1st nine wee ks - suffolk city public schoolsblogs.spsk12.net/spsgifted/files/2012/10/packet...|...

| Debra Curran, Linda Ellis, Pamela Stark, Renee Wagner - Gifted Resource Teachers 1

Suffolk Public School’s Quest Packet & Portfolio

1st Nine Weeks

Student’s Name: ________________________________ School: ________________________________________ Accelerated Course: 7th Life Science . Core Teacher: __________________________Block: ___ Gifted Resource Teacher: _________________________

Each assignment must be submitted on the assigned due date for this nine

week grading period. Students are responsible for completing 3 packet

activities, and a final portfolio submission which includes 2 additional

class work samples as well as a final project from the student choice

menu. Please do not wait until the end of the quarter to begin working on

your portfolio project. These projects are designed to require several

days of planning, research and assembly.

___________________________________ ____________________________________ Student Signature GRT Signature


Welcome to 7th Grade Science

Life Science The Life Science standards emphasize a more complex understanding of change, cycles, patterns, and relationships in the living world. Students build on basic principles related to these concepts by exploring the cellular organization and the classification of organisms; the dynamic relationships among organisms, populations, communities, and ecosystems; and change as a result of the transmission of genetic information from generation to generation. Inquiry skills at this level include organization and mathematical analysis of data, manipulation of variables in experiments, and identification of sources of experimental error. Metric units (SI – International System of Units) are expected to be used as the primary unit of measurement to gather and report data at this level. The Life Science standards continue to focus on student growth in understanding the nature of science. This scientific view defines the idea that explanations of nature are developed and tested using observation, experimentation, models, evidence, and systematic processes. The nature of science includes the concepts that scientific explanations are based on logical thinking; are subject to rules of evidence; are consistent with observational, inferential, and experimental evidence; are open to rational critique; and are subject to refinement and change with the addition of new scientific evidence. The nature of science includes the concept that science can provide explanations about nature and can predict potential consequences of actions, but cannot be used to answer all questions. While each science teacher may have their own individual rules and procedures for their classrooms, there are a few universal expectations and guidelines for ALL 7th grade science students enrolled in Suffolk Public Schools Quest Courses:

1. Cheating of any kind will result in a “0”/”F” grade and an administrative referral. 2. Using sources of information and not citing the source or plagiarizing (copying) the source will be

considered cheating and will result in a “0”/”F” grade and an administrative referral. 3. All assignments are due on the assigned date. Late work will follow Suffolk Public School’s Student

Handbook. 4. ALL students will conduct themselves in a respectful manner and in accordance to Suffolk Public

Schools conduct guidelines. 5. Students will be responsible for seeking out missing work due to absences.

These unit packets can be electronically accessed at http://blogs.spsk12.net/spsgifted/. If there are ever any questions or concerns, please do not hesitate to contact your assigned Science Teacher or GRT. Core Teacher: ___________________________________ Email: ___________________________________________

GRT (KFMS): Debra Curran Email: [email protected]

GRT (JYMS): Renee Wagner Email: [email protected]

GRT (FGMS):Linda Ellis Email: [email protected]

GRT: Email: Student Name (please print)_____________________________Parent Signature: ______________________________

http://blogs.spsk12.net/spsgifted/

mailto:[email protected]




Unit Lesson Plan Time Allottment: 9 weeks (one quarter) Curriculum Standards: Adaptations from LS SOLs: LS 2, 3, 4, 13, 5, 11 Established Goals:

For this unit, students will investigate and understand that all living things are composed of cells (LS.2)

a) cell structure and organelles (cell membrane, cell wall, cytoplasm, vacuole, mitochondrion, endoplasmic reticulum, nucleus, and chloroplast);

b) similarities and differences between plant and animal cells; c) development of cell theory; and d) cell division (mitosis and meiosis).

The student will investigate and understand that living things show patterns of cellular organization. (LS.3)

a) cells, tissues, organs, and systems; and b) life functions and processes of cells, tissues, organs, and systems (respiration, removal of

wastes, growth, reproduction, digestion, and cellular transport).

The student will investigate and understand that the basic needs of organisms must be met in order to carry out life processes. (LS.4)

a) plant needs (light, water, gases, nutrients); b) animal needs (food, water, gases, shelter, space); and c) factors that influence life processes.

The student will investigate and understand that organisms reproduce and transmit genetic information to new generations. (LS.13)

a) the role of DNA; b) the function of genes and chromosomes; c) genotypes and phenotypes; d) factors affecting the expression of traits; e) characteristics that can and cannot be inherited; f) genetic engineering and its applications; and g) historical contributions and significance of discoveries related to genetics. BIO.2d) the development of the structural model of DNA.

The student will investigate and understand how organisms can be classified. (LS.5)

a) the distinguishing characteristics of kingdoms of organisms; b) the distinguishing characteristics of major animal and plant phyla; and c) the characteristics of the species.

The student will investigate and understand that ecosystems, communities, populations, and organisms are dynamic and change over time (daily, seasonal, and long term). (LS.11)

a) phototropism, hibernation, and dormancy; b) factors that increase or decrease population size; and eutrophication, climate changes, and

catastrophic disturbances.


Lesson Objectives:

Students will demonstrate their knowledge of the natural world around them, to include the following; cell structure, the similarities and differences between the plant and animal cell, the cell theory, cell division, cellular organization, life funtions and processes of cells and the basic needs of organisms.

Students will investigate and understand that organisms reproduce and transmit genetic information to new generations by the role of DNA; the function of genes and chromosomes; genotypes and phenotypes; factors affecting the expression of traits; characteristics that can and cannot be inherited; genetic engineering and its applications; and historical contributions and significance of discoveries related to genetics.

Students will investigate and understand how organisms can be classified by the distinguishing characteristics of kingdoms of organisms; the distinguishing characteristics of major animal and plant phyla; and the characteristics of the species.

The student will investigate and understand that ecosystems, communities, populations, and organisms are dynamic and change over time (daily, seasonal, and long term) phototropism, hibernation, and dormancy; factors that increase or decrease population size; and eutrophication, climate changes, and catastrophic disturbances.

Throughout the unit, students will: develop a cell model create a cartoon about the cell theory or cell division Survival Box/Bag - Basic needs of plants and animals Create a DNA model Create a Phenome Family Tree- to highlight dominant traits of students, parents and grandparents Construct a position defending or refuting genetic testing

Unit Vocabulary/Terms:

cell structure and organelles, cell membrane, cell wall, cytoplasm, vacuole,

mitochondrion, endoplasmic reticulum, nucleus, and chloroplast

plant and animal cells, cell theory; cell division,(mitosis and meiosis

cells, tissues, organs, and systems, respiration, removal of wastes, growth,

reproduction, digestion, and cellular transport

DNA, genes, chromosomes, genotype, phenotype, traits, genetic engineering

Kingdoms, phyla, species

Phototropism, hibernation, dormancy

Population, eutrophication


Understanding by Design Template Teacher: Debra Curran, GRT Grade: 7th Portfolio Date: 1st Semester Subject: Life Science

Topics

Cell Theory, Cells, Basic Needs, Genetics, Classification, Change, Genetic Testing

Activities develop a cell model create a cartoon about the cell theory or cell division Survival Box/Bag - Basic needs of plants and animals Create a DNA model Create a Phenome Family Tree- to highlight dominant traits of students, parents and grandparents (if

adopted use adopted parents and grandparents) Construct a position via multimedia presentation defending or refuting genetic testing

Assessments 1. Cell model - animal and plant cells with organelles 2. Plant and Animal Survival Box/Bag 3. Model of DNA 4. Family tree – Genetics 5. Student reflections on the unit

Stage 1- Desired Results SOLs: LS 2, 3, 4, 13, 5, 11 Established Goals: For this unit, students will investigate and understand that all living things are composed of cells. The student will investigate and understand that living things show patterns of cellular organization.

(LS.3) The student will investigate and understand that the basic needs of organisms must be met in order to

carry out life processes. (LS.4) The student will investigate and understand that organisms reproduce and transmit genetic

information to new generations. The student will develop a structural model of DNA. BIO.2d The student will investigate and understand how organisms can be classified. (LS.5) The student will investigate and understand that ecosystems, communities, populations, and

organisms are dynamic and change over time (daily, seasonal, and long term).

Understandings:

Essential Questions:

Students will: demonstrate understanding of cells,

genetics, Cell Theory, Basic Needs, Genetics, Classification, Change, Genetic Testing

understand how to make convincing presentations

1. How do we come to know the natural world and our place in it? (LS.2)

2. What is the basis of life? (LS.2) 3. How are the characteristics of living things passed

on through the generations? (LS13) 4. How do we classify things around us? (LS.5) 5. How do organisms survive in harsh or changing

environments? (LS11) 6. How do species change through time? (LS.11)


Stage 2- Assessment Evidence

Cell model - animal and plant cells with organelles

Plant and Animal Survival Box/Bag

Family tree – Genetics Student reflections on the unit

Student will be able to…

demonstrate understanding of cells, genetics,

understand how to make convincing presentations

select an appropriate presentation form for a specific purpose and audience

Stage 3 Learning Plan Learning Activities: Students will work independently to meet project due dates Students will research cell theory, DNA, cell structures and genetics Students will learn how to constructively present and debate issues The teacher will provide a positive learning environment to foster student independent learning


Cell Cartoon Directions for Choice A: Create a cartoon about cell theory from the point of view of the cell.

OR Directions for Choice B: Create a cartoon which includes a step by step guide that could be used by a cell to

learn how to divide. Your cartoon must be from the point of view of the cell.

If you choose Choice A: Cell Theory Cartoon

1. Include the principle elements of cell theory. 2. Must include 6 frames 3. Should be neat and colorful.

Answer the following questions before you create your cartoon. Describe the important discoveries leading to the development of cell theory.

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

List the 3 components of the cell theory?

1. _________________________________________________________________________________

_________________________________________________________________________________

2. .________________________________________________________________________________

_________________________________________________________________________________

3. _________________________________________________________________________________

_________________________________________________________________________________

Why do you think scientific research is important? ____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________


If you choose Choice B: Cell Division Cartoon

1. Include steps of mitosis and meiosis 2. Include at least 6 frames 3. Must be neat and colorful

Answer the following questions before you create your cartoon. Why must your body make new cells?

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

What is the cell cycle? ____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

What is mitosis? ____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

Where does mitosis fit into the cell cycle? ____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

What is the difference between mitosis and meiosis? ____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________

____________________________________________________________________________________


Name ______________________________

Cell Theory Cartoon (6 Frames)


3D Cell Model Project (Page A of B)

Directions: Please construct both a Plant and Animal cell to reflect your knowledge of cell structures and functions.

Suggested Materials:

Directions for Model:

Lab sheet:

1. Model Magic, clay or Playdoh

2. Items from your house to represent each organelle.

3. Index cards

(for labeling)

4. Toothpicks

Create a 3D model of an animal cell

and a 3D model of a plant cell.

Include the organelles listed

below: cell membrane, cell wall, cytoplasm, vacuole, mitochondrion, endoplasmic reticulum, ribosome, nucleus, and chloroplast

Label each part of the cell

model (neatly) Use household items to

represent each organelle (you must use a different items for each organelle)

In your own words Define the organelle List the item used to represent

each organelle Write an explanation of why you

chose the item and how it is connected to the organelle.

Example: Cell membrane- saran wrap – I

used saran wrap for the cell membrane because it keeps things from entering and leaving the container (Cell)

Animal Cell

biologycorner.com

Plant Cell

biologycorner.com


Cell Model Lab Sheet (Page B of B)

Animal Cell Organelles – Definition (in your own words)

Representative Item –

List the item used with an explanation of why you used that item for that organelle.

1. cell membrane

2. cytoplasm

3. nucleus

4. vacuole

5. mitochondria

6. endoplasmic reticulum – smooth

7. endoplasmic reticulum – rough

8. Golgi bodies (apparatus)

9. ribosome

Plant Cell Organelles – Definition (in your own words)

Representative Item –

List the item used with an explanation of why you used that item for that organelle.

1. cell wall

2. cell membrane

3. cytoplasm

4. nucleus

5. vacuole

6. mitochondria

7. endoplasmic reticulum – smooth

8. endoplasmic reticulum – rough

9. chloroplast

10. Golgi bodies (apparatus)

11. ribosome


DNA Model (Virginia Department of Education)

Materials needed: licorice ropes, small colored gumdrops, color toothpicks, “The DNA Model” worksheet.

Procedure: 1. Before you begin, draw and label a model of DNA based on your previous knowledge from class.

2. Select different colors of gumdrops, two licorice ropes and a handful of toothpicks to use to build the DNA model you drew. The two licorice ropes represent the sugar/phosphate backbone of DNA, while the gumdrops represent nitrogen bases.

3. Construct the DNA molecule, making sure to match the bases appropriately. The toothpicks make up the “rungs” of the ladder, with two gumdrops on each rung and a licorice rope at each side. The gumdrop colors identified with adenine and thymine must be paired and the colors designating guanine and cytosine must be paired. (If the model does not follow the scientific structure of DNA, no points will be awarded).

4. After the ladder is complete, students may twist the model to show the double helix model. 5. Be sure to label the key below to accurately reflect your DNA model:

Key Points to Remember: DNA is Deoxyribose Nucleic Acid. DNA is made up of nitrogen bases, phosphate and sugar. The sequence of the bases makes up a gene.

Example: aattgccaatgggccctttaagagctagggatcgatgctagctagttttctagatct could be the gene for a certain trait. Nitrogen bases DNA genes chromosome (Nitrogen bases make up DNA, which makes up genes,

which group together to form a chromosome.) The chromosomes are passed on to offspring, who carry on the genetic information.

6. How can only four bases make up so many different traits, characteristics, or sets of instructions for an

organism? Explain. ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

DNA Structure Purpose/Location Model Key List the item and color for each part used to

represent the DNA model

Phosphate Makes up side of DNA ladder

Sugar Makes up side of DNA ladder

Adenine Nitrogen base, pairs with thymine

Guanine Nitrogen base, pairs with cytosine

Cytosine Nitrogen base, pairs with guanine

Thymine Nitrogen base, pairs with adenine


STUDENT CHOICE A

Create a SURVIVAL BOX/BAG for a plant of your choice and a

SURVIVAL BOX/BAG for an animal of your choice.

Plant needs are: light, water, gasses and nutrients

Animal needs are: food, water, gases, shelter, space;

and factors that influence life processes

You have learned that the basic needs of organisms must be met in order to carry out life processes. Now it is time to think….

What if you had unlimited powers and resources?

1. Choose a plant. Label with the scientific name. 2. Roll the die one time. Check the key to see where in the world, the plant you have selected will be moved.

How will your plant survive in the region?

1. Choose an animal. Label with the scientific name. 2. Roll the die one time. Check the key to see where in the world, the animal you have selected will be moved.

How will your animal survive in the region?

The boxes/bags are to contain:

Boxes/bags are to be decorated with the pictures or descriptions of the basic needs of organisms.

Index cards describing what basic needs are lacking after the move, and how you will help your plant and animal survive in the new habitat.

Pictures, drawings, or items from home with index cards explaining the items and how it will help the plant or animal survive in their new habitat.

Picture of world map labeled with the starting point and ending point for the plant and animal. KEY For Dice: (Latitude and Longitude)

1=South America The latitude and longitude of Buenos Aires, Argentina is: 34° 36' S / 58° 22' W

2 = North America- The latitude and longitude of NYC, USA is: 40° 42' N / 74° 0' W

3 = Antarctica- The latitude and longitude of Antarctica is: 82° 51' S / 135° NaN' W

4= Asia- The latitude and longitude of Siberia is: 61° 0' N / 99° 11' E

5 = Australia- The latitude and longitude of Sydney NSW, Australia is: 33° 52' S / 151° 12' E

6 = Africa- The latitude and longitude of Cairo, Egypt is: 30° 2' N / 31° 14' E

MATERIALS NEEDED: 2 Small boxes or bags, markers, index cards, items from home for cell, cut out pictures or drawings, climate and conditions about the place your plant and animal will be sent.


STUDENT CHOICE B

Task I – Vocabulary Complete a Frayer Model (on your own medium) for EACH of the following vocabulary words. DNA, generation, inherit, heredity, genetics, allele, heterozygous, homozygous, genotype and

phenotype Frayer Model consists of the word, definition, facts/characteristics, examples or drawings, non-

examples

EXAMPLE DEFINITION A molecular unit of heredity of a living organism The stuff living things are made of.

FACTS/CHARACTERISTICS Holds the information to build and

maintain an organisms’ cells and pass genetic traits to offspring

Majority of living organisms encode their genes in DNA

Gregor Mendel – Father of Genetics

EXAMPLES/DRAWINGS

NON-EXAMPLES

Tree – made up of genes Hard drive for computer

Heredity is the passing of traits from parents to offspring. Some characteristics can be inherited

such as, hair color, eye color, eyebrow shape, height etc. You are to choose five of your physical traits to investigate and create your own Genotype Family Tree which will transmit genetic information to future generations. You can choose your mother’s side or your father’s side of the family (or both). This will be a great way to talk to family members about what you are learning in your Life Science class. Complete the chart below.

VOCABULARY WORD

GENE


Frayer Model Template DEFINITION

FACTS/CHARACTERISTICS

EXAMPLES/DRAWINGS

NON-EXAMPLES

DEFINITION

FACTS/CHARACTERISTICS

EXAMPLES/DRAWINGS

NON-EXAMPLES

VOCABULARY WORD

VOCABULARY WORD


Task II – Choose 5 of your own physical traits.

1. ________________________________ 2. ________________________________ 3. ________________________________ 4. ________________________________ 5. ________________________________

My Physical Traits (You may substitute a “TV” family)

Family Member Parent, Grandparent, etc.

Physical Trait Same? Different?

1.

2.

3.

4.

5.


Task III – Create a Phenome Family Tree Materials needed; Poster board Markers Pictures or drawings of family members Construction paper Index cards for labeling With teacher approval, students may create the Family Phenome Tree on the computer

Instructions; Once you have completed your research, create a Family Phenome Tree. There is no specific ways to create your tree. Be creative. Here are some ideas to get you started:

You may have different limbs on the tree for different traits You may have different limbs represent different family members. Make sure you keep the generations consecutive.

Example

Hair type – Deb, dad, grandfather

Curly hair – Deb, dad, grandfather

Eye shape – Deb, mom, grandmother

Dimple – Deb, mom, grandmother

Gray hair – Deb, mom, grandfather


STUDENT CHOICE C

Are you for or against genetic engineering?

Choose one of the following Controversial Gene Technologies to research: Cloning of animals (sheep) Producing a seedless watermelon Making crops resistant to herbicides Using DNA fingerprinting to solve crimes Introducing a growth hormone into the diet of dairy cows to improve milk production Grafting multiple fruits onto one tree Selective Breeding

Directions: After selecting one of the topics above to research, construct a multimedia presentation to address the multifaceted aspects of your topic in relation to genetic engineering.

The following questions/topics must be clearly present in your multimedia presentation.

What is the controversial gene technology?

What are the benefits of your chosen gene technology?

What are the negative effects of your chosen gene technology?

What are the risks associated with your chosen gene technology?

What is an ethical concern regarding your chosen gene technology?

(There always are ethical concerns when science challenges nature)

How does this technology affect the ecosystem?

How does this technology affect your life now and what are the ramifications for future generations? List the sources used for your research:


STUDENT CHOICE D: Reflection Block ______Name ____________________________________________________________Date __________________________

Select a lesson that was presented to you when the Gifted Resource Teacher was in your class this quarter. Construct a personal narrative (at least 1 page) in which you fully develop your voice addressing the main topic/s covered from the lesson. [1] Include the important elements of the lesson and how it connects to the real world [2] what aspects of this lesson were particularly positive or negative to your own personal academic development and learning style (Metacognition), [3] what would you do to improve the lesson if you were given the opportunity to present the lesson yourself (If you wouldn’t

change the lesson, you must fully justify why). You will be scored based on the following RUBRIC:

CRITERIA UNDERSTANDING PERSONAL RESPONSE CRITICAL RESPONSE TEACHER COMMENTS

EXCEEDS THE STANDARD

4 points

I recall the important elements of the lesson in order, with details. My response has a sense of story.

I made connections from my life to the lesson. I made connections to my own personal academic development and learning style. I give details to explain my connections.

I tell what I think about the lesson. I support it with details from the lesson or my life.

MEETS THE STANDARD

3 points

I recall the important elements of the lesson in order. My response has a sense of story.

I made connections from my life or to my own personal academic development and learning style to the lesson. I give few details to explain my connections.

I tell what I think about the lesson. I support it with details from the lesson.

NEARLY MEETS THE STANDARD

2 points

I recall some important elements of the lesson. The elements are not in order and/or complete.

I made connections from my life or to my own personal academic development and learning style to the lesson. I lack details to explain my connections.

I tell what I think about the lesson, but I don't use details from class.

LITTLE EVIDENCE OF THE STANDARD

1 point

I recall elements of the lesson. They may not be important or complete.

I tell events from the lesson and/or my life, but they are not connected.

I tell about the lesson without telling what I think.

Points Earned

Total Score:

12


Name _________________________

Cells, DNA and Genes

Quest Packet Assignments The following assignments are designed to be completed in class. Gifted Resource Teachers in conjunction with core teachers may elect to omit assignments due to time restraints.

Only those assignments presented in class will be counted toward a grade.

Due Dates Assignment Science Packet Portfolio 1st 9 weeks Activity Page/s

Score

Cell Cartoon Pages 7, 8 & 9

Cell Model (To be completed at Home) Pages 10 & 11

DNA Model Page 12

Student Selected Portfolio Activity Students must submit 2 additional assignments they completed in science class from the quarter (Quest Packet Assignments are NOT valid) as well as 1 out of the 4 portfolio Student Choice Activities from

pages 13-17 to demonstrate their academic growth and development . These home-based activities must be turned in on the assigned due date to receive credit.

Student Choice for Portfolio Piece #1

(Completed class product or reflection from 1st quarter GRT lesson. If submitting a reflection, please use the reflection form from page 19 of this packet. Only 1 Reflection is allowed.)

Name & description of submission:


(Completed class product from 1st quarter GRT lesson)



(Must be 1 out of the 3 choices from pages 13 - 18)


Teacher Comments:

Final 1st Quarter Earned Test Score

100

15

15

70

1st nine wee ks - suffolk city public schoolsblogs.spsk12.net/spsgifted/files/2012/10/packet...|...

Documents