual promot ers so as to form perfect or largely double-stranded RNA. Rather, the method depends on constructs that yield single stranded RNA transcripts, and exploits endogenous or in vivo-produced miRNAs or siRNAs to initiate production of siRNAs. The miRNAs or siRNAs guide cleavage of the tran script and set the register for production of siRNAs (usually 21 nucleotides in length) encoded adjacent to the initiation cleavage site within the construct. The method results in speci?c formation of siRNAs of predictable size and register (phase) relative to the initiation cleavage site. The method can be used to produce speci?c siRNAs in vivo for inactivation or suppression of one or more target genes or other entities, such as pathogens.

36 Claims, 22 Drawing Sheets

US 8,030,473 B2

OTHER PUBLICATIONS Kato et al., “Expression of siRNA from a Single Transcript That Includes Multiple Ribozymes in Mammalian Cells,” Oligonucleotides, 13:335-343 (2003). Lippman et al., “Role of transposable elements in heterochromatin and epigenetic control,” Nature, 430:471-476 (Jul. 2004). Llave et al., “Cleavage of Scarecrow-like mRNA Targets Directed by a Class ofArabidopsis miRNA,” Science, 297:2053-2056, 2002. Mallory et al., “MicroRNAs: something important between the genes,” Current Opinion in Plant Biology, 71120-125 (2004). Palatnik et al., “Control of Leaf Morphogenesis by microRNAs,” Nature, 425 1257-263 & Supplementary Material Sl-S24 (Sep. 2003). Park et al., “Carpel Factory, a Dicer Homolog, and HENl, a Novel Protein, Act in microRNA Metabolism in Arabidopsis thaliana,” Current Biology, 12:1484-1495 (Sep. 2002). Peragine et al., “SGS3 and SGS2/SDEI/RDR6 are required for juve nile development and the production of trans-acting siRNAs in Arabidopsis,” Genes & Development, 18:2368-2379 (2004). Jones-Rhoades et al., “Computational Identi?cation of Plant MicroRNAs and Their Targets, Including a Stress-Induced miRN ,” Molecular Cell, 141787-799 (Jun. 2004). Rhoades et al., “Prediction of Plant MicroRNA Targets,” Cell, 1101513-520 (Aug. 2002).

Schmid et al., “Combinatorial RNAi: a method for evaluating the functions of gene families in Drosophila,” TRENDS in Neurosciences, 25:71-74 (Feb. 2002). Vaucheret et al., “The action of ARGONAUTEl in the miRNA path way and its regulation by the miRNA pathway are crucial for plant development,” Genes & Development, 18:1187-1197 (2004). Vazquez et al., “Endogenous trans-Acting siRNAs Regulate the Accumulation of Arabidopsis inRNAs,” Molecular Cell, 16:69-79 (Oct. 2004). Xie et al., “Dicer-Like 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana,”PNAS, 102112984-12989 (Sep. 2005). Xie et al., “Expression of Arabidopsis MIRNA Genes,” Plant Physi ology, 13812145-2154 (Aug. 2005). Xie et al., “Genetic and Functional Diversi?cation of Small RNA Pathways in Plants,” PLoS Biology, 210642-0652 (May 2004). Xie et al., “Negative Feedback Regulation of Dicer-Like] in Arabidopsis by microRNA-Guided mRNA Degradation,” Current Biology, 131784-789 (Apr. 2003). Zilberman et al., “Role of Arabidopsis ARGONAUTE4 in RNA Directed DNA Methylation Triggered by Inverted Repeats,” Current Biology, 14:1214-1220 (Jul. 2004).

* cited by examiner

US. Patent

FIGURE 1A

FIGURE 1B

FIGURE 1C

FIGURE 1D

Oct. 4, 2011 Sheet 1 0f 22 US 8,030,473 B2

Arabrdopsis transcript and EST databases [ plus validated miRNAs J

I

Predict targets from transcript database - Mispair score. ?lter 54 (238) - MFE ratio ?lter. 273% (145) - Conservation ?lter (103)

Predict targets from EST database - Mispair score. ?lter 54 (767) ~ MFE ratio l'tltei'v 270% (213) - Redundancy ?lter (16) - Conservation ?lter (6)

Total: 109 predicted targets

Expression profiling uslng mlRNA

biogenesls mutants

63 targets 1 Previously validated False negative rate 0.045 targets. experimental

24 targets 2 Previously predicted. False negative rate 0.143 computational only

9 new predicted targets 3 from existing target families

9 novel targets, 4 experimentally validated

4 targets tested 5 experimentally but

not validated

Mispaired bases l%) 8

i '1 3 4 S r? 7 B 9 301? 12 t31~11515it202l

Base-pair position relative to miRNA 5' end

Ti

LL

2 0,1

0,, . . . . . . . . . .

- m 20 an as as so in so so iE=J

miRNA: Target duplex

300‘ Mispair plus _ 0,73 MFE ratio ?lters

Predicted target genes 8 set. ca ptu red

O -u we a. an m

.

5 Mispair score

US. Patent 0a. 4, 2011 Sheet 4 0f 22 US 8,030,473 B2

FIGRE 4A

If,

FIGURE 48 2 Bins 1 &2

Norma?zed imensity (log?) 0 U! o.

05

-‘ . .

\H I

M a 1 x g 1 i g \ \ a x s m \ \ a \ x 5 K A \r K, , ,5. N, , A K. A V k: . I M , 5

6% 69 &5 g? $9 §* § @0 § 6* 6* &§ 6? $9 $9 é @0 §$ FIGURE 4D FIGURE 4E

2 2 i BMs1-4

w?

.115

US. Patent 0a. 4, 2011

FIG URE 4F

hyI1-2 hst- 1 5

dcl1-7 hen 1- 1

rdr6- 1

62 dcl2-1 5“ abKi1

rdr2-1

rdr1-1

73

66 30

76

I lw

37

miRNA target genes (Bins 1-4)

FIGURE 4G 1° All genes ;

Sheet 5 0f 22

72

US 8,030,473 B2

hy41-2 hsb15

—dcl1-7 63

73

55

All genes

hen 1 - 1

dcl2-1 dc/3-1 rdr1- 1

—- rdr2-1

rdr6- 1

US 8,030,473 B2 Sheet 6 0f 22 Oct. 4, 2011 US. Patent

93.25 mm P 35.x 33m

_ MK E. E

:22: IE: :2

.n 53042933“.u44a83562:543u:05$Ba<a,2922soonnnncb?g?néboaoumg"055.55295.8 "v58095080585350560088innocuoboaobiu .m _ __ _ _ _ _ _ _ _

$8», $8.» $35 38% 35% » Q “m QR

Mm wgwmh

wmthw

~ n 00UnvngOKDQPDDHDAODQUDOuDdDdUQUDDngU

35“ £3,“ £25, {8.0. Emu.“ 3.6.", | »

725%? 33va THEE? 3",.” £82. “It,

89% $5.6

<m mgu-k


28% $th 1 $8.“ 28.“ 25“ + umq?

39% N5; 582 52% 32mm w?ww 9&va $5-88: Ev . -

_ 9.: ca» 2 E?

_

$86

$th $va 38..“ E8.“ | £63 I » uéME.

mgmww ommEm mmem mm? 8%: 88 888

mNBN

39: N22. __ 5 l E ?g. I‘. 28%? Till 88%?

Smwmmmmz 2 omcmwzcmv 6:095: wa 0:89:00 nv_ r

Um ngmm


Sm VIN P @Q

33%

39:5 _||l|||l _m dddonu‘AuQAanquéuov .m bogeomdooaabnmoawg . m DavaoobobmmbvmvdguobvvngoDBDOoaboueagaobugogmogdmnbbu

_ _ _ L hqéqb 38h W

25 @? Ea MES.

3: ma “5030Dgobzb?vmbzggggoebboDUDMDOH-bmooBdO?U?DDDDOODOOggdggwod?mbvgepzooo odgmbbDudBH-obgnb 0059.50 049.5 pgbbbobobbmgmoh?bba. . m

_ _ _ _ _ _ _ _ _ _ _ _

38m 2va 33.“ 38h 23b 38b

saga 52% 8,5 m<Z Eml? mmE.

<0 EDGE


TAS3 locus

Sense

1 - Antisense

TASS 5‘D7(+)

‘ U TASS 5'D8(+)

FIGURE 6B


$9.2 8221.2

Eazmhow mNEO 2:3 2520 2:22 Ow HMDUE

US. Patent 0a. 4, 2011 Sheet 12 0122 US 8,030,473 B2

Figure 6D 7“!

ARF3 zaps

Q a “4 “ “WWW W.-.“ w~ “ll—“2., __

g Q 9/1541151/15 ‘ = '0

.g °~ m w o 5' AGAGGGUCUUGCAAGGUCMGAAAU 3 '

Eg- l-ll-lll-llllllllllll % 3' unccscmummcczxcuucuu 5'

F: §‘ , , n: ARF4 1357 1566 < c“ ' '

A - B W WM. . F, _____,___~.......

.5/141/14 11141114x Nucleotide position

5’ CUAAGGUCUUGCAAGGUCAAGAAAA 3‘;

u 5‘ CAAGGGUCUUGCAAGGUCAAGAAAU 3’

l-H-III-IIIHIHHII

Figure 6E

ARF10


FIGURE 7

ta-siRNA Formation by 5' Initiation ta-siRNA Formation by 3’ Initiation

Initiation cleavage site Initiation dealag'e site Steps 1, l

s i i i I 1 i a z a i 1

g - L, ............................ ,...,.

a Aberrani RNA"

assisted recruilmem /\, of RDRS?

a a i i 1 1 i i l i , ,

RDRS

3.02M ,5 ..................... ,3 5,02”)

__ @z: AM .._____—

3'02'0 3’02(-) 502m */

R‘sciasiRNAS’mk)@ RlsciaaiRNASWH Cleavage of initiaior transcript

l in cis 1

h-Sl'RNNgUidBd ta-siRNA-guided cleavage of target mRNA cleavage of target mRNA


FIGURE 8A

ASRP database small RNAs from Col-0, rdr2, and ch3 mutants (5521)

I Predict miRNAs

- Structural RNA ?lter (1920) - Repeat and genic region ?lter (1045) - Small RNA cluster ?lter (630) - Size ?lter (242) - Foldback prediction ?lter (103) - Known miRNA/miRNA* and

locus consolidation filter (13) l

[Expression and biogenesis scree? 4 new validated miRNAs

FIGURE 8B

miR390b

26 m/ loop


FIGU RE 8C

58 rR NA/tRNA

FIGURE 8D 35S:P1/HC ass-p19 35s p21

miR167

miR173

miR403

miR390

miR391

miR447

ss rRNA/tRNA


FIGURE 9A

F, FA FB $% +

4-4- 4-4

R8 RA R (A)n MIRNA transcript

1111131171 sow-1v mRNA + <_ (A)" (#1149001 50) 301R 100412

(A)n SCL6-IV 3' " cleavage product

1004!?

FIGURE 9B

SCL6-I V MIR MIR MIR 301R 1004R 163RA 397bR1 398d?1

, W , ~5§~ 1500

()1 _; O O O O O

5-300

- LL - l L NCIP+TAP 5 6 7 a 9 10 11


FIGURE 10A

90 80 70~ 60 50 40 30" 20" 10"

Frequency (%)

FIGURE 10C

%) 00 O

hmmw 0000 o . .W

10: ’WW all!" - -

-200 -15 -10 -50 +1 +50 Position Relative to Transcription Start

Frequency of TATA Motif (


Figure 108 MIR156a aaacgggttcctaatcttTATATATAccttccatcatcaaaagaccattcAttgttcact MIR156a ataaagaaaggtaagactctttgaaatagagagagataaggttttctcttAtcttcttct MIR156c tcttctcctctcctcttattaatctaatcctcctccccgaatatttctcthctttagtt MIR156c ctcttctccttcggtTATAAATAttctctccggttttgcttgtttaacctAaaagcctca MIR156e tctatccccatttggcTATAAAAAgccccgacaggtctcagtttcttcccAcatccaaag MIR156f tctctccattttggcTATAAAAAgccacaacagggtctccatttcttccchagccaatg MIR157c tttctcaacttactccTATAIATAtacacattactctctattttcccttthcacttcat MIRl57d tggtctcaaatctttccTATATATAcacaccactttccattacaccatttActcttcacc MIRlSQa tgttcctttttttcttttctttttattcttctatcacgaatatctaaaccAcTATAATTA MIR159a acgaatatctaaaccacTATAATTAcgactctctatctatcatttcttccAaaacatgac MIR159b ggctacagatttttgtctttaaaaagccattcaagtttcaatggtttttcActtttgttc MIR319a gttctaaatttgaagctTATAAAAAcccatcactacttttgcatacttgtAtccgcagtg MIR3l9b tacctttgtttttgcTATAAAAAgccataactccttcattttctttagacAtctcttctt MIRl60a tcttgtctacaTATACATATATTTATAtacacacatgtatctctctcatcAcacccttaa MIR160a atcccacccttaattgtttTATATAAAccatttctcctcctctctccatcAccttcaatc MIRl60b tttatcatttttctcctcTATATATAtgtgccaccattcctcttatactcAtaactctcc MIRlGOc tcttctctctttccccttTATATATTtgtaccacatattcctcttcaaccAaaactcttc MIR161a ctttctcttcttccttcaTATTTATAtacaaccttctctcacttatctctAactcatcct MIR162a tgttatgagacttttagatacattttagtTATAAATAtgaatcaaatacaTtttagttct MIRlGZa tttagatacattttagtTATAAATAtgaatcaaatacattttagttctagAagaaaaaac MIRl62a accagatctataaagtttgtTATTAAAAgatagagagagaggagggatgtAgtaggccaa MIRl63a catcaaaggaaaattagTATAAATAagcatagaggcgtccatggattatcAcagttctca MIR164a ctagcaacctagcactTATAIATGtagagtttgtgaaatttagggcagacAagcccccac MIRl64a atgcaatctttgggccTATATATAcaaacctttccataaccaaagttctcAtactacaaa MTRl64b atagatatttccgtttgcTATAAATGagaaagcacttacaacatacatacAttctctctt MIR165a tgtttctgttgtgtctTATTAAAAgcccatcttcgtctccgccactcatcAttccctcat MIR166a tctccactactcaatttcttcataaaacccccctttttatttctctcattthtcttcca MTRl66a aatttcttcataaaacccccctttttatttctctcattctctcttccatcAtcaccactc MTRl66b tcttgagtttttttctcttcttaaaaacctcttcttcacttatccttctcAtcattctct MIRl66c tggtcatttgtgcctcTATATATAcaagacataggtttattttgtctcacAcataccttt MIRl66d ttgctcctctctcctathATAAATAttcgcctcacacatagacctatttAgcttcttct MIR167a tctcctccttatcccttcTATATAAAcactcgtcttcttcttcacttgatGaacagaaaa MIRl67b caaatcctctctcatctctttcTATAAGTAtctatagcgcctcttaaaccAcaaagcatc MIR169a tatctctgacccatcttcTATATAAAcccagagcgggtaagtcctctagtAttcataagc MIRl69c aactggtagaaagatcTATAAGTAcgatacaccttatacttcaagagagcAagacaatgc MIRl69h ttcgtacggtcatgcctatataacacacatagtagtcttgtgggatactcAtcaacaacc MIR1691 ttccttctctcaagggtTATAAATAaaacgagagcacatgaatgtaaggcAtgagacata MIR169n cgagtctcgagggtTATAAAAAgagagcacatgcatgtatggaataaggcAaaaacatat MIRl70a tgagagtagcagagtTATTAAATgcttcgcagaattgcagttgcacattcActcccttct MIRl7la taattcttcctcaaaatcttttctctttttttggtTATATATAtttgaatTttgatttat MIRl7lb cttcttcaaccatcttchATTTATAtcttcttcttcactatgcatactcAtaaactttg MIRl7lc tcttcatcaccctcttchATTTATAtctccttcactctgcaaacccaagAaaaaacatt MIRl72a ccaaataaatcaacaTATATATTattacacagtcacatctcttactgtgcATATATATTt MIRl72a acatctcttactgtgcaTATATATTtagacaaacacatctctctctctctAtctctctca MIR172a gttttactattttagcagTATATATTaagaagttcagatgttattcgatcAtctgttttt MIR172b aagtcattgcgtgtctcTATAAATAccacacttcaccttcttcttcactthacctctca MIRl72b tttttctcgtttttttcttcttcttctccaagaaaatagagatcgaaaagAttagatcta MIR172c tttaatttgttaatTATATATAttttatgcacatcattggagaaaacaccAaataggctc MIRl72c tctttatcgcttcaTATATATAaaagtctacatctatctctttctaggtcActagctaga MIR172e aaaaggttttacggtttgthATAAAAGacttgcaatcttgagatatgtcAtattgagaa MIR172e atatgtcatattgagaactctttagcctttggcttctgttcctgacacttAtatagtgaa MIR172€ tttcatatgagthATATATTcatgtacctatCtctthaattgcttCtCAccaaaatca MIR394a tgttagatctgaggtcTATTAAAAtccgaatcctttcaatctcttctcttAttccatcac MIR394a agggttttaagccaagcttatatagcccgtcataaagagaactcatctgcthtctctca MIR394a ctctcaataccAATAAATAtcaccaccgtccttctctcctatcactattcAatctatcgc MIR395c gactctttgcaataataTATAAATAggcatgcagtgttagtgttgtttgtAtcatgacag MIR395e acaatgcttccaatthATATATAaaacgccagtccctccattctttttcAaaccctaac MIR396a ctcttcccttgtccccTATAAATAtctttctatcgaccatcttccttctcAcaacttcaa MIR397b aagacacgaccaaatgtctTATAAATGatatttgtgtttatctccatggtAatagaaatg MIR398c tcatttgttgtgttgthATATATAgtagctctcagcagatttgaaggatAtcgaaactc MIR399b cacacacgcatatataTATAAATAcagacacaagccttcatatggatcttAtagagatga MIR399c ccactttTATTAAAActcaTATATATAcactgagccattagtccatgaatAaccaaccag MIR399d aaacactttcatcaacTATATATAcatactttgctagtccaacttccaatAactcaaaat

(12) united states patent us 8,030,473 b2 carrington et al ... · ers so as to form perfect or...

Documents