2009 bovine coronavirus nonstructural protein 1 (p28) is an rna binding protein that binds terminal...

JOURNAL OF VIROLOGY, June 2009, p. 6087–6097 Vol. 83, No. 120022-538X/09/$08.00�0 doi:10.1128/JVI.00160-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Bovine Coronavirus Nonstructural Protein 1 (p28) Is an RNA BindingProtein That Binds Terminal Genomic cis-Replication Elements�

Kortney M. Gustin,1 Bo-Jhih Guan,1 Agnieszka Dziduszko,2 and David A. Brian1,2*Departments of Microbiology1 and Pathobiology2, University of Tennessee College of Veterinary Medicine,

Knoxville, Tennessee 37996-0845

Received 23 January 2009/Accepted 29 March 2009

Nonstructural protein 1 (nsp1), a 28-kDa protein in the bovine coronavirus (BCoV) and closely related mousehepatitis coronavirus, is the first protein cleaved from the open reading frame 1 (ORF 1) polyprotein product ofgenome translation. Recently, a 30-nucleotide (nt) cis-replication stem-loop VI (SLVI) has been mapped at nt 101to 130 within a 288-nt 5�-terminal segment of the 738-nt nsp1 cistron in a BCoV defective interfering (DI) RNA.Since a similar nsp1 coding region appears in all characterized groups 1 and 2 coronavirus DI RNAs and must betranslated in cis for BCoV DI RNA replication, we hypothesized that nsp1 might regulate ORF 1 expression bybinding this intra-nsp1 cistronic element. Here, we (i) establish by mutation analysis that the 72-nt intracistronicSLV immediately upstream of SLVI is also a DI RNA cis-replication signal, (ii) show by gel shift and UV-cross-linking analyses that cellular proteins of �60 and 100 kDa, but not viral proteins, bind SLV and SLVI, (SLV-VI)and (iii) demonstrate by gel shift analysis that nsp1 purified from Escherichia coli does not bind SLV-VI but doesbind three 5� untranslated region (UTR)- and one 3� UTR-located cis-replication SLs. Notably, nsp1 specificallybinds SLIII and its flanking sequences in the 5� UTR with �2.5 �M affinity. Additionally, under conditions enablingexpression of nsp1 from DI RNA-encoded subgenomic mRNA, DI RNA levels were greatly reduced, but there wasonly a slight transient reduction in viral RNA levels. These results together indicate that nsp1 is an RNA-bindingprotein that may function to regulate viral genome translation or replication but not by binding SLV-VI within itsown coding region.

Coronaviruses (CoVs) (59) cause primarily respiratory andgastroenteric diseases in birds and mammals (35, 71). In hu-mans, they most commonly cause mild upper respiratory dis-ease, but the recently discovered human CoVs (HCoVs),HCoV-NL63 (65), HCoV-HKU1 (73), and severe acute respi-ratory syndrome (SARS)-CoV (40) cause serious diseases inthe upper and lower respiratory tracts. The SARS-CoV causespneumonia with an accompanying high (�10%) mortality rate(69). The �30-kb positive-strand CoV genome, the largestknown among RNA viruses, is 5� capped and 3� polyadenylatedand replicates in the cytoplasm (41). As with other character-ized cytoplasmically replicating positive-strand RNA viruses(3), translation of the CoV genome is an early step in replica-tion, and terminally located cis-acting RNA signals regulatetranslation and direct genome replication (41). How these hap-pen mechanistically in CoVs is only beginning to be under-stood.

In the highly studied group 2 mouse hepatitis coronavirusmodel (MHV A59 strain) and its close relative the bovineCoV (BCoV Mebus strain), five higher-order cis-replicationsignals have been identified in the 5� and 3� untranslatedregions (UTRs). These include two in the 5� UTR requiredfor BCoV defective interfering (DI) RNA replication (Fig.1A) described as stem-loop III (SLIII) (50) and SLIV (51).Recently, the SLI region in BCoV (15) has been reanalyzedalong with the homologous region in MHV and is now

described as comprising SL1 and SL2 (Fig. 1A), of whichSL2 has been shown to be a cis-replication structure in thecontext of the MHV genome (38). In the 3� UTR, twohigher-order cis-replication structures have been identifiedthat function in both DI RNA and the MHV genome. Theseare a 5�-proximal bulged SL and adjacent pseudoknot thatpotentially act together as a unit (23, 27, 28, 72) and a3�-proximal octamer-associated bulged SL (39, 76) (Fig.1A). In addition, the 5�-terminal 65-nucleotide (nt) leaderand the 3�-terminal poly(A) tail have been shown to becis-replication signals for BCoV DI RNA (15, 60).

In CoVs, the 5�-proximal open reading frame (ORF) of �20kb (called ORF 1) comprising the 5� two-thirds of the genomeis translated to overlapping polyproteins of �500 and �700kDa, named pp1a and pp1ab (41). pp1ab is formed by a �1ribosomal frameshift event at the ORF1a-ORF1b junctionduring translation (41). pp1a and pp1ab are proteolyticallyprocessed into potentially 16 nonstructural protein (nsp) endproducts or partial end products that are proposed to functiontogether as the replicase (24). ORF 1a encodes nsps 1 to 11which include papain-like proteases (nsp3), a 3C-like mainprotease (nsp5), membrane-anchoring proteins (nsps 4 and 6),a potential primase (nsp8), and RNA-binding proteins (nsp7/nsp 8 complex and nsps 9 and 10) of imprecisely understoodfunction (19, 20, 24, 25, 29, 43, 49, 77). ORF 1b encodes nsps12 to 16 which function as an RNA-dependent RNA polymer-ase, a helicase, an exonuclease, an endonuclease, and a 2�-O-methyltransferase, respectively (6, 17, 24, 44). 3� Proximalgenomic ORFs encoding structural and accessory proteins aretranslated from a 3�-nested set of subgenomic mRNAs (sgm-RNAs) (41).

* Corresponding author. Mailing address: Department of Microbi-ology, University of Tennessee, Knoxville, TN 37996-0845. Phone:(865) 974-4030. Fax: (865) 974-4007. E-mail: [email protected].

� Published ahead of print on 8 April 2009.

6087

on March 29, 2015 by S

T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

The N-terminal ORF 1a protein, nsp1, in the case of BCoVand MHV is also named p28 to identify the cleaved 28-kDaproduct (18). The precise role of nsp1 in virus replication hasnot been determined, but it is known that a sequence encodingan N-proximal nsp1 region in MHV (nt 255 to 369 in the 738-ntcoding sequence) cannot be deleted from the genome withoutloss of productive infection (10). nsp1 also directly binds nsp7and nsp10 (11) and by confocal microscopy is found associatedwith the membranous replication complex (10, 66) and virusassembly sites (11). The amino acid sequence of nsp1 is poorlyconserved among CoVs, indicating that it may be a protein thatinteracts with cellular components (1, 58). In the absence ofother viral proteins, MHV nsp1 induces general host mRNAdegradation (79) and cell cycle arrest (16). The SARS-CoVnsp1 homolog, a 20-kDa protein, has been reported to causemRNA degradation (30, 45), inhibition of host protein synthe-sis (30, 45, 70), inhibition of interferon signaling (70, 79), andcytokine dysregulation in lung cells (36).

In this study, we examine the RNA-binding properties ofBCoV nsp1 with the hypothesis that it is a potential regu-lator of translation or replication through its binding ofSLVI mapping within its coding region. The rationale forthis hypothesis stems from five observations. (i) In theBCoV DI RNA, the 5�-terminal one-third (approximately)of the nsp1 cistron and the entire nucleocapsid (N) proteincistron together comprise the single contiguous ORF in theDI RNA, and most of both coding regions appear requiredfor DI RNA replication (15). (ii) The partial nsp1 cistron inthe DI RNA must be translated in cis for DI RNA replica-

tion in helper virus-infected cells (12, 14). (iii) A similar partof the nsp1 cistron is found in the genome of all character-ized naturally occurring group 1 and 2 CoV DI RNAs de-scribed to date (7, 8). (iv) A cis-acting SL named SLVI isfound within the partial nsp1 cistron in the BCoV DI RNA(12). (v) Translation, which involves a 5�33� transit of ri-bosomes, and negative-strand synthesis, which involves a3�35� transit of the RNA-dependent RNA polymerase, can-not simultaneously occur on the same molecule with a singleORF (4, 31). Thus, to enable genome replication an inhibi-tion of translation at least early in infection for cytoplasmi-cally replicating positive-strand RNA viruses is required (4,5, 22, 32). Mechanisms of translation inhibition have beendescribed for the Q� viral genome, wherein the viral repli-case autoregulates translation by binding an intracistroniccis-replication element (32), and for the polio virus genome,wherein genome circularization inhibits the early translationstep (5, 22). Therefore, since nsp1 is synthesized early andalso contains an intracistronic cis-replication element, wepostulated that it is autoregulatory with RNA binding prop-erties.

Here, we do the following: (i) demonstrate by mutagen-esis analysis that the 72-nt SLV, mapping immediately up-stream of SLVI and within the partial nsp1 cistron, is also acis-acting DI RNA replication element; (ii) show by gel shiftand UV cross-linking analyses that there is likely no bindingof an intracellular viral protein to SLV and SLVI (SLV-VI),but there is binding of unidentified cellular proteins of �60and 100 kDa; and (iii) show by gel shift analysis that recom-

FIG. 1. RNA structures in the BCoV genome tested for nsp1 binding. (A) BCoV 5�-terminal and 3�-terminal cis-acting RNA SL structures andflanking sequences identified for BCoV DI RNA replication. Regions of the genome are identified and SL cis-replication elements are identifiedschematically. Open boxes at nt 100 and 211 identify AUG start codons for the short upstream ORF and ORF 1, respectively. A closed box at nt124 identifies the UAG stop codon for the short upstream ORF. Shown below the SL structures are the RNA segments used as 32P-labeled probesin the gel shift assays. BSL-PK, bulged SL-pseudoknot; 8mer-BSL, octamer-associated bulged SL. (B) Gel shift assays for probes when used withpurified nsp1. Protein-RNA complexes identifying a shifted probe are labeled C.

6088 GUSTIN ET AL. J. VIROL.


T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

binant nsp1 purified from Escherichia coli does not bindSLV-VI but does bind SLs I to IV in the 5� UTR and alsothe 3�-terminal bulged SL in the 3� UTR, suggesting a pos-sible regulatory role at these sites. Notably, specific bindingwith �2.5 �M affinity of nsp1 to SLIII and its flankingregions in the 5� UTR was observed. Additionally, we showthat, under conditions that would express nsp1 from a DIRNA-encoded sgmRNA, DI RNA levels are greatly re-duced; viral RNA species levels, however, are reduced onlyslightly, and this reduction is transient. These results to-gether indicate that nsp1 is an RNA-binding protein thatmay function as a regulator of viral translation or replicationbut not through its binding of cis-acting SLs V and VI withinits own cistron.

MATERIALS AND METHODS

Cells and viruses. A DI RNA-free stock of the Mebus strain of BCoV(GenBank accession number U00735) at 4.5 � 108 PFU/ml (14, 15) wasgrown on human rectal tumor cell line HRT-18 (64) as described previously(15). Other genome sequences analyzed were those of MHV-A59 (GenBankaccession number NC_001846) and SARS-CoV-Toronto (GenBank accessionnumber NL_004718).

RNA structure predictions. Mfold (http://mfold.bioinfo.rpi.edu/) (42, 78) wasused to predict RNA secondary structures.

Plasmid constructs. To make BCoV DI RNA with mutations in SLV, PCRmutagenesis (52) was done using pDrep1 DNA. pDrep1 is a pGEM3Zf(�)(Promega)-based plasmid containing a cDNA clone of a naturally occurring2.2-kb DI RNA of BCoV modified to carry a 30-nt in-frame reporter (15). Formutagenesis, overlapping primers bordering SLV and containing the desiredbase changes (Table 1) and HpaI and XbaI sites (occurring in pDrep 1 at nt 150and 595, respectively) were used for directional ligation into wt pDrep1.

To make BCoV DI RNA for expressing wild-type (wt) nsp1 from subgenomicmRNAs, a modification of pDrep12.7 (75), which is itself a modification ofpDrep1 (75), was used and named pDrep-ISnsp1. For this, a 756-nt fragmentcontaining the upstream 7-nt template-switching core and flanking sequences forN mRNA (AATAATCTAAACTTTAAGG, a total of 18 nt called the intergenicsequence [IS]) (34) and the nsp1 cistron (BCoV genomic nt 211 to 948, a totalof 738 nt) flanked by BamHI and KpnI restriction enzyme sites was used to

replace the 198-nt BamHIKpnI fragment (nt 1667 to 1865) in pDrep12.7. ForpDrep-ISnsp11–95, genomic nt 211 to 495 (encoding nsp1 amino acids[aa] 1 to 95)were used in place of the full-length nsp1 cistron to make the construct, and forpDrep-ISnsp195–246, genomic nt 493 to 948 (encoding nsp1 aa 95 to 246) wereused.

To make RNA probes for gel shift analyses, primers bordering the cis-repli-cation elements in pDrep 1 were used that had incorporated EcoRI and HindIIIsites for directional ligation into EcoRI/HindIII-linearized pGEM3Zf(�) (Pro-mega).

To make nsp1 in E. coli, the nsp1 cistron from BCoV (nt 211 to 948) wassubcloned with BamHI and EcoRI site-containing primers into the BamHI/EcoRI site of pET28a(�) vector (Novagen). This construct yielded BCoV nsp1with a 33-nt upstream His6-thrombin site-T7 tag-encoding sequence.

RNA synthesis. For synthesis of uncapped positive-strand transcripts of SLVDI RNA mutants for testing mutational effects on DI RNA replication, 2 �g ofMluI-linearized plasmid DNA was transcribed in a 100-�l reaction mixturecontaining 40 U of T7 RNA polymerase (Promega) following the Promegaprotocol for synthesis of uncapped nonlabeled RNA. The mix was treated with3 U of RQ1 RNase-free DNase (Promega), and RNA was purified by silicamatrix affinity using an RNaid kit (MP Biochemicals) and quantified spectro-photometrically.

For synthesis of positive-strand radiolabeled RNA probes, 2 �g of HindIII-linearized plasmid DNA was transcribed in a 50-�l reaction mixture containing40 U of T7 RNA polymerase (Promega) and 120 �Ci of [�32P]UTP (3,000Ci/mmole) (MP Biochemicals). The mixture was treated with 3 U of RQ1RNase-free DNase (Promega), and probes were purified by electrophoresis on a5 or 9% polyacrylamide–7% urea gel. RNA visualized by autoradiography waseluted from the excised gel band overnight in elution buffer (1 mM EDTA, 0.5M ammonium acetate), and ethanol precipitated. Cerenkov counts were deter-mined by scintillation counting in water.

Northern assay for DI RNA replication. Northern blot assays for detectingreporter-containing DI RNAs were performed essentially as described pre-viously (56, 75). Briefly, cells (�6 � 106) at �80% confluence in a 35-mm dishwere infected with BCoV at a multiplicity of 10 PFU per cell and transfected1 h later with 500 ng of RNA using Lipofectin (Invitrogen). At the indicatedtimes postinfection, RNA was extracted with Trizol (Invitrogen) and stored inwater at �20°C. For passage of progeny virus, supernatant fluids were har-vested at 48 h postinfection (hpi), and 300 �l was used to infect freshlyconfluent cells (�8 � 106) in a 35-mm dish (called virus passage 1 [VP1])from which supernatant fluids at 48 hpi were used to infect new cells (calledVP2). For VP1 and VP2, RNA was extracted at 48 hpi. For electrophoretic

TABLE 1. Oligonucleotides used in this study

Oligonucleotidea Polarityb Sequence (5�33�)c Binding region inpDrep1 (nt)d

pRight-5� 306/309 � GGATAACCCTAGCAGCTCAGAGGT 294–317pRight-3� 306/309 � ACCTCTGAGCTGCTAGGGTTATCC 294–317pLeft-5� 240/243 � TCGAGCTGCACTGGGCTCCAGAATTTCC 236–263pLeft-3� 240/243 � GGAAATTCTGGAGCCCAGTGCAGCTCGA 236–263pRtLt-5� � CTCGAGCTGCACTGGGCTCCAGAATTTCCCTGGATG 235–270pRtLt-3� � CATCCAGGGAAATTCTGGAGCCCAGTGCAGCTCGAG 235–270pRtLt (�loops)-5� � AGAATTTCCATGGATGTTTGAGGACGCAGA 255–284pRtLt (�loops)-3� � TCTGCGTCCTCAAACATCCATGGAAATTCT 255–284pLoops-5� � CCAGAATTTCCCTGGATGTTCGAAGACGCA 253–282pLoops-3� � TGCGTCTTCGAACATCCAGGGAAATTCTGG 253–282pRtLoops-L-5� � CACTGGGCTCCAGAATTTCCCTGGATG 244–270pRtLoops-L-3� � CATCCAGGGAAATTCTGGAGCCCAGTG 244–270pRtLoops-R-5� � GTTCGAAGACGCAGAGGAGAAGTTGGATAACCCTAGCAGCTCA 270–312pRtLoops-R-3� � TGAGCTGCTAGGGTTATCCAACTTCTCCTCTGCGTCTTCGAAC 270–312150-HpaI-5� � GTTAACAGCTTTCAGCCAGGGACGTGTTG 150–178600-XbaI-3� � TCTAGATTGGTCGGACTGATCGGCC 576–600BCoV leader � GATTGTGAGCG 1–11TGEV8(�) � CATGGCACCATCCTTGGCAACCCAGA 1098–1123HSVgD(�) � GAGAGAGGCATCCGCCAAGGCATATTTG 1854–18853’UTR (�) � CAGCAAGACATCCATTCTGATAGAGAGTG 2226–2254

a The positive and negative symbols in the oligonucleotide names indicate the polarity of the nucleic acids to which the oligonucleotides anneal.b Polarity of the oligonucleotide relative to the positive-strand DI RNA.c Boldface nucleotides represent mutations.d For probe binding to negative-strand sequence, the numbers correspond to complementary positive-strand sequence.

VOL. 83, 2009 BOVINE CORONAVIRUS RNA BINDING PROTEIN nsp1 6089


T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

resolution in a formaldehyde-agarose gel, one-quarter of the RNA from eachdish was used per lane (where total RNA in dishes increased with time dueto continued cell proliferation and one-quarter was �14, 30, and 44 �g for 1,24, and 48 hpi and �100 �g each for VP1 and VP2). Approximately 1 ng ofRNA transcript, identified as RNA in the Northern blot figures, was used asa marker. RNA was transferred to Hybond N� nylon membrane (Amersham)by vacuum blotting, and membranes were UV irradiated. Blots were probedwith 20 pmol of -32P-end-labeled oligonucleotide probe at �5 � 105 cpm/pmol. The probes used were TGEV8(�) or HSVgD(�) (where TGEV istransmissible gastroenteritis virus and HSV is herpes simplex virus) for de-tecting DI RNA progeny and 3�UTR(�) for detecting DI RNA, viral genome,and viral sgmRNAs. Probed blots were exposed to Kodak XAR-5 film for 1to 7 days at �80°C for imaging, and counts were quantified with aPhosphorImager (Molecular Dynamics).

Sequence analysis of progeny from mutant DI RNA replicons. Reverse tran-scription with Superscript II Reverse Transcriptase (Invitrogen) was done onRNA extracted at VP1 and VP2, and PCR was done with primers BCoVleader(�) and TGEV(�). PCR products were sequenced directly.

In vitro translation. A total of 500 ng of wt or mutant DI RNA as transcriptsfrom plasmids was translated in a 50-�l reaction mixture of rabbit reticulocytelysate (Promega) containing 20 �Ci of [35S]Met. At 90 min, proteins in a 5-�lsample were resolved by sodium dodecyl sulfate-polyacrylamide gel electro-phoresis (SDS-PAGE) in a gel of 12% polyacrylamide, and radioactivity wasquantified on the dried gel by phosphor imaging.

Cell lysate preparation. BCoV-infected and mock-infected cell lysates wereprepared essentially as described by Thomson et al. (63). Briefly, cells from a75-cm2 flask were collected by scraping, and pelleted cells were resuspended in100 �l of lysis buffer (10 mM HEPES [pH 7.5], 3 mM MgCl2, 14 mM KCl, 5%glycerol, 0.5% NP-40, 1 mM dithiothreitol, 1� complete protease inhibitor[Roche]) and incubated on ice for 20 min. Lysates were clarified by microcen-trifugation at 3,000 rpm for 4 min at 4°C, and aliquots were stored at �80°C. Forinfected cell lysates, cells were infected with at a multiplicity of infection of 10viruses per cell, and lysates were prepared at 6 hpi. Protein concentrations weredetermined by the Bradford assay.

Protein expression and purification from E. coli. BL21(DE3) E. coli cellstransformed with p28(�)-nsp1 were grown in LB medium containing 34 �g/mlchloramphenicol and 25 �g/ml kanamycin until an optical density at 600 nm of�0.6. Protein expression was induced with 1 mM IPTG (isopropyl-�-D-thioga-lactopyranoside), and cells were grown for an additional 15 h at 15°C. Cells (�10 g)were pelleted at 5,000 � g, flash frozen in liquid N2, and resuspended withsonication in 30 ml of lysis buffer (50 mM Tris [pH 8.0], 0.3 M NaCl, 10 mMimidazole, 5% glycerol, 1 mM �-mercaptoethanol, 1 mM phenylmethylsulfonylfluoride, 1� EDTA-free complete protease inhibitor [Roche], and 25 U/mlbenzonase endonuclease [Novagen]). Fusion protein was purified by chromatog-raphy on Ni-nitrilotriacetic acid superflow resin (Qiagen), and nsp1 was releasedin column by thrombin cleavage and concentrated by filtration on YM-10 Cen-triprep/Centricons cellulose membranes (Millipore).

Gel shift assays. The method of Andino et al. (2) as modified by Silvera etal. (57) and as described here was used. Briefly, �4 � 104 cpm of �-32P-labeled RNA probe (1 to 5 ng) was incubated in a 15-�l binding reactionmixture containing 5 mM HEPES (pH 7.9), 40 mM KCl, 2 mM MgCl2, 4%glycerol, 2 mM dithiothreitol, 0.25 �g/�l heparin, 1 U/�l RNasin (Promega),0.5 �g/�l yeast tRNA, 1� EDTA-free complete protease inhibitor (Roche),and either 20 �g of HRT cell lysate protein, or purified E. coli-expressedfusion protein to make a final concentration of 5 to 30 �M. The mixture waspreincubated without probe for 10 min at 30°C and then for an additional 10min after probe was added. Two microliters of 50% glycerol was added, andreaction products were electrophoretically separated on a 5% nondenaturingpolyacrylamide gel for approximately 4 h at 4°C. Gels were dried and exposedto Kodak XAR-5 film, and results were visualized by autoradiography andquantified by phosphor imaging.

UV cross-linking. The UV cross-linking method essentially as described byPestova et al. (48) was used. Briefly, �3 � 105 cpm of �-32P-labeled RNA probein 15 �l of binding reaction mixture with cell lysate was incubated as describedfor the gel shift assay and irradiated on ice at 3 mW/cm2 for 30 min using a UVStratalinker 1800. Irradiated reaction mixtures were treated with 2.5 U of RNaseA, 100 U of RNase T1, and 0.1 U of RNase CV1 (all from Ambion) for 30 minat 37°C, and proteins were resolved by SDS-PAGE. Dried gels were exposed toKodak XAR-5 film for autoradiography.

Bioinformatics. Potential RNA and protein binding domains in BCoV andMHV nsp1 were predicted with the SMART program (http://smart.embl-heidelberg.de/) (37, 53). Sequence alignments were made with Vector NTI Suite8 (Invitrogen).

RESULTS

SLV mapping within the nsp1 cistron immediately upstreamof SLVI is a required cis-acting signal for DI RNA replication.A 30-nt SL, SLVI, mapping at nt 101 to 130 within the 5�-terminal partial nsp1 cistron (genomic nt 311 to 340) (Fig. 1Aand 2A) was recently identified as a cis-acting replication ele-ment for BCoV DI RNA (12). Although its cis-replicationfeature remains to be tested in the context of the full-lengthviral genome, this SL along with the frame-shifting pseudoknotat the ORF 1a/1ab junction (9) are, to our knowledge, the onlyhigher-order cis-replication elements known within CoV ORF1 (12). Just upstream of SLVI is a structure-mapped 72-nt SL,SLV at nt 29 to 100 within the nsp1 cistron (genomic nt 239 to310) (Fig. 2A) (12), whose function as a cis-acting higher-orderstructure has not yet been tested. To examine its potentialcis-acting role in BCoV DI RNA replication, synonymous basesubstitutions designed to disrupt base pairings in a helicalregion and compensatory mutations designed to restore basepairings were tested. Silent helix-disrupting substitutions werefeasible in only the downstream side of the bottom-most stem,for which changes U306C and U309C were made to formmutant pRt (where Rt and Lt refer to the right and left sidesof the stems, respectively), and transcripts were tested for DIRNA replication. Following transfection into BCoV-infectedcells, pRt DI RNA accumulation as determined by a visibleband in Northern analysis was undetectable at 48 hpi and waspresent only at low levels in VP1 and VP2 compared to wt DIRNA levels (Fig. 2B). Sequence analysis of progeny RNAshowed only wt revertants in VP2, indicating that the mutanthad replicated poorly, if at all, and revertants with wt sequence,likely arising through recombination with the 5� end of thehelper virus genome, were selected (data not shown). How-ever, when base pairings were restored by the compensatorymutations A240G and A243G in mutant pLtRt, replication asevidenced by accumulation of pLtRt DI RNA in Northernblots was restored to nearly wt levels in VP1 and VP2 (Fig. 2B),and mutations on both sides of the stem were retained in VP2as revealed by sequence analysis (data not shown). A240G andA243G alone in mutant pLt were not predicted to disrupt basepairing in the stem, and, consistent with this structure, theirpresence alone did not block DI RNA replication, as evi-denced by DI RNA accumulation in Northern blots (Fig. 2B)and sequence analysis. These results together indicate thatoptimal replication of DI RNA requires base pairing in thelowest helical region of SLV. Furthermore, when three silentpoint mutations were made in the upper loops of SLV, namelyA264C, U273C, and G276A (Fig. 2A), to form the mutantnamed pLoops, the overall Mfold-predicted structure of SLVwas only slightly changed (data not shown), and progeny DIRNA from pLoops, although slow in accumulating, retainedthe parent mutations in VP2. However, when the mutations inpLoops were combined with those in pRt to form pRt/Loops,there was additional structure disruption as predicted byMfold, and accumulation was further impaired over pRt (Fig.2B). That is, accumulation of pRt/Loops was not visible byNorthern analysis at 48 hpi or in VP1 or VP2 (Fig. 2B) eventhough small amounts of wt progeny and progeny with rever-sions only at 306 and 309 were found by sequencing reversetranscription-PCR products (data not shown). These results



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

indicate that the overall higher-order structure of SLV, inaddition to integrity in the lower stem, contributes to optimalBCoV DI RNA replication.

Translation of the partial 1a ORF has been shown to be a cisrequirement for DI RNA replication (12, 14). To rule out thepossibility that the observed loss of replication for SLV mu-tants was a result of unforeseen blocked translation arisingfrom altered secondary structure (33), capped transcripts of wtand two selected mutants that did not replicate were translatedin vitro in rabbit reticulocyte lysate, and the products werecompared. Proteins translated in the presence of [35S]methi-onine from equal amounts of RNA (Fig. 2C) were evaluated by

SDS-PAGE, and the results showed that wt, pRt, and pRt/Loops translated at comparable levels (Fig. 2C). Thus, theobserved decreases in RNA accumulation can be attributed todefects in RNA synthesis and not defects in translation.

Unidentified cellular proteins with molecular masses of �60and 100 kDa, but not nsp1, bind cis-acting SLV and SLVI. Totest our hypothesis that nsp1 binds intra-nsp1 cistronic cis-replication elements SLV and SLVI, two approaches weretaken. In the first, evidence of viral protein binding to the32P-labeled SLV-SLVI probe was sought by gel shift experi-ments with lysates of infected cells. In this analysis, three re-tarded proteinase K-sensitive complexes were found that were

FIG. 2. Mutations in SLV that affect replication of wt BCoV DI RNA. (A) Mapped structures of SLIV-VI and predicted structure of SLVIIin wt BCoV DI RNA (as found in pDrep1). Note that in mutant p397–498 (12), nt 397 to 498 are deleted, which resulted in no loss of replicatingability. In mutant p397–498 DI RNA, the N ORF begins at nt 397. The mutations in SLV are as follows: left, A240G and A243G; right, U306Cand U309C; loops, A264C, U273C, and G276A; Rt/loops, U306C, U309C, A264C, U273C, and G276A. (B) Northern analysis of wt and SLVmutant DI RNAs. The calculated free energies (G) of wt and mutated SLVs are shown. The Northern analyses used a 32P-radiolabeled probespecific for the reporter sequence (30-nt TGEV reporter) on extracted RNA at the indicated times postinfection. RNA, a 1-ng sample of inputRNA. Replication is based on the presence of DI RNA by Northern analysis in VP2, and reversion is judged from the sequence of the reversetranscription-PCR product in VP2 RNA. If only wt (i.e., reverted sequence) is found in VP2, the mutant is considered dead. (C) In vitro translationof wt and mutant DI RNA transcripts. The upper panel shows 35S-radiolabeled translation product. The lower panel shows ethidium bromide-stained RNA transcript used for in vitro translation.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

also present with lysates from uninfected cells (Fig. 3A and B),suggesting that SLV and SLVI are bound by cellular but notviral proteins. The number and molecular masses of boundproteins were determined by UV cross-linking followed byRNase digestion and SDS-PAGE to be species with molecularmasses of �60 kDa and �100 kDa (Fig. 3C). The identity ofthese and the significance of their interactions with SLV SLVIremain to be determined.

In the second approach, binding was sought with recombi-nant nsp1 from E. coli. When purified nsp1 was incubated with32P-labeled SLV-SLVI, SLV, SLVI, or (putative) SLVIIprobes, no gel shifting was observed although shifting wasfound with other terminal cis-acting structures noted below,indicating by this second method that nsp1 does not bindcis-acting SLV-VI (Fig. 1B).

nsp1 binds cis-replication structures in the 5� and 3� UTRs.Coronaviral proteins other than nsp1 have been shown to bindcis-replication structures: N protein binds the 5�-proximal SLIIregion (46, 61, 62), 2�-O-methyltransferase (nsp16) binds the 3�-terminal octamer-associated bulged stem-loop (A. Dziduszko etal., unpublished data), and an unknown viral protein(s) frominfected cell lysates binds SLIII (S. Raman and D. Brian, unpub-lished data). Therefore, we systematically sought the binding ofnsp1 to the three 5� UTR-located cis-replication elements SLI-SLII, SLIII, and SLIV and two 3� UTR-located cis-replicationelements, the bulged SL-pseudoknot and the octamer-associatedbulged SL. Binding of nsp1 to these would suggest other possiblesites for nsp1 regulation of translation or RNA synthesis. In gelshift experiments, nsp1 was not found to bind the 3� proximalbulged SL-pseudoknot but was found to weakly bind 5�-proximalSLI-SLII and SLIV, to moderately bind the 3�-terminal octamer-associated bulged SL, and to quantitatively shift the probe repre-senting 5� SLIII with its extended flanking sequences (sequencesof 28 nt upstream and 67 nt downstream [SLIII-Long]) (Fig. 1B).Additionally, it was not found to bind the 5�-proximal uncharac-

terized putative SLVII in the partial nsp1 cistron (Fig. 1B). Theseresults indicate that nsp1 is an RNA-binding protein that mayfunction to regulate RNA translation or replication through itsinteraction with 5� or 3� cis-replication elements but not throughbinding to SLV-SLVI.

nsp1 binds SLIII and its flanking sequences with specificityand micromolar affinity. Since nsp1 caused a quantitative shiftin the SLIII-Long probe, we sought to establish both its spec-ificity and affinity of binding to SLIII-Long, as shown in Fig. 1,and SLIII-short (SLIII with flanking sequences of only 10 ntupstream and 10 nt downstream), which nearly representsSLIII proper. Figure 4A, lane 1, shows that the SLIII-Longprobe migrates as upper and lower bands, probably represent-ing two folded forms of the probe. Lane 2 shows approximately50% of the lower form and all of the upper form of the probefully shifting positions with 2.5 �M nsp1, indicating a Kd (dis-sociation constant) of �2.5 �M for nsp1 binding to SLIII-Long. Figure 4A (lanes 5 to 7) shows a complete inhibition ofSLIII-Long shifting with 5, 10, and 15 �g of unlabeled probe,representing 2,500, 5,000, and 7,500 molar excess over labeledprobe, respectively, whereas no inhibition was seen with 5, 10,and 15 �g of tRNA. These results together show specific bind-ing of nsp1 to SLIII-Long. Figure 4B, (lane 1) shows theSLIII-Short probe migrating as a single band. Lanes 2 to 4show far less quantitative shifting of the probe to an upperband, and thus binding affinity was not determined by theseexperiments. Lanes 5 to 7, however, show that a band shiftingwith 2.5 �M protein was completely inhibited by the additionof 4, 8, and 12 �g, respectively, of unlabeled SLIII-Short probe,whereas lanes 8 to 10 show no inhibition of binding with 4, 8,and 12 �g of tRNA, respectively. These results show weakerbut still specific binding of nsp1 to SLIII-Short. Together, theresults show that whereas SLIII per se is probably a specifictarget for nsp1, the affinity of binding is greatly increased withthe presence of its extended flanking sequences.

FIG. 3. Cellular proteins but apparently no viral proteins from cell lysates bind the SLV-VI probe. (A) Three gel shift complexes are formedwith lysates of uninfected (Uninf) and infected (Inf) cells with SLV-VI probe. (B) Protein-RNA complexes with SLV-VI probe are destroyed byproteinase K (Pr K) treatment. (C) Proteins of 100 and 60 kDa from uninfected cell lysate UV cross-link to the SLV-VI probe. HMW,high-molecular-weight protein markers; LMW, low-molecular-weight protein markers.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

The nsp1 cistron positioned for sgmRNA expression fromDI RNA leads to inhibition of DI RNA accumulation but toonly slight transient inhibition of viral RNA. To determinewhether higher than normal levels of nsp1 expression have aneffect on BCoV replication, as might be expected of a regula-tory protein, pDrep-ISnsp1 was constructed for testing; for thisconstruct the BCoV nsp1 cistron was cloned into the BCoV DIRNA vector pDrepIS12.7 at a site known to express sub-genomic RNA in 1.5-fold molar excess over viral genome whenthe intergenic transcription signaling sequence for the mRNA7 (mRNA for N synthesis) is used (Fig. 5A) (75). Overexpres-sion of a viral protein from a DI RNA would avoid a noncoro-naviral expression system, and the expressed protein wouldpresumably be available to the viral replication machinerywithin its membranous compartment (55, 67). When BCoV-infected cells were transfected with T7 RNA polymerase-gen-erated DI RNA from pDrep12.7 (wt) (a DI RNA expressing a116-aa fusion protein from the transcription start site of viralsgmRNA 5 [47, 75]) or pDrep-ISnsp1 (which is an nsp1cistron-containing DI RNA construct missing the 18-nt IStranscription start signal) and evaluated by Northern anal-ysis with a probe detecting the downstream reporter se-quence (HSVgD), DI RNA progeny for each was observedthrough VP2 (Fig. 5B). These results indicate little or no inhi-bition of DI RNA replication. However, from infected cellstransfected with pDrep-ISnsp1 RNA, no increase in DI RNAaccumulation over input RNA was detected at 24 h posttrans-fection or beyond (Fig. 5B and C). Nor were sgmRNAs withthe nsp1 cistron identified by Northern analysis at these times(data not shown) although they may have been present atearlier times posttransfection. In addition, no new bands werefound that might have suggested recombination events be-

tween the DI RNAs and viral genome (data not shown).Therefore, direct evidence of nsp1 sgmRNA expression, as wasshown for sgmRNA expression from pDrep12.7v(75), was notobtained. A blockage in the accumulation of DI RNA was notlikely an effect of the nsp1 coding sequence within the DI RNAsince the same sequence is present in pDrep-ISnsp1, whichunderwent replication. Interestingly, inhibition of DI RNAaccumulation was observed not only with apparent expressionof full-length nsp1 from a sgmRNA but also with expression ofthe C-terminal region of nsp1 from pDrep-ISnsp195-246

(genomic nt 493 to 948; nsp1 aa 95 to 246), representing a partof the genome whose homologous region in MHV can bedeleted without loss of viral viability (Fig. 5B and C) (10). Lessbut still significant inhibition was seen with the N-terminalregion of nsp1 from pDrep-ISnsp11-95 (genomic nt 211 to 495;nsp1 aa 1 to 95), a sequence whose homolog in the MHV nsp1cistron contains a 30-nt sequence (nt 255 to 369) required forMHV genome replication (10, 21).

In addition, reduction in viral genome and sgmRNA levelswith nsp1-expressing DI RNA was only slight and short-livedcompared with expression levels in pDrep12.7-transfected cells(Fig. 5D to F). That is, a twofold reduction in viral sgmRNAs6 and 7, the earliest appearing helper virus RNA species, wasobserved at 24 h posttransfection (Fig. 5E and F), but after thistime wt levels were reached. No inhibition of viral genome orsgmRNAs was observed with expression of the C- and N-terminal regions of nsp1 (Fig. 5D to F).

We interpret these results together to mean that inhibitorylevels of nsp1 were expressed from sgmRNA, although directevidence for this expression remains to be shown, and that trans-lation or replication of the DI RNA was more sensitive to theeffects of nsp1 than that of viral genome or sgmRNAs. It is

FIG. 4. Gel shift analysis of purified BCoV nsp1 binding to SLIII. (A) SLIII-Long. Lane 1, probe alone showing upper and lower forms; lanes2 to 4, shifted bands into lower (C1) and upper (C2) complexes that form with the indicated amounts of protein; lanes 5 to 7, competition of proteinbinding with 5, 10, and 15 �g of unlabeled SLIII-Long RNA; lanes, 8 to 10, competition of protein binding with 5, 10, and 15 �g of tRNA overand above the tRNA in the binding buffer present in all lanes. (B) SLIII-Short. Lane 2, probe alone; lanes 2 to 4, shifted band with the indicatedamounts of protein; lanes 5 to 7, competition of protein binding with 4, 8, and 12 �g of unlabeled SLIII-Short RNA; lanes 8 to 10, competitionof protein binding with 4, 8, and 12 �g of tRNA over and above the tRNA in the binding buffer present in all lanes.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

FIG. 5. Detrimental effects of nsp1 expression from subgenomic mRNA in DI RNA. (A) Map of DI RNA constructs for expressing thefull-length nsp1, the N-terminal 95 aa (N-term; aa 1 to 95), and the C-terminal 152 aa (C-term; aa 95 to 246) of nsp1. The IS used to inducesgmRNA transcripts for nsp1 expression is the 18-nt sequence upstream of the BCoV N mRNA (sgmRNA 7) (see text). (B) Northern analysis ofin vivo generated transcripts of wt and truncated nsp1 constructs shown in panel A as identified by a probe specific for DI RNA (HSVgD reporter).Results from control constructs are also shown. ISnsp1 represents a construct identical to pDrep-ISnsp1 except that the 18-nt IS is deleted. RNA,a 1-ng sample of input RNA. (C) Quantitative summary of PhosphorImager data collected from data in panel B. (D) Northern analysis of viralRNA probed with a 3� end-specific probe [3�UTR(�)]. sgmRNAs 6 and 7 are identified. (E and F) Quantitative summary of phosphor imagingdata shown in panel D for sgmRNA 6 and sgmRNA 7, respectively. Asterisks identify the most inhibited quantities of sgmRNA 6 and sgmRNA7 observed with nsp1 expression from DI RNA. Uninf, uninfected; inf, infected.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

possible that as a transacting regulatory protein, nsp1 remainsmore localized in a DI-replicating compartment and does notfreely diffuse to the replication-transcription complex of the viralgenome.

DISCUSSION

Here, we test the hypothesis that nsp1 (p28) of BCoV, thefirst replicase protein to be synthesized and proteolyticallyreleased, is an RNA-binding protein that binds the cis-actingSLVI replication element within the nsp1 cistron. Binding ofnsp1 to this structure would identify a potential means forautoregulation of gene expression. The rationale for thishypothesis is stated in the introduction. Although in thisstudy we found no evidence of nsp1 binding to the intracis-tronic SLVI (12) as the hypothesis predicted, or to a newlyidentified SLV cis-acting replication signal immediately up-stream of SLVI within the nsp1 cistron (this study), bindingwas found at other sites within the 5� and 3� UTRs thatmight function to regulate translation or replication. Nota-bly, binding to a long form of cis-acting SLIII in the 5� UTRwith �2.5 �M affinity was found.

To our knowledge, this is the first report of an RNA-bindingproperty for CoV nsp1. While we tested binding here to onlyspecific terminal regions of genomic RNA, the presence ofmultiple binding sites suggests possible broad-spectrum bind-ing activity with other sites in the viral genome and also sug-gests relevance to the variety of cellular responses to CoVinfection noted in several recent reports (16, 30, 45, 70, 79).Binding of nsp1 to cellular RNAs, for example, might inducepathogenic cellular responses. To date, however, only protein-protein interactions have been evaluated in these processes.

With regard to direct involvement of nsp1 in virus replica-tion, several possibilities can be envisioned that will need test-ing. (i) nsp1 bound to SLIII (or SLs III and IV) might represstranslation of ORF 1. The moderately high affinity of nsp1 forthe long form of SLIII in the 5� UTR and perhaps the lesserbut still specific affinity to SLIV are consistent with results ofan earlier study showing a 12-fold repression of translation inBCoV-infected cells for a reporter mRNA carrying the 210-ntgenomic 5� UTR but not one carrying the 77-nt 5� UTR of

sgmRNA 7 (54). That is, SLIII and SLIV are present in the210-nt genomic 5� UTR that experienced repression but not inthe 77-nt sgmRNA 5� UTR that experienced no repression(54). The molecules tested in these experiments had identical3� UTRs (54). If the observed repression is a function of a viralprotein as postulated (54), then nsp1 becomes a candidate forthis function. It is intriguing that SLIII contains some portionof a short upstream ORF found in virtually all CoV genomes(50). Although the function of the upstream ORF has yet to befound, conceivably it or its translated product plays a role inregulating translation or RNA replication, and nsp1 by bindingSLIII may influence these processes. Based on precedents inother well-studied positive-strand RNA viruses, an inhibitionof translation might facilitate negative-strand synthesis in acouple of ways. (a) nsp1 binding might block ribosomal transitand enable initiation of negative-strand synthesis. (b) nsp1might interact with SLs I to IV and also the 3� end, or other 3�end-binding components, to form a circular molecule thatfunctions to inhibit translation and enable initiation of nega-tive-strand synthesis as has been shown for picornaviruses (5,22). (ii) nsp1 might interact with a membrane-anchoring pro-tein to bring the genome into the membrane-protected repli-cation compartments, where the viral replication complex as-sembles and presumably functions in the absence (mostly) ofthe cellular translation machinery (55, 67). This mechanism,too, has precedence in nodaviruses and several plant viruses(68). (iii) nsp1 by binding directly to the very 3� end of thegenome might take part in replication complex formation andinitiation of negative-strand synthesis. (iv) nsp1 through itsaffinity for SLIII in the 5� UTR may play a role in RNA-dependent RNA polymerase template-switching events thatdirect leader formation at the 3� end of sgmRNA-length tem-plates for sgmRNA synthesis (74, 75). (v) Finally, nsp1 mightfunction in the initiation of nascent positive strands from the 3�end of the negative-strand antigenome. For this, a systematicstudy has not been made, but we have learned that SLIII doesspecifically, although weakly, bind the negative-strand counter-parts to SLIII-Long and SLIII-Short (data not shown), sug-gesting a possible role for nsp1 in positive-strand synthesis.

At this time we have no experimental evidence to explain

FIG. 6. Aligned amino acid sequences for nsp1 in BCoV (p28), MHV (p28), and SARS-CoV (p20). The arrowhead identifies the separationsite of BCoV nsp1 into the N-terminal and C-terminal parts studied in the experiments shown in Fig. 5. The potential zinc finger-like RNA-bindingdomain in BCoV and MHV (nt 34 to 75) is identified by highlighting. Also highlighted (gray shading) in all three viruses is a highly similar 8-aasequence in nsp1 (nt 192 to 199) that identifies a potential positively charged region of the protein. Numbers refer to amino acid positions in theBCoV sequence. Regions in the proteins coinciding with the coding regions harboring SLV and SLVI are indicated.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

how expression of nsp1 from a DI RNA affects the accumula-tion of DI RNA more than that of helper virus genome andsgmRNAs, but it is possible that the DI RNA is simply moresensitive to nsp1 function or that it is in a different membra-nous compartment than the viral genome and sgmRNAs andtherefore experiences a higher concentration of nsp1. The factthat both the N-terminal and C-terminal regions affect accu-mulation suggests that there is more than one functional do-main within nsp1 involved in regulation. Nevertheless, a nearlycomplete repression of DI RNA accumulation and a twofoldrepression of viral sgmRNA abundance, even if short-lived, issuggestive evidence that nsp1 has an effect on viral mRNAexpression.

Both the identity and function of the �60- and 100-kDacellular proteins that bind SLV-SLVI remain to be deter-mined. Curiously, six cellular proteins with molecular massesof 25 to 58 kDa but no viral proteins were found to bind SLIVin the 5� UTR (51). The arrangement of three cis-acting ele-ments in close proximity suggests that they might functiontogether as a larger structure. Although a relationship betweencellular proteins binding SLV-SLVI or SLIV-SLVI and trans-lation inhibition has not yet been shown, it is possible that thecellular proteins play a role in targeting the viral genome to themembranes making up the replication compartment (67).

Where is the RNA binding domain in nsp1? Bioinformaticsanalysis of the BCoV p28 amino acid sequence predicts noobvious RNA binding domain but does reveal a potential Znfinger with similarity to RNA binding motifs (13, 26). Thisdomain (aa 34 to 75), common to both BCoV and MHV, ishighlighted in Fig. 6. It has also been noted that an 8-amino-acid C-proximal domain of unknown function, also highlightedin Fig. 6, is conserved among all group 2 CoVs including theSARS-CoV, and the positively charged surface of this domaincould be an RNA binding site (1). The functional RNA bindingdomain in nsp1, however, remains to be experimentally deter-mined.

We conclude that, together, the results indicate that nsp1 isan RNA-binding protein that may function as a regulator ofviral translation or replication but not through the binding of5�-proximal cis-acting SLV and SLVI within its coding region.How and where nsp1 functions as an RNA-binding protein,and how SLV and SLVI function as cis-regulatory structuresare questions that remain to be answered.

ACKNOWLEDGMENTS

We thank Kim Nixon and Hung-Yi Wu for many helpful discussions.This work was supported by Public Health Service grant AI014367

from the National Institute of Allergy and Infectious Diseases and byfunds from the University of Tennessee, College of Veterinary Med-icine, Center of Excellence Program for Livestock Diseases and Hu-man Health.

REFERENCES

1. Almeida, M. S., M. A. Johnson, T. Herrmann, M. Geralt, and K. Wuthrich.2007. Novel �-barrel fold in the nuclear magnetic resonance structure of thereplicase nonstructural protein 1 from the severe acute respiratory syndromecoronavirus. J. Virol. 81:3151–3161.

2. Andino, R., G. E. Rieckhof, and D. Baltimore. 1990. A functional ribonucle-oprotein complex forms around the 5� end of poliovirus RNA. Cell 63:369–380.

3. Ball, L. A. 2001. Replication strategies of RNA viruses, p. 105–118. In D. M.Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman,and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins,Philadelphia, PA.

4. Barton, D. J., B. J. Morasco, and J. B. Flanegan. 1999. Translating ribosomesinhibit poliovirus negative-strand RNA synthesis. J. Virol. 73:10104–10112.

5. Barton, D. J., B. J. O’Donnell, and J. B. Flanegan. 2001. 5� Cloverleaf inpoliovirus RNA is a cis-acting replication element required for negative-strand synthesis. EMBO J. 20:1439–1448.

6. Bhardwaj, K., S. Palaninathan, J. M. Alcantara, L. L. Yi, L. Guarino, J. C.Sacchettini, and C. C. Kao. 2008. Structural and functional analyses of thesevere acute respiratory syndrome coronavirus endoribonuclease Nsp15.J. Biol. Chem. 283:3655–3664.

7. Brian, D. A., and Spaan, W. J. M. 1997. Recombination and coronavirusdefective interfering RNAs. Sem. Virol. 8:101–111.

8. Brian, D. A., and R. S. Baric. 2005. Coronavirus genome structure andreplication. Curr. Top. Microbiol. Immunol. 287:1–30.

9. Brierley, I., M. E. Boursnell, M. M. Binns, B. Bilimoria, V. C. Blok, T. D.Brown, and S. C. Inglis. 1987. An efficient ribosomal frame-shifting signal inthe polymerase-encoding region of the coronavirus IBV. EMBO J. 6:3779–3785.

10. Brockway, S. M., and M. R. Denison. 2005. Mutagenesis of the murinehepatitis virus nsp1-coding region identifies residues important for proteinprocessing, viral RNA synthesis, and viral replication. Virology 340:209–223.

11. Brockway, S. M., X. T. Lu, T. R. Peters, T. S. Dermody, and M. R. Denison.2004. Intracellular localization and protein interactions of the gene 1 proteinp28 during mouse hepatitis virus replication. J. Virol. 78:11551–11562.

12. Brown, C. G., K. S. Nixon, S. D. Senanayake, and D. A. Brian. 2007. An RNAstem-loop within the bovine coronavirus nsp1 coding region is a cis-actingelement in defective interfering RNA replication. J. Virol. 81:7716–7724.

13. Brown, R. S. 2005. Zinc finger proteins: getting a grip on RNA. Curr. Opin.Struct. Biol. 15:94–98.

14. Chang, R. Y., and D. A. Brian. 1996. cis Requirement for N-specific proteinsequence in bovine coronavirus defective interfering RNA replication. J. Vi-rol. 70:2201–2207.

15. Chang, R. Y., M. A. Hofmann, P. B. Sethna, and D. A. Brian. 1994. Acis-acting function for the coronavirus leader in defective interfering RNAreplication. J. Virol. 68:8223–8231.

16. Chen, C. J., K. Sugiyama, H. Kubo, C. Huang, and S. Makino. 2004. Murinecoronavirus nonstructural protein p28 arrests cell cycle in G0/G1 phase.J. Virol. 78:10410–10419.

17. Decroly, E., I. Imbert, B. Coutard, M. Bouvet, B. Selisko, K. Alvarez, A. E.Gorbalenya, E. J. Snijder, and B. Canard. 2008. Coronavirus nonstructuralprotein 16 is a cap-0 binding enzyme possessing (nucleoside-2�O)-methyl-transferase activity. J. Virol. 82:8071–8084.

18. Denison, M., and S. Perlman. 1987. Identification of putative polymerasegene product in cells infected with murine coronavirus A59. Virology 157:565–568.

19. Donaldson, E. F., R. L. Graham, A. C. Sims, M. R. Denison, and R. S. Baric.2007. Analysis of murine hepatitis virus strain A59 temperature-sensitivemutant TS-LA6 suggests that nsp10 plays a critical role in polyprotein pro-cessing. J. Virol. 81:7086–7098.

20. Donaldson, E. F., A. C. Sims, R. L. Graham, M. R. Denison, and R. S. Baric.2007. Murine hepatitis virus replicase protein nsp10 is a critical regulator ofviral RNA synthesis. J. Virol. 81:6356–6368.

21. Eckerle, L. D., S. M. Brockway, S. M. Sperry, X. Lu, and M. R. Denison.2006. Effects of mutagenesis of murine hepatitis virus nsp1 and nsp14 onreplication in culture. Adv. Exp. Med. Biol. 581:55–60.

22. Gamarnik, A. V., and R. Andino. 1998. Switch from translation to RNAreplication in a positive-stranded RNA virus. Genes Dev. 12:2293–2304.

23. Goebel, S. J., B. Hsue, T. F. Dombrowski, and P. S. Masters. 2004. Charac-terization of the RNA components of a putative molecular switch in the 3�untranslated region of the murine coronavirus genome. J. Virol. 78:669–682.

24. Gorbalenya, A. E., L. Enjuanes, J. Ziebuhr, and E. J. Snijder. 2006. Nidovi-rales: evolving the largest RNA virus genome. Virus Res. 117:17–37.

25. Graham, R. L., A. C. Sims, R. S. Baric, and M. R. Denison. 2006. The nsp2proteins of mouse hepatitis virus and SARS coronavirus are dispensable forviral replication. Adv. Exp. Med. Biol. 581:67–72.

26. Hall, T. M. 2005. Multiple modes of RNA recognition by zinc finger proteins.Curr. Opin. Struct. Biol. 15:367–373.

27. Hsue, B., T. Hartshorne, and P. S. Masters. 2000. Characterization of anessential RNA secondary structure in the 3� untranslated region of themurine coronavirus genome. J. Virol. 74:6911–6921.

28. Hsue, B., and P. S. Masters. 1997. A bulged stem-loop structure in the 3�untranslated region of the genome of the coronavirus mouse hepatitis virusis essential for replication. J. Virol. 71:7567–7578.

29. Imbert, I., J. C. Guillemot, J. M. Bourhis, C. Bussetta, B. Coutard, M. P.Egloff, F. Ferron, A. E. Gorbalenya, and B. Canard. 2006. A second, non-canonical RNA-dependent RNA polymerase in SARS coronavirus. EMBOJ. 25:4933–4942.

30. Kamitani, W., K. Narayanan, C. Huang, K. Lokugamage, T. Ikegami, N. Ito,H. Kubo, and S. Makino. 2006. Severe acute respiratory syndrome corona-virus nsp1 protein suppresses host gene expression by promoting hostmRNA degradation. Proc. Natl. Acad. Sci. USA 103:12885–12890.

31. Kolakofsky, D., and C. Weissmann. 1971. Possible mechanism for transition ofviral RNA from polysome to replication complex. Nat. New Biol. 231:42–46.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

32. Kolakofsky, D., and C. Weissmann. 1971. Q. replicase as repressor of Q.RNA-directed protein synthesis. Biochim. Biophys. Acta 246:596–599.

33. Kozak, M. 1991. Structural features in eukaryotic mRNAs that modulate theinitiation of translation. J. Biol. Chem. 266:19867–19870.

34. Krishnan, R., R. Y. Chang, and D. A. Brian. 1996. Tandem placement of acoronavirus promoter results in enhanced mRNA synthesis from the down-stream-most initiation site. Virology 218:400–405.

35. Lai, M. C., and K. V. Holmes. 2001. Coronaviridae: The Viruses and TheirReplication, p. 1163–1186. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A.Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, vol.1, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA.

36. Law, A. H., D. C. Lee, B. K. Cheung, H. C. Yim, and A. S. Lau. 2007. Rolefor nonstructural protein 1 of severe acute respiratory syndrome coronavirusin chemokine dysregulation. J. Virol. 81:416–422.

37. Letunic, I., R. R. Copley, B. Pils, S. Pinkert, J. Schultz, and P. Bork. 2006.SMART 5: domains in the context of genomes and networks. Nucleic AcidsRes. 34:D257–D260.

38. Liu, P., L. Li, J. J. Millership, H. Kang, J. L. Leibowitz, and D. P. Giedroc.2007. A U-turn motif-containing stem-loop in the coronavirus 5� untrans-lated region plays a functional role in replication. RNA 13:763–780.

39. Liu, Q., R. F. Johnson, and J. L. Leibowitz. 2001. Secondary structuralelements within the 3� untranslated region of mouse hepatitis virus strainJHM genomic RNA. J. Virol. 75:12105–12113.

40. Marra, M. A., S. J. Jones, C. R. Astell, R. A. Holt, A. Brooks-Wilson, Y. S.Butterfield, J. Khattra, J. K. Asano, S. A. Barber, S. Y. Chan, A. Cloutier, S. M.Coughlin, D. Freeman, N. Girn, O. L. Griffith, S. R. Leach, M. Mayo, H.McDonald, S. B. Montgomery, P. K. Pandoh, A. S. Petrescu, A. G. Robertson,J. E. Schein, A. Siddiqui, D. E. Smailus, J. M. Stott, G. S. Yang, F. Plummer, A.Andonov, H. Artsob, N. Bastien, K. Bernard, T. F. Booth, D. Bowness, M. Czub,M. Drebot, L. Fernando, R. Flick, M. Garbutt, M. Gray, A. Grolla, S. Jones, H.Feldmann, A. Meyers, A. Kabani, Y. Li, S. Normand, U. Stroher, G. A. Tipples,S. Tyler, R. Vogrig, D. Ward, B. Watson, R. C. Brunham, M. Krajden, M. Petric,D. M. Skowronski, C. Upton, and R. L. Roper. 2003. The genome sequence ofthe SARS-associated coronavirus. Science 300:1399–1404.

41. Masters, P. S. 2006. The molecular biology of coronaviruses. Adv. Virus Res.66:193–292.

42. Mathews, D. H., J. Sabina, M. Zuker, and D. H. Turner. 1999. Expandedsequence dependence of thermodynamic parameters improves prediction ofRNA secondary structure. J. Mol. Biol. 288:911–940.

43. Matthes, N., J. R. Mesters, B. Coutard, B. Canard, E. J. Snijder, R. Moll,and R. Hilgenfeld. 2006. The non-structural protein Nsp10 of mouse hepa-titis virus binds zinc ions and nucleic acids. FEBS Lett. 580:4143–4149.

44. Minskaia, E., T. Hertzig, A. E. Gorbalenya, V. Campanacci, C. Cambillau, B.Canard, and J. Ziebuhr. 2006. Discovery of an RNA virus 3�35� exoribo-nuclease that is critically involved in coronavirus RNA synthesis. Proc. Natl.Acad. Sci. USA 103:5108–5113.

45. Narayanan, K., C. Huang, K. Lokugamage, W. Kamitani, T. Ikegami, C. T.Tseng, and S. Makino. 2008. Severe acute respiratory syndrome coronavirusnsp1 suppresses host gene expression, including that of type I interferon, ininfected cells. J. Virol. 82:4471–4479.

46. Nelson, G. W., and S. A. Stohlman. 1993. Localization of the RNA-bindingdomain of mouse hepatitis virus nucleocapsid protein. J. Gen. Virol. 74:1975–1979.

47. Ozdarendeli, A., S. Ku, S. Rochat, G. D. Williams, S. D. Senanayake, andD. A. Brian. 2001. Downstream sequences influence the choice between anaturally occurring noncanonical and closely positioned upstream canonicalheptameric fusion motif during bovine coronavirus subgenomic mRNA syn-thesis. J. Virol. 75:7362–7374.

48. Pestova, T. V., C. U. Hellen, and E. Wimmer. 1991. Translation of poliovirusRNA: role of an essential cis-acting oligopyrimidine element within the 5�nontranslated region and involvement of a cellular 57-kilodalton protein.J. Virol. 65:6194–6204.

49. Ponnusamy, R., R. Moll, T. Weimar, J. R. Mesters, and R. Hilgenfeld. 2008.Variable oligomerization modes in coronavirus non-structural protein 9. J.Mol. Biol. 383:1081–1096.

50. Raman, S., P. Bouma, G. D. Williams, and D. A. Brian. 2003. Stem-loop IIIin the 5� untranslated region is a cis-acting element in bovine coronavirusdefective interfering RNA replication. J. Virol. 77:6720–6730.

51. Raman, S., and D. A. Brian. 2005. Stem-loop IV in the 5� untranslated regionis a cis-acting element in bovine coronavirus defective interfering RNAreplication. J. Virol. 79:12434–12446.

52. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a labo-ratory manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY.

53. Schultz, J., F. Milpetz, P. Bork, and C. P. Ponting. 1998. SMART, a simplemodular architecture research tool: identification of signaling domains. Proc.Natl. Acad. Sci. USA 95:5857–5864.

54. Senanayake, S. D., and D. A. Brian. 1999. Translation from the 5� untrans-lated region (UTR) of mRNA 1 is repressed, but that from the 5� UTR ofmRNA 7 is stimulated in coronavirus-infected cells. J. Virol. 73:8003–8009.

55. Sethna, P. B., and D. A. Brian. 1997. Coronavirus genomic and subgenomicminus-strand RNAs copartition in membrane-protected replication com-plexes. J. Virol. 71:7744–7749.

56. Sethna, P. B., S. L. Hung, and D. A. Brian. 1989. Coronavirus subgenomicminus-strand RNAs and the potential for mRNA replicons. Proc. Natl.Acad. Sci. USA 86:5626–5630.

57. Silvera, D., A. V. Gamarnik, and R. Andino. 1999. The N-terminal K ho-mology domain of the poly(rC)-binding protein is a major determinant forbinding to the poliovirus 5�-untranslated region and acts as an inhibitor ofviral translation. J. Biol. Chem. 274:38163–38170.

58. Snijder, E. J., P. J. Bredenbeek, J. C. Dobbe, V. Thiel, J. Ziebuhr, L. L. Poon,Y. Guan, M. Rozanov, W. J. Spaan, and A. E. Gorbalenya. 2003. Unique andconserved features of genome and proteome of SARS-coronavirus, an earlysplit-off from the coronavirus group 2 lineage. J. Mol. Biol. 331:991–1004.

59. Spaan, W. J. M., D. Brian, D. Cavanagh, R. J. de Groot, L. Enjuanes, A. E.Gorbalenya, K. V. Holmes, P. Masters, P. Rottier, F. Taguchi, and P. Talbot.2005. Coronaviridae, p. 1259. In C. Fauquet, M. A. Mayo, J. Maniloff, U.Desselberger, and L. A. Ball (ed.), Virus taxonomy. Eighth report of theInternational Committee on Taxonomy of Viruses classification and nomen-clature of viruses. Elsevier/Academic Press, San Diego, CA.

60. Spagnolo, J. F., and B. G. Hogue. 2000. Host protein interactions with the 3�end of bovine coronavirus RNA and the requirement of the poly(A) tail forcoronavirus defective genome replication. J. Virol. 74:5053–5065.

61. Stohlman, S. A., R. S. Baric, G. N. Nelson, L. H. Soe, L. M. Welter, and R. J.Deans. 1988. Specific interaction between coronavirus leader RNA and nu-cleocapsid protein. J. Virol. 62:4288–4295.

62. Tahara, S. M., T. A. Dietlin, C. C. Bergmann, G. W. Nelson, S. Kyuwa, R. P.Anthony, and S. A. Stohlman. 1994. Coronavirus translational regulation:leader affects mRNA efficiency. Virology 202:621–630.

63. Thomson, A. M., J. T. Rogers, C. E. Walker, J. M. Staton, and P. J. Leedman.1999. Optimized RNA gel-shift and UV cross-linking assays for character-ization of cytoplasmic RNA-protein interactions. BioTechniques 27:1032–1039, 1042.

64. Tompkins, W. A., A. M. Watrach, J. D. Schmale, R. M. Schultz, and J. A.Harris. 1974. Cultural and antigenic properties of newly established cellstrains derived from adenocarcinomas of the human colon and rectum.J. Natl. Cancer Inst. 52:1101–1110.

65. van der Hoek, L., K. Pyrc, M. F. Jebbink, W. Vermeulen-Oost, R. J. Berk-hout, K. C. Wolthers, P. M. Wertheim-van Dillen, J. Kaandorp, J. Spaar-garen, and B. Berkhout. 2004. Identification of a new human coronavirus.Nat. Med. 10:368–373.

66. van der Meer, Y., E. J. Snijder, J. C. Dobbe, S. Schleich, M. R. Denison, W. J.Spaan, and J. K. Locker. 1999. Localization of mouse hepatitis virus non-structural proteins and RNA synthesis indicates a role for late endosomes inviral replication. J. Virol. 73:7641–7657.

67. van Hemert, M. J., S. H. van den Worm, K. Knoops, A. M. Mommaas, A. E.Gorbalenya, and E. J. Snijder. 2008. SARS-coronavirus replication/tran-scription complexes are membrane-protected and need a host factor foractivity in vitro. PLoS Pathog 4:e1000054.

68. Van Wynsberghe, P. M., H. R. Chen, and P. Ahlquist. 2007. Nodavirus RNAreplication protein a induces membrane association of genomic RNA. J. Vi-rol. 81:4633–4644.

69. Wang, J. T., and S. C. Chang. 2004. Severe acute respiratory syndrome. Curr.Opin. Infect. Dis. 17:143–148.

70. Wathelet, M. G., M. Orr, M. B. Frieman, and R. S. Baric. 2007. Severe acuterespiratory syndrome coronavirus evades antiviral signaling: role of nsp1 andrational design of an attenuated strain. J. Virol. 81:11620–11633.

71. Weiss, S. R., and S. Navas-Martin. 2005. Coronavirus pathogenesis and theemerging pathogen severe acute respiratory syndrome coronavirus. Micro-biol. Mol. Biol. Rev. 69:635–664.

72. Williams, G. D., R. Y. Chang, and D. A. Brian. 1999. A phylogeneticallyconserved hairpin-type 3� untranslated region pseudoknot functions in coro-navirus RNA replication. J. Virol. 73:8349–8355.

73. Woo, P. C., S. K. Lau, C. M. Chu, K. H. Chan, H. W. Tsoi, Y. Huang, B. H.Wong, R. W. Poon, J. J. Cai, W. K. Luk, L. L. Poon, S. S. Wong, Y. Guan, J. S.Peiris, and K. Y. Yuen. 2005. Characterization and complete genome se-quence of a novel coronavirus, coronavirus HKU1, from patients with pneu-monia. J. Virol. 79:884–895.

74. Wu, H. Y., and D. A. Brian. 2007. 5�-Proximal hot spot for an induciblepositive-to-negative-strand template switch by coronavirus RNA-dependentRNA polymerase. J. Virol. 81:3206–3215.

75. Wu, H. Y., A. Ozdarendeli, and D. A. Brian. 2006. Bovine coronavirus5�-proximal genomic acceptor hotspot for discontinuous transcription is 65nucleotides wide. J. Virol. 80:2183–2193.

76. Yu, W., and J. L. Leibowitz. 1995. A conserved motif at the 3� end of mousehepatitis virus genomic RNA required for host protein binding and viralRNA replication. Virology 214:128–138.

77. Ziebuhr, J., E. J. Snijder, and A. E. Gorbalenya. 2000. Virus-encoded protein-ases and proteolytic processing in the Nidovirales. J. Gen. Virol. 81:853–879.

78. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridizationprediction. Nucleic Acids Res. 31:3406–3415.

79. Zust, R., L. Cervantes-Barragan, T. Kuri, G. Blakqori, F. Weber, B.Ludewig, and V. Thiel. 2007. Coronavirus nonstructural protein 1 is a majorpathogenicity factor: implications for the rational design of coronavirus vac-cines. PLoS Pathog. 3:e109.



T A

ND

RE

WS

UN

IVhttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

2009 bovine coronavirus nonstructural protein 1 (p28) is an rna binding protein that binds terminal...

Documents