2010, 1, 1-54 · 2011. 9. 7. · the terms of a license issued by the national reproduction rights...

American Journal of Plant Sciences, 2010, 1, 1-54 Published Online September 2010 in SciRes (http://www.SciRP.org/journal/ajps/)

Copyright © 2010 SciRes. AJPS

TABLE OF CONTENTS

Volume 1 Number 1 September 2010

Photosynthesis-Dependent Extracellular Ca2+ Influx Triggers an Asexual Reproductive Cycle in the Marine

Red Macroalga Porphyra yezoensis

M. Takahashi, N. Saga, K. Mikami…………………………………………………………………………………………………1

TLC Determination of Marmesin, a Biologically Active Marker from Feronia Limonia L.

M. Jain, A. Trivedi, S. H. Mishra…………………………………………………………………………………………………12

Genetic Analysis of Leucine Content in Indica-Japonica Hybrid Rice (Oryza sativa L.)

X. M. Zhang, C. H. Shi, J. G. Wu, S. H. Ye, G. L. Bao, W. C. Yan………………………………………………………………17

Effects of Hypoxia Stress and Different Level of Mn2+ on Antioxidant Enzyme of Tomato Seedlings

A. R. Liu, S. C. Chen, Y. F. Mi, Z. Zhou, G. J. Ahammed………………………………………………………………………24

Phylogenic Study of Twelve Species of Phyllanthus Originated from India through Molecular Markers for

Conservation

G. R. Rout, S. Aparajita…………………………………………………………………………………………………………32

Nutrient Flows in Perennial Crop-Based Farming Systems in the Humid Forests of Cameroon

E. E. Ehabe, N. L. Bidzanga, C. -M. Mba, J. N. Njukeng, I. de Barros, F. Enjalric………………………………………………38

Characteristics of Gas Exchange in Three Domesticated Anemone Species

F. H. Liu, F. Li, X. N. Liang………………………………………………………………………………………………………47

American Journal of Plant Sciences (AJPS)

Journal Information

SUBSCRIPTIONS

The American Journal of Plant Sciences (Online at Scientific Research Publishing, www.SciRP.org) is published quarterly by

Scientific Research Publishing, Inc., USA.

Subscription rates: Print: $50 per issue.

To subscribe, please contact Journals Subscriptions Department, E-mail: [email protected]

SERVICES

Advertisements

Advertisement Sales Department, E-mail: [email protected]

Reprints (minimum quantity 100 copies)

Reprints Co-ordinator, Scientific Research Publishing, Inc., USA.

E-mail: [email protected]

COPYRIGHT

Copyright©2010 Scientific Research Publishing, Inc.

All Rights Reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by

any means, electronic, mechanical, photocopying, recording, scanning or otherwise, except as described below, without the

permission in writing of the Publisher.

Copying of articles is not permitted except for personal and internal use, to the extent permitted by national copyright law, or under

the terms of a license issued by the national Reproduction Rights Organization.

Requests for permission for other kinds of copying, such as copying for general distribution, for advertising or promotional purposes,

for creating new collective works or for resale, and other enquiries should be addressed to the Publisher.

Statements and opinions expressed in the articles and communications are those of the individual contributors and not the statements

and opinion of Scientific Research Publishing, Inc. We assumes no responsibility or liability for any damage or injury to persons or

property arising out of the use of any materials, instructions, methods or ideas contained herein. We expressly disclaim any implied

warranties of merchantability or fitness for a particular purpose. If expert assistance is required, the services of a competent

professional person should be sought.

PRODUCTION INFORMATION

For manuscripts that have been accepted for publication, please contact:

E-mail: [email protected]

American Journal of Plant Sciences, 2010, 1, 1-11 doi:10.4236/ajps.2010.11001 Published Online September 2010 (http://www.SciRP.org/journal/ajps)


1

Photosynthesis-Dependent Extracellular Ca2+ Influx Triggers an Asexual Reproductive Cycle in the Marine Red Macroalga Porphyra yezoensis

Megumu Takahashi1, Naotsune Saga2, Koji Mikami2*

1Graduate School of Fisheries Sciences, Hokkaido University, Hakodate, Japan; 2Faculty of Fisheries Sciences, Hokkaido University, Hakodate, Japan. *Email: [email protected] Received August 16th, 2010; revised September 6th, 2010; accepted September 9th, 2010

ABSTRACT

Asexual propagation to increase the number of gametophytic clones via the growth of asexual haploid spores is a unique survival strategy found in marine multicellular algae. However, the mechanisms regulating the asexual life cycle are largely unknown. Here, factors involved in the regulation of production and discharge of asexual spores, so-called monospores, are identified in the marine red macroalga Porphyra yezoensis. First, enhanced discharge of monospores was found by incubation of gametophytes in ASPMT1, a modified version of the previously established synthetic me-dium ASP12. Comparison of the compositions of ASPMT1 and our standard medium, ESL, indicated that the Ca2+ con-centration in ASPMT1 was three times lower than that in ESL medium. Thus, we modified ASPMT1 by increasing its Ca2+ concentration, resulting in reduction of monospore discharge. These findings demonstrate the role of reduced Ca2+ concentrations in enhancing monospore production and release. Moreover, it was also observed that initiation of asexual life cycle required illumination, was repressed by DCMU, and was induced by a Ca2+ ionophore in the dark. Taken together, these results indicate that photosynthesis-dependent Ca2+ influx triggers the asexual life cycle by pro-moting the production and discharge of monospores in P. yezoensis. Keywords: Asexual Life Cycle, Bangiophyceae, Ca2+ Influx, Monospore, Photosynthesis, Porphyra yezoensis,

Rhodophyta, Synthetic Medium

1. Introduction

Asexual life cycle occurs in multicellular eukaryotes including algae and fungi [1-3]. In the sexual haploid-diploid life cycle of multicellular plants, meiosis in the diploid sporophyte produces a haploid gametophyte and syngamy (fertilization) of male and female gametes restores the diploid sporophytic genome [3-5]. By contrast, free- living haploid gametophytes of marine macroalgae often produce asexual spores that develop into haploid gametophytic clones by mitotic cell division without ploidy change [6]. Extensive analysis of plant haploid-diploid life cycles has progressed with recent genomic and genetic studies in Arabidopsis thaliana, which identified candi-date genes involved in the regulation of the sexual life cycle [7-9]. In contrast, despite an accumulation of mor-phological and cytological observations, mechanisms of regulation of the asexual life cycle are still largely un-known, due to the lack of a model plant for investigation

of the asexual life cycle. Porphyra yezoensis, a red macroalga included in Ban-

giophycideae of Rhodophyta, has recently received con-siderable attention as a promising model macroalga for physiological and molecular biological studies of marine red algae, which largely depends on the establishment of laboratory cultures in which the haploid-diploid life cycle can be completed in a short period [10]. As for most of Bangiophycideae red algae, asexual spores, so-called monospores, are produced in monosporangia typically occurring at the marginal region of the gametophyte in P. yezoensis [11], although a biphasic sexual life cycle, which consists of morphologically distinct macroscopic gametophytic blades in winter and microscopic sporophytic filaments in summer, is predominant [11,12]. Thus, it is important to analyze the production and development of monospores in P. yezoensis to elucidate the biological significance and regulatory mechanisms of asexual propagation in multicellular red algae.



2

In the asexual life cycle of P. yezoensis, monospores are released from monosporangia and migrate while un-dergoing morphological changes, then adhere to the sub-stratum and divide asymmetrically to produce two dif-ferent vegetative and rhizoid cells [13-17]. The early development of monospores has been extensively studied, revealing the critical involvement of photosynthsis-dependent extracellular Ca2+ influx and phosphoinositide sig-naling, including phosphatidylinositol 3-kinase and phos-pholipase C, in the establishment of cell polarity that di- rects migration and adherence of monospores [16-19]. In contrast, there is only a few information about monospore production and discharge. Gametophytes may be induced to release monospores by changing water tempera-ture and light conditions [20] and by irradiance with strong light [21]. Also, high yields of monospores from gametophytes treated with allantoin have been reported [22]. A mutant showing high levels of monospore pro-duction has also been isolated and characterized [23]; however, this mutant has not yet been analyzed to determine the mechanisms regulating the production and discharge of monospores in P. yezoensis. Therefore, knowl-edge of the mechanisms regulating production and dis-charge of monospores from gametophytes in P. yezoensis is not complete.

Here, we identified factors involved in regulation of the asexual life cycle in P. yezoensis. Our establishment of an artificial synthetic medium for the culture of P. yezoensis clearly demonstrated that extracellular Ca2+ influx plays a critical role in the production and dis-charge of monospores from gametophytes, and that these processes depend completely on photosynthetic activity. These findings could provide new insights into the regu-lation of the eukaryotic asexual life cycle.

2. Materials and Methods

2.1. Growth of Gametophytes and Discharge of Monospores

The cultivation of gametophytic blades of P. yezoensis strain TU-1 was performed as previously reported [16]. Briefly, the ESL (enriched SEALIFE) medium, which is made by dissolving commercially available SEALIFE powder (Marintech Co. Ltd., Tokyo, Japan) in distilled water (DW) with the addition of ESS2 (enriched seawater Saga2) solution, was renewed weekly until gametophytes were about 3 mm long. Subsequently, gametophytes were grown in ESL or various synthetic media as mentioned in the text. Two pieces of 1 cm polyvinyl alcohol (PVA) monofilaments to which gametophytic blades (ca. 3 mm long) attached were transferred to 100 mL of culture me-dium. The culture media were continuously bubbled with filter-sterilized air under 60 μmol/m2/s irradiance with a

photocycle of 10 h light and 14 h dark at 15˚C, with weekly renewal of culture medium. The length of a total of 10 gametophytic blades was measured to calculate their growth rate. Observation of monospore discharge was performed by three different ways as below. First is com-parison of accumulation of monospores on the bottom of culture flask, for which flasks were placed on white paper to make photographs taken using a digital camera (Ca- non PowerShot G10). Second is observation of monospores attached to PVA monofilaments that photographed using the stereomicroscopic (Leica S8AP0) equipped with Nikon DigitalSight (DS-L2). The last is direct counting the number of monospores, for which 6 pieces gametophytes (ca. 3 mm long) were transferred to 35 mm tissue culture dishes (Iwaki Scitech Div., Asahi Techno Glass) containing ESL or various synthetic media and then the number of discharged monospores was counted under the inverted microscopic (Leica DMIL) during 7 days.

2.2. Quantification of Pigment Contents

Four-week-old gametophytes cultured in ESL or synthetic media were used for calculation of photosynthetic pigments (chlorophyll a, Chl a; phycoerythrin, PE; phyco-cyanin, PC) and carotenoids (Car). Chl a and Car were measured using a method described previously [24], while extraction and measurement of PE and PC were carried out according to the method Beer and Eshel [25].

2.3. Calculation of Magnesium, Potassium and Calcium ion Contents

Concentrations of magnesium, potassium and calcium ions were determined for ESL and ASPMT1 with a po-larized Zeeman atomic absorption spectrophotometer (Hitachi Z-6100) according to the manufacture’s proto-cols.

2.4. Treatment of Gametophytic Blades with Pharmacological Reagents

The photosynthesis inhibitor 3-(3,4-dichlorophenyl)-1,1- dimethylurea (DCMU) (Sigma, USA) was dissolved in dimethyl sulfoxide (DMSO) to prepare a 100 mM stock solution. The calcium ion-specific chelator ethylene gly-col tetraacetic acid (EGTA) (Dojindo Laboratories, Japan) was dissolved in distilled water (DW) to create a 0.5 M stock solution adjusted to pH 8.0 with NaOH. The cal-cium ionophore A23187 (Sigma, USA) was dissolved in DW to prepare a 1.0 M stock solution. The stocks pre-pared above were added to the each medium to treat ga-metophytic blades at the working concentrations indi-cated below. The pH of medium was adjusted at 8.0 after adding of these regents. The concentration of the solvents



3

DW and DMSO did not exceed 0.4% and 0.1%, respec-tively, after addition to the media. At the same time, ap-propriate control experiments were performed with DW at concentration corresponding to the maximum volume of the reagents. For evaluation of the effects of each in-hibitor, gametophytes standing-cultured in 35 mm tissue culture dishes were treated with each of pharmacological reagent at working concentrations indicated in the text.

3. Results

3.1. Enhancement of Monospore Discharge in Synthetic Medium

Porphyra yezoensis is routinely cultured in our labora-tory in ESL [26], which is made with SEALIFE powder whose chemical composition is proprietary. However, it is important to use a culture medium whose chemical compositions are defined for our purpose, so that the medium can be modified experimentally. To date, many kinds of synthetic medium for culturing marine algae

have been described, including the ASP series [27,28]. Among these, we selected ASP12 that was successfully used for the culture of several algae [29,30]. In this study, ASPMT 1 (ASPMT: ASP modified by M. T.), in which compositions of ASP12 were slightly modified (Ta-ble 1), was used as a primary medium.

First, we compared the growth of P. yezoensis in ESL and ASPMT1. As shown in Figure 1, vegetative cells of ASPMT1-cultured gametophytes assumed a round shape and deep red color (Figure 1(b)), and the growth of gametophytic blades cultured in this me-dium was significantly slower than that in ESL (Fig-ures 1(a),(e)). In addition, when the contents of Chl a, PE, PC and Car were measured for gametophytic blades cultured in ESL or ASPMT1 for 4 weeks, PE content was higher in ASPMT1-cultured gametophytes, whereas Chl a, PC and Car contents showed no sig-nificant differences between ESL- and ASPM- T1-cultured gametophytes (Table 2). A remarkable future

Table 1. Chemical compositions of synthetic culture media used in this study.

ESL ASPMT1 ASPMT2 ASPMT3 ASPMT4

HEPES (g/L) 0.1 1.0 1.0 1.0 1.0

NaCl (g /L) n.d.+ 28 28 28 28

MgSO4･7H2O (g/L) n.d.+ 7.0 7.0 7.0 7.0

MgCl2･6H2O (g/L) n.d.+ 4.0 4.0 4.0 4.0

KCl (mg/L) n.d.+ 700 700 700 700

CaCl2･2H2O (mg/L) n.d.+ 400 400 800 200

NaNO3 (mg/L) 60 100 60 60 60

K3PO4 (mg/L) n.d.+ 10 ― ― ―

Na2-glycerophosphate (mg/L) 8 10 8 8 8

NaSiO3･9H2O (mg/L) n.d.+ 150 150 150 150

Fe-EDTA･3H2O (mg/L ) 3 ― ― ― ―

Na2-EDTA (mg/L) 4 10 10 10 10

FeCl3 (mg/L) 0.196 0.1 0.1 0.1 0.1

H3BO3 (mg/L) 4.56 2.0 2.0 2.0 2.0

MnCl2 (mg/L) 0.576 0.4 0.4 0.4 0.4

ZnCl2 (mg/L) 0.0416 0.05 0.05 0.05 0.05

CoCl2 (mg/L ) 0.0161 0.01 0.01 0.01 0.01

Na2MoO4 (mg/L) n.d.+ 0.5 0.5 0.5 0.5

KBr (mg/L) n.d.+ 10 10 10 10

SrCl (mg/L) n.d.+ 2.0 2.0 2.0 2.0

RbCl (mg/L ) n.d.+ 0.2 0.2 0.2 0.2

LiCl (mg/L) n.d.+ 0.2 0.2 0.2 0.2

KI (mg/L) 0.02 0.01 0.01 0.01 0.01

VaCl (mg/L ) n.d. + 0.001 0.001 0.001 0.001

Vitamin mix ESS2 (mL/L)++ 0.1 0.1 0.1 0.1 0.1

pH 8.0 8.0 8.0 8.0 8.0

+ n.d., not determined; ++ The composition is 10 g/L vitamin B12, 10g/L biotin, 1 mg/L thiamine-HCL, 1 mg/L nicotinic acid, 1 mg/L Ca-pantothenate, 100 g/L p-aminobenzoic acid, 10 mg/L inositol and 1 mg/L thymine



4

(a) (b)

(c) (d)

(e) (f)

Figure 1. Red coloration of gametophytes and enhanced discharge of monospores in P. yezoensis cultured in the synthetic media ASPMT1 or ASPMT2. (a-d) Comparison of growth, vegetative cells and monospore discharge among gametophytes cultured in ESL (left), ASPMT1 (center) or ASPMT2 (right). Gametophytes were cultured in the media at 15℃ under 60 mol photons/m2/s with photocycle of 10 h light and 14 h dark for 4 weeks. (a) Growth of gametophytes, (b) microscopic view of vegetative cells, (c) monospore accumulation at the bottom of culture flasks and (d) monospores attached to PVA mono-filaments were presented. Bars: (a) 2 cm; (b) 20 m; (c) 1 cm; (d) 200 m. (e) Comparison of gametophytic growth. Cultiva-tion was performed as above in ESL, ASPMT1 or ASPMT2 and the length of gametophytes was measured weekly. Values are the mean ± SD (n = 10). (f) Comparison of the number of discharged monospores. Gametophytes were cultured 1 week as above in ESL, ASPMT1 or ASPMT2. The number of discharged monospores was counted during 7 days. Values are the mean ± SD (n = 3).

of ASPMT1-cultured gametophytes was an increased dis-charge of monospores relative to ESL-cultured gameto-phytes (Figure 1(f)). Indeed, a large number of monospores were observed on the bottom of flasks and PVA monofilament in ASPMT1 than ESL (Figures 1(c),(d)).

According to these results, we speculated that differ-ences in the chemical composition of ASPMT1 and ESL (see Table 1) are responsible for the differences in the degree of red coloration and discharge of monospores.

3.2. Nitrogen and Phosphorus are not Involved in Red Coloration and Monospore Discharge

To identify factors influencing the pigmentation of vege-tative cells and discharge of monospores, we changed the composition of ASPMT1 and compared the color and

growth of gametophytes cultured in these modified me-dia with those in the ESL. Excess nitrogen and phospho-rus are known to be responsible for reduced growth rate and increased pigmentation in P. yezoensis [31], and the lack of nitrogen is known to result in growth inhibition and discoloration [32,33]. In addition, phosphorus con-tent in the medium also influences the growth of P. ye-zoensis gametophytes [31,32]. Thus, we first hypothe-sized that reducing nitrogen and phosphorus concentra-tions could increase growth rate and reduce strong red coloration occurring in ASPMT1. To test this possibility, we reduced NaNO3 from 100 mg/L to 60 mg/L in ASPMT1 as is in ESL. The concentration of Na2- glyc-erophosphate was also reduced to 8 mg/L, and K3PO4

was eliminated from ASPMT1 due to the lack of corre-



5

sponding information about the K3PO4. Concentration in the ESL medium. The modified med-

ium was designated ASPMT2 (Table 1). Following culture of P. yezoensis gametophytes in ASPMT2 for 4 weeks, a small increase in the growth of gametophytes was observed (Figures 1(a),(e)), which was due to a small increase in the size of vegetative cells attributable to an increase in the cytoplasmic chloroplast-free space compared with ASPMT1 -cultured gametophytes (Figure 1(b)). However, there was no significant change in the degree of monospore discharge (Figure 1(f)), because consistently larger quantities of monospores were observed on the bottom of flasks and PVA monofilaments in ASPMT1 or ASPMT2 compared with ESL (Figures 1(c),(d)). In addition, cul-ture in ASPMT2 for 4 weeks did not affect red coloration (Figure 1(b)) and there were no significant changes in the contents of photosynthetic pigments compared with ASPMT1-cultured gametophytes (Table 2). These re-sults indicate that differences in the concentration of ni-trogen and phosphorus between ASPMT1 and ESL are not responsible for the red coloration of gametophytes and enhanced discharge of asexual monospores.

3.3. Decrease in the Extracellular Ca2+ Concentration Results in Red Coloration of Vegetative Cells and Enhancement of Monospore Discharge

As shown in Table 1, the concentrations of MgCl2, Mg- SO4, KCl, K3PO4 and CaCl2 are unknown in ESL. Thus, the concentration of Mg2+, K+ and Ca2+ in both ESL and ASPMT1 were measured by determining atomic weight using the polarized Zeeman atomic absorption spectro-photometer. We found that although Mg+ and K+ con-centrations were similar in these two media, remarkable differences in the Ca2+ concentration was observed; that is, ESL contains Ca2+ concentration three times greater than that in ASPMT1 (Figure 2), suggesting that the de-creased concentration of Ca2+ in ASPMT1 and ASPMT2 may be responsible for the observed growth and red pigmentation effects on P. yezoensis gametophytes.

To address this possibility, we made two modified versions of ASPMT2 with CaCl2 concentrations two tim-

es greater (800 mg/L) (ASPMT3) or half (200 mg/L) (AS- PMT4) (Table 1). Gametophytes cultured in ASPMT3 for 4 weeks exhibited the same rate of growth as those grown in ESL (Figures 3(a),(e)), whereas gametophytes grown in ASPMT2 or ASPMT4 (Figures 1(a) and 3(a)) exhibited negative growth effects relative to growth in ESL. In addition, although ASPMT4 had no effect on the recovery of color and cell shape, vegetative cells of gametophytes cultured in ASPMT3 showed normal shape and color as those grown in ESL (Figure 3(b)). Although cultivation in ASPMT3 resulted in reduced concentration of Chl a and PE compared with ESL-cultured, PE/Chl a, PC/Chl a and PE/PC were similar between ASPMT3 and ESL-cultured gametophytes (Table 2). On the other hand, culture in ASPMT4, whose Ca2+ concentration is approximately 6 times lower than that in ESL (Table 1 and Figure 2), Chl a and PE contents were higher than those in ESL-cultured gametophytes (Table 2). Moreover, large quantities of dis-charged monospores were observed in ASPMT4, while the number of monospores discharged from gameto-phytes grown in ESL and ASPMT3 was similar to each other (Figure 3(f)). Furthermore, large numbers of monospores adhered to the bottom of flasks and PVA

Figure 2. Quantification of magnesium, potassium and cal-cium ions in ESL and ASPMT1. The concentration of Mg2+, K+ and Ca2+ in both ESL and ASPMT1 was measured as atomic weight by the polarized Zeeman atomic absorption spectrophotometer. Columns and vertical bars represent the mean ± SD, respectively (n = 3).

Table 2. Comparison of concentration of photosynthetic pigments in P. yezoensis cultured in ESL and modified media.

Chl a* PE* PC* Car* PE/Chl a PC/Chl a PE/PC

ESL 1.56 ± 0.11 6.40 ± 1.22 1.5 ± 0.38 0.03 ± 0.01 4.11 0.97 4.26

ASPMT1 1.31 ± 0.24 8.09 ± 0.43 1.41 ± 0.10 0.04 ± 0.02 6.18 1.08 5.73

ASPMT2 1.45 ± 0.07 8.43 ± 0.72 1.70 ± 0.34 0.03 ± 0.01 5.80 1.17 4.96

ASPMT3 1.36 ± 0.12 5.59 ± 1.56 1.28 ± 0.44 0.02 ± 0.01 4.12 0.94 4.38

ASPMT4 1.92 ± 0.35 11.18 ± 0.40 1.47 ± 0.23 0.05 ± 0.01 5.82 0.77 7.60

Concentrations of chlorophyll a (Chl a), phycoerythrin (PE), and phycocyanin (PC) carotenoids (Car) were measured using gametophytes cultured in each medium for 4 weeks. *mg/g fresh wt ± SD



6

(a) (b)

(c) (d)

(e) (f)

Figure 3. Effects of extracellular Ca2+ contents on growth, color and monospore discharge. (a-d) Comparison of growth, vegetative cells and monospore discharge among gametophytes cultured in ESL, ASPMT3 or ASPMT4. Gametophytes were cultured in the media at 15℃ under 60 μmol photons/m2/s with photocycle of 10 h light and 14 h dark for 4 weeks. (a) Growth of gametophytes, (b) microscopic view of vegetative cells, (c) monospore accumulation at the bottom of culture flasks and (d) monospores attached to PVA monofilaments were presented. Bars: (a) 2 cm; (b) 20 μm; (c) 1 cm; (d) 200 μm. (e) Comparison of gametophytic growth. Cultivation was performed as above in ESL, ASPMT3 or ASPMT4 and the length of gametophytes was measured weekly. Values are the mean ± SD (n = 10). (f) Comparison of the number of discharged mono-spores. Gametophytes were cultured as above in ESL, ASPMT3 or ASPMT4. The number of discharged monospores was counted during 7 days. Values are the mean and SD (n = 3).

monofilaments in ASPMT4, while a smaller number of monospores was observed in ESL and ASPMT3 (Fig-ures 3(c),(d)).

We therefore concluded that the concentration of Ca2+ in the medium is an important factor responsible for the negative effects of ASPMT1 on growth, coloration and monospore discharge in gametophytes, indicating that the extracellular concentration of Ca2+ has an important in-fluence on the asexual reproductive life cycle in P. ye-zoensis.

3.4. Photosynthetic Activity Regulates Discharge of Monospores

Consistent with previous reports showing that discharge of monospores is light-dependent in P. yezoensis and Bangia atropurpurea [21,34], strong inhibition of the

discharge of monospores was observed under dark conditions (Figure 4(a)). To understand the role of the light, we tested whether photosynthetic activity is required for the discharge of monospores using DCMU, an inhibitor of electron transport on the acceptor side of Photosystem II. When gametophytes were treated with 0.1, 1 or 10 μM DCMU for 3 days, after which photosynthesis was gradually inhibited but not showed the cell death (data not shown), the number of discharged monospores decreased in a concentration-dependent manner (Figure 4(b)). These results indicate that photosynthesis is another important factor regulating the asexual life cycle in P. yezoensis. Thus, enhancement of monospore discharge is regulated by both a decrease in extracellular Ca2+ concentration and illumination resulting in photosynthesis (Figures 3 and 4).



7

(a)

(b)

Figure 4. Critical involvement of photosynthetic activity in production and discharge of monospores. (a) Comparison of gametophytic vegetative cells and monospore discharge among gametophytes cultured in ESL (left), ASPMT3 (middle) or ASPMT4 (left). Gametophytes were cultured in me-dia at 15℃ under 60 μmol photons/m2/s with photocycle of 10 h light and 14 h dark or consecutively dark for 1 weeks. Under light conditions (upper part), monosporangia were observed only at the edge of the gametophytes in ESL and ASPMT3 but spread to the mid region of gametophytes in ASPMT4. Microscopic view of vegetative cells and monospore accumulation at the bottom of culture flasks were com-binationally represented for light and dark conditions. Bars = 20 μm in photos for vegetative cells; 1 cm in photos for bottom of culture flasks. (b) Comparison of the number of discharged monospores. Gametophytes were cultured as above for 3 days in ESL or ASPMT3 with or without DCMU (0.1, 1, 10 μM), and then the number of discharged mono-spores was counted. Columns and vertical bars represent the mean ± SD, respectively (n = 3).

3.5. Extracellular Ca2+ Influx is Required for Discharge of Monospores

We next addressed the interaction between extracellular Ca2+ concentration and photosynthesis. First, extracellular Ca2+ was reduced by the addition of EGTA to ESL and modified media ASPMT3. After 3 days of treatment of ga-metophytes with 0.5 or 1.0 mM EGTA, which did not bring cell death (data not shown), the discharge of monospores was enhanced by EGTA in both ESL and ASPMT3 (Fig-ure 5(a)). Thus, it is possible that a decrease in extracel-lular Ca2 + may affect the influx of Ca2 + into

(a)

(b)

Figure 5. Critical involvement of Ca2+ influx in production and discharge of monospores. (a) Effects of EGTA on dis-charge of monospores. Gametophytes were cultured in ESL (left), or ASPMT3 (right) with or without EGTA (0.5, 1.0, 2.0, 5.0 mM) at 15℃ under 60 μmol photons/m2/s with photocycleof 10 h light and 14 h dark for 3 days. Then, the number of discharged monospores was counted. Columns and vertical bars represent the mean ± SD, respectively (n = 3). (b) Effects of artificial Ca2+ influx on discharge of monospores. Gametophytes were cultured as above except for under continual dark with or without the calcium ionophore A23187 (1 μM) and the number of discharged monospores was counted. Columns and vertical bars represent the mean ± SD, respectively (n = 3).



8

vegetative cells. Based on these findings, we then examined the effects of the artificial influx of Ca2+ on monospore dis-charge in the dark using the calcium ionophore A23187. As shown in Figure 5(b), although gametophytes cultured in the dark did not produce monospores, as mentioned in Figure 4(a), a number of monospores were released from gametophytes treated with 1 μM A23187 in the absence of illumination, in which no cell death was observed (data not shown), although effects of A23187 treatment on monospore discharge werenot observed under the illumination because of strong influence of photosynthe-sis on monospore discharge as shown Figure 4. These above-mentioned results clearly indicate that Ca2+ influx is photosynthesis-dependent and a critical factor direct-ing the asexual life cycle in P. yezoensis.

Figure 5(b) shows that the effects of A23187 on monospore discharge were different between ESL and ASPMT3. Since Ca2+ concentration of ASPMT3 is less than that of ESL (Table 1 and Figure 2), we propose that gametophytes cultured in ASPMT3 may acquire the po-tential of monospore discharge during cultivation. In addition, it was also observed that extensive deficiency of extracellular Ca2+ caused by the addition of 2.0 and 5.0 mM EGTA in ASPMT3 and ESL inhibited the dis-charge of monospores (Figure 5(a)). The viability of vegetative cells under these conditions were quite low (data not shown), suggesting that inhibition of mono-spore discharge by EGTA treatment may be due to cell death before or after the formation of monosporangia.

4. Discussion

The presence of asexual reproduction via monospores is a remarkable strategy for survival in Bangiophycideae red algae because of its absence in land plants. Because the origin of asexual monospores can be traced back to 1,200 MYA based on fossil records of monospores of an ancient Bangiophycean alga [35], research into the asex-ual life cycle of modern red algae might provide novel information regarding the origin and evolution of mechanisms regulating the eukaryotic life cycle. To date, it has been known that artificial changes in culture systems provided information about production and discharge of monospores [20,21]; however, regulatory mechanisms of this asexual reproduction mode have not yet been exten-sively analyzed. In the present study, we demonstrated that photosynthesis-dependent extracellular Ca2+ influx triggers the production and discharge of monospores from gametophytes of P. yezoensis via the establishment of artificial synthetic medium for the laboratory culture of this organism.

The importance of extracellular Ca2+ influx in the production of monospores (Figures 3 and 5) indicates the

close relationship between enhanced monospore production and changes in both morphology and color of vegetative cells in gametophytes (Figures 1 and 3). We have previ-ously reported that monospore production requires the formation of monosporangia in which vegetative cells become small, red-pigmented monospores [16]. Thus, the characteristics of cells found in gametophytes cultured in ASPMT1 and 2 (see Figure 1(b)) resemble those natu-rally occurring in monosporangia. Accordingly, we pro-posed that the decrease in extracellular Ca2+ due to incu-bation in ASPMT4 resulted in the extensive formation of monosporangia throughout the entire gametophyte fol-lowed by enhanced discharge of monospores due to the resulting greater area devoted to the production of monosporangia compared with ESL-cultured gameto-phytes. Based on this prediction, we hypothesized a mechanism for the formation and discharge of mono-spores (Figure 6). Briefly, the reduction of extracellular Ca2+ concentration stimulates the formation of monospo-rangia at the edge of gametophytes in which photosyn-thesis-dependent extracellular Ca2+ influx is indispensa-ble. Monosporangia then release monospores autono-mously or in a Ca2+ influx-dependent manner (Figure 6 upper). Thus, enhanced formation of monosporangia in gametophytes cultured in ASPMT4 (Figures 3 and 4) appears to have resulted in the development of nearly all vegetative cells into monospores, causing an extensive discharge of monospores (Figure 6 lower).

Another significant result of the present study is the establishment of the novel synthetic medium ASPMT3 for P. yezoensis culture (Figure 3). At present, there are three types of media for red algal cultivation: filter-sterilized natural seawater with addition of a mineral mixture, ESL using commercially released SEALIFE powder with ESS2 [26], and synthetic medium such as the ASP series [27,28]. The composition of the first medium usually varies greatly depending on location and season, thus it is not fit for physiological studies due to difficulties re-garding control conditions and reproducibility. The sec-ond medium is a standard in our laboratory; however, the composition of the SEALIFE powder is proprietary, and therefore not obtainable. As mentioned in Figure 1, the third synthetic medium, the ASP series, has negative effects on the growth of P. yezoensis, although its chemical composition is well known. Considering the previous lack of availability of a good synthetic medium for P. yezoensis in physiological experiments, the establishment of ASPMT3 is therefore an important technological im-provement for the study of P. yezoensis. Because appli-cability of ASPMT3 to the culture of other Bangiophy-cean red algae is unknown, it is important to test the growth of Porphyra and Bangia species of Bangiophy-



9

cideae in compared with ESL medium to be able to gen-eralize the utility of ASPMT3 for Bangiophycean red algal research.

Our aim is to understand the survival advantage of the asexual life cycle in red algae compared with other algae performing only sexual life cycle. The present study de- monstrates the importance of photosynthesis-dependent extracellular Ca2+ influx in monospore production (Fig-ures 4 and 5). However, the relative significance of asexual life cycle compared with the sexual life cycle in P. yezoensis and other Bangiophycean red algae still re-mains to be settled. Due to the dominance of the sexual life cycle in red algae, we propose that the advantage of asexual life cycle relates to the relatively low success rate

of syngamy between male and female gametes. Red algal cells are aflagellate during their entire life cycle [36,37], thus success of syngamy depends completely on the number of free discharged male gametes compared with the number of female gametes located in gametophytes. The probability of syngamy may be enhanced by increasing the number of free male gametes and increasing the total area producing female gametes in gametophytes. Thus, increasing the density of gametophytic clones produced by asexual propagation of monospores could in-crease both the number of male gametes released in sea water and the probability of fertilizing female gametes existing in gametophytes. In fact, similar explanation has been given for the tri-phasic life cycle observed in the

Figure 6. A model of the involvement of Ca2+ and photosynthesis in production and discharge of asexual monospores in P. yezoensis gametophytes. In ESL and ASPMT3, if extracellular Ca2+ content is decreased, the formation of monosporangia is stimulated at the tip region of gametophytes, followed by discharge of monospores, for which photosynthesis activated by illumination accelerates extracellular Ca2+ influx to promote the formation of monosporangia (upper part). According to this hypothesis, the strong effects of ASPMT4 on growth of gametophytes and monospore discharge are explained by enhance-ment of monosporangium formation throughout the body of gametophytes after severe limitation of extracellular Ca2+, re-sulting in enhanced extracellular Ca2+ influx and monospore discharge, which reflects growth inhibition (lower part). Area containing monosporangia is schematically indicated by highlighted gray region. Photos show monosporangia in gameto-phytes cultured in ESL (upper) and ASPMT4 (lower).



10

more advanced red algae, classified as Florideophyceae, in which an extra diploid generation, so-called a tetraspo- rophyte, is found between the gametophyte and sporo-phyte phases [38]. The increase in the number of ga-metophytes via production of haploid tetraspores in tet-rasporophytes also makes on advantage for successful syngamy in Florideophyceae. However, regulation mechanism producing spores are completely different between Bangiophyceae and Florideophyceae.

To determine the relative advantages of asexual life cycle against sexual one in P. yezoensis, it is necessary to elucidate the molecular mechanisms regulating formation of monosporangia, sporulation of vegetative cells to monospores, and discharge of monospores from gameto-phytes. Since the importance of extracellular Ca2+ influx (Figure 5) suggested the involvement of pumps and/or transporters of Ca2+ in monosporangia formation, it is essential to identify such molecules to understand how photosynthesis regulates extracellular Ca2+ influx for the promotion of monosporangia formation. In addition, it is necessary to elucidate how a decrease of extracellular Ca2+ concentration stimulates the intracellular Ca2+ influx, since there is no other example for the promotion of ex-tracellular Ca2+ influx by decrease in the Ca2+ concentra-tion outside of cells. Moreover, to understand the effects of the transfer of Ca2+ into the cytoplasm, it is important to identify targets of Ca2+ that participate in cellular sig-nal transduction pathways for monosporangia formation, sporulation and monospore discharge.

We have also observed a similar regulatory system in the early development of P. yezoensis monospores, in which photosynthesis-dependent extracellular Ca2+ influx triggers initiation of the directional migration of mono-spores via the activation of phosphoinositide signaling components such as phosphatidylinositol 3-kinase and phospholipase C [17-19]. Thus, extracellular Ca2+ influx plays roles in different stages of the early development of monospores in this asexual life cycle. Such complexity related to multiple functions of Ca2+ should be resolved by focusing on whether extracellular Ca2+ influx is regu-lated by the same or different Ca2+ pumps and/or trans-porters during the formation of monosporangia and mi-gration of monospores. Therefore, identification of genes involved in the Ca2+ dependence of the asexual life cycle is necessary for progress in molecular biological and genetic studies on the regulation of the asexual life cycle in eukaryotic red algae.

5. Acknowledgements

We are grateful to Drs. Yasuaki Takagi and Hajime Ya-sui (Hokkaido University, Japan) for kindly providing the polarized Zeeman atomic absorption spectropho-tometer and microscopes, respectively. This study was supported in part by Grants-in-Aid for Scientific Re-search (21580213) and the Regional Innovation Cluster

Program (Global Type) from the Ministry of Education, Culture, Sports, Science, and Technology, Japan.

REFERENCES [1] T. H. Adams, J. K. Wieser and J. H. Yu, “Asexual Sporu-

lation in Aspergillus nidulans,” Microbiology and Mo-lecular Biology Reviews, Vol. 62, No. 1, March 1998, pp. 35-54.

[2] R. M. McCourt, C. F. Delwiche and K. G. Karol, “Ch- Arophyte Algae and Land Plant Origins,” Trends in Ecol-ogy and Evolution, Vol. 19, No. 12, December 2004, pp. 661-666.

[3] K. J. Niklas and U. Kutschera, “The Evolution of the Land Plant Life Cycle,” New Phytologist, Vol. 185, No. 1, January 2010, pp. 27-41.

[4] S. M. Coelho, A. F. Peters, B. Charrier, D. Roze, C. Destombe, M. Valero and J. M. Cock, “Complex Life Cycles of Multicellular Eukaryotes: New Approaches Based on the Use of Model Organisms,” Gene, Vol. 406, No. 1-2, December 2007, pp. 152-170.

[5] K. J. Niklas and U. Kutschera, “The Evolutionary Devel-opment of Plant Body Plans,” Functional Plant Biology, Vol. 36, No. 8, August 2009, pp. 682-695.

[6] F. Magne, “Classification and Phylogeny in the Lower Rhodophyta: A New Proposal,” Journal of Phycology, Vol. 27, No. s3, June 1991, p. 46.

[7] L. Goosey and R. Sharrock, “The Arabidopsis Compact Inflorescence Genes: Phase-Specific Growth Regulation and the Determination of Inflorescence Architecture,” Plant Journal, Vol. 26, No. 5, June 2001, pp. 549-559.

[8] G. C. K. Chiang, D. Barua, E. M. Kramer, R. M. Ama-sino and K. Donohue, “Major Flowering Time Gene, FL- OWERING LOCUS C, Regulates Seed Germination in Arabidopsis Thaliana,” Proceeding of the National Acad- emy of Sciences of the USA, Vol. 106, No. 28, July 2009, pp. 11661-11666.

[9] K. E. Hubbard, F. C. Robertson, N. Dalchau and A. A. R. Webb, “Systems Analyses of Circadian Networks,” Mo-lecular Biosystems, Vol. 5, No. 12, December 2009, pp. 1502-1511.

[10] N. Saga and Y. Kitade, “Porphyra: A Model Plant in Marine Sciences,” Fisheries Science, vol. 68, Supplement II, November 2002, pp. 1075-1078.

[11] A. Miura, “Genetic Analysis of the Variant Color Types of Light Red, Light Green and Light Yellow Phenotypes of Porphyra yezoensis (Rhodophyta, Bangiaceae),” In: H. Hara, ed., Origin and Evolution of Diversity in Plants and Plant Communities, Academic Scientific Book Inc, To-kyo, 1985, pp. 270-284.

[12] M. Kurogi, “Species of Cultivated Porphyra and Their Life Histories,” Bulletin of Tohoku Regional Fisheries Resear- ch Laboratory, Vol. 18, March 1961, pp. 91-115.

[13] M. D. Guiry, “The Life-History of Liagora harveyana （Nemaliales, Rhodophyta) from SOUTH-EASTERN AUSTRALIA,” European Journal of Phycology, Vol. 25,



11

No. 4, December 1990, pp. 353-362.

[14] J. D. Pickett-Heaps, J. A. West, S. M. Wilson and D. L. McBride, “Time-Lapse Videomicroscopy of Cell (Spore) Movement in Red Algae,” European Journal of Phycol-ogy, Vol. 36, No. 1, February 2001, pp. 9-22.

[15] J. C. Ackland, J. A. West and J. Pickett-Heaps, “Actin and Myosin Regulate Pseudopodia of Porphyra pulchella (Rhodophyta) Archeospores,” Journal of Phycology, Vol. 43, No. 1, February 2007, pp. 129-138.

[16] L. Li, N. Saga and K. Mikami, “Phosphatidylinositol 3- Kinase Activity and Asymmetrical Accumulation of F- Ac-tin are Necessary for Establishment of Cell Polarity in the Early Development of Monospores from the Marine Red Alga Porphyra yezoensis,” Journal of Experimental Botany, Vol. 59, No. 13, October 2008, pp. 3575- 3586.

[17] K. Mikami, “Migrating Plant Cell: F-Actin Asymmetry Directed by Phosphoinositide Signaling,” In: S. Lansing and T. Rousseau, eds., Cytoskeleton: Cell Movement, Cy-tokinesis and Organelles Organization, Nova Science Publishers, New York, 2010, pp. 205-218.

[18] L. Li, N. Saga and K. Mikami, “Ca2+ Influx and Phos-phoinositide Signalling Are Essential for the Establish-ment and Maintenance of Cell Polarity in Monospores from the Red Alga Porphyra yezoensis,” Journal of Ex-perimental Botany, Vol. 60, No. 12, August 2009, pp. 3477-3489.

[19] K. Mikami, L. Li, M. Takahashi and N. Saga, “Photosyn-thesis-Dependent Ca2+ Influx and Functional Diversity between Phospholipases in Formation of Cell Polarity in Migrating Cells of Red Algae,” Plant Signaling and Be-havior, Vol. 4, No. 9, September 2009, pp. 911-913.

[20] Y. Kitade, G. Taguchi, J. A. Shin and N. Saga, “Porphyra Monospore System (Bangiales, Rhodophyta): A Model for the Developmental Biology of Marine Plans,” Phycological Research, Vol. 46, No. 1, March 1998, pp. 17-20.

[21] S. Y. Li, “The Ecological Characteristics of Monospores of Porphyra yezoensis Ueda and their Use in Cultiva-tion,” Hydrobiologia, Vol. 116/117, No. 1, September 1984, pp. 255-258.

[22] H. Mizuta, H. Yasui and N. Saga, “A Simple Method to Mass Monospores in the Thallus of Porphyra yezoensis Ueda,” Journal of Applied Phycology, Vol. 15, No. 4, July 2003, pp. 345-349.

[23] X. H. Yan, Y. Fujita and Y. Aruga, “High Monospore- Producing Mutants Obtained by Treatment with MNNG in Porphyra yezoensis Ueda (Bangiales, Rhodophyta),” Hydrobiologia, Vol. 512, No. 1-3, January 2004, pp. 133- 140.

[24] G. R. Seely, W. E. Vidaver and M. J. Duncan, “Prepara-tive and Analytical Extraction of Pigments from Brown Algae with Dimethyl Sulfoxide,” Marine Biology, Vol. 12, No. 2, January 1972, pp. 184-188.

[25] S. Beer and A. Eshel, “Determining Phycoerythrin and Phycocyanin Concentrations in Aqueous Crude Extracts of Red Algae,” Australian Journal of Marine and Fresh-water Research, Vol. 36, No. 6, September 1985, pp.

785-792. [26] Y. Kitade, S. Fukuda, M. Nakajima, T. Watanabe and N.

Saga, “Isolation of a cDNA Encoding a Homolog of Ac-tin from Porphyra yezoensis (Rhodophyta),” Journal of Applied Phycology, Vol. 14, No. 2, April 2002, pp. 135-141.

[27] L. Provasoli, J. J. A. McLaughlin and M. R. Droop, “The Development of Artificial Media for Marine Algae,” Ar-chiv für Mikrobiologie, Vol. 25, No. 4, December 1957, pp. 392-428.

[28] L. Provasoli, “Growing Marine Seaweeds,” In: A. D. De Virville and J. Feldman, eds., Proceedings of the Fourth International Seaweed Symposium, Pergamon Press, Ox-ford, 1963, pp.9-17.

[29] N. Saga, T. Motomura and Y. Sakai, “Induction of Callus from the Marine Brown Alga Dictyosiphon foenicu-laceus,” Plant and Cell Physiology, Vol. 23, No. 4, June 1982, pp. 727-730.

[30] N. S. Yokoya, “Apical Callus Formation and Plant Re-generation Controlled by Plant Growth Regulators on Axenic Culture of Red Alga Gracilariopsis tenuifrons (Gracilariales, Rhodophyta),” Phycological Research, Vol. 48, No. 3, September 2000, pp. 133-142.

[31] S. Shen, L. He, P. Xu and J. Zhu, “Effect of Nitrogen and Phosphorus on the Development and Differentiation of Vegetative Cells of Porphyra yezoensis on Solid Agar Medium,” Botanica Marina, Vol. 49, No. 5/6, December 2006, pp. 372-378.

[32] J. T. Hafting, “Effect of Tissue Nitrogen and Phosphorus Quota on Growth of Porphyra yezoensis Blades in Sus-pension Cultures,” Hydrobiologia, Vol. 398/399, No. 0, April 1999, pp. 305-314.

[33] M. Kakinuma, D. Coury, C. Nakamoto, K. Sakaguchi and H. Amano, “Molecular Analysis of Physiological Re-sponses to Changes in Nitrogen in a Marine Macroalga, Porphyra yezoensis (Rhodophyta),” Cell Biology and Toxicology, Vol. 24, No. 6, December 2008, pp. 629-639.

[34] K. Charnofsky, L. R. Towill and M. R. Sommerfeld, “Li- Ght Requirements for Monospore Germination in Bangia atropurpurea (Rhodophyta),” Journal of Phycology, Vol. 18, No. 3, September 1982, pp. 417-422.

[35] N. J. Butterfield, “Bangiomorpha pubescens n. gen., n. sp.: Implications for the Evolution of Sex, Multicellular-ity, and the Mesoproterozoic/Neoproterozoic Radiation of Eukaryotes,” Paleobiology, Vol. 26, No. 3, September 2000, pp. 386-404.

[36] G. Tripodi and F. de Masi, “Unusual Structure in the Spermatial Vesicles of the Red Alga Erythrocystis mon-tagnei,” Plant Systematics and Evolution, Vol. 143, No. 3, September 1983, pp. 197-206.

[37] M. N. Clayton, “Propagules of Marine Macroalgae: Stru- Cture and Development,” European Journal of Phycology, Vol. 27, No. 3, September 1992, pp. 219-232.

[38] C. S. Thornber, “Functional Properties of the Isomorphic Biphasic Algal Life Cycle,” Integrative and Comparative Biology, Vol. 46, No. 5, October 2006, pp. 605-614.



TLC Determination of Marmesin, a Biologically Active Marker from Feronia Limonia L.

Mahendra Jain*, Ashish Trivedi, S.H.Mishra

Herbal Drug Technology Laboratory, Pharmacy Department, Faculty of Technology and Engineering, The M. S. University of Baroda, Kalabhavan, Vadodara, Gujarat, India. Email: *[email protected] Received August 9th, 2010; revised August 24th, 2010; accepted September 6th, 2010

ABSTRACT

Feronia limonia Linn. (Rutaceae) have gained traditional therapeutic importance owing to their high essential oil and coumarins content. Marmesin, a furanocoumarin was identified by TLC and isolated by column chromatography and further purified by Preparative TLC. Presently, there is no appropriate TLC based method available for standardization of F. limonia. A simple, sensitive and accurate high performance thin layer chromatographic (HPTLC) method has been developed for the estimation of marmesin in the methanolic extract of stem bark of Feronia limonia. HPTLC was performed on precoated silica gel 60F254 aluminium plates (20 cm × 20 cm) with Chloroform: Methanol (9.5:0.5), as mobile phase. Quantitative evaluation of the plate was performed in the absorption-reflection mode at 338 nm. The calibration curve was linear in the concentration range of 20 – 100 ng spot–1. The method was validated for precision, repeatability and accuracy. The technique has been applied, for the first time, for the estimation of marmesin. The pro-posed method was found to be robust, precise, and accurate, it therefore holds potential for detection, monitoring and quantification of marmesin in Feronia limonia and its related formulation. Keywords: Marmesin, Feronia Limonia, HPTLC

1. Introduction

Standardization and characterization of herbal drugs is a topic of continuous scientific interest in the herbal drug industry [1]. With the advent of modern chromatographic systems there is an ever increasing intent to produce and develop easy, rapid, convenient and cost effective methods for standardization of herbal drugs based on their phy- toconstituents. This requirement is fulfilled by thin layer chromatography (TLC) [2,3]. Feronia limonia is (family Rutaceae, subfamily Aurantioideae), commonly known as wood-apple , belongs to the tribe Citreae and subtribe Balsamocitrinae[4] which is widely distributed in dry wa- rm regions of India, Bangladesh, Barma, Ceylon, Java & Srilanka [5,6]. This plant recently gained a great thera-peutically relevance owing to their high Coumarins and monoterpenoids content, which is explored for treatment of snake bite [7]. Stem bark mainly consists of furan Al-kaloid; Coumarins; Flavanones; Lignan; triterpene [8]. It is useful as tonic in diarrhoea, dysentery, stomatitis, tum- ors, cough, asthma, leucorrhoea, wounds and ulcers. Fru- its, leaves and stem bark of F. limonia have been studied

for anti-tumor [9], larvicidal [10] and antimicrobial ac-tivity [8].

Marmesin is one of the most prevalent linear dihydro-furanocoumarin, is abundant in species belonging to the families of Umbelliferae, Apiaceae, Rutaceae, Moraceae, and Leguminoseae [11,12]. It is originally isolated from indigenous indian plants, Aegle marmelos Correa [13], and later from the Hawiian shrub Pelea barbigera [14] both of these are from rutaceae family. It has an amazing array of scientifically acknowledged benefits for key areas of health, as dermal photosensitizing activity benefi-cial in the treatment of leucoderma [15], antifungal activ-ity [16], phytoalexin [17], feeding deterrence effects [18] and radical scavenging activity [19]. Currently HPTLC is often used as an alternative to HPLC for the quantifica-tion of plant products because of its simplicity, accuracy, cost-effectiveness and rapidity [20]. The present study is based on development of methods for determination of marmesin by HPTLC in F. limonia stem bark that may contribute in standardization of raw material of the plant and its formulation.

TLC Determination of Marmesin, a Biologically Active Marker from Feronia limonia L.


13

2. Experimental

2.1. Reagents and Chemicals

All the chemicals, including solvents, were of analytical grade from E. Merck, India. The HPTLC plates Si 60F254 (20 cm × 20 cm) were purchased from E. Merck (Darm-stadt, Germany).

2.2. Plant Materials

The plant material of Feronia limonia was collected in the months of September– October 2008 from campus of The M.S. University, Vadodara (Gujarat). They were authenticated in the Botany Department and a voucher specimen (No.Pharmacy/FL/ 08-09/01/MJ) has been de-posited in the Pharmacy Department of The M. S. Uni-versity of Baroda, Vadodara, India.

2.3. Extraction and Isolation of Reference Compound (MR-1) from Feronia Limonia

Air-dried and finely powdered stem barks of the plant (500 g) were exhaustively extracted at temperature (60- 80˚C) with methanol (3 × 1.5 L) in a soxhlet apparatus and the pooled extracts then obtained were concentrated under vacuum to give methanolic extract. Methanolic extract was made hydroalcoholic by addition of hot dis-tilled water in 1:1 ratio partitioned with chloroform (100 mL × 4), and combined chloroform fraction was concen-trated in vacuum to afford a brown residue (4.5 g). This residue was chromatographed over a Silica gel (60#120 mesh size) column eluting with toluene followed by in-creasing concentrations of ethyl acetate and methanol. Fraction 9-10 (toluene: ethyl acetate, 60:40) yielded yel-lowish crystal resulted in mixture of compounds on TLC. Further purification of MR-1 was achieved by prepara-tive TLC (chloroform: methanol, 9.8:0.2) and confirmed by analytical HPLC. MR-1 obtained as white crystal (118

mg). The structure elucidation of MR-1 was performed with the help of 13CNMR, mass (ESI-MS) spectra and CHN analysis that confirmed as marmesin reported earlier [2,3-dihydro-2-(1-hydroxy-1 methylethyl)- 7H-furo[3, 2-g][1]benzopyran-7-one] (Figure 1)[21].

Marmesin (MR-1): C14H14O4 m.p.188-1900 (CHCl3-pe- trol); IR spectra: 3479,2977, 2929, 1703, 1630, 1572, 14851444, 1404 and 819 cm-1 ;1H NMR: δ1.23 and 1.37(> CMe2, 1.85(1H, br), 3.23 (2H, br d, J 8.8 Hz, H2-1’), 4.74 (1H, t, J 8.8 Hz, H-2’), 6.21(1H, d, J 9.5 Hz, H-3), 6.74(1H, s, H-8), 7.22(1H, s, H-5), 7.59(1H, d, J 9.5 Hz, H-4) ; m/z (%) 246 (M+,39), 213(20), 188 (75), 187(100), 175(15), 160(30), 131(19), 59(66), 43(7) ; CHO % elements- (Oxyzen-25.915), (Carbon-67.191) and (Hydrozen-5.480).

2.4. Preparation of Crude Extract

Accurately weighed 5 g of the coarse powder of F. limo-nia stem barks were extracted with methanol (3 × 50 mL) under reflux (30 min each time) on a water bath. The combined extracts were filtered and concentrated, and transferred to a 25 mL volumetric flask and the volume was made up with methanol.

2.5. Preparation of Standard Solution

A stock solution of marmesin (100 µg mL-1) was prepared by dissolving 1 mg of accurately weighed marmesin in methanol and making up the volume of the solution to 10 mL with methanol.

2.6. Chromatography

A Camag TLC system equipped with Camag Linomat V an automatic TLC sample spotter, Camag glass twin trough chamber (20 × 10 cm), Camag scanner 3 and integrated win CATS 4 Software were used for the analysis. TLC was performed on a pre-coated TLC plate silica gel60F254

Figure 1. Mass spectroscopy and chemical structure of marmesin.



14

(20 cm × 10 cm). Samples and standards were applied on the plate as 8 mm wide bands with an automatic TLC sampler (Linomat V) under a flow of N2 gas, 10 mm from the bottom and 10 mm from the side and the space between two spots were 15 mm of the plate. The linear ascending development was carried out in a Camag twin trough chamber (20 cm × 10 cm) which was presa- tu-rated with 20 mL mobile phase chloroform: methanol (9.5:0.5 v/v) for 20 min at room temperature (25 ± 2˚C and 40% relative humidity). The length of the chroma-togram run was 9 cm. Subsequent to the development, TLC plates were dried under stream of hot air and then subjected to densitometric scanning using a Camag TLC scanner III (Camag, Switzerland) with win CATS soft-ware (version 1.4.1) in the absorbance- reflectance scan mode. Quantitative evaluation of the plate was performed in absorption-reflection mode at 338 nm. Quantification of marmesin in the extract of F. Limonia stem barks was performed by external standard method, using pure marmesin as standard.

2.7. Calibration Curve for Marmesin

Stock solution of marmesin (100 µg mL-1) was prepared in methanol and different amounts (20–100 ng spot-1) were applied on a TLC plate, using Linomat V for pre-paring five point calibration graphs of peak area versus concentration. The regression equation for marmesin was 1089.554 + 230.603x and co-relation coefficient (r2) was 0.999.

2.8. Quantification of Marmesin in Test Sample

Ten microlitres of sample solution were applied in tripli-cate on a TLC plate and developed, scanned as above. Peak areas were recorded and the amount of marmesin was calculated using the calibration plot.

2.9. Specificity

The specificity of the method was ascertained by co-an-

alyzing standard and sample. The band for marmesin in sample was confirmed by comparing the Rf (0.49) and absorption spectra of the spot to that of reference compound. The peak purity of marmesin peak in sample track was assessed by comparing the spectra at peak start, peak apex and peak end positions of the band. Good correla-tion was also obtained between standards and sample overlay spectra (r2 > 0.99).

2.10. Method Validation

The method was validated for precision, accuracy and repeatability [22]. Instrumental precision was checked by repeated scanning of the same spot 20 and 100 ng five times and was expressed as coefficient of variance (% RSD). Method precision was studied by analyzing the standards 20 and 100 ng per spot under the same analytical procedure and lab conditions on the same day and on different days (inter-day precision) and the results were expressed as % RSD. Accuracy of the method was tested by performing the recovery studies of the pre-analysed sample with standard at three levels (55.02, 68.78 and 82.53 µg mL-1), % recovery and average % recovery were calculated.

3. Result and Discussion

Chloroform: methanol (9.5:0.5 v/v) gave the best resolu-tion and satisfactory separation of the components in the extracts with well resolved peaks. A total of nine peaks were observed methanol extracts of samples. A compara-tive chromatographic display is shown in Figures 2(a) & 2(b). The densitometric scanning was therefore performed at a wavelength of 338 nm. The identities of the bands of marmesin (Rf = 0.49), in the sample extract were con-firmed by overlaying their absorption spectra with those of the standard compounds using the TLC Scanner 3. The peak purity of the separated marmesin was confirmed by recording the absorption spectra at start to middle and middle to the end of the peak.

(a) (b)

Figure 2. (a) TLC chromatogram, for a standard marmesin in methanol, Calibration curve and Three-dimensional overlaid chromatogram of standard track and sample track for marmesin; (b) TLC chromatogram, for stem barks methanolic extract of Feronia Limonia.



15

3.1. System Suitability Test

3.1.1. Linearity and Detection Limit Linearity was checked by applying standard solutions of marmesin at five different concentration levels. The cali-bration curve was drawn in the concentration range of 20–100 ng spot-1(Figures 2(a) and 2(b)). The equation for the calibration curve of marmesin is Y = 1089.554 + 230.603x and the correlation coefficient of the calibration plot was 0.999 indicating good linearity. Results of re-gression analysis on the calibration curve and detection limits are presented in Table 1(a).

3.1.2. Precision Studies Instrumental precision was checked by repeated scanning of the same spots (20 and 100 ng spot-1) of standard marmesin five times and the RSD values were 1.56 and 1.82 for 20 and 100 ng spot-1, respectively. To determine the precision of the developed assay method 20 and 100 ng spot-1 of the marmesin standard was analysed five times within the same day to determine the intra-day variability. The RSD values were 3.41 and 6.29 for 20 and 100 ng

Table 1. Method validation parameters for quantification of marmesin using proposed TLC densitometric method.

(a) Linearity regression data

Sl no. Parameter Results

1 RF 0.49

2 Dynamic range (ng spot-1) 20–100

3 Equation Y = 1089.554 + 230.603x

4 Slope 230.603

5 Intercept 1089.554

6 Limit of detection 5 ng

7 Limit of quantification 15.15 ng

8 Linearity (correlation coefficient) 0.999

9 Specificity Specific

(b) Precision studies data

Method precision (% RSD)Concentration (ng spot-1)

Instrumental precision (% RSD)

Intra-day Inter-day

20 1.56 3.41 2.68

100 1.82 6.29 2.83

(c) Recovery studies of marmesin

Sl no. Amount of marmesin present in the sample

(µg)

Amount added (µg)

Amount found (µg)

Avg. Recovery

(%)

1 68.78 55.02 122.11 98.83

2 68.78 68.78 136.92

3 68.78 82.53 148.81

spot-1, respectively. Similarly the inter-day precision was tested on the same concentration levels on 2 days and the RSD values were 2.68 and 2.83, respectively (Table 1(b)).

3.1.3. Sample Analysis and Recovery Studies This developed TLC method was subsequently applied for the analysis of marmesin in the methanolic extract of Feronia limonia stem barks. The marmesin content of the stem barks by this proposed method was found to be 0.03412%. For the examination of recovery rates, 80, 100 and 120% of pure marmesin were added to preana-lyzed sample and quantitative analysis was performed. The average recovery was 98.83 (Table 1(c)).

4. Conclusions

Thin layer chromatography is a globally accepted, ratio- nal and practical solution to characterize the crude plant drug along with pharmacologically active constituent enriched standardized extracts and their formulations. TLC method on silica gel 60F254 with chloroform–methanol (9.5:0.5, v/v) was developed and densitometric evalua-tion was performed at 338 nm. This method is simple, specific, precise, accurate and robust for the determina-tion of marmesin [2,3-dihydro-2-(1-hydroxy-1 methylethyl)- 7H-furo[3,2-g][1]benzopyran-7-one]. This standardized TLC procedure may be used effectively for the screening analysis as well as quality evaluation of the plant or its derived herbal products.

REFERENCES [1] N. Govindarajan, M. Vijayakumar, M. Thakur, V. K.

Dixit, S. Mehrotra and P. Pushpangadan, “Standardization and Determination of Antioxidant Activity of Chlorophytum Borivilianum,” Journal of natural Products, Vol. 11, Oc-tober 2005, pp. 165-169.

[2] M. Thakur, S. Bhargava and V. K. Dixit, “Immunomodu-latory Activity of Chlorophytum borivilianum Sant. & F,” Evidence-based Complementary and Alternative Medi-cine, Vol. 4, No. 4, 2007, pp. 419-423.

[3] S. K. Chauhan, B. P. Singh and S. Agrawal, “Determina-tion of Pistacienoic Acids in Pistacla Integerrima Stewart Ex Brandis by HPTLC and HPLC,” Indian Journal of Pharmaceutical Science, Vol. 64, February 2002, pp. 403-405.

[4] D. L. Dreyer, M. V. Pickering and P. Cohan, “Distribu-tion of Limonoids in the Rutaceae,” Phytochemistry, Vol. 11, No. 2, February 1972, pp.705-713.

[5] J. D. Hooker, “The Flora of British India,” L. Reeve & Co, London, Vol. 1, No. 1, 1875, p.178.

[6] K. R. Kirtikar, B. D. Basu and I. C. S. An, “Indian Me-dicinal Plants,” Bishen Singh Mahendra Pal Sigh, India, Vol. 1, 1933, pp. 496-498.

[7] A. Agarwal, I. R. Siddique and J. Singh, “Coumarins from the Roots of Feronia limonia,” Phytochemistry, Vol.



16

28, No. 4, 1989, pp.1229-1231.

[8] M. M. Rahman and I. G. Alexander, “Antimicrobial Con-stituents from the Stem Bark of Feronia Limonia,” Phy-tochemistry, Vol. 59, No. 1, January 2002, pp.73-77.

[9] Y. Saima, A. K. Das, K. K. Sarkar, A. K. Sen and P. Sur, “An Antitumor Pectic Polysaccharide from Feronia limo-nia,” International Journal of Biological Macromolecules, Vol. 27, No. 5, August 2000, pp.333-335.

[10] A. A. Rahuman, G. Gopalakrishnan, B. S. Ghouse, S. Arumugam and B. Himalayan, “Effect of Feronia Limo-nia on Mosquito Larvae,” Fitoterepia, Vol. 71, No. 5, September 2000, pp. 553-555.

[11] S. A. Brown, “Biochemistry of the Coumarins. In Recent Advances in Phytochemistry,” In: T. Swain, J. B. Har-borne and. C. F. Van Sumere, Ed., Plenum Press, New York, Vol. 12, 1978, pp. 249-286.

[12] H. G. Floss, “Biosynthesis of Furanocoumarins. In Recent Advances in Phytochemistry,” Proceedings of the 9th Annual Symposium of the Phytochemical Society of North America, V. C. Runeckles and J. E. Watkins, Ed., Appel-ton–Century–Crofts, New York, Vol. 4, 1972, pp. 143-164.

[13] A. Chatterjee and S. S. Mitra, “On the Constitution of the Active Principles Isolated from the Matured Bark of Ae-gle marmelos Correa,” Journal of the American Chemical Society, Vol. 71, February 1949, p.606.

[14] T. Higa and P. J. Scheuer, “Coumarins and Flavones from Pelea Barbigera (Gray) Hillebrand (Rutaceae),” Journal of the Chemical Society-Perkin Transactions, Vol. 1, 1974, pp. 1350-1352.

[15] T. O. Soine, “Naturally Occurring Coumarins & Related Physiological Activities,” Journal of Pharmaceutical Sci-ences, Vol. 3, No. 53, 1964, pp. 231-262.

[16] U. Afek, S. Carmeli and N. Aharoni, “The Involvement of Marmesin in Celery Resistance to Pathogens during Stor-age and the Effect of Temperatures on its Concentration,” Phytopathology, Vol. 85, 1995, pp.1033-1036.

[17] U. Afek, J. Orenstein and N. Aharoni, “The Involvement of Marmesin and Its Interactionwith GA3 and Psoralens in Parsley Decay Resistance,” The Canadian Journal of Plant Pathology, Vol. 24, 2002, pp. 61-64.

[18] T. T. John and G. M. Jocelyn, “Biological Activity of Marmesin and Demethylsuberosin against a Generalist Herbivore, Spodoptera exigua (Lepidoptera: Noctuidae),” Journal of Agricultural and Food Chemistry, Vol. 44, 1996, pp. 2859-2864.

[19] V. Vimal and T. Devaki, “Linear Furanocoumarin Pro-tects Rat Myocardium against Lipid Peroxidation and Membrane Damage during Experimental Myocardial In-jury,” Biomedicine & Pharmacotherapy, Vol. 58, No. 6-7, 2004, pp. 393-400.

[20] K. Arvind, R. K. Tripathi, A. K. Verma, M. M. Gupta and P. S. K. Suman, “Quantitative Determination of Phyllan-thin and Hypophyllanthin in Phyllanthus Species by High- Performance Thin Layer Chromatography,” Phyto-chemical Analysis, Vol. 17, No. 6, 2006, pp. 394-397.

[21] A. Patra, S. K. Mishra and S. K. Chaudhuri, “Constituents of Limonia Acidissima: Applications of Two-Dimen-sional NMR Spectroscopy in Structural Elucidation,” Journal of the Indian Chemical Society, Vol. IXV, 1988, pp. 205-208.

[22] ICH guideline Q2R1, validation of analytical procedures: text and methodology (November 1996/2005) Geneva, Switzerland.



17


Xiaoming Zhang1,2, Chunhai Shi2*, Jianguo Wu2, Shenghai Ye1, Genliang Bao1, Wenchao Yan1

1Institute of Crop Research and Atomic Energy Utilization, Zhejiang Academy of Agricultural Sciences, Hangzhou, People’s Repub-lic of China; 2College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, People’s Republic of China. Email: [email protected] Received August 10th, 2010; revised September 6th, 2010; accepted September 13th, 2010

ABSTRACT

Genetic control of leucine content in indica-japonica hybrid rice (Oryza sativa L.) was studied in 35 crosses of F1 and F2 generations, which were derived from crossing 7 male sterile indica rice lines with 5 restorer japonica rice lines along with their parents. Two genetic models and their corresponding statistical methods for quantitative traits of trip-loid seeds in cereal crops were used for the analysis. The first was the unconditional genetic model, which refers to the analysis of cumulative measurements ( f rom flowering to a specific time) along the developmental stages, while the sec-ond was the conditional genetic model, which relates to analysis from one developmental stage to another stage (t - 1→t). The results showed that leucine content of indica-japonica hybrid rice was controlled by the expression of triploid endosperm effect (endosperm additive effect and endosperm dominant effect), cytoplasm effect, diploid maternal plant effect (maternal additive effect and maternal dominant effect) and their environmental interaction effects. Of these ef-fects, endosperm dominant effect and maternal dominant effect were more important at the earlier stages, while en-dosperm additive effect and maternal additive effect were more important at the later stages of rice grain development under both unconditional and conditional genetic analyses. Due to the high heritabilities, which came from endosperm, maternal and cytoplasm effects for leucine content at different developmental stages, selection for leucine content of indica-japonica hybrid rice would be more efficient at early generations in breeding programs. Keywords: Indica-Japonica Hybrid Rice, Developmental Genetics, Quality, Leucine Content, Genetic Variance,

Conditional Genetic Variance, Heritability

1. Introduction

The use of indica-japonica F1 hybrids offers a way of co- mbining the best attributes of both types. Advantages of these hybrids include strong tillering ability, thick culms and larger panicles. However, some disadvantages have also been noted, such as longer growing duration, greater plant height and reduced spikelet fertility. Recently, significant progress has been made in improving agronomic traits in an indica-japonica hybrid breeding project [1] and breeders are now paying greater attention to improv-ing rice grain quality traits.

In most reports, phenotypic values measured at ma-turity are used when analyzing rice quality traits [2-7], but this does not provide information on the develop-mental processes of these traits. Although recent quan-titative trait analysis software makes developmental genetic analysis possible [8], the literatures are limited

to indica rice apparent quality and milling quality [9-11]. A little information on nutrition of indica-japonica hy-brid rice has been reported, especially for amino acids. One reason for the lack of information is the difficulty in obtaining a significant quantity of F1 seeds for analysis due to incompatibility between the indica and japonica rice subspecies when crossed. Some japonica wide compatible restorers developed by our projects make this genetic analysis in indica-japonica hybrid rice pos-sible.

Leucine (C6H13NO2) is a neutral, genetically coded essential amino acid in human nutrition, which is very important in human health. The expression of genes for leucine content at different grain-filling stages is yet to be understood. Understanding the dynamics of gene ex-pression for leucine content in contrasting environments may prove helpful for future improvements in the nutri-tional quality of rice. The objective of this study was to clarify the developmental behavior of leucine content *corresponding author



18

gene expression in indica-japonica hybrid rice. The developmental dynamic expression mechanism and the heritability components from different genetic systems were estimated by unconditional and conditional genetic models.


2.1. Plant Material

Seven indica cytoplasmic male sterile lines (A lines) (Zhe 38, Xieqingzao, K17, Zhenshan 97, Zhenong 8010, Jin 23 and Ⅱ-32) and their maintainers (B lines), and 5 japonica wide compatible restorers (R lines) (T 748, T 42, R 1252, Linhui 422 and Zhong 9308) with significant variation in leucine contents were used in this experiment (Table 1).

2.2. Field Experiment

F1 seeds were obtained by crossing female A lines to male R lines (A R) using a factorial design. The F1s and their parents were sown at the experimental farm, Zhejiang Academy of Agricultural Sciences, China. After 25 days, seedlings were individually transplanted at a spacing of 20 26 cm. There were 36 plants in each plot and two replications. A second experiment was conducted 7 months later using the same methods to provide contrasting environmental conditions at Hainan province, China. Se- eds from parental lines and F2 seeds from F1 plants were collected at 7-, 14-, 21-, 28- and 35-day after flowering from the central 16 plants within each plot. The F1 plants resulted from A × R crosses. The grain-filling period was

devided into stages, the initial stage (1-7days after flow-ering), early stage (8-14days), middle stage (15-21days), late stage (22-28 days) and ripe stage (29-35days).

2.3. Leucine Content Analysis

All seed hulls of F1s, F2s and their parents were removed using a Yanmar ST50 dehuller from Japan, then milled using a sample miller (model JB-20, Zhejiang province, China). Samples were further ground to 100 mesh with a cyclone grinder (model 3010-019, Fort Collins, Colorado, USA). Leucine content was determined using the amino acid analysis method described by Wu et al. [12] with two replications for each sample.

2.4. Statistical Method

Two developmental genetic models, the unconditional genetic model [13] and the conditional genetic model [8], for quantitative traits of endosperm in cereal crops were used to estimate the variance components for ge-netic main effects and genotype- environmental interac-tion effects at different grain-filling stages. For the un-conditional genetic analysis, which refers to the analy-sis of cumulative measurements through progressive developmental stages, the genetic effects were defined as accumulated effects of genes expressed from flow-ering (0) to a particular time (t). The variance compo-nents were divided into endosperm additive variance (VA), endosperm dominance variance (VD), cytoplasmic variance (VC), maternal additive variance (VAm), maternal

Table 1. Leucine content (%) of 12 parents at five different developmental stages.

Parent Initial stage Early stage Middle stage Late stage Ripening stage

Female group

Zhe38 1.113a 1.122a 1.274a 1.203ab 1.083ab

Xieqingzao 0.769b 0.805d 0.921cd 0.926bc 0.781e

K17 0.788b 0.751d 0.906cd 0.934bc 0.867cde

Zhenshan97 0.984ab 0.966bc 1.097abc 1.198ab 0.951bcd

Zhenong8010 0.738b 0.872cd 0.849d 1.021abc 0.743e

Jin23 1.008ab 1.019ab 1.186ab 1.271a 1.120a

II-32 0.723b 0.757d 0.860cd 0.991abc 0.891cde

Standard deviation 0.156 0.142 0.171 0.143 0.142

Male group

T748 0.748b 0.843cd 0.838d 0.875bc 0.860cde

T42 1.029ab 1.041ab 1.070abcd 1.080abc 0.959bc

R1252 0.852ab 0.829d 0.947bcd 1.024abc 0.824cde

Linhui422 0.871ab 0.820d 0.935cd 0.940bc 0.807de

Zhong9308 0.734b 0.771d 0.838d 0.863c 0.957bcd

Standard deviation 0.119 0.104 0.096 0.094 0.073

a,b,c,d,e denote significance at 0.05 probability level.



19

dominance variance (VDm), and their endosperm additive environment interaction variance (VAE), endosperm dominance interaction variance (VDE), cytoplasm interaction variance (VCE), maternal additive interaction variance (VAmE) and maternal dominance interaction variance (VDmE), and residual variance (Ve). Since some endosperm genes were derived from maternal plants, there were possible covariances between endosperm effects and maternal effects including additive covariance CA.Am, dominance covariance CD.Dm, additive interaction covariance CAE.AmE, and dominance interaction covariance CDE.DmE. The partitioning for the phenotypic variance (VP(t)) was:

2( ) 2( )

P A D C Am Dm AE DE CE AmE DmE

A Am D Dm AE AmE DE DmE e

V V V V V V V V V V V

C C C C V

For the conditional genetic analysis, which refers to grain analysis within each stage, the conditional developmental genetic models could be used to estimate conditional variances during rice grain filling periods (t – 1→t) for leucine content. These conditional variance components were VA(t | t - 1) (conditional endosperm additive variance), VD(t | t - 1) (conditional endosperm dominance variance), VC(t | t - 1) (conditional cytoplasmic variance), VAm(t | t - 1) (conditional maternal additive variance), VDm(t | t - 1) (conditional maternal dominance variance), VAE(t | t - 1) (conditional endosperm additive interaction variance), VDE(t | t - 1) (conditional endosperm dominance interaction variance), VCE(t | t - 1) (conditional cytoplasm interaction variance), VAmE(t | t - 1) (conditional maternal additive interaction variance), VDmE(t | t - 1) (conditional maternal dominance interaction variance), CA.Am(t | t - 1) (conditional additive covariance), CD.Dm(t | t - 1) (conditional dominance covariance), CAE.AmE(t | t - 1) (conditional additive interaction covariance), CDE.DmE(t | t - 1) (conditional dominance interaction covariance) and Ve(t | t - 1) (conditional residual variance). The partitioning for the conditional phenotypic variance (VP(t | t - 1)) was:

)1()1()1(

)1()1()1(

)1()1()1()1(

)1()1()1()1()1()1(

)(2

)(2

ttettDmEDEttAmEAE

ttDmDttAmAttDmE

ttAmEttCEttDEttAE

ttDmttAmttCttDttAttP

VCC

CCV

VVVV

VVVVVV

Heritabilities ( 2h ) can be further divided into general heritability ( 2

Gh ) and environment interaction heritability ( 2

GEh ) by unconditional genetic analysis. The general heritability ( 2

Gh ), which was controlled by genetic main effects, could be further divided into endosperm general heritability ( PAmAAGo VCVh )(2

), cytoplasm heritabil-ity ( PCGc VVh 2 ) and maternal general heritability ( 2

Gmh

PAmAAm VCV )( ). The interaction heritability ( 2GEh ),

which was controlled by genotype environmental interaction effects, also could further be divided into endosperm environment interaction heritability ( AEGoE Vh (2

PAmEAE VC /) ), cytoplasmic environment interaction heritability ( PCEGcE VVh 2 ) and maternal environment interaction heritability ( PAmEAEAmEGmE VCVh )(2

). The partitioning for the total narrow-sense heritability was:

)()( 222222222GmEGcEGoEGmGcGoGEG hhhhhhhhh

The Jackknife re-sampling method was used by sam-pling generation means of entries for estimating standard errors of variances components, covariance and herita-bilities [14-15].

3. Results

3.1. Difference of Leucine Content in Parents and their Descendants

There was significant variation for leucine content both in female parents and in male parents at five different filling stages (Table 1). Of the A lines, Zhe38 and Jin23 had high leucine content at the initial stage, while of the B lines, T42 had the highest leucine content at the initial stage. Zhenong 8010 and T748 were developed quickly than others at early filling stage, Xieqingzao, Zhen-shan97, R1252 and Linhui422 were developed faster at middle filling stage. All the parents except Zhong 9318 reached their highest level of leucine content at the late grain-filling stage, and the results showed that Jin23 was the highest (1.271%) and K17 was the lowest (0.934%). At the ripe stage, leucine content of Jin 23 was signifi-cant high than that of II-32, K17, T748, R1252, Linhui 422, Xieqingzao and Zhenong 8010 (Table 1).

The mean leucine contents of indica-japonica hybrids of females, males and their F1 and F2 descendants are shown in Figure 1. There were continuous increases after

0.6

0.7

0.8

0.9

1.0

1.1

LC %

7d 14d 21d 28d 35d

Female Male F1 F2

Figure 1. Leucine contents of 4 generations at five different filling stages.



20

flowering until the late stage and the mean values for these four stages were 0.858, 0.899, 1.013 and 1.078% for females, and 0.844, 0.865, 0.925 and 0.958% for males, respectively. Leucine content decreased to 0.920 and 0.890% at the ripe stage, respectively. At all grain-filling stages leucine content of female parents was higher than that of the male parents. In both groups of females and males, the highest leucine content level was observed at the late developmental stage. The leucine contents of F1s were 1.094, 0.978, 1.052, 1.073 and 1.092%, while those of F2 were 0.947, 0.926, 1.022, 1.070 and 0.960%, respectively. Heterosis for leucine content was observed in both F1 and F2, but F1 heterosis was stronger than F2, due

to the segregation among F2 plants.

3.2. Unconditional Genetic Analysis for Leucine Content at Different Filling Stages

Table 2 shows parameters generated by the unconditional genetic model of developmental genetics and corresponding statistical analysis for quantitative trait cumula-tive effects in cereal crops [13]. This analysis showed that leucine content of indica-japonica hybrid rice was controlled by genetic main effects as well as by genotype environmental interaction effects at five different fill-ing stages. Compared with genetic main effects (VG = VA + VD +VC +VAm + VDm), leucine content was mainly con-trolled by genotype environmental interaction effects (VGE = VAE + VDE + VCE + VAmE + VDmE) at 7th, 14th, 21st and 35th day after flowering and the VGE were accounted for 74.87, 93.44, 93.79 and 61.23% of total genetic vari-

ance (VGE / (VG + VGE)), respectively. However, the fourth developmental stage (late stage, 28th day after flowering) was mainly controlled by the genetic main effect. In summary, leucine content was controlled by both genetic main effects and their genotype environ-mental interaction effects at all filling stages, but was mainly controlled by their interaction effects in all but the late stage.

Among genetic main effects, there were endosperm dominant effect and maternal additive effect at the initial stage, maternal dominant effect at early stage, endosperm dominant effect at middle stage, endosperm additive effect, cytoplasmic effect, maternal additive effect and ma-ternal dominant effect at late stage, and endosperm additive effect, endosperm dominant effect and maternal addi-tive effect at ripe stage. All genotype environmental interaction effects were significant, except for the additive interaction effects at middle stage and additive interaction effect and maternal additive interaction effects at late stage.

Table 2 also showed that leucine content was mainly controlled by additive effects both in genetic main effect and in their genotype environmental interaction effects. It accounted for 97.89% ((VA + VAm) / (VA + VAm + VC+ VD + VDm)) and 60.91% ((VAE + VAmE) / (VAE + VAmE + VCE + VDE + VDmE)) of the variance at ripe stage, respectively. This means that selection will be effective in early generations because additive effects can be fixed during subsequent inbreeding. There was no relationship detected between the expression of endosperm and maternal genes

Table 2. Estimates of unconditional variance components at different developmental stages for leucine content in indica-japonica rice.

Developmental time (days after flowering) Parameter

7d 14d 21d 28d 35d

VA 0.000 0.000 0.000 7.710 ** 12.830 **

VD 2.597 ** 0.000 1.841 ** 0.000 0.286 **

VC 0.000 0.000 0.000 6.839 ** 0.000

VAm 11.825 ** 0.000 0.000 13.169 ** 13.000 **

VDm 0.000 3.509 ** 0.000 2.029 ** 0.000

VAE 14.306 ** 12.496 ** 0.000 0.000 9.037 **

VDE 3.223 ** 3.086 ** 2.282 ** 2.587 ** 3.440 **

VCE 6.346 ** 8.549 ** 9.940 ** 4.032 ** 8.416 **

VAmE 14.762 ** 21.192 ** 12.082 ** 0.000 16.079 **

VDmE 4.330 ** 4.689 ** 3.516 ** 3.042 ** 4.265 **

CA•Am 0.000 0.000 0.000 -4.559 -2.177

CD•Dm 0.000 0.000 0.000 0.000 0.000

CAE•AmE 1.695 -10.410 0.000 0.000 2.263

CDE•DmE -0.650 0.011 0.028 -0.330 -0.059

Ve 0.440 ** 0.668 ** 0.553 ** 0.467 ** 0.272 **

** significant at 0.01 probability level.



21

since the genetic main covariances (CA.Am or CD.Dm) and genotype environmental interaction covariances (CAE•AmE or CDE•DmE) between the endosperm and maternal effects were not significant. Leucine content may be influenced by sampling errors according to the significant residual variances (Ve). But, in comparison with other genetic parameters, the values of Ve were lower.

3.3. Conditional Genetic Analysis for Leucine Content at Different Filling Stages

The genetic variances estimated by unconditional genetic analysis revealed accumulated genetic effects which were expressed from flowering to time t (0→t), and the results could not clarify gene expression at each special developmental stage (t – 1→t). Therefore, conditional genetic analysis was used to clearly explain the dynamic gene expression at each filling stage (t – 1→t).

Table 3 shows the parameters generated by the condi-tional genetic model of developmental genetics and cor-responding statistical analysis for quantitative trait perio- dical effects of triploid in cereal crops [8]. There was no detection of new gene expression for conditional en-dosperm additive main effects (VA (7|0), VA (14|7) and VA

(21|14)) from initial- to middle-filling stages, conditional maternal additive main effects (VAm(14|7) and VAm(21|14)) at early- and middle-filling stages, conditional endosperm dominant main effects (VD(21|14) and VD(28|21)) at middle-

and late-stages, conditional maternal dominant main effects (VDm(7|0) and VDm(28|21)) at initial- and late-filling stages and conditional cytoplasmic main effects (VDm(7|0) and VC(35|28)) at initial- and ripe stages, since the condi-tional genetic main variances at these filling stages were not significant in this experiment. The unconditional ma-ternal dominant main effect at late filling stage in Table 2 might be due to the dominant effect expressed at the former stage, i.e. at middle stage (14-21 days after flow-ering), and then continual expression from activated genes at this stage. Similarly, the endosperm dominant main effect was significant at 21 days after flowering by unconditional genetic analysis, but was not significant using conditional genetic analysis. In contrast, conditional maternal dominant effects at the ripe stage were found by conditional genetic analysis, but not found by unconditional genetic analysis in Table 2. This may reflect inter-ruption of gene expression during different filling stages or the gradual activation of quantitative genes through the filling period(s). It may also indicate that there were differences in regulation of gene expression in triploid endosperm, cytoplasm and diploid maternal plant genetic systems. These results were not detected by the uncondi-tional genetic variance analysis.

For the conditional interaction analysis, new genetic effects from gene expression was not detected for the con-

Table 3. Estimates of conditional variance components for leucine content at different developmental stages in indica-japonica rice.

Developmental stage of grain (t|t-1) Parameter

7d|0d 14d|7d 21d|14d 28d|21d 35d|28d

VA (t|t-1) 0.000 0.000 0.000 4.324 ** 9.703 **

VD (t|t-1) 2.597 ** 4.700 ** 0.000 0.000 1.279 **

VC (t|t-1) 0.000 7.137 ** 3.621 ** 2.848 ** 0.000

VAm (t|t-1) 11.825 ** 0.000 0.000 9.158 ** 6.559 **

VDm (t|t-1) 0.000 3.277 ** 6.975 ** 0.000 1.076 **

VAE (t|t-1) 14.306 ** 13.463 ** 10.171 ** 0.000 8.072 **

VDE (t|t-1) 3.223 ** 0.000 4.543 ** 2.809 ** 2.503 **

VCE (t|t-1) 6.346 ** 0.000 0.000 0.000 0.000

VAmE (t|t-1) 14.762 ** 7.358 ** 3.852 ** 0.000 11.931 **

VDmE (t|t-1) 4.330 ** 6.009 ** 0.000 2.290 ** 3.941 **

CA•Am (t|t-1) 0.000 0.000 0.000 -2.819 -8.654

CD•Dm (t|t-1) 0.000 -0.080 0.000 0.000 3.889 **

CAE•AmE (t|t-1) 1.695 -46.510 -2.301 0.000 2.404

CDE•Dm E(t|t-1) -0.650 0.000 0.000 -0.436 -0.290

Ve(t|t-1) 0.440 ** 0.738 ** 0.794 ** 0.413 ** 0.257 **

** was significant at 0.01 probability level.



22

ditional endosperm additive interaction effect (VAE

(28|21)), conditional maternal additive interaction effect (VAmE (28|21)) at late filling stage, conditional endosperm dominant interaction effect (VDE(14|7)) at early stage, conditional maternal dominant interaction effect (VDmE

(21|14)) at middle stage and conditional cytoplasm interac-tion effect (VCE (14|7), VCE (21|14), VCE (28|21) and VCE (35|28)) at early-, middle- and ripe-stage. The VDE at early stage, VDmE at middle stage and VCE at early-, middle- and ripe-stage were significant using the unconditional ge-netic analysis in Table 2, but were not significant using the conditional genetic analysis in Table 3. It is likely that there was continual expression of activated genes at these stages.

There was significant positive conditional dominant interaction covariance (CD•Dm(35\28)=3.889**) at ripe stage, which showed that the new expression for dominance effect from endosperm nuclear genes was closely related with that from maternal nuclear genes at the ripe stage. Significant conditional residual variances (Ve(t|t-1)) showed that new expression of genes for leucine content at the ripe stage could be influenced by sampling errors, but these values were lower than the genetic variances.

3.4. Estimation of Heritability at Different Filling Stages

The results in Table 4 showed that general heritability components from cytoplasm and endosperm were not significant at first three stages, but were significant at the next two developmental stages for endosperm and the fourth stage for cytoplasm, while their interaction heritabil-ity components were all significant except for endosperm interaction heritabilities at middle- and late-stage. Ma-ternal general heritabilities were significant except for early- and middle-stage and its interaction heritabilities except for late filling stage. The interaction heritabilities including endosperm, maternal and cytoplasm interaction heritabilities were larger than their general heritability components at the first three stages and the last filling st-

age, i.e. initial-, early-, middle- and ripe stage, while general heritability was larger than the interaction herita-bility at late filling stage. The total narrow sense herita-bility values ( 2h ) at most filling stages for leucine con-tent were over 75% (h(7d)=84.50, h(14d)= 64.14, h(21d)= 72.75, h(28d)= 75.20 and h(35d)= 87.97%). The general heritabilities were 19.70, 0.00, 0.00, 61.80 and 31.73% and interaction heritabilities were 64.80, 64.14, 72.75, 13.40 and 56.23%, respectively. With regard to the components of heritability, maternal and cytoplasm gen-eral heritabilities and interaction heritabilities were more important for leucine content ( 2222

GcEGmEGcGm hhhh = 57.80, 57.89, 72.75, 75.20 and 55.53%, respectively) in this experiment. These data suggest that improving leu-cine content would be more efficient when selection is based on maternal plants in early indica-japonica gen-erations.

4. Discussion

The genetic behavior of rice quantitative traits is simulta- neously controlled by endosperm, maternal and cytoplasm effects. Genes controlling the performance of complex quantitative traits, were expressed at various times during different developmental stages [8-10]. Analysis for quantitative traits has been gradually emphasized in developmental genetics.

This research revealed that gene expression varied during most filling stages in endosperm, cytoplasm and maternal genetic systems across environments. Leucine content was mainly controlled by additive effects, maternal effects and cytoplasmic effects, both by variance analysis and by heritabilities analysis. This means that selection for leucine content would be more efficient at early gen-erations in a rice breeding program. The results of condi-tional genetic variance analysis for leucine content fur-ther indicated that there was a phenomenon of interval expression for some genes among rice filling stages. For example, the conditional genetic analysis, found a sig-nificant maternal additive effect at the initial stage, which was non-significant at the early- and middle- stage, but

Table 4. Estimates of heritability components (%) for leucine content at different developmental stages in indica-japonica rice.

Heritability Parameter

7d 14d 21d 28d 35d 2

Goh 0.000 0.000 0.000 10.470 15.740 2

Gch 0.000 0.000 0.000 22.724 ** 0.000 2

Gmh 19.700 ** 0.000 0.000 28.608 ** 15.992 + 2

GoEh 26.700 6.249 0.000 0.000 16.697 * 2

GcEh 10.600 25.603 ** 32.837 ** 13.397 ** 12.435 * 2

GmEh 27.500 32.289 ** 39.914 ** 0.000 27.101 **

+, * and ** denote significance at 0.10, 0.05 and 0.01 probability levels, respectively.



23

was again significant at the late- and ripe- stage.

Genotype environment interaction effects including endosperm additive and dominant interaction effects, maternal additive and dominant interaction effect, and cyto-plasmic interaction effects were found at most filling stages by both unconditional genetic analysis and condi-tional genetic analysis but cytoplasmic interaction effect in this study. Significant genotype environment interaction effects also indicated that the sequential expression of genes from endosperm, cytoplasm and maternal genetic systems was also influenced by the environmental conditions. The genotype environment interaction effect was the main cause of genetic differences across envi-ronments. It is necessary to consider the variation of rice quantitative traits in different environments because of the varied climatic conditions to which rice is exposed.

The genetic models and statistical analysis methods used in this experiment, which include genetic main effects and genotype environment interaction effects, can be analyzed with only three generations, such as parents, F1 and F2 at different filling stages across a range of en-vironments. Evidence of varying gene expression for leucine content during grain filling in rice serves to under-score the need to study developmental behavior of gene expression for important quantitative traits in other cereal crops.

5. Acknowledgements

The project was supported by the Science and Technol-ogy Office of Zhejiang Province, China (No. 2008C14071 and 011102471), Zhejiang Provincial Natural Science Foundation of China, 151 Foundations for the Talents of Zhejiang Province and the Exchange Program of Friend-ship between Zhejiang Government of China and Fukui of Japan.

REFERENCES [1] W. Q. Dong, S. H. Shi and Y. J. Dong, “Breeding and

Utility of a New Hybrid Rice Xieyou9516,” Zhejiang Ag-ricultural Science, Vol. 5, No. 5, 1999, pp. 211-213.

[2] J. S. Chauhan, V. S. Chauhan and S. B. Lodh, “Environ-ment Influence on Genetic Parameters of Quality Com-ponent in Rainfed Upland Rice,” Indian Journal of Agri-cultural Science, Vol. 62, No. 5, 1992, pp. 773-775.

[3] K. F. Osato, Y. Hamachi and Y. Matsue, “Genotype Environment Interaction of Palatability in Rice,” Japa-nese Journal of Crop Science, Vol. 65, No. 5, 1996, pp. 585-589.

[4] C. H. Shi, J. M. Xue, Y. G. Yu, X. E. Yang and J. Zhu, “Analysis of Genetic Effects for Nutrient Quality Traits in Indica Rice,” Theoretical and Applied Genetics, Vol. 92, No. 8, 1996, pp. 1099-1102.

[5] C. H. Shi, J. Zhu, X. E. Yang, Y. G. Yu and J. G. Wu, “Genetic Analysis for Protein Content in Indica Rice,” Euphytica, Vol. 107, No. 2, 1999, pp. 135-140.

[6] Y. F. Tan, J. X. Li and C. G. Xu, “Genetic Bases of Ap-pearance Quality of Rice Grains in Shanyou 63, an Elite Rice Hybrid,” Theoretical and Applied Genetics, Vol. 101, No. 5-6, 2000, pp. 823-829.

[7] C. W. Xu, A. H. Zhang and Q. S. Zhu, “Genetic Analysis of Quality Traits in Rice Crosses between Indica and Ja-ponica,” Acta Agronomica Sinica, Vol. 22, No. 5, 1996, pp. 530-534.

[8] J. Zhu, “Analysis of Conditional Genetic Effects and Variance Components in Developmental Genetics,” Ge-netics, Vol. 141, No. 4, 1995, pp. 1633-1639.

[9] C. H. Shi, J. G. Wu and P. Wu, “A Developmental Be-havior of Gene Expression for Brown Rice Thickness under Different Environments,” Genesis, Vol. 33, No. 4, 2002, pp. 185-190.

[10] C. H. Shi, J. G. Wu, X. B. Lou, J. Zhu and P. Wu, “Ge-netic Analysis of Transparency and Chalkiness Area at Different Filling Stages of Rice (Oryza sativa L.),” Field Crops Research, Vol. 76, No. 1, 2002, pp. 1-9.

[11] C. H. Shi, J. G. Wu, X. M. Zhang and P. Wu, “Develop-mental Analysis on Genetic Behavior of Brown Rice Re-covery in Indica Rice across Environments,” Plant Sci-ence, Vol. 163, No. 3, 2002, pp. 555-561.

[12] J. G. Wu, C. H. Shi and X. M Zhang, “Estimating the Amino Acid Composition in the Milled Rice Powder by Near-Infrared Reflectance Spectroscopy,” Field Crops Research, Vol. 75, No. 1, 2002, pp. 1-7.

[13] J. Zhu and B. S. Weir, “Analysis of Cytoplasm and Ma-ternal Effects: II. Genetic Models for Triploid Endospe- Rms,” Theoretical and Applied Genetics, Vol. 89, No. 2-3, 1994, pp. 160-166.

[14] R. G. Miller, “The Jackknife- A review,” Biometrika, Vol. 61, No. 1, 1974, pp. 1-15.

[15] J. Zhu and B. S. Weir, “Diallel analysis for sex-linked and maternal effects,” Theoretical and Applied Genetics, Vol. 92, No. 1, 1996, pp. 1-9.




Airong Liu1, Shuangchen Chen1*, Yinfa Mi1, Zhou Zhou1, Golam Jalal Ahammed2

1College of Forestry, Henan University of Science and Technology, Luoyang, P.R. China; 2College of Horticulture, Bangladesh Agricultural niversity, Mymensingh , Bangladesh. Email: *[email protected] Received June 2nd, 2010; August 2nd, 2010; September 13th, 2010

ABSTRACT

The changes of antioxidant enzyme activities and related genes expression of tomato seedlings were evaluated under hypoxia stress with different levels of Mn2+. Activities of superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxide (APX), glutathione reductase (GR), catalase (CAT), the contents of H2O2, ascorbic (AsA) and malondialde-hyde (MDA) were studied to investigate how active oxygen damaged the membrane lipid under hypoxia stress. With 10-200 μmol·L-1 Mn2+, the activities of SOD, POD, APX, GR and the contents of H2O2, AsA, MDA of leaves and roots increased significantly, which indicated that low Mn2+ could eliminate the active oxygen and protect the membrane lipid from hurt. But the activities of catalase (CAT) decreased evidently in the root. When the concentration of Mn2+ reached 400-600 μmol·L-1 under hypoxia stress, the activities of SOD, POD, APX, GR and ASA content decreased remarkably. However, the contents of H2O2 and MDA increased contrarily. A series of resistance genes level achieved peak value with 10 µmol·L-1 Mn2+. The expression level of SOD, CAT, APX, POD, GR were 6.28, 2.19, 5.66, 5.21 and 6.79 times compared to control respectively. These results illustrated appropriate amount of Mn2+ could reduce the damage of active oxygen under hypoxia stress, but reversely, high level of Mn2+ just aggravated the already serious damage to the tomato seedlings. Keywords: Tomato, Hypoxia Stress, Mn2+, Antioxidant Enzyme

1. Introduction

Manganese (Mn) is an essential trace element for plant systems. It is involved in photosynthesis, respiration and activation of several enzymes including superoxide dismutase, NADPH-specific decarboxylating malate dehydro- genase and nitrate reductase [1]. The availability of manganese (Mn) to plants is governed by redox proc-esses, which depend on soil Mn reserve, pH and the availability of electrons [2].

However, the presence of Mn at higher concentrations retards plant growth and development by interfering with metabolic processes [3,4], and consequently it represents an important factor in environmental contamination with various phytotoxic effects. But during plant cultivation, lack of oxygen or anoxia is a common environmental ch- allenge which plants have to face throughout their life. Winter ice encasement, seed imbibition, spring floods and excess of rainfall are examples of natural conditions lea- ding to root hypoxia or anoxia. Hypoxia occurs when the decomposition gives rise to water oxygen concentrations

less than 2 ml·L-1 [5]. Due to lack of oxygen, the reduction potential and pH

will become much lower around the root-zoon of plants. On the one hand, under this reducing conditions, Mn4+ will be deoxygenized to Mn2+, which is the most form of manganese absorbed by plants in the soil. If the anoxic soil keep this low reducing and pH conditions for a long time, Mn2+ will be accumulated to a high concentration, which lead to serious acidification of soil and result in increasing available Mn concentration [6] and Mn toxicity to plants maybe occur. It has been reported that excess Mn disturbs the metabolism of plants and inhibit the plant growth [7-9]. Mn in excess inhibit respiration, affect negatively nitrogen and protein metabolism, cause a reduction of chlorophyll contents and inhibit some photosynthetic functions in leaves [10]. As Mn is essential micronutrients imported actively in the chloroplasts, par- ticipating in the structure of different photosynthetic proteins and enzymes, the excess of Mn seems to be particularly damaging to chloroplasts. Some studies have indicated that excess Mn causes deficiency of Fe, Mg



25

and Ca [11,12] and induces inhibition of chlorophyll biosynthesis and a decline in the photosynthetic rate [13,14].

Research indicates that the degree of cell damage un-der heavy metal stress depends on the rate of ROS formation and on the efficiency and capacity of detoxification and repair mechanisms. ROS were partially reduced forms of atmospheric oxygen and under normal conditions their production in cells was low and tightly controlled

[15]. Stress that disrupts the cellular homeostasis, including heavy metal toxicity, can enhance the production of ROS and increase the steady-state level of H2O2 up to 30-fold [16]. The degree of cell damage under heavy metal stress depends on the rate of ROS formation and on the efficiency and capacity of detoxification and repair mechanisms. Many other proteins require metal ions for their catalytic activities and contain metal binding sites making these enzymes highly susceptible to site specific metal-catalyzed oxidation. Any system capable of producing H2O2 and of reducing Fe3+ or Cu2+ can provoke this type of oxidative modification and convert some amino acid residues to carbonyl derivates [17]. This mechanism of oxidative damage could be relevant with Cu and Mn toxicity. Metal-catalyzed oxidation of proteins has been implicated in the marking of proteins for subsequent proteolytic degradation [18].

Tomato (Solanum lycopersium Mill.) plants are very sensitive to water flooding or excess of rainfall, which can easily produce root-zoon hypoxia stress and reducing conditions. So Mn toxicity is incidental to the tomato plants during growing season. Previous researches had mainly focused on plant growth and chlorophyll fluorescence in plants [12]. However, little work has been done to determine the antioxidant enzyme activity and related genes expression.

The objectives of this study were to identify changes in activities of SOD, POD, CAT, APX, GR and their gene expressions, along with the contents of ASA, H2O2 and MDA in tomato seedlings leaves and roots under hypoxia stress with different level of Mn2+.

2. Material and Methods

2.1. Plant Materials and Treatment Conditions

The experiments were carried out in a greenhouse of He- nan University of Science and Technology. Tomato seeds (S. lycopersium Mill. cv. Zhongza 9) were sown in growth medium containing a mixture of peat and vermicu-lite (7:3, v:v) in trays. When the first true leaf fully ex-panded, groups of eight seedlings were transplanted into a container (40 cm × 25 cm × 15 cm) filled with Hoagland nutrient solution. When the seedlings reached 5 leaves, they were transferred to 10 L plastic pots con-taining aerated full nutrient solution, six seedlings per pot,

pH was maintained close to 6.5 by adding diluted H2SO4 or KOH.

After 7 days of pre-culture, the plants were treated with 10 μM Mn2+ concentration (normal Mn2+) and 200 μM, 400 μM, 600 μM Mn2+ concentration (excess Mn2+) (su- pplied with MnSO4) and two level of dissolved oxygen (DO) with about 8.0-8.5 mg·L-1 at a normal level and about 0.9-1.1 mg·L-1 at a low level.

The experiments seedlings were subjected to hypoxia by flushing nutrient solution with N2 gas for 10 days. The nutrient solution of control plants was continuously flu- shed with air with an air pump. Oxygen concentration in the vessels was monitored with an oxygen meter.

The normal DO (8.0-8.5 mg·L-1) was an optimum intensity and the low DO (0.9-1.1 mg·L-1) was suboptim- um intensity for plant growth. The experiment had eight treatments: Mn2+ 10 μM + normal DO; Mn2+ 200 μM + normal DO; Mn2+ 400 μM + normal DO; Mn2+ 600 μM + normal DO; Mn2+ 10 μM + low DO; Mn2+ 200 μM + low DO; Mn2+ 400 μM + low DO; Mn2+ 600 μM + low DO. The experiment was arranged as a randomized, complete block design with four replicates, giving a total 64 pots. The growth conditions were as follows: photoperiod of 14/10 h (day/night), temperature of 25/17˚C (day/night), and photosynthetic photon flux density (PPFD) of 600 µmol m-2 s-1.

The youngest fully developed leaves and tender roots were rinsed carefully in water, dried with filter paper and used either immediately or frozen in liquid nitrogen for assays of antioxidant enzymes. ASA, H2O2 and MDA contents were measured as soon as symptoms were extre- mely evident.

2.2. Determination of MDA and H2O2 Contents in Leaves

The thiobarbituric acid (TBA) test, which determines ma- lonaldehyde (MDA) as an end-product of lipid peroxida-tion in the leaves, was used to measure MDA. Leaves were homogenized and centrifuged in a potassium phos-phate buffer (pH 7.8) for 20 min at 12,000 g, with 1 ml of the supernatant incubated in boiling water for 30 min. The tubes were placed in an ice bath to stop the reaction, after which the samples were centrifuged at 1500 g for 10 min and the absorption was read at 532 nm. The value for nonspecific absorption at 600 nm was measured sim- ultaneously and then subtracted from OD532. The extinc-tion coefficient of 155 mM cm–1 was used to calculate the amount of the MDA-TBA complex.

The concentration of H2O2 in leaves was measured by monitoring the absorbance of the titanium-peroxide complex at 415 nm, using the method of Brennan and Frenkel

[19]. Absorbance values were quantified using a standard curve generated from known concentrations of H2O2.



26

2.3. Enzyme Extraction and Activity Assay

For the enzyme assays, 0.3 g of leaf were ground with 3 ml ice-cold 25 mM HEPES buffer (pH 7.8) containing 0.2 mM EDTA, 2 mM AsA and 2% PVP. The homoge- nates were centrifuged at 4˚C for 20 min at 12,000 g and the resulting supernatants were used for the determination of enzymatic activity. A photochemical method pub-lished by Giannopolitis and Ries [20] was used to deter-mine superoxide dismutase (SOD). One unit of SOD activity was defined as the amount of enzyme required to cause a 50% inhibition in the rate of p-nitro blue tetra-zolium chloride reduction at 560 nm. Catalase (CAT) was measured in a reaction mixture containing 25 mM phosphate buffer (pH 7.0), 10 mM H2O2, and the enzyme. The decomposition of H2O2 was determined at 240 nm (E = 39.4 mM cm–1) [21].

APX activities were measured by a decrease in absorbance at 290 nm and an increase in absorbance at 265 nm according to Nakano and Asada [22]. Glutathione re-ducetase (GR) activity was measured according to Foyer and Halliwell [23], which depends on the rate of decrease in the absorbance of NADPH at 340 nm.

All data presented were the mean values of four replicates and were analyzed by Duncan’s multiple new range tests using Origin Pro 7.5 and SAS software.

2.4. RNA Extraction and RT-PCR for Gene Expression Analysis

Total RNA was isolated from eggplant leaves with 0.3% using TRIZOL reagent (Invitrogen) according to the ma- nufacturer’s instruction. Genomic DNA was removed

with RNeasy Mini Kit (Qiagen). The cDNA used as template for RT-PCR was synthe-

sized using a RevertAidTM first strand cDNA Synthesis Kit (Fermentas) from 2 μg purified RNA. On the basis of mRNA or EST sequences, the gene-specific primers were shown in Table 1 and used for amplification.

Quantitative real time PCR was performed using the iCycler iQTM Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). PCRs were performed using the SYBR Green PCR Master Mix (Applied Biosystems). The PCR conditions consisted of denaturation at 95˚C for 3 min, followed by 40 cycles of denaturation at 95˚C for 30 s, annealing at 58˚C for 30 s and extension at 72˚C for 30 s. A dissociation curve was generated at the end of each PCR cycle to verify that a single product was am-plified using software provided with the iCycler iQTM Real-time PCR Detection System. The identity of the PCR products was verified by single strand sequencing using MegaBACE 1000 DNA analysis system (Amer-sham Biosciences, USA). To minimize sample variations, mRNA expression of the target gene was normalized relative to the expression of the housekeeping gene actin. All experiments were repeated three times for cDNA prepared for two samples of eggplants leaves. The quan-tification of mRNA levels is based on the method of Li- vak and Schmittgen [24]. The threshold cycle (Ct) value of actin was subtracted from that of the gene of interest to obtain a ∆Ct value. The Ct value of untreated control sample was subtracted from the ∆Ct value to obtain a ∆∆Ct value. The fold changes in expression level relative to the control were expressed as 2-∆∆Ct.

Table 1. Primers used for real-time RT-PCR assays.

Gene Encoding protein Accession no. Primer pairs

SOD Superoxide dismutase AY262025.1 F: GGCTTGCATACAAACCTGAA R: CTGACTGCTTCCCATGACAC

CAT catalase M93719.1 F: GTCGATTGGTGTTGAACAGG R: AGGACGACAAGGATCAAACC

cAPX cytosolic ascorbate

peroxidase DQ099420.1

F: GACTCTTGGAGCCCATTAGG R: AGGGTGAAAGGGAACATCAG

POD peroxidase DQ099421.1 F: TTAGGGAGCAGTTTCCCACT

R: AGGGTGAAAGGGAACATCAG

GR glutathione reductase AW033378 F: TTGGTGGAACGTGTGTTCTT R: TCTCATTCACTTCCCATCCA

actin AB199316 F: TGGTCGGAATGGGACAGAAG R: CTCAGTCAGGAGAACAGGGT

F: forward primer; R: reverse primer.



27

3. Results

3.1. Effects of Excess Mn under Hypoxia Stress on Activities of SOD, POD, CAT, APX and GR

According to Figure 1, SOD activity under hypoxia con-ditions with 10-400 µmol·L-1 Mn2+ greatly increased in the leaves and roots than aeration condition (Figure 1). Under hypoxia, SOD activity of tomato seedlings treated

by 200 µmol·L-1 Mn2+ reached maximum, which increased averagely by 194.5%, 206.9% in leaves and roots respectively.

Compared with aeration, SOD activity under hypoxia reduced greatly by 600 µmol·L-1 excess Mn2+, in the leaves and roots depressed by 27.3%, 43.13% (P<0.05) respectively. It showed that SOD activity could be greatly induced by 10-400 µmol·L-1 excess Mn2+, which could reduce the damage of O2

-. under hypoxia stress.

0

50

100

150

200

0

50

100

150

0.0

0.5

1.0

1.5

2.0

2.5

0

10

20

30

40

0

10

20

30

40

b

b

aa

a

c

cd

leaves

SO

D a

cti

vit

y (

U g

-1 F

W)

Paeonia suffruticosa-CK P. suffruticosa-hypoxia stressroots

0

50

100

150 ab

b

a

a

c

cd

Paeonia suffruticosa-CK P. suffruticosa-hypoxia stress

PO

D a

cti

vit

y(U

g-1 F

W)

0

50

100

150

200

d

a

b

a

Mn concentration (mol L-1)

SO

D a

cti

vit

y (

U g

-1 F

W)

10 200 400 600 10 200 400 600

c

c

b

a

b bb

aa

ccc

PO

D a

ctiv

ity

(U

g-1 F

W)

0.0

0.5

1.0

1.5

2.0

2.5b

baa

cc

d d

CA

T a

cti

vity

(U

g-1 F

W)

bba

a

cc

d d

CA

T a

cti

vit

y (U

g-1 F

W)

b baa

cc

dd

AP

X a

ctiv

ity

(U

g-1 F

W)

0

10

20

30

40

bb

a a a

cc

AP

X a

cti

vit

y (U

g-1 F

W)

bc

0

10

20

30

40

bb

aa

c

c

d

GR

ac

tiv

ity

(U g

-1 F

W)

b b

b

aa

c c

c

d

GR

ac

tiv

ity

(U

g-1 F

W)

Figure 1. Effects of excess Mn under hypoxia stress on activities of SOD, POD, CAT, APX and GR in tomato seedlings. Dif-ferent letter indicates significant difference between treatments (P < 0.05). The same is as below.



28

POD activity in the leaves and roots were increased ev-

idently under hypoxia conditions with 10-200 µmol·L-1

Mn2+ (Figure 1). However, POD activity were gradually decreasing with 200 to 600 µmol·L-1 Mn2+ under hypoxia stress. POD activity in the leaves and roots researched the highest point with 400 µmol·L-1 Mn2+ under aeration conditions. POD activity under hypoxia in the roots was gradually lower than those of aeration with the increasing concentration of Mn2+. But in the leaves, POD activity under hypoxia was kept nearly in the same level as those of aeration. Thus, it indicated that 200 µmol·L-1 Mn2+ could eliminate the contents of O2

.- and H2O2 produced by hypoxia stress, which could avoid O2

.- and H2O2 react-ing to form another serious kind of free radical .OH and reduced their harmfulness.

According to Figure 1, CAT activity in the leaves in-creased with the increasing Mn2+ concentration from 10 to 200 μmol·L-1. CAT activities enhanced averagely by 11.9%, 11.3% under aeration and hypoxia stress respec-tively. When Mn2+ was higher than 200 μmol·L-1, CAT activity in the leaves and roots both reduced with the increasing Mn2+ concentration. Moreover, with the same Mn2+ concentration, CAT activity in leaves and roots had no significant under aeration and hypoxia.

Varying tendency of APX activities in leaves had much difference from those in roots (Figure 1). Under aera-tion conditions, APX activities in the leaves increased obviously with the increasing of Mn2+. But under hypoxia conditions, APX activities in the leaves reduced obviously with the increasing of Mn2+. APX activity in the leaves under hypoxia were distinctly lower than those of aeration when Mn2+ was higher than 400 μmol·L-1.

APX activity in the roots had peak value when Mn2+ was 200 μmol·L-1. When Mn2+ was above 200 μmol·L-1, APX activities in the roots reduced rapidly with the increasing of Mn2+ under hypoxia conditions. But under nor-mal aeration conditions, the reducing tendency of APX activity was much gently.

When Mn2+ was less than 200 μmol·L-1, APX activi-ties of hypoxia in the roots were higher than those of aeration. At the concentration of 200 μmol·L-1 Mn2+, APX activities enhanced averagely by 237.9%, 208.4% in the roots under hypoxia and aeration respectively compared with the control respectively. When Mn2+ was higher than 400μmol·L-1, APX activities of hypoxia in the roots were evidently lower than those of aeration.

GR activity in the leaves enhanced obviously with the increase of Mn2+ under aeration conditions when Mn2+ was less than 200 μmol·L-1, but it reduced obviously with the increasing of Mn2+ (Figure 1). When Mn2+ was 10 μmol·L-1, GR activities in the leaves of hypoxia increased averagely by 243.9%, which were much higher than those of aeration. When Mn2+ was less than 200 μmol·L-1,

GR activity under aeration or hypoxia conditions increased obviously with the increase of Mn2+ in the roots. When Mn2+ was higher than 200 μmol·L-1, GR activity under aeration or hypoxia conditions reduced obviously with the increase of Mn2+. It could come to the conclu-sion that 200 μmol·L-1 Mn2+ could effectively eliminate the harmfulness to the seedlings of free radical.

3.2. Effects of Excess Mn under Hypoxia Stress on H2O2, MDA and ASA Content

AsA activity in the leaves and roots increased obviously with the increase of Mn under aeration or hypoxia conditions when Mn2+ was less than 200 μmol·L-1, and AsA activity in the leaves and roots of hypoxia were much higher than those of aeration (Figure 2). The AsA activ-ity in the leaves of hypoxia and aeration enhanced 262.1%, 226.9% respectively. AsA activity in the roots of hypoxia and aeration enhanced 312.1%, 261.2% respectively. However, when Mn2+ was higher than 400 μmol·L-1, AsA activity in the leaves and roots of hypoxia were obviously lower than those of aeration. AsA activity in the leaves of hypoxia and aeration were reduced averagely by 10.2%, 57.5% respectively compared with the control and AsA activity in the roots of hypoxia and aeration were reduced averagely by 121.8%, 81.7% respectively compared with the control. Therefore, low level of Mn2+ could relieve the harmfulness from hypoxia stress, on the contrary, high level of Mn2+ could only make more serious.

As shown in Figure 2, contents of H2O2 in the leaves and roots reduced when Mn2+ was less than 200 μmol·L-1 and then increased obviously when Mn2+ was higher than 200 μmol·L-1 under hypoxia conditions. However, contents of H2O2 in the roots raised all the way under aeration condition.

Under hypoxia, contents of MDA in the leaves and roots reduced at the critical point of 200 μmol·L-1 Mn2+ and then increased (Figure 2). Under the conditions of other things being equal, the hypoxia contents of MDA in leaves and roots were much higher than those of aeration. Contents of MDA in the hypoxia leaves and roots, aeration leaves and roots increased by 246.1%, 157.7%, 396.7%, and 320.2% respectively. In term of hypoxia stress, 200-400 μmol·L- 1 Mn2+ could reduce the contents of MDA evidently and the contents of MDA in hypoxia leaves and roots were lowered by 57.9%, 52.2% than those of control. It indicated appropriate amount of Mn2+ could effectively alleviate the over-oxidation to the membrane lipid of cell under hypoxia.

3.3. Changes in Gene Expressions in Response to Mn2+ Levels under Hypoxia Stress

To analyze the underlying molecular mechanisms for



29

0

10

20

30

40

0

10

20

30

40

0

2

4

6

8

10

0

10

20

30

40

10 200 400 600

c

b

a

AS

A c

on

ten

t

( m

ol g

-1 F

W)



d

b a

c

d

leaves

10 200 400 600 c

c

b

b

a

a

a

a

AS

A c

on

ten

t

( m

ol g

-1 F

W)

d

roots

0

10

20

30

H2O

2 c

on

ten

t

( m

ol g

-1 F

W)

b

a

c

b

b

b

a

a

c

c

b

b

a

H2

O2

co

nte

nt

(m

ol g

-1 F

W)

d

a

0

2

4

6

8

10

ccb bb

a

a

MD

A c

on

ten

t

( m

ol g

-1 F

W)

Mn concentration(mol L-1)

bc

c

c

b

b

a

a

MD

A c

on

ten

t

(m

ol g

-1 F

W)

bcd

H2O

2

Figure 2. Effects of excess Mn under hypoxia stress on content of ASA, H2O2 and MDA in tomato seedlings.

0

2

4

6

0

2

4

60

2

4

6

1

2

0

3

6

SOD

Concentration of Mn2+(M)10 200 400 600

POD

APX

Re

lati

ve m

RN

A a

bu

nd

ance

CAT

GR

Figure 3. Changes in stress responsive genes expressions in response to Mn2+ levels under hypoxia stress. Related genes were analyzed by quantitative real time PCR using the gene- specific primer pairs shown in Table 1. The data were obtained from three independent experiments. Each value in the graph shows mean with ± SD of three experiments.

hypoxia stress tolerance, we examined the effects of dif-ferent Mn2+ concentrations on stress responsive genes expression.

As shown in Figure 3, the gene expression was insp- ired on the low level of Mn2+, and a series of resistance genes level achieved peak value with 10 µmol·L-1 Mn2+. The expression level of SOD, CAT, APX, POD, GR were 6.28, 2.19, 5.66, 5.21 and 6.79 times compared to control respectively. And the expression level decreased in resistance genes with the increasing level of Mn2+. The gene expression levels with excessive Mn2+ under hypoxia stress was less than the low level Mn2+.

4. Discussion

Mn toxicity is one of important abiotic stresses in acidic soil [21], and affects some physiological and biochemical processes associated with plant growth and development [3,25]. Results of experiment in cucumber have shown that excess Mn inhibited plant growth [12]. It has been reported that the occurrence of Mn toxicity was closely related with Mg in muskmelon and Fe concentrations in lichen tissues [3,26]. Excess Mn significantly reduced the contents of Mg and Fe in cucumber leaves. The decrease in the contents of Mg and Fe may increase the SOD ac-tivity to hypoxia stress [21,27]. The antioxidant enzymes were important enzymes in preventing the oxidative stress in plants as is based on the fact that the activity of one or more of these enzymes in generally increased in plants when exposed to stressful conditions and this enhanced activity is related to increased stress tolerance [28,30].



30

The oxidative stress is a key component of environ-mental stress [31]. Various environmental stresses cause accumulation of H2O2 in different tissue segments and the regulation of H2O2 levels is of utmost importance in plant cell metabolism [32]. The enhancement of antioxidant enzymes activities was correlated with increased protection from damage associated with oxidative stress [33]. In the present experiment, excess Mn increased the ac-tivities of SOD, APX and GR, particularly under hypoxia stress. It may be concluded that appropriate amount of Mn2+could reduce the damage of active oxygen under hypoxia stress, but reversely, excessive level of Mn2+ were just to aggravate the already serious damage to the to-mato seedlings.

REFERENCES [1] M. J. Mukaopadhyay and A. Sharma, “Manganese in Cell

Metabolism of Higher Plants,” Botanical Review, Vol. 51, No. 2, April 1991, pp.117-149.

[2] C. Negra, D. S. Ross and A. Lanzirotti, “Oxidizing Be-havior of Soil Manganese: Interactions among Abundance, Oxidation State, and pH,” Soil Science Society of America Journal, Vol. 69, No. 1, January 2005, pp. 87-95.

[3] M. Hauck, A. Paul, S. Gross and M. Raubuch, “Manga-nese Toxicity in Epiphytic Lichens: Chlorophyll Degra-dation and Interaction with Iron and Phosphorus,” Envi-ronmental and Experimental Botany, Vol. 49, No. 2, April 2003, pp. 181-191.

[4] C. O. Dimkpa, D. Merten, A. Svatoš, G. Büchel and E. Kothe, “Metal-Induced Oxidative Stress Impacting Plant Growth in Contaminated Soil is Alleviated by Microbial Siderophores,” Soil Biology & Biochemistry, Vol. 41, No. 1, January 2009, pp. 154-162.

[5] R. V. Tyson and T. H. Pearson, “Modern and Ancient Continental Shelf Anoxia: An Overview,” In: R. V. Ty-son, T. H. Pearson, Ed., Modern and ancient continental shelf anoxia, London, Geological Society Special Publi-cation, 1991, pp. 1-24.

[6] L. Blake and K. W. T. Goulding, “Effects of Atmospheric Deposition, Soil pH and Acidification on Heavy Metal Contents in Soils and Vegetation of Semi-Natural Eco-systems at Rothamsted Experimental Station, UK,” Plant Soil, Vol. 240, No. 2, March 2002, pp. 235-251.

[7] F. C. Vlidon and M. G. Teixeira, “Oxygen Radical Pro-duction and Control in the Chloroplast of Mn-Treated Rice,” Plant Science, Vol. 152, No. 1, January 2000, pp. 7-15.

[8] H. Markus, P. Alexander, G. Shana and R. Markus, “Manganese Toxicity in Epiphytic Lichens: Chlorophyll Degradation and Interaction with Iron and Phosphorus,” Environmental and Experimental Botany, Vol. 49, No. 2, April 2003, pp. 181-191.

[9] Q. H. Shi, Z. Y. Bao, Z. J. Zhu, Q. S. Ying and Q. Q. Qian, “Effects of Different Treatments of Salicylic Acid on Heat Tolerance, Chlorophyll Fluorescence, and Anti-

oxidant Enzyme Activity in Seedlings of Cucumis Sativa L.,” Plant Growth Regulation, Vol. 48, No. 2, February 2006, pp. 127-135.

[10] T. El-Jaoual and D. A. Cox, “Manganese Toxicity in Plants,” Journal of Plant Nutrition, Vol. 24, No. 2, Feb-ruary 1998, pp. 353-386.

[11] J. Le Bot, E. A. Kirkby and M. L. Van Beusichem, “Manganese Toxicity in Tomato Plants: Effects on Cation Uptake and Distribution,” Journal of Plant Nutrition, Vol. 13, No. 5, May 1990, pp. 513- 525.

[12] Q. H. Shi, Z. J. Zhu, Y. He, Q. Q. Qian and J. Q. Yu, “Silicon-Mediated Alleviation of Mn Toxicity in Cucumis Sativus in Relation to Activities of Superoxide Dismutase and Ascorbate Peroxidase,” Phytochemistry, Vol. 66, No. 13, July 2005, pp. 1551-1559.

[13] S. M. Macfie and G. J. Taylor, “The Effects of Excess Manganese on Photosynthetic Rate and Concentration of Chlorophyll in Triticum Aestivum Grown in Solution Culture,” Physiologia Plantarum, Vol. 85, No. 3, June 2008, pp. 467-475.

[14] M. Hauck, A. Paul, C. Mulack, E. Fritz and M. Runge, “Effects of Manganese on the Viability of Vegetative Di-aspores of the Epiphytic Lichen Hypogymnia Physodes,” Environmental and Experimental Botany, Vol. 47, No. 2, March 2002, pp. 127-142.

[15] S. S. Sharma and K. J. Dietz, “The Relationship between Metal Toxicity and Cellular Redox Imbalance,” Trends in Plant Science, Vol. 14, No. 1, January 2009, pp. 43-50.

[16] R. Mittler, “Oxidative Stress, Antioxidants and Stress Tolerance,” Trends in Plant Science, Vol. 7, No. 9, Sep-tember 2002, pp. 405-410.

[17] E. R. Stadtman and C. N. Oliver, “Metal-Catalyzed Oxi-dation of Proteins. Physiological Consequences,” Journal of Biological Chemistry, Vol. 266, No. 4, February 1991, pp. 2005-2008.

[18] J. A. Harrigan, J. Piotrowski, L. D. Noto, R. L. Levine and V. A. Bohr, “Metal-Catalyzed Oxidation of the Werner Syndrome Protein Causes Loss of Catalytic Activities and Impaired Protein-Protein Interactions,” Journal of Bio-logical Chemistry, Vol. 282, No. 50, December 2007, pp. 36403-36411.

[19] T. Brennan and C. Frenkel, “Involvement of Hydrogen Peroxide in the Regulation of Senescence in Pear,” Plant Physiology, Vol. 59, No. 3, March 1977, pp. 411-416.

[20] C. N. Giannopolitis and S. K. Ries, “Superoxide Dismu-tases I. Occurrence in Higher Plants,” Plant Physiology, Vol. 59, No. 2, 1977, pp. 309-314.

[21] I. Cakmak and H. Marschner, “Magnesium Deficiency and High Light Intensity Enhance Activities of Superox-ide Dismutase, Ascorbate Peroxidase and Glutathione Reductase in Bean Leaves,” Plant Physiology, Vol. 98, No. 4, April 1992, pp. 1222-1227.

[22] Y. Nakano and K. Asada, “Purification of Ascorbate Peroxidase in Spinach Chloroplasts; its Inactivation in Ascorbate-Depleted Medium and Reactivation by Monode-hydroascorbate Radical,” Plant and Cell Physiology, Vol. 28, No. 1, January 1987, pp. 131-140.



31

[23] C. H. Foyer and B. Halliwell, “The Presence of Glu-tathione and Glutathione Reductase in Chloroplasts: A Proposed Role in Ascorbic Acid Metabolism,” Planta, Vol. 133, No. 1, January 1976, pp. 21-25.

[24] K. J. Livak and T. D. Schmittgen, “Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method,” Methods, Vol. 25, No. 4, December 2001, pp. 402-408.

[25] A. Paul, M. Hauck and E. Fritz, “Effects of Manganese on Element Distribution and Structure in Thalli of the Epiphytic Lichens Hypogymnia Physodes and Lecanora Conizaeoides,” Environmental and Experimental Botany, Vol. 50, No. 2, October 2003, pp. 113-124.

[26] O. M. Elamin and G. E. Wilcox, “Effects of Magnesium and Manganese Nutrition on Muskmelon Growth and Manganese Toxicity,” Journal of the American Society for Horticultural Science, Vol. 111, No. 4, April 1986, pp. 582-587.

[27] I. Cakmak, B. Erenoglu, K. Y. Gulut, R. Derici and V. Romheld, “Light-Mediated Release of Phytosiderophores in Wheat and Barley under Iron or Zinc Deficiency,” Plant Soil, Vol. 202, No. 2, May 1998, pp. 309-315.

[28] G. Santandrea, T. Pandolfini and A. Bennici, “A Physio-logical Characterization of Mn-Tolerant Tobacco Plants Selected by In Vitro Culture,” Plant Science, Vol. 150,

No. 2, January 2000, pp. 163-177.

[29] M. M. Fecht-Christoffers, P. Maier and W. J. Horst, “Apoplastic Peroxidases and Ascorbate are Involved in Manganese Toxicity and Tolerance of Vigna Unguicu-lata,” Physiologia Plantarum, Vol. 117, No. 2, March 2003, pp. 237-244.

[30] A. Hameed, S. Naseer, T. Iqbal, H. Syed and M. A. Haq, “Effects of NaCl Salinity on Seedling Growth, Senes-cence, Catalase and Protease Activities in Two Wheat Genotypes Differing in Salt Tolerance,” Pakistan Journal of Botany, Vol. 40, No. 3, March 2008, pp. 1043-1051.

[31] A. C. F. de Vasconcelos, X. Z. Zhang, E. H. Ervin and K. J. de Castro, “Enzymatic Antioxidant Responses to Bio-stimulants in Maize and Soybean Subjected to Drought,” Scientia Agricola, Vol. 66, No. 3, May 2009, pp. 395- 402.

[32] T. S. Gechev and J. Hille, “Hydrogen Peroxide as a Sig-nal Controlling Plant Programmed Cell Death,” Journal of Cell Biology, Vol. 168, No. 1, January 2005, pp. 17-20.

[33] H. H. Abd El-Baky, F. K. El Baz and G. S. El-Baroty, “Enhancement of Antioxidant Production in Spirulina Platensis under Oxidative Stress,” Acta Physiologiae Plan-tarum, Vol. 31, No. 3, May 2009, pp. 623-631.



Phylogenic Study of Twelve Species of Phyllanthus Originated from India through Molecular Markers for Conservation

Gyana Ranjan Rout*, Subhashree Aparajita

Department of Agricultural Biotechnology, College of Agriculture, Orissa University of Agriculture & Technology, Bhubaneswar, India. Email: *[email protected] Received July 2nd, 2010; revised July 22nd, 2010; accepted September 8th, 2010

ABSTRACT

The objective of the study was to characterize the germplasm for identification and phylogeny study for conservation. Identification and characterization of germplasm is an important link between the conservation and utilization of plant genetic resources. The present investigation was undertaken to draw the phylogenetic relationship between twelve spe-cies from India belonging to genus Phyllanthus with the help of molecular markers. In total, 259 marker loci were as-sessed, out of which 249 were polymorphic revealing 96.13% polymorphism. Nei’s similarity index varies from 0.23 to 0.76 for RAPD and 0.26 to 0.81 for ISSR marker systems. Cluster analysis by unweighted pair group method (UPGMA) of Dice coefficient of similarity generated dendogram with more or less similar topology for both the analysis that gave a better reflection of diversity and affinities between the species. The phylogenetic tree obtained from both RAPD and ISSR marker has divided the 12 species in two groups: group I consisting of only one species Phyllanthus angustifolius and the group II with the rest 11 species. This molecular result is comparable to notable morphological characteristics. The present study revealed the distant variation within the species of Phyllanthus. This investigation will help for iden-tification and conservation of Phyllanthus species. Keywords: Genetic Variation, ISSR, Medicinal Plant, RAPD

1. Introduction

The genus Phyllanthus belonging to family Euphorbiac- eae is an important group of medicinal plants used for various purposes. In Phyllanthus emblica L. Syn: Embli- ca officinalis Gaertn, the fruit is used for diverse applications in healthcare, food and cosmetic industry. It has been well studied for immunomodulatory, anticancer, antioxidant and antiulcer activities [1]. Phyllanthus amarus is an important folk remedy used in the treatment of a variety of ailments [2]. In India, it is predominantly used as a cure for liver disorders [3,4]. The aqueous extract from Phyllanthus amarus has been reported to inhibit DNA polymerase of Hepatitis-B and woodchuck hepati-tis virus. Proper identification of genotype, therefore, re- mains important for protection of both the public health and industry. Chemo profiling and morphological evaluation are routinely used for identification of genotype. Chemical complexity and lack of therapeutic markers are some of the limitations associated with the identification of genotype. Molecular markers have provided a power-

ful new tool for breeders to search for new sources of variation and to investigate genetic factors controlling qua- ntitatively inherited traits. The molecular approach for identification of plant varieties/genotypes seems to be more effective than traditional morphological markers because it allows direct access to the hereditary material and makes it possible to understand the relationships between individuals [5,6]. Genetic polymorphism in medicinal plants has been widely studied which helps in distinguish- ing plants at inter- and / or intra-species level. The most important role of conservation is to preserve the genetic variation and evolutionary process in viable populations of ecologically and commercially viable varieties / genotypes in order to prevent potential extinction. PCR- based molecular markers are widely used in many plant species for identification, Phylogenetic analysis, population stud-ies and genetic linkage mapping [5]. Both RAPD and IS- SR marker, based on PCR techniques have proven to be a reliable, easy to generate, inexpensive and versatile set of marker that rely on repeatable amplification of DNA se-



33

quence using single primers. The RAPD and ISSR mark-ers can be used in the study of the genetic variability of species or natural populations and in the identification of genotypes [7-14]. In this communication, we report the feasibility of PCR-based DNA (RAPD and ISSR) marker for phylogeny study and identification for conservation of Phyllanthus species.


2.1. Plant Materials

Twelve species of Phyllanthus were collected from natu-ral forest of Orissa, India and used for molecular analy-sis.

2.2. DNA Isolation and Quantification

DNA was extracted from fresh leaves by using the Cetyl- trimethyl ammonium bromide (CTAB) method [15]. Ap- proximately, 20 mg of fresh leaves was ground to pow-der in liquid nitrogen using a mortar and pestle. The ground powder was transferred to a 50 ml falcon tube with 10 ml of CTAB buffer [2% (w/v) CTAB, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris (tris (hydroxymethyl) aminom- ethane)-HCl, pH 8.0, and 0.2% (v/v) β-mercaptoethanol]. The homogenate was incubated at 60˚C for 2 h, extracted with an equal volume of chloroform/isoamyl alcohol (24: 1 v/v) and centrifuged at 10,000 x g for 20 min. DNA was precipitated from the aqueous phase by mixing with an equal volume of isopropanol. After centrifugation at 10,000 x g for 10 min, the DNA pellet was washed with 70% (v/v) ethanol, air-dried and resuspended in TE (10 mM Tris-HCl, pH 8.0, and 0.1 mM EDTA) buffer. DNA quantifications were performed by visualizing under UV light, after electrophoresis on 0.8% (w/v) agarose gel at 50 V for 45 min and compared with a known amount of lambda DNA marker (MBI, Fermentas, Richlands B.C., Old). The resuspended DNA was then diluted in TE buffer to 5 µg/µl concentration for use in polymerase chain reaction (PCR).

2.3. Primer Screening

Thirty decamer primers, corresponding to kits A, D, and N from Operon Technologies (Alameda, California, USA) and twenty synthesized ISSR primer (M/S Bangalore Ge- nei, Bangalore, India) were initially screened using one species of Phyllanthus i.e., ‘Phyllanthus virgatus’ to de-termine the suitability of each primer for the study. Pr- imers were selected for further analysis based on their ability to detect distinct, clearly resolved and polymorph- hic amplified products within the species. To ensure reproducibility, the primers generating no, weak, or complex patterns were discarded.

2.4. RAPD and ISSR Assay

Polymerase chain reactions (PCR) with single primer were carried out in a final volume of 25 l containing 20 ng template DNA, 100 M of each deoxyribonucleotide triphosphate, 20 ng of decanucleotide primer (M/S Ope- ron Technology), 1.5 mM MgCl2, 1X Taq buffer [10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.001% gelatin], and 0.5 U Taq DNA polymerase (M/S Bangalore Genei, India). Amplification was performed in a PTC-100 thermal cy-cler (M J Research Inc., Watertown, MA, USA) programmed for a preliminary 2 min denaturation step at 94˚C, followed by 40 cycles of denaturation at 94˚C for 20 s., annealing at required temperature for 30 s and extension at 72˚C for 1 min, finally at 72˚C for 10 min for amplifi-cation. Amplification products were separated alongside a molecular weight marker (1.0 kb plus ladder, M/S Ban- galore Genei) by 1% and 1.5% (W/V) agarose gel for RAPD and ISSR respectively. Electrophoresis was done in 1X TAE (Tris acetate EDTA) buffer, stained with eth- idium bromide and visualized under UV light. Gel photographs were scanned through a Gel Documentation Sys-tem (Gel Doc. 2000, BioRad, California, USA) and the amplification product sizes were evaluated using the software Quantity one (BioRad, USA).

2.5. Data Analysis

Data were recorded as presence (1) or absence (0) of band products from the photographic examination. Each amplification fragment was named by the source of the primer, the kit letter or number, the primer number and its approximate size in base pairs. Bands with similar mobility to those detected in the negative control, if any, were not scored. A pair-wise matrix of distance between landraces was determined for the RAPD and ISSR data using Dice formula [16] in the program Free Tree [17]. The average of similarity matrices was used to generate a tree by UPGMA (unweighted pair-group method arith-metic average) using the program Tree view.

3. Results and Discussion

The present study offers an optimization of primer screening for evaluation of genetic relationship between twelve Phyllanthus species collected from Indian origin. DNA extraction of Phyllanthus proved difficult due to presence of secondary metabolites and essential oil content. A modified CTAB method by Doyle and Doyle proved to be fruitful. The modified method included higher concentra-tion of CTAB (4%), EDTA (50mM) and 1% 2-Mercapt- oethanol. Importantly purification by Choloform: Isoa-myl alcohol (24:1) was performed twice. Significant quantities of DNA were always successfully extracted by



34

this modified method that varied from 200 to 1000ng in different Phyllanthus species. The reproducibility of both RAPD and ISSR primer amplification were detected by performing separate runs of PCR with DNA extraction from different preparation. No significant differences were observed in different experiments although occa-sional variation in the intensities of individual bands was detected. Bands with same mobility were considered as identical fragments receiving equal values regardless of their staining ability. When multiple bands in a region were difficult to resolve, data of that region were not included for the analysis. As a result ten RAPD and eight ISSR primers were selected out of thirty RAPD and twenty ISSR primers screened, as they generated clear and scorable bands with considerable polymorphism.

Using ten RAPD primers, 157 bands were produced with an average of ~ 16 bands per primer out of which 150 were polymorphic revealing 95.54% polymorphism. The size of the RAPD fragments ranged from 0.2 to 2.4 Kilo base pairs (Table 1). The banding profile by RAPD primer OPA-01 and OPD-18 has been shown in the Fig-ure 1. The primer OPA-01 amplified a maximum of 24 fragments whereas OPD-02 produced least number of amplified bands (08). Similarly 102 amplified ISSR products were scored across 12 species of Phyllanthus by eight selected custom synthesized ISSR primers with 97.05% polymorphism. The average number of amplification products per ISSR primer was ~ 13. The size of ISSR amplified fragments varied from 0.3-2.5 Kilo base pair (Ta-ble 2).

The banding pattern by ISSR primer IG-10 and IG-14 are presented in Figure 2. The genetic variation through RAPD and ISSR markers has been highlighted in a nu-

mber of medicinal plants [18-21]. The result shows that both the marker systems are efficient enough to distin-guish 12 species of Phyllanthus and in revealing mo-lecular relationship among them. The resolution of ISSR markers (97.08%) is high in comparison to RAPD mark-ers (95.54%). The similarity matrix of RAPD and ISSR data after multivariant analysis using Nei and Li’s coef-ficient has been presented in Tables 3 & 4 respectively. The similarity value ranged from 0.23 to 0.76 in case of RAPD and from 0.26 to 0.81 for ISSR. The similarity matrix obtained in the present study was used to con-struct a dendrogram with the UPGMA method by both RAPD and ISSR data (Figures 3 & 4). The dendograms generated by both the approaches (RAPD and ISSR) were with broad agreement with each other and also with accepted taxonomy; two major groups were obtained and most of the related species were found to be grouped together. Phyllanthus angustifolia, morphologically dis-tinct from the rest 11 species had been grouped isolated in group-I by both the molecular approaches. At the mo-lecular level Phyllanthus angustifolia is having six unique RAPD bands and five unique ISSR bands.

The remaining eleven species positioned in group II are differentiated into two clad by both the marker sys-tem. The first clad having six species (Phyllanthus spp “Acc No-1”, Phyllanthus reticulus, Phyllanthus nivosus, Phyllanthus nivosus “varigata”, Phyllanthus acidus, Phy- llanthus emblica) and other clad having five species (Ph- yllanthus flatarnus, Phyllanthus urinaria, Phyllanthus rotundifolius, Phyllanthus virgatus and Phyllanthus ama-rus). Phyllanthus acidus and Phyllanthus emblica as well as Phyllanthus nivosus and Phyllanthus nivosus “vari-gata” are grouped together by both the approaches, where

Table 1. Total number of amplified fragments and number of polymorphic fragments generated by PCR using selected RAPD primers.

Primer Primer sequence Total no. of bands

No. of Polymorphic bands

Polymorphismpercentage

No. of Unique bands

Band range (kbp)

OPA-01 5’-TGCCGAGCTG-3’ 24 24 100 3 0.4-2.1

OPA-04 5’-AATCGGGCTG-3’ 18 18 100 2 0.25-2.4

OPA-10 5’-GTGATCGCAG-3’ 20 20 100 3 0.3-2.3

OPD-02 5’-GGACCCAACC-3’ 8 7 87.4 2 0.5-1.8

OPD-11 5’-AGCGCCATTG-3’ 12 10 83.3 1 0.3-2.3

OPD-18 5’-GAGAGCCAAC-3’ 15 15 100 1 0.2-2.1

OPD-20 5’-ACCCGGTCAC-3’ 11 11 100 0 0.3-2.2

OPN-06 5’-GAGACGCACA-3’ 20 20 100 3 0.3-2.5

OPN-15 5’-GGTGAGGTCA-3’ 14 11 78.5 2 0.4-2.4

OPN-16 5’-AAGCGACCTG-3’ 15 14 93 2 0.2-3.0

TOTAL ---------------- 157 150 95.5 11 0.2-3.0



35

Figure 1. RAPD banding patterns of twelve species of Phyl-lanthus generated by the primers OPA- 01 (A) and OPD-18 (B) M – Molecular weight ladder (kb). 1-Phyllanthus nivo-sus, 2-Phyllanthus flaternus, 3-Phyllanthus reticulus, 4-Ph- yllanthus acidus, 5-Phyllanthus nivosus “Varigata”, 6-Phy- llanthus spp “Àcc No.1”, 7-Phyllanthus rotundifolius, 8-Phy- llanthus angustifolius, 9-Phyllanthus emblica, 10-Phyllant- hus uninaria, 11-Phyllanthus virgatus, 12-Phyllanthus amarus.

Figure 2. ISSR banding pattern in 12 species of Phyllanthus obtained from PCR amplification by ISSR primer IG-10(A) and IG-14(B). M indicates DNA size marker; 1-Phyllanthus nivosus, 2-Phyllanthus flaternus, 3-Phyllanthus reticulus, 4- Phyllanthus acidus, 5-Phyllanthus nivosus “Varigata”, 6-Ph- yllanthus spp “Àcc No.1”, 7-Phyllanthus rotundifolius, 8-Ph- yllanthus angustifolius, 9-Phyllanthus emblica, 10-Phyllan- thus uninaria, 11-Phyllanthus virgatus, 12-Phyllanthus amarus.

Table 2. Total number of amplified fragments and number of polymorphic fragments generated by PCR using selected ISSR Primers.

Primer Primer sequence Total no. of

bands No. of Polymorphic

bands Polymorphism

percentage No. of

Unique bands Band range

(kbp)

IG-01 5’AGGGCTGAGGAGGGC-3’ 12 12 100 1 0.5-1.6

IG-03 5’GAGGGTGGAGGATCT-3’ 8 08 100 1 0.5-1.6

IG-10 3’- (AG)8T-5’ 12 12 100 0 0.3-1.8

IG-11 3’- (AG) 8C-5’ 12 12 100 1 0.3-1.6

IG-13 3’- (AC) 8G-5’ 11 11 100 1 0.4-2.2

IG-14 3’- (GA) 88A-5’ 18 17 94.4 2 0.3-2.5

IG-15 3’- (GA) 8T-5’ 15 14 93.33 0 0.4-2.0

IG-23 3’- (GA) 8C-5’ 14 13 92.85 1 0.3-2.1

TOTAL -------------- 102 99 97.05 7 0.3-2.5

Table 3. Similarity matrix of 12 species of Phyllanthus generated by RAPD markers.

P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12

P1 1.00 P2 0.31 1.00 P3 0.53 0.40 1.00 P4 0.57 0.43 0.50 1.00 P5 0.74 0.25 0.52 0.54 1.00 P6 0.45 0.49 0.51 0.48 0.50 1.00 P7 0.55 0.54 0.43 0.52 0.44 0.41 1.00 P8 0.41 0.23 0.41 0.33 0.39 0.29 0.36 1.00 P9 0.58 0.50 0.56 0.76 0.50 0.56 0.56 0.40 1.00 P10 0.38 0.37 0.43 0.46 0.38 0.46 0.54 0.35 0.45 1.00 P11 0.45 0.54 0.42 0.59 0.46 0.51 0.63 0.35 0.58 0.51 1.00 P12 0.41 0.41 0.35 0.47 0.45 0.44 0.52 0.36 0.45 0.55 0.72 1.00

P1-Phyllanthus nivosus, P2-Phyllanthus flaternus, P3-Phyllanthus reticulus, P4-Phyllanthus acidus, P5-Phyllanthus nivosus “Varigata”, P6-Phyllanthus spp “Àcc No.1”, P7-Phyllanthus rotundifolius, P8-Phyllanthus angustifolius, P9-Phyllanthus emblica, P10-Phyllanthus uninaria, P11-Phyllanthus virgatus, P12- Phyllanthus amarus.



36

Table 4. Similarity matrix of 12 species of Phyllanthus generated by ISSR markers.

P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12

P1 1.00 P2 0.32 1.00 P3 0.37 0.29 1.00 P4 0.56 0.50 0.42 1.00 P5 0.81 0.36 0.32 0.64 1.00 P6 0.46 0.50 0.53 0.57 0.43 1.00 P7 0.47 0.41 0.42 0.39 0.55 0.46 1.00 P8 0.29 0.44 0.26 0.44 0.36 0.33 0.32 1.00 P9 0.57 0.50 0.48 0.72 0.55 0.52 0.47 0.38 1.00 P10 0.36 0.69 0.29 0.54 0.48 0.46 0.57 0.47 0.43 1.00 P11 0.43 0.48 0.28 0.45 0.53 0.41 0.57 0.37 0.41 0.57 1.00 P12 0.44 0.46 0.27 0.38 0.56 0.32 0.49 0.33 0.42 0.52 0.64 1.00

P1-Phyllanthus nivosus, P2-Phyllanthus flaternus, P3-Phyllanthus reticulus, P4-Phyllanthus acidus, P5-Phyllanthus nivosus “Varigata”, P6-Phyllanthus spp “Àcc No.1”, P7-Phyllanthus rotundifolius, P8-Phyllanthus angustifolius, P9-Phyllanthus emblica, P10-Phyllanthus uninaria, P11-Phyllanthus virgatus, P12- Phyllanthus amarus.

Figure 3. Dendogram showing the cluster analysis of 12 species of Phyllanthus using RAPD markers. 1-Phyllanthus nivosus, 2-Phyllanthus flaternus, 3-Phyllanthus reticulus, 4- Phyllanthus acidus, 5-Phyllanthus nivosus “Varigata”, 6-Ph- yllanthus spp “Àcc No.1”, 7-Phyllanthus rotundifolius, 8- Phyllanthus angustifolius, 9-Phyllanthus emblica, 10-Phyll- anthus uninaria, 11-Phyllanthus virgatus, 12-Phyllanthus amarus.

Figure 4. Dendrogram showing the cluster analysis of 12 species of Phyllanthus using ISSR markers. 1-Phyllanthus nivosus, 2-Phyllanthus flaternus, 3-Phyllanthus reticulus, 4- Phyllanthus acidus, 5-Phyllanthus nivosus “Varigata”, 6-Ph- yllanthus spp “Àcc No.1”, 7-Phyllanthus rotundifolius, 8-Ph- yllanthus angustifolius, 9-Phyllanthus emblica, 10-Phyllant- hus uninaria, 11-Phyllanthus virgatus, 12-Phyllanthus amarus.

as Phyllanthus spp “Acc No-1” and Phyllanthus reticulus forming single cluster in case of ISSR are grouped sepa-rately in RAPD approach. Phyllanthus amarus and Phy- llanthus virgatus in clad II is always grouped together in both the approaches. The differences in number of indi-viduals estimated by RAPD markers in this study are similar to the result obtained by Rajaseger et al. [22] in RAPD studies of the Ixora coccinea and Ixora. javanica. They also found that the taxa-specific RAPD and ISSR bands could be utilized to define the identification.

The present findings include the identification and ge-netic variation within twelve species of Phyllanthus. The dendogram shows the distant variation within the species.

The genetic relation through RAPD and ISSR markers provides a reliable method for identification of species than morphological characters. This investigation as an understanding of the level and partitioning of genetic variation within the species would provide an important input into determining efficient management strategies. The genetic variability in a gene pool is normally con-sidered as being the major resource available to breeders for improvement program.

REFERENCES [1] W. Dnyaneshwar, C. Preeti, J. Kalpana and P. Bhushan,

“Development and Application of RAPD-SCAR Marker



37

for Identification of Phyllanthus Emblica Linn,” Biologi-cal & Pharmaceutical Bulletin, Vol. 29, No. 11, 2006, pp. 2313-2316.

[2] B. S. Geetha, K. K. Sabu and S. Seeni, “Genetic Variation in South India Populations of Phyllanthus Amarus Schum & Thonn. (Euphorbiaceae) Assessed Using Isozymes,” Proceedings of the Fifteenth Kerala Science Congress, 29-31 January 2003, pp. 196-201.

[3] K. P. Kirtikar and B. D. Basu, “Indian Medicinal Plants,” Vol.III, 2nd edition, Bishen Singh Mahendrapal Singh, New Delhi, 1993.

[4] K. M. Nadkarni, “Indian Materia Medica, 1:1947,” Popu-lar Prakashan Pvt. Ltd, Bombay, 1976.

[5] J. G. K. Williams, A. R. Kubelik, K. J. Livak, J. A. Rafal-ski and S. V. Tingey, “DNA Polymorphisms Amplified by Arbitrary Primers are Useful as Genetic Markers,” Nucleic Acids Research, Vol. 18, No. 22, 1990, pp. 6531 -6535.

[6] A. H. Paterson, S. D. Tanksley and M. E. Sorreis, “DNA Markers in Plant Improvement,” Advances in Agronomy, Vol. 46, No. 1, 1991, pp. 39-90.

[7] S. Barik, S. K. Senapati, S. Aparajita, A. Mohapatra and G. R. Rout, “Identification and Genetic Variation among Hibiscus Species (Malvaceae) Using RAPD Markers,” Z Naturforsch C, Vol. 61, No. 1-2, 2006, pp. 123-128.

[8] A. Mohapatra and G. R. Rout, “Identification and Genetic Variation among Rose Cultivars,” Z Naturforsch C, Vol. 60, No. 7/8, 2005, pp. 611-617.

[9] M. Pharmawati, G. Yen and I. J. McFarlane, “Application of RAPD and ISSR Markers to Analyse Molecular Rela-tionships in Grevillea (Proteaceae),” Australian System-atic Botany, Vol. 17, No. 1, 2004, pp. 49-61.

[10] B. Koller, A. Lehmann, J. M. Mcdermott and C. Gessler, “Identification of Apple Cultivars Using RAPD Mark-ers,” TAG Theoretical and Applied Genetics, Vol. 85, No. 6-7, 1993, pp. 901-904.

[11] K. Wolff and J. Peters-Van Run, “Rapid Detection of Genetic Variability in Chrysanthemum (Dendranthema Gr- Andiflora Tzvelev.) Using Random Primers,” Hered-ity, Vol. 71, No. 4, 1993, pp. 335-341.

[12] P. H. Lashermes, J. Cros, P. H. Marmey and A. Charrier, “Use of Random Amplified Polymorphic DNA Markers

to Analyze Genetic Variability and Relationships of Cof-fea Species,” Genetic Resource and Crop Evolution, Vol. 40, No. 2, 1993, pp. 91-99.

[13] S. E. Wilkie, P. G. Isaac and R. J. Slater, “Random Am-plified Polymorphic DNA (RAPD) Markers for Genetic Analysis in Allium,” TAG Theoretical and Applied Ge-netics, Vol. 86, No. 4, 1993, pp. 497-504.

[14] J. Wilde, R. Waugh and W. Powell, “Genetic Finger Printing of Theobroma Clones Using Randomly Ampli-fied Polymorphic DNA Markers,” TAG Theoretical and Applied Genetics, Vol. 83, No. 6-7, 1992, pp. 871-877.

[15] J. J. Doyle and J. L. Doyle, “Isolation of Plant DNA from Fresh Tissue,” Focus, Vol. 12, No. 1, 1990, pp. 13-15.

[16] M. Nei and W. H. Li, “Mathematical Modes for Studying Genetic Variation in Terms of Restriction Endonucle-ases,” Proceedings of the National Academy of Sciences, Vol. 76, No. 10, 1979, pp. 5269-5273.

[17] A. Pavlicek, S. Hrda and J. Flegr, “Free Tree-Freeware Program for Construction of Phylogenetic Trees on the Basis of Distance Data and Boot Strapping/Jackknife Analysis of the Tree Robustness. Application in the RAPD Analysis of the Genus Frenkelia,” Folia Biologica, Vol. 45, No. 3, 1999, pp. 97-99.

[18] D. Bai, J. Brandle and R. Reeleder, “Genetic Diversity in North America Ginseng (Panax Quinquefolius L.) Grown in Ontario Detected by RAPD Analysis,” Genome, Vol. 40, No. 1, 1997, pp. 111-115.

[19] G. R. Rout, P. Das, S. Goel and S. N. Raina, “Determina-tion of Genetic Stability of Micropropagated Plants of Ginger Using Random Amplified Polymorphic DNA (RAPD) Markers,” Botanical Bulletin Academia Sinica, Vol. 39, No. 1, 1998, pp. 23-27.

[20] M. D. Pal and S. S. Raychaudhuri, “Estimation of Genetic Variability in Plantago Ovata Cultivars,” Biologia Plan-tarum, Vol. 47, No. 3, 2003, pp. 459-462.

[21] G. R. Rout, “Identification of Tinospora Cordifolia (Willd) Miers ex Hook F & Thomas Using RAPD Markers,” Z Naturforschung C, Vol. 61, No. 1-2, 2006, pp. 118-122.

[22] G. Rajaseger, H. T. W. Tan, I. M. Turner and P. P. Kumar, “Analysis of Genetic Diversity among Ixora Cultivars (Rubiaceae) Using Random Amplified Polymorphic DNA,” Annals of Botany, Vol. 80, No. 3, 1997, pp. 355-361.




Eugene Ejolle Ehabe1*, Nomo Lucien Bidzanga2, Charles-Magloire Mba1, Jetro Nkengafac Njukeng1, Inacio de Barros3, Frank Enjalric4

1Institute of Agricultural Research for Development (IRAD), Ekona Regional Research Centre, PMB 25 Buea, Cameroon; 2Institute of Agricultural Research for Development (IRAD), Nkolbisson, Yaounde, Cameroon; 3INRA Antilles-Guyana, URAPC, Guadeloupe (FWI); 4Unité Mixte de Recherche Système, CIRAD Cultures Pérennes, Montpellier, France . Email: *[email protected] Received August 4th, 2010; revised August 24th, 2010; accepted September 11th, 2010

ABSTRACT

A study was conducted in some perennial crop-based farms in the humid forests of South West Cameroon, to better un-derstand their soil fertility patterns and management and identify factors that contribute most to nutrient depletion trends in such multi-storey farmholdings. The main perennial crops were the para rubber tree (Hevea brasiliensis), co-coa (Theobroma cacao) and oil palm (Eleais guineensis) whose ages ranged from immature to very old (senescence). Data were collected over a two-year period (2007 and 2008) and modelled using the farm NUTrient MONitoring (NUTMON) tool. Results showed that the farming systems played key roles in the overall exploitation strategies. Plan-tain and cassava (annual crops) and cocoa (perennial) were the most associated crops, accounting for more than half of intercropped frequencies. Whereas nutrient flows within and between farm units were confirmed, the net loss in soil N, P and K nutrient balances differed with the main perennial crop - being highest for the oil palm and lowest for the rubber tree. The average nutrient balance of each farm was markedly negative for N but positive for P and K. Partial nutrient balance (ignoring biophysical flows like N-fixation, leaching and erosion) was positive for the three nutrients indicating therefore that the biophysical flows accounted more for N depletion. Nitrogen loss was mainly due to, leach-ing (~70%), volatilization (~20%), and exported crops and their residues. Keywords: Soil Fertility, Nutrient Monitoring, Depletion, Nutmon

1. Introduction

Crop production practices within peasant farm holdings in sub-Saharan Africa often progress at the expense of sustainable land use as farmers are primarily concerned about crop and animal production, for the forthcoming sea-son. Hence, long-term processes that adversely affect sustainability, such as decrease and eventual depletion of soil nutrient stocks, are less visible and receive a lower priority. Most often, these soils are progressively being mined of their nutrients [1] whereas there is need to se-cure present productivity and ensure the sustainability of these farming systems. These farmers have to manage the fertility of their soils by manipulating the flows of nutri-ents into, out of and within the farm. Indeed, decisions concerning soil productivity are determined by house-hold objectives (food security, profit or cash maximiza-tion, risk aversion, long term security of livelihood, etc.), available resources (labour, cash, implements, natural resources, etc.) and the socio-economic environment.

Soil fertility in sub-Saharan Africa is today regarded as a major survival issue, especially in peasant perennial crop-based systems in the humid forests of Cameroon. This project was initially undertaken to ensure a better understanding and improvement of soil fertility in these cropping systems, to determine the possible role of integrated nutrient management in reversing present trends of nutrient depletion at each farm-level, and to integrate quantitative and qualitative assessment approaches in man-aging soil fertility.

The complexity of peasant farms does not always all- ow for quantification of all flows and stocks. Nutrient monitoring (NUTMON) is a multi-scale modelling approach that was conceived to assess stocks and flows of certain nutrients in a well defined geographical unit following a strict monitoring of all farm inputs (mineral fer-tilizers, manures, atmospheric deposition and sedimenta-tion) and outputs (harvested crop produces, residues, leaching, denitrification, erosion losses). The NUTMON-



39

Toolbox was developed with three modules to quantify nutrient flows, nutrient stocks and economic performance indicators for farms. It provides guidelines for data gath-ering in the field, data entry, calculation of flows and balances and data interpretation. Application of the tools from the toolbox results in a thorough analysis providing insight into nutrient flows between the various activities within the farm as well as between the farm and its sur-roundings [2].

The specific objectives of this study were therefore to evaluate variations of soil nutrient stocks at farm level, measure and estimate the major nutrient flows at farm level as a means to describe current farm nutrient management, to identify the key factors influencing land management in perennial crop-based farms in the humid forests of South West Cameroon in a bid to discover some of the underlying causes of soil fertility depletion. This was particularly supposed to be done using the Nutrient Mo- nitoring Programme (NUTMON) or software, a tool that was developed to assess nutrient balances (stocks and flows of some macro-nutrients - N, P and K), biomass flow and economic performance at farm level [2].

NUTMON has been suggested as a decision-support model to monitor the effects of changing land use and suggest interventions that improve the nutrient balance [4]. As input and output determinants cannot all be quantified equally well, the model recognizes primary data, estimates and assumptions. The NUTMON determinants are mostly scale-neutral and can therefore be used to monitor nutrient balances at farm, regional, national and supra- national levels.

NUTMON is fed by a number of basic data, and by nutrient input and output data [2]. Basic data include the surface area of the arable land, and the spatial patterns of land use systems (LUS). Nutrient input and output data are reflections of different processes, each of which has a certain value (the nutrient balance) which is specific for a given LUS at a given time. A second monitoring exercise at a later stage may yield different results, which may be due to changes in the LUS, or changes in the individual nutrient input and output values. As the changes have either aggravated or ameliorated the nutrient balance, NU- TMON can support decision-making in the interest of sustainable forms of agriculture [3,5].

2. Methodology

2.1. The Study Area

Field observations were carried out on 19 typical peren-nial crop-based agroforestry farms, distributed around Ku- mba and extending to the Bombe-Malende zones (4°25’- 4°80’N and 9°25’- 9°35’E) in the South West Region of Cameroon (Figure 1). This region falls within the rain-

forest area (mean rainfall of 2,852 mm/yr), with a mark- ed rainy season (March to October), and high mean annual temperatures (~23˚C) evenly distributed throughout the year [6], Soils are ferrallitic with patches of fertile volcanic areas, and altitudes varying from 25 to 400 m to-ward the North. The agro-forestry exploitations existing in the area are typically characterized as home gardens [7], that is, permanently occupied (no fallow) small areas, usually adjacent to the farmers’ houses, integrating main perennials (oil palm, rubber trees and cocoa), food crops (yams, cassava, maize, banana, plantain, cocoyam, etc.), and native trees (as well as ornamentals and medicinal plants not considered in the surveys).

The farm holdings had been judged homogeneous in terms of their farm and non-farm economic activities as well as the presence of some perennials as main crop in association with other crops. These farm types ranged from small-scale holdings with mostly food crops, indus-trial plantations for export crops and intercropped farms having various combinations of perennial and food crops [8,9]. The main crops, their development stages and basic characteristics of the terrain of the studied farms are pre-sented in Table 1. The parent material of all the soils was of a volcanic/basement complex [1,10].

Prior to the survey, each farm was characterised for its location, altitude, rainfall and surface area, relief, soil morphology (depth, texture or clay content, colour, parent material) and composition (moisture status, rooting status, etc.).

2.2. Soil Analyses

For each plot, three to five representative samples were collected, following the procedure described latter on, and bulked. A soil observation was made at 100-m inter-vals using a soil auger to examine the soil down to a depth of 50 cm or more, when feasible. During such obser-vations, several soil/land characteristics were noted, no-tably the slope, horizon differentiation, soil depth, texture, colour, coarse fragments, drainage conditions, etc. These were later on sorted into groups of similar soils and ter-rain. Similar soils were bulked, labelled and packaged for eventual laboratory analysis.

In the laboratory, the soils were dried under ambient conditions for about 2 weeks, crushed and sieved through a 2-mm mesh. The throughs were subjected to several standard soil analytical procedures, notably for their:

- texture (particle size) using the pipette method to ob-tain the relative proportions of sand, silt and clay;

- pH (water and KCl), measured potentiometrically in a soil suspension (1:2.5) after 24 h;

- Total Nitrogen (N) by the Kjeldahl semi-micro method [11];

- Available Phosphorus (P) by the Bray II method [12];



40

Figure 1. Map of Cameroon showing the study site.



41

Table 1. Farmholdings covered during the study.

Plot Village Main crop Development of main crop Altitude (m) Slope (%) Clay (%) FSU

18 Bombe Oil palm In production 208 1 35 A

21 Bombe Cocoa Immature 45 3 30 A

22 Malende Cocoa Immature 67 5 35 A

23 Bombe Cocoa Immature 89 3 40 C

24 Malende Cocoa Immature 38 3 30 A

25 Bombe Cocoa In production 45 0 40 C

26 Bombe Cocoa In production 28 0 40 C

27 Bombe Cocoa In production 56 20 40 D

28 Malende Oil palm Immature 87 13 30 B

29 Malende Oil palm Immature 56 3 30 A

30 Bombe Oil palm Immature 34 4 30 A




34 Bombe Rubber Immature 82 3 30 A



37 Bombe Rubber In production 69 1 30 A

38 Bombe Rubber In production 70 25 40 D

- Exchangeable bases calcium (Ca), magnesium (Mg),

potassium (K) and sodium (Na) by the neutral ammo-nium acetate leaching method [13,14];

- Aluminium and hydrogen ions (Al+ H) by leaching with 1M KCl [13,14];

- The soil bulk density was determined from soil cores using the Cylinder method [15,16]. Soil samples were dried at 105˚C to constant weight, and the bulk density was recorded as the ratio of the mass of the dried soil (in g) to the internal volume of the core cutter (in cm3).

2.3. Data Collection and Analysis Using NUTMON ®

The NUTMON ® tool, applied at both the farm and activity levels, included a structured questionnaire, a data- base, and two static models - NUTCAL for calculation of nutrient flows and the ECCAL for calculation of economic parameters [17]. A user interface facilitated data entry, data manipulation and data extraction to produce input for both models.

An initial inventory of household composition, farm and field layout, agricultural activities and nutrient stocks was completed for each farm. This inventory was followed by a monthly monitoring of on-farm agricultural activities that affect nutrient flows. The activities of the farm family, their cash income and the allocation of labour were also recorded.

Based on the algorithm of the NUTMON ® software,

the obtained data were modelled to obtain nutrient balances (inputs less outputs) for all the farms. Nutrient output included harvested crop products and residues, nutria- nts leached out below the root zone, gaseous losses from the top soil, erosion and human excreta lost because it ends up in deep pit latrines far below the root zone. Nut- rient inputs into the system were mineral fertilisers, organic inputs (manure, imported crop residues and feeds), air-borne deposition, biological N-fixation by plants, sed- imentation and nutrients extracted from the sub-soil by deep-rooting crops and trees.

3. Results and Discussion

3.1. Characterisation of Farm Sections

Initial assessment as shown in Figure 2 (not derived us-ing the NUTMON ®), showed that plantain and cassava were the most intercropped annual crops while cocoa, and to a slightly lesser extent, oil palm were the most intercropped perennial crops in the study area. In effect, the two respective crops in each category accounted for more that 50% of observed intercropped frequencies.

Interviews confirmed that the farmers were aware of the progressive decline in land productivity over the years, a phenomenon attributed to continuous cropping on the same fields, soil erosion and most especially the dim- inishing supplies of manure. However, they were not aware of the fate of macro nutrients in these processes and/



42

or how this affected their soil productivity.

3.2. Analysis of Nutrient Flows in Farm Units

The overall N-P-K nutrient flows showed that these flows varied with the nutrients under consideration and with the distribution factors considered (Figure 3).

N, P and K in-flows seemed to be evenly distributed between imported organic fertiliser (IN1a), wet and dry

atmospheric deposition (IN3), N-fixation (IN4) and to a lesser extent the minerals in harvested produce. This, however, was not the case for out-flows as the proportions varied considerably with the nutrients considered. First, the greatest nutrient loss was that of nitrogen, and this was mainly attributed to leaching (~70%), volatilization (~20%), and to exported crops and crop residues. Very little of P and K were lost from the farms. Instead, these

0

10

20

30

40

50

Plan

tain

Cas

sava

Pum

pkin

Mai

ze

Mai

ze

Ric

e

Pine

appl

e

Tar

o/C

ocoy

am

Yam

Ban

ana

Bea

n

Freq

uenc

y (%

)

a

0

10

20

30

40

50

Coc

oa

Oil

pal

m

Rub

ber

Avo

cado

Nja

nsan

g

Papa

ya

Cas

hew

Gua

va

Man

go

Ora

nges

Plum

Freq

uenc

y (%

)

b

Figure 2. Frequency of occurrence of the main (a) annual crops and (b) perennial crops associated in the perennial crop based smallholdings.

0

5000

10000

15000

20000

25000

30000

Min

eral

fert

ilis

er, I

N1

Impo

rted

org

anic

fert

ilis

er, I

N2a

Impo

rted

man

ure,

IN2b

Atm

osph

eric

depo

siti

on, I

N3

N-f

ixat

ion,

IN4

Har

vest

s, O

UT

1

Exp

orte

d cr

opre

sidu

es, O

UT

2a

Man

ure

excr

etio

nou

tsid

e fa

rm, O

UT

2b

Lea

chin

g, O

UT

3

Gas

eous

loss

, OU

T4

Ero

sion

, OU

T5

Qua

ntit

y of

nut

rien

ts t

rans

ferr

ed, g

-40000

-30000

-20000

-10000

0

10000

20000

Full balance Partial balance

Nu

trie

nts

tra

nsf

erre

d (

kg/

ha)

N P K

Figure 3. Overall N-P-K nutrient flows for the farms studied, as well as the specific full and partial balance of N-P-K nutrient transfers (insert).



43

nutrients were mostly obtained from imported organic fertilisers and atmospheric deposition. These figures were confirmed by the rather different overall balances, negative for nitrogen and positive for phosphorus and potassium (Figure 3(a)). On ignoring all losses due to leaching (partial nutrient balance), the overall figures became positive for the three elements, especially for N (Figure 3, insert). This demonstrated that farmers may have inadv- ertently compensated for depletion provoked by harvesting of farm produce by returning global biomass at the plot level.

3.3. Nutrient Flows between Farm Units

Full and partial balances of the nutrients showed large differences between farm units (Figure 4). Whereas all farm units had negative full balances for nitrogen (Figure 4(a)), only about one-quarter of them had a negative par-tial balance for that nutrient (Figure 4(b)). This situation was slightly different for K transferred, but much differ-ent for P. Indeed, almost all the farm units had positive full and partial balances for P while a small proportion of

them continued to have negative values for K for both the full and partial balances. These results indicate clearly that leaching might be the most important factor contributing to loss of soil nutrients, especially nitrogen.

When all the farms were considered as a farm section unit (FSU), the contribution of various modelled factors to the overall nutrient status (Figure 5) as well as to the full and partial nutrient balances (Figure 5, insert) changed considerably. From these, it could be shown that atmospheric deposition was responsible for most of the N- nutrient transferred into the FSU, followed by N fixation and imported organic fertiliser. Once more, leaching and gaseous loss accounted for most of the N loss while harvested produce and the exported crop residues accounted for P and K loss.

Net nutrient losses in soil N, P and K were much more pronounced in cocoa and oil palm based fields than the Hevea ones. This will certainly be related to the multi-plicity of products harvested from the oil palm and cocoa fields compared to the rubber fields which give essen-tially C, captured though photosynthesis.

-90

-60

-30

0

30

60

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

Ful

l bal

ance

of n

utri

ents

tran

sfer

red,

kg/

ha - N - - P - - K -a

-40

-20

0

20

40

60

80

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

Par

tial

bal

ance

of n

utri

ents

tran

sfer

red,

kg/

ha - N - - P - - K -b

Figure 4. Specific full and partial balance of overall N-P-K nutrient transfers for the individual farm units.



44

0

6000

12000

18000

24000

30000

Min

eral

fert

ilis

er,

IN1

Imp

orte

d o

rgan

icfe

rtil

iser

, IN

2a

Atm

osp

her

icd

epos

itio

n, I

N3

N-f

ixat

ion

, IN

4

Har

vest

s, O

UT

1

Exp

orte

d c

rop

resi

du

es, O

UT

2a

Lea

chin

g, O

UT

3

Gas

eou

s lo

ss,

OU

T4

Ero

sion

, OU

T5

N a

nd

P tr

ansf

erre

d, g

/ha

0

150

300

450

600

750

K tr

ansf

erre

d, g

/ha

N K P-7500

-6000

-4500

-3000

-1500

0

N P K

Nu

trie

nt b

alan

ce, g

/ha

Full Partial

Figure 5. Contribution of various factors to the N-P-K nutrient balance in the farm section unit (FSU) and their contributions to the total nutrient balance (insert).

Table 2. Flows per unit outside the farm for the entire farm section unit.

(a) Rubber farm

Movement Material Fresh, kg/ha Dry, kg/ha N, kg/ha P, kg/ha K, kg/ha

OUT Rubber coagula 737 295 0.8 0.3 0.8

OUT Pineapple fruit 4 1 0.0 0.0 0.0

IN Formic acid 4 4 0.0 0.0 0.0

IN Ethrel 1 1 0.0 0.0 0.0

(b) Oil palm farm

in/out material Fresh, kg/ha Dry, kg/ha N, kg/ha P, kg/ha K, kg/ha

OUT Cassava - tuber 467 177 0.7 0.1 0.7

OUT Oil palm nuts 459 459 10.7 15.6 20.9

OUT Palm oil 3560 3560 12.1 160.2 12.7

OUT Pumpkin – seeds 80 72 0.6 0.1 0.2

IN Calash 1 1 0.0 0.0 0.0

IN 20/10/10 5 5 1.0 0.2 0.4

IN Maize - grain 4 3 0.1 0.0 0.0

IN Okra - grain 0 0 0.0 0.0 0.0

IN Plantain - sucker 70 70 0.3 0.3 0.1

IN Yam - tuber 23 6 0.0 0.0 0.0

IN Pumpkin - grain 11 10 0.1 0.0 0.0

IN Insecticides 1 1 0.0 0.0 0.0

IN Plantain - bunch 23 4 0.0 0.0 0.0

IN Maize – cob 30 26 0.4 0.1 0.1

IN Taro/cocoyam tuber 15 15 0.1 0.1 0.2



45

(c) Cocoa farm

in/out Material Fresh, kg/ha Dry, kg/ha N, kg/ha P, kg/ha K, kg/ha

OUT Cocoa - grain 122 122 4.0 5.6 0.4

OUT Pineapple - fruit 3 1 0.0 0.0 0.0

OUT Plantain - bunch 3681 626 0.8 0.2 2.8

OUT Rice - grain 60 54 0.6 0.2 0.2

OUT Cassava - processed 70 27 0.1 0.0 0.1

OUT Groundnuts 220 209 7.8 1.3 1.7

IN Potato – tuber 10 2 0.0 0.0 0.0

IN Cocoa - seedlings 450 450 9.0 2.1 1.5

IN Rice - grain 68 61 0.7 0.2 0.2

IN Cassava - tuber 78 29 0.1 0.0 0.1

IN Maize – cob 338 294 4.9 1.2 1.4

IN Plantain - sucker 395 395 1.4 1.8 0.7

IN Cocoa – seeds 560 560 18.5 25.8 2.0

IN Taro/cocoyam tuber 50 50 0.2 0.3 0.6

Economic analyses, which formed a related aspect of

this study but presented elsewhere [18], showed that cash crops, as compared to staple crops, could be more profit- able and often associated with less negative nutrient balances than food crop because more inputs were invested in them (Table 2). At farm level, a higher nutrient loss was calculated for the more heavily intercropped fields, notably oil palm and cocoa. Indeed, these fields suffered the greatest nutrient depletion due to the multiple forms in which their products were harvested. As shown in Table 2, the Hevea fields mostly lost their nutrients following tapping and draining of their latex whereas the oil palm lost its nutrients through its harvested bunches (seeds, kernels and leaves).

As our results would indicate, nutrient balance models are valuable when using data obtained from a site or set of sites to extrapolate to larger areas [4]. However, there are limitations inherent to such aggregations, notably with respect to the representativeness of sample site(s) and the applicability of data collected at one scale (geograp- hic or temporal) in representing processes, which may occur at broader scales [19]. NUTMON is a multi-scale approach that assesses stocks and flows of some macro-nutrients (N, P and K only) in a well defined geographical unit. It is often considered as pragmatic to carry out nutrient audits after calculating nutrient balances and evalua- ting trends in nutrient mining/enrichment [20]. The NU- TMON model has therefore been widely adopted though the several major simplifications (coefficients for crop residue removal are the same for all crops) and its inability to measure effects of interactions between the nutri-ents seem to make the results less reliable [21,22]. Furth- ermore, the model ignores data on carbon sequestration, a factor that would much improve its usefulness and applicability.

4. Conclusions

Overall N-P-K flows varied with the nutrients and the distribution factors considered. The in-flow of these nutria- nts was evenly distributed between dry atmospheric deposition, N-fixation and the harvested produce. Nitrog- en was the nutrient lost in greatest amounts, due essenti- ally to leaching, gaseous loss and harvesting of crops and their residues. Less important amounts of P and K were lost from the farms as substantial amounts were obtained from imported organic fertilisers and atmospheric deposition. Large differences were observed between farm units with respect to their full and partial balances of the nutrients. Despite the sustained productivity within perennial crop-based cropping systems, all farm units had negative balances for N and almost none for P and K. Net nutrient losses in soil N, P and K were much more pronounced in cocoa and oil palm based fields than the Hevea ones, probably because of the multiplicity of products harvested from former fields. The more heavily intercropped fields were subjected to greater nutrient depletion. These results could nonetheless be treated with some ca- ution and the Nutmon software revised to eliminate its several major simplifications, its inability to measure effects of interactions between the nutrients, and its non-uti- lisation of carbon sequestration data, all of which seem to make the results less reliable.

5. Acknowledgements

This work was undertaken in the framework of the ATP CARESYS Project and funded by the Centre Internatio- nal de Coopération en Recherche Agronomique pour le Développement (CIRAD). The Logistic and other support of the Regional Directorate of CIRAD for Central Africa are highly appreciated.



46

REFERENCES [1] J. Kanmegne, “Slash and Burn Agriculture in the Humid

Forest Zone of Southern Cameroon: Soil Quality Dyn- amics, Improved Fallow Management and Farmers’ Per-ceptions,” PhD Thesis, Wageningen University and Re-search Centre, 2004.

[2] H. V. D. Bosch, A. de Jager and J. Vlaming, “Monitoring Nutrient Flows and Economic Performance in African Farming Systems (NUTMON) II. Tool Development,” Agriculture, Ecosystems and Environment, Vol. 71, No. 1, December 1998, pp. 49-62.

[3] A. de Jager, S. M. Nandwa and P. F. Okoth, “Monitoring Nutrient Flows and Economic Performance in African Farming Systems (NUTMON) I. Concepts and Method-ologies,” Agriculture, Ecosystems and Environment, Vol. 71, No. 1, December 1998, pp. 39-50.

[4] E. M. A. Smaling and L. O. Fresco, “A Decision Support Model for Monitoring Nutrient Balances under Agricul-tural Land Use (NUTMON),” Geoderma, Vol. 60, No. 1-4, December 1993, pp. 235-256.

[5] U. Surendran, V. Murugappan, A. Bhaskaran and R. Jaga- deeswaran, “Nutrient Budgeting Using NUTMON-Tool- Box in an Irrigated Farm of Semi-Arid Tropical Region in India: A Micro-and Meso-Level Modelling Study,” World Journal of Agricultural Sciences, Vol. 1, No. 1, January 2005, pp. 89-97.

[6] E. E. Ehabe, M. T. Besong and S. W. Almy, “Late and Infrequent Weeding by Peasant Farmers in the Humid Forest of Cameroon,” Tropical Science, Vol. 41, No. 3, September 2001, pp. 137-141.

[7] F. L. Sinclair, “A General Classification of Agro-Forestry Practice,” Agroforestry Systems, Vol. 46, No. 2, Septem-ber 1999, pp. 161-180.

[8] S. J. Epale, “Plantations and Development in Western Ca- meroon. 1885-1975. A Study in Agrarian Capitalism,” Vantage Press Inc., New York, 1985.

[9] C. Plaza “Situation de l'hévéaculture Villageoise dans une Filière en Évolution: Cas de la Région d'Ekona, Province du Sud-Ouest Cameroun,” M.Sc. Thesis, Université Mon- tpellier I, France, 2003.

[10] M. T. Besong, S. W. Almy and B. Bakia, “Land Produc-tivity of Small Farm Holders in South West Province of Cameroon,” International Journal of Tropical Agricul-ture, Vol. 11, No. 1, March 1993, pp. 81-87.

[11] J. Jones and J. Benton, “A Kjeldahl Method of Nitrogen

Determination,” Micro-Macro Publishing Inc., Athens, Geor-gia, USA, 1991.

[12] R. H. Bray and L. T. Kurt, “Determination of Total Org-

anic Available Forms of Phosphorus in Soils,” Soil Sci-ence, Vol. 59, No. 1, January 1945, pp. 39-45.

[13] C. A. Black, “Methods of Soil Analysis,” American Soci-ety of Agronomy, No. 9, Part 2, Madison, Wiscosin. 1965.

[14] M. L. Jackson, “Soil Chemical Analysis,” Prentice Hall, New York, 1962.

[15] A. L. Tisdall, “Comparison of Methods of Determining Apparent Density of Soils,” Australian Journal of Agri-cultural Research, Vol. 2, No. 4, December 1951, pp. 349- 354.

[16] B. R. Brasher, D. P. Franzmeier, V. Valassis and S. E. Da- vidson, “Use of Saran Resin to Coat Natural Soil Clods for Bulk Density and Moisture Retention Measurements,” Soil Science, Vol. 101, No. 2, February 1966, pp. 108- 222.

[17] J. Vlaming, A. de Jager, R. van den Bosch, G. Mei-jerink, C. van Beek , S. van Wijk and H. van Keulen, NUTMON Toolbox-Data Background, Data Entry, and Data Processing Modules, v3.5-1. "Atambua". Jointly published by Envista Consultancy, Agricul-tural Economics Research Institute (The Nether-lands), Alterra Consultancy and Plant Research In-ternational (The Netherlands), 2006. http://www monqi.org/

[18] G. S. Rodrigues, I. de Barros, E. E. Ehabe, P. Sama-Lang and F. Enjalric, “Integrated Indicators for Performance Assessment of Traditional Agroforestry Systems in South West Cameroon,” Agroforestry Systems, Vol. 77, No. 1, September 2009, pp. 9-22.

[19] P. Drechsel, M. Giordano and L. Gyiele, “Valuing Nutri-ents in Soil and Water: Concepts and Techniques with Examples from IWMI Studies in the Developing World,” Research Report 82, Colombo, International Water Man-agement Institute, Sri Lanka, 2004.

[20] U. Surendran and V. Murugappan, “Pragmatic Approach- es to Manage Soil Fertility in Sustainable Agriculture,” Journal of Agronomy, Vol. 9, No. 2, January 2010, pp. 57-69.

[21] N. R. Rabindra and R. V. Misra, “Soil Nitrogen Balance Assessment and its Application for Sustainable Agricul-ture and Environment,” Science in China Series C - Life Sciences, Vol. 48, No. 6, January 2005, pp. 843-855.

[22] U. Surendran and V. Murugappan, “Nutrient Budgeting in Tropical Agro Ecosystem-Modeling District Scale Soil Nutrient Balance in Western Zone of Tamil Nadu Using Nutmon-Toolbox,” International Journal of Soil Science, Vol. 2, No. 3, September 2007, pp. 159-170.



47


Feihu Liu1*, Fei Li1, Xueni Liang2

1Faculty of Life Science, Yunnan University, Kunming, China; 2College of Adults and Professional Education, Yunnan University, Kunming, China. Email: *[email protected] Received August 9th, 2010; revised August 27th, 2010; accepted August 31st, 2010

ABSTRACT

Seeds of three Anemone species were collected from the suburban areas of Kunming and planted in a nursery for three and a half years at Kunming, Yunnan Province, China. Leaf gas exchange measurement indicated that these species had similar one-peak diurnal trends of net photosynthetic rate (PN), although A. rivularis had lower transpiration rate (TR), stomatal conductance (gs) and intercellular CO2 concentration (Ci), and higher stomatal limit in the afternoon. Species differences in response of PN to photosynthetically active radiation (PAR) were observed, especially under strong light. A. rivularis had the highest PN and Ci under strong light which corresponded with its highest gs and TR. A. rivularis had the highest light saturation point (LSP) (1000 mol m-2 s-1) and light compensation point (LCP) (69 mol m-2 s-1), while A. hupehensis var. japonica had the lowest LSP (800 mol m-2 s-1) and a lower LCP (53 mol m-2 s-1). But the three species responded similarly to the change of CO2 concentration in the air from 0 to 350 mol (CO2) mol-1, and their observed CO2 compensation point showed little difference (47, 53 and 56 mol (CO2) mol-1). Moreover, A. rivu-laris had the highest apparent quantum yield (0.032), carboxylation efficiency (0.049), PN (11.68 mol (CO2) m

-2 s-1) and TR (5.36 mmol (H2O) m-2 s-1) based on the PN -PAR response. The results implied that A. rivularis is able to grow well under higher radiation, while A. hupehensis var. japonica is the best one to grow under partial shade. Keywords: CO2 Compensation Point, Gas Exchange, Light Compensation Point, Light Saturation Point

1. Introduction

Anemone is a newly developed species for cut flowers that is also used as a potted plant. Many commercial Ane- mone varieties have been released in other countries [1]. Anemone is an important genera (25 species, 4 subspe-cies, and 9 varieties) in Yunnan province, China [2]. Inv- estigations have been reported on taxonomy, cytology and pollen morphology of Anemones [3, 4] and breeding studies were carried out by Hoot [5], Jacob [6] and Lind- ell [7]. However, photosynthesis has not been document- ed for the genus.

Many studies are being done on development and utilization of wild flower species for ornamental purpose, of which cultivation of the wild species is one of the impor-tant challenges [1]. Three wild Anemone species, collected from Yunnan Province, were successfully cultured in a suburban plant nursery at Kunming, but they showed different responses to the light environment. This was re- asonable in view of their in situ growth environment, and suggested the importance of controlling light intensity in

artificial culture of these wild plants. Consequently, these Anemone species were presumed to have their own pecu-liarities in photosynthesis. This paper aimed at studying the photosynthetic characteristics of Anemone species and their photosynthetic responses to the important components of the environment, providing knowledge for control-ling light conditions in the cultivation of Anemone spe-cies.


2.1. Plants and Cultivation

Three Anemone representative species were selected according to the distribution, leaf and plant form, and growth habit. Seeds were collected from the suburban areas of Kunming, Yunnan Province, China. A. vitifolia Buch.- Han. Ex DC. (growing on a stony hillside at 2200 m a.s.l), A. rivularis Buch.-Han. Ex DC. (growing on a grass hill-side under sparse trees at 2230m a.s.l.) and A. hupehensis Lemoine var. japonica (Thunb.) Bowles et Stearn (growing on a limestone wall at 2180 m a.s.l). Seedlings from



48

seeds planted in a suburban nursery of light loam soil with satisfied drainage at Kunming in early spring of 2000 (random block design with three replicates, at density of 20 40 cm in 3 m2 plots). The plants had grown under light shade of trees (50%-100% of natural sunshine, var-ied along with the angle of incidence), for three and a half years at which time the tests were carried out.

Kunming (2501’E, 10241’N, 1896m a.s.l) has a dry season from November through April and a wet season from May through October, with a yearly mean temperature of 14.9˚C, RH of 72%, and an annual rainfall of 1011 mm. The full natural sun radiation at the experimental site was recorded equivalent photosynthetically active radiation 1500-2000 μmol m-2 s-1 on cloud-free days throughout the growth season. The soil prior to the experiment contained 150.3 mg kg-1 hydrolysable nitrogen, 25.1 mg kg-1 available phosphorus, 250.3 mg kg-1 available potassium, 5% of organic matter and with a pH 7.45.

The plants were watered if necessary to avoid water stress during the growing season and were fertilized twice a year before flowering, each time with 80 kg ha-1 of urea (46% of N), 100 kg ha-1 of normal calcium superph- osphate (18% of P2O5) and 65 kg ha-1 of potassium sulfa- te (50% of K2O). The plants showed normal growing, flowering, and fruit setting. The biomass was tested for the species by harvesting all the plots when photosynthesis measurement finished.

2.2. Photosynthesis Measurements and Environmental Data

In late July, 2003 during flower bud stage, net photosyn-

thetic rate (PN) (3 plants per species, the last fully exp- anded leaf per plant) in the three species was measured in the field by a portable gas-exchange analyzer (LI-6400, LICOR, Lincoln, NE, USA) (tested leaf area 6cm2, air flow rate 400μmol s-1, stomatal ratio 0.5, a long tube was used to draw the inlet air far from the operator in order to minimize human impact on the CO2 levels). Stomatal conductance (gs), intercellular CO2 concentration (Ci), tran-spiration rate (TR), air temperature (Ta), ambient CO2

concentration (Ca), relative air humidity (RH) and photosynthetically active radiation (PAR) were also recorded.

Diurnal trend of PN was analyzed at 1-hour intervals from 0700 to 1900 h on a cloud-free day. This was repeated on one subsequent cloud-free day. Leaf water use efficiency (LWUE) was calculated as PN / TR [8], and stomatal limitation (Ls) as (Ca - Ci) / Ca [9]. The environmental conditions were recorded by the LI-6400 instrument as shown in Figures 1(a), (b). Ca and RH did vary con-siderably from early morning to nightfall.

The response of photosynthesis to light intensity was measured. PN was tested from 0830-1130 h on a cloud- free day respectively under PAR 2000, 1800, 1600, 1400, 1200, 1000, 800, 600, 400, 200, and 0 μmol m-2 s-1 (using 6400-02B light source) to set up a response of photosyn-thesis to light intensity, when Ta, RH, and Ca were 22.5-28˚C, 45-65%, and 360-375 μmol (CO2)

mol-1. On one subsequent cloud-free day from 0830-1030 h, PN was tested respectively under PAR 800, 600, 400, 200, 80, 40, and 0 μmol m-2 s-1 to determine accurate light compensation points in different species, when Ta, RH, and Ca were 23-26.5˚C, 50-65%, and 365-375 μmol

Figure 1. Diurnal trends of the photosynthetically active radiation (PAR), air temperature (Ta), ambient CO2 concentration (Ca), relative humidity (RH), net photosynthetic rate (PN) and transpiration rate (TR) in the domesticated Anemone species. The symbols and the vertical bars in the figure were mean ± standard deviation.



49

(CO2)

mol-1. Sample leaves were first exposed to the highest PAR. When a constant PN was achieved PAR was lowered step by step to total darkness. At each step, a constant PN was achieved prior to recording the data. The apparent quantum yield (AQY) was calculated as the initial slope of the regression PN on PAR under condi-tions of PAR 0, 40 and 80 μmol m-2 s-1 [10-12].

Light saturation points (LSP) were the turning point areas on the curves in Figure 3(a), while light compen-sation points (LCP) were derived from the linear correla-tion of PN and PAR when PAR 80 μmol m-2 s-1 (Figure 4), here the constant dependent X (PAR) was considered as LCP, i.e., the PAR value when PN = zero. CO2 compensation points (CCP) was determined by the linear corre-lation between PN and Ca when Ca 100 μmol (CO2) mol-1 (Figure 5(a)), here the constant dependent X (CO2) was considered as CCP, i.e., the CO2 value when PN = zero.

The response of photosynthesis to CO2 concentration was measured from 0900-1100 h on another cloud-free day, when Ta and RH were 24-27˚C and 55-65%. PAR was set at 1200 μmol m-2 s-1 based on the PN-PAR re-sponse (see Figure 3(a)), and Ca was set at 0, 50, 100, 150, 200, 250, 300, and 350 μmol (CO2) mol-1 by adjust-ing the instrument. The carboxylation efficiency (CE) was calculated as the initial slope of the regression PN on Ci under conditions of Ca 0, 50 and 100 μmol (CO2) mol-1 [9,13].

2.3. Data Analysis

PN and TR values at the seven PAR settings i.e. 800, 1000,

1200, 1400, 1600, 1800 and 2000 μmol m-2 s-1 were used for comparing PN and TR among species. Specific dif-ference was determined by LSD test (Fisher) at = 0.05. Post hoc comparisons for the data in Table 1 and all dia-grams were carried out using Statistica 5.0 (StatSoft Inc. (1995) STATISTICA). The vertical bars in the figures were means ± standard deviations (SD).

3. Results

3.1. Diurnal Patterns of PN and the Related Pa-rameters

The three species had similar one-peak diurnal trends of PN showing an asymmetric parabola-like curve (Figure 1(c)). A. vitifolia had a maximum PN at 1000 h, the other two at 1100 h. At 1000, 1300-1500 and 1700-1800 h, A. rivularis had lower PN values than A. vitifolia. TR showed the same trend peaking at 1300 h (Figure 1(d)), but A. rivularis had lower TR than the other two from 1200-1700 h.

The diurnal trends of gs in the three species were similar, but species differences could be seen from the height of peaks and curves, as well as the timing of peak value (Figure 2(a)). Ci decreased up to 1000 h and increased after 1700 h (Figure 2(b)), showing little change from 1000 to 1700 h at about 280 μmol (CO2) mol-1, with A. rivularis being exceptionally low, the result from the lower values of gs (Figure 2(a)).

LWUE peaked at 0900 h, decreasing from 0900 h to 1100 h due to TR increase (Figure 1(d)), then remaining

Figure 2. Diurnal trends of the stomatal conductance (gs), intercellular CO2 concentration (Ci), leaf water use efficiency (LWUE, = PN / TR) and stomatal limitation (Ls, = (Ca - Ci) / Ca) in the domesticated Anemone species. The symbols and the vertical bars in the figure were mean ± standard deviation.



50

Figure 3. Responses of the net photosynthetic rate (PN), intercellular CO2 concentration (Ci), transpiration rate (TR) and stomatal conductance (gs) to photosynthetically active radiation (PAR) in the domesticated Anemone species. The symbols and the vertical bars in the figure were mean ± standard deviation.

constant until 1800 h (Figure 2(c)). Ls showed diurnal variations and all the species maintained high Ls values from 1000 h to 1700 h (Figure 2(d)), but A. rivularis had the highest values of Ls from 1200 – 1600 h.

3.2. Response of Photosynthesis to Light Intensity

PN responses to PAR of the considered species showed significant differences under the light intensity of 400 through to 2000 μmol m-2 s-1. Under this condition, A. rivularis had the highest PN, and A. hupehensis var. japonica had the lowest, showing their difference in sensitiv- ity to light intensity (Figure 3(a)). PN increased rapidly when PAR increased from zero to 600 or 800 μmol m-2 s-1, although light depression of photosynthesis was not observed within the short time (0900-1100 h) when PAR did not exceed 1800 μmol m-2 s-1. LSPs were 1000 μmol m-2 s-1 for A. rivularis and A. vitifolia, and 800 μmol m-2

s-1 for A. hupehensis var. japonica (Figure 3(a)). LCPs of A. vitifolia, A. hupehensis var. japonica and A. rivu-laris were 47 1.2 (SD), 53 1.4 and 69 1.6 μmol m-2 s-1 (Figure 4).

Ci responded to light intensity reversal to PN (Figure 3(b)) and reached 380-410 μmol (CO2) mol-1 when the leaf was put in dark (PAR = 0). A. rivularis had higher Ci values than the other two under light intensity of 200-2000 mol m-2 s-1. Correlation analysis showed a significantly negative correlation between PN and Ci (r = –0.93*, data not shown). Moreover, Anemones showed a

stable TR that was influenced little by the increasing PAR (Figure 3(c)), and A. rivullaris had the highest TR values that corresponded with gs (Figure 3(d)).

3.3. Response of Photosynthesis to CO2 Concentration

To estimate CCP and CE, PN responses of the Anemone species were measured under a range of Ca from 0 to 350 μmol (CO2) mol-1. PN increased when Ca increased from

0 40 80 200 400 600 800

PAR [mol m -2 s-1]

-4

0

4

8

12

PN

[m

ol (

CO

2) m

-2 s

-1]

A. vitifolia A. rivularis A. hupehensis var. japonica

Figure 4. Photosynthetic rate (PN) of the Anemone species under low photosynthetically active radiation (PAR) show-ing the light compensation point. The symbols and the ver-tical bars in the figure were mean ± standard deviation.



51

Figure 5. Responses of the net photosynthetic rate (PN) and intercellular CO2 concentration (Ci) to ambient CO2 con-centration (Ca) in the domesticated Anemone species. The symbols and the vertical bars in the figure were mean±standard deviation.

0 to 350 μmol (CO2) mol-1, showing insignificant differences among the considered species (Figure 5(a)). Ci showed same response to the change of Ca (Figure 5(b)). CCP was 47 1.0 (SD) μmol (CO2) mol-1 for A. vitifolia, 53 1.1 for A. rivularis and 56 1.4 for A. hupehensis var. japonica (Figure 5(a)).

3.4. Differences in PN, TR, CE, AQY and Biomass

PN and TR were compared according to the data of PN / TR-PAR responses within PAR 800-2000 μmol m-2 s-1 and showed significant specific difference (Table 1). A. rivularis had the highest PN and TR, while A. hupehensis var. japonica had the lowest. The specific difference was observed in biomass that showed a close correlation with

PN (r = 0.991*, Table 1). CE varied from 0.036 to 0.049 among the species with

A. rivularis having the highest CE. The specific differ-ence in CE showed a close correlation with PN values (r = 0.999*, Table 1). AQY was in the range 0.023 to 0.032; A. rivularis again had the highest value. AQY was also closely associated with PN values (r = 0.999*, Table 1).

4. Discussion

4.1. Diurnal Trend of Photosynthetic Rate

In this experiment, the major environmental factors, PAR, Ta and air RH changed remarkably during the day as shown in Figures 1(a), (b). This situation is normal at our experimental site and is the driver of PN daily change. No increase of PN was observed in the afternoon while a midday depression in photosynthesis was found in Anemone species collected from the alpine region in suburban areas of Kunming (1896 m a.s.l.). PN increased before 1000 or 1100 h and decreased from 1000 or 1100 h (dependent on species) onwards. The increase of PN in the morning was driven by the increase of PAR and gs (Fig-ures 1(a), (c); Figure 2(a)), and decrease of PN from the late morning to the afternoon was caused by the decrease of gs (Figure 1(c); Figure 2(a)). A close link between PN and gs and/or PAR (only in the morning) was observed in the investigation of the diurnal trends of photosynthetic rate for Ginkgo biloba, Paspalum notatum, and Enkleia malaccensis [14-16]. Whereas gs decrease in this ex-periment resulted from the integrative action of adverse ecological factors such as the rise of Ta (> 30˚C), de-crease of air RH (< 35%) and Ca (< 386 μmol (CO2) mol-1), and strong light (> 1500 μmol m-2 s-1) (Figures 1(a), (b)). A strong light of no more than 1800 μmol m-2 s-1 did not depress the photosynthesis of the Anemones in the field (Figure 3(a)). This may reflect the intrinsic adaptation of the Anemone species to the mild ecological environments in their native habitats of moderate Ta, higher air RH but strong light. The decrease of gs from 1000 or 1100 h on-wards and the decrease of TR in the afternoon were caused by the increase of stomatal limitation (Ls)

Table 1. Carboxylation efficiency (CE), apparent quantum yield (AQY), Photosynthetic rate (PN), transpiration rate (TR) and biomass of the Anemone species.

Taxon CE AQY PN TR Biomass (kg m-2)

A. rivularis 0.0491 0.0014a 0.0317 0.0005a 11.68 0.448a 5.36 0.354a 1.02 0.055a

A. vitifolia 0.0417 0.0011b 0.0275 0.0007b 9.25 0.346b 3.22 0.351b 0.83 0.071b

A. hupehensis var. japonica 0.0355 0.0013c 0.0229 0.0009c 8.05 0.420c 2.96 0.372b 0.78 0.069b

PN and TR values at the seven PAR settings i.e. 800, 1000, 1200, 1400, 1600, 1800 and 2000μmol m-2 s-1 were used for comparing PN and TR among species. Numbers in the table are means SD. Same letters show no statistical difference among species by LSD test (Fisher) at = 0.05. Correlation coefficients of PN –AQY and PN–Biomass were 0.999* and 0.991*.



52

(Figure 1(d); Figures 2(a), (d)). Here TR seemed to have a delayed response to the change of Ls, but in fact TR was tightly linked to the increasing Ta, PAR and va-por pressure deficit based on leaf temperature (VpdL), and decreasing RH (Correlation coefficients of TR with PAR, Ta, VpdL and RH were derived as 0.89*, 0.86*, 0.61* and –0.72*, respectively) (data not shown). This led to a high level of TR around noon even though at this time gs decreased and/or Ls increased. Therefore, PAR, Ta and RH were the major drivers of TR (Figures 1(a), (b) and (d)), as VpdL negatively correlated with RH (r = –0.94*) (data not shown).

The decrease of Ci is the major criterion for verifying Ls if PN decreased or stayed at a low level [17]. In our experiment, Ci obviously decreased in the morning be-fore 1100 h that reflected the normal changes from night (where Ci increased over time because of respiration) to daytime from increased intercellular CO2 use resulting from increasing photosynthesis. The decrease of Ci in A. rivularis from 1100 h until 1600 h (Figure 2(b)) was likely caused by the decrease of gs (Figure 2(a)) since PN decreased as well during this period (Figure 1(c)) and water stress was avoided by watering. Based on the above argument, the decrease of PN from the late morn-ing to the afternoon was mainly caused by a shortage of CO2 resulted from an increase of Ls and decrease of gs (Figure 1(c); Figures 2(a), (d)). It is well known that the increase of Ci is the reason for non-stomatal limitation of photosynthesis when PN is at a low level [18]. Therefore, the rapid decrease of PN after 1700 h was caused by an increase of non-stomatal limitation (e.g., carboxylation resistance) that quite likely resulted from the decrease of PAR (Figure 1(a)), for even if gs was at a low level, Ci increased and Ls decreased rapidly during this time. There is a strong correlation between PN and gs because stomata respond to the changes in assimilation via Ci. Correlation analysis revealed a significantly positive correlation between PN and gs (r = 0.77*), and a negative correlation between PN and Ci (r = –0.73*) (data not shown).

When PAR was set to zero, the PN values of –2.5- –2.0 μmol (CO2) m

-2 s-1 might reflected the respiration rates of the Anemones under the experimental conditions (Figure 4).

4.2. Response of Photosynthesis to Light Intensity

In lettuce [19], tobacco [20], and Phaseolus vulgaris [21], PN along with the increase of light intensity increased to a peak, then decreased if the light intensity increased further. However, in ramie (Boehmeria nivea (L.) Gaud.) [22], tomato [23], cucumber [17], and cotton [24], as light intensity increased, PN increased and kept on at a high

level within a wide range of light intensity. The depres-sion of photosynthesis in tobacco when PAR > 600 μmol m-2 s-1 was due to the reduction in activities of PSI and PSII, carbonic anhydrase and electron transfer speed [20]. A large decrease in stomatal conductance to water va-pour in Phaseolus vulgaris leaves exposed to strong light was found [21].

In our experiments, strong light of no more than PAR 1800 μmol m-2 s-1 did not depress photosynthesis, although differences were observed in utilization of light energy under high light intensity (Figure 3(a)) with ade-quate soil water, Ta 23-30˚C and RH 45-65%. Further-more, the sample leaf was put under a strong light for a few minutes for achieving a constant PN before going to a lower PAR. Therefore, it needs more investigations to uncover whether or not the Anemone species have a photosystem insensitive to the change of light intensity. The experiment results, based on single leaf test, sug-gested that PAR 800-1000 μmol m-2 s-1 is enough for a satisfactory PN and meets the needs for photosynthetic products for normal growth and development of Anem-one cultivation.

Among the three species, A. rivularis was from a grass hillside under sparse trees with good sunshine and had a different response to light from other species, showing a high LCP and LSP. Whereas, A. hupehensis var. japonica was from a limestone wall with only intermittent sunshine and is probably less well adapted to continuous strong light. The light response data, low LCP and LSP, and low maximum PN value all indicated that this species is the best one to grow under partial shade.

4.3. Response of Photosynthesis to CO2

Among PN, TR, gs, and Ci, only PN and Ci were observed to increase regularly as Ca increased, and the response of PN and Ci to the change of Ca showed little difference among the species (Figures 5(a), (b)). When Ca was set to zero, PN was –3 μmol (CO2) m

-2 s-1 (Figure 5(a)) which was roughly considered as the sum of respiration and photorespiration under the experimental conditions. This was unlike the PN values at PAR = 0 μmol m-2 s-1 where the minus PN values just presented the respiration rates. The CO2 saturation curve of photosynthesis in the con-sidered species is still in need of study.

A higher CCP (60-75 μmol (CO2) mol-1), but a much lower LCP (13-28 μmol m-2 s-1), and similar diurnal curves of PN and TR were observed in domesticated Pri-mula species collected from an alpine area of north-western Yunnan Province, China [25]. This reflected the similarity in photosynthetic daily patterns of Anemones and Primulas as alpine plants, and the dissimilarity in light and CO2 utilization qualities of plants of the two genera, which should be taken into consideration for their cultivation.



53

5. Conclusions

The Anemone species described here showed similar one- peak diurnal trends of PN, although A. rivularis had lower TR, gs, and Ci, and higher Ls in the afternoon. Spec- ific differences in response of PN to PAR were observed, especially under strong light. A. rivularis had the highest PN and Ci under strong light which corresponded with its high gs and TR. A. rivularis had the highest LSP (1000 mol m-2 s-1) and LCP (69 mol m-2 s-1), while A. hupe-hensis var. japonica had the lowest LSP (800 mol m-2 s-1) and a lower LCP (53 mol m-2 s-1). All these species responded similarly to the change of Ca from 0 to 350 mol (CO2) mol-1, and their CCP showed little difference. Moreover, A. rivularis had the highest AQY, CE, PN and TR based on the PN-PAR response. In conclusion, A. rivularis is able to grow well under higher radiation, while A. hupehensis var. japonica is the best one to grow under partial shade.

6. Acknowledgements

The authors are grateful to the reading and comments given by Gordon Rowland, University of Saskatchewan. Thanks are expressed to Su WH of Yunnan University for his kind help in the equipment operation.

REFERENCES [1] Y. L. Yuan, J. L. Zhao and W. P. XU, “Anemone of Mor-

phology Characteristic and Introduction Apply Study,” Acta Botanica Boreali-Occidentalia Sinica, Vol. 17, No. 5, 1997, pp. 134-136.

[2] Botanical Institute of Kunming CAoS, “Flora Yunna- nica,” Science Press, Beijing, Vol. 11, 2000, pp. 183-204.

[3] M. Y. Fang and M. Y. Yang, “A Study on Pollen Morph- ology and Evolution of the Genus Anemone from Sichu- an,” Journal of Sichuan University, Vol. 31, No. 2, 1994, pp. 246-258.

[4] Q. E. Yang, “Cytology of Ten Species in Anemone, One in Anemoclema and Six in Clematis (Trib. Anemoneae, Ranunculaceae) form China,” Acta Phytotaxonomica Sinica, Vol. 40, No. 5, 2002, pp. 396-405.

[5] S. B. Hoot, “Phylogenetic Relationships in Anemone (Ranu-culaceae) Based on Morphology and Chloroplast DNA,” Systematic Botany, Vol. 19, No. 1, 1994, pp. 169-200.

[6] Y. Jacob, “Breeding of Anemone Coronaria Tetraploid Hybrids,” Proceedings of the Seventh International Sym-posium on Flower Bulbs, Vol. II, Herzliya, Israel. Acta Horticulturae, Vol. 430, 1997, pp. 503-508.

[7] T. Lindell, “Breeding Systems and Crossing Experiments in Anemone Patens and in the Anemone Pulsatilla Group (Ranunculaceae),” Nordic Journal of Botany, Vol. 18, No. 5, 1998, pp. 549-561.

[8] J. J. Vacher, “Responses of Two Main Andean Crops, Quinoa (Chenopodium quinoa Willd) and Papa Amarga

(Solanum juzepczukii Buk.) to Drought on the Bolivian Altiplano: Significance of Local Adaptation,” Agriculture, Ecosystems & Environment, Vol. 68, No. 1-2, 1998, pp. 99-108.

[9] G. D. Farquhar and T. D. Sharkey, “Stomatal Conduc-tance and Photosynthesis,” Annual Review of Plant Phys- iology, Vol. 33, 1982, pp. 317-345.

[10] J. Ehleringer and O. Björkman, “Quantum Yields for CO2 Uptake in C3 and C4 Plants,” Plant Physiology, Vol. 59, No. 1, 1977, pp. 86-90.

[11] J. Ehleringer and R. W. Pearcy, “Variation in Quantum Yield for CO2 Uptake among C3 and C4 Plants,” Plant Physiology, Vol. 73, No. 3, 1983, pp. 555-559.

[12] Z. Y. Tao and Q. Zou, “Effect of Strong Irradiance and Shortly Elevated CO2 Concentrations on Photosynthetic Efficiencies in Maize and Soybean Leaves,” Acta Botanica Boreali-Occidentalia Sinica, Vol. 25, No. 2, 2005, pp. 244-249.

[13] Z. J. Wang, T. C. Guo, Y. J. Zhu, Y. H. Wang, J. H. Wang and M. Zhao, “Comparison of CO2 Assimilation Capacity in Flag Leaf for Super High Yield Wheat with Different Spike Type,” Acta Agronomica Sinica, Vol. 30, No. 8, 2004, pp. 739-744.

[14] S. Pandey, S. Kumar and P. K. Nagar, “Photosynthetic Performance of Ginkgo Biloba L. Grown under High and Low Irradiance,” Photosynthetica, Vol. 41, No. 4, 2003, pp. 505- 511.

[15] R. V. Ribeiro, G. B. Lyra, A. V. Santiago, A. R. Pereira, E. C. Machado and R. F. Oliveira, “Diurnal and Seasonal Patterns of Leaf Gas Exchange in Bahiagrass (Paspalum Notatum Flugge) Growing in A Subtropical Climate,” Grass and Forage Science, Vol. 61, No. 3, 2006, pp. 293 -303.

[16] A. C. Tay, A. M. Abdullah, M. Awang and A. Furukawa, “Midday Depression of Photosynthesis in Enkleia Ma-laccensis, a Woody Climber in a Tropical Rainforest,” Photosynthetica, Vol. 45, No. 2, 2007, pp. 189-193.

[17] D. H. Ma, J. A. Pang, Z. R. He and S. J. Li, “Effect of Environmental Factors on the Photosynthetic Characteris-tics of Cucumber Seedlings,” Acta Botanica Boreali-Occ- identalia Sinica, Vol. 12, No. 4, 1997, pp. 97-100.

[18] D. Q. Xu, “Some Problems in Stomatal Limitation Analy-sis of Photosynthesis,” Plant Physiology Communications, Vol. 33, No. 4, 1997, pp. 241-244.

[19] P. P. Li, Y. G. Hu, Y. G. Zhao, X. J. Ying and H. P. Mao, “Comprehensive Model on the Effect of CO2 Enrichment on Lettuce Photosynthesis in Greenhouse,” Transaction of the CSAE, Vol. 17, No. 3, 2001, pp. 75-79.

[20] L. Jiang, S. Q. Cao, X. Dai and X. M. Xu, “Effect of Dif-ferent Light Intensity on Photosynthesis of Tobacco,” Journal of Chinese Tobacco, Vol. 6, No. 4, 2000, pp. 17-20.

[21] L. Guidi, M. Tonini and G. F. Soldatini, “Effects of High Light and Ozone Fumigation on Photosynthesis in Phase-olus Vulgaris,” Plant Physiology and Biochemistry, Vol. 38, No. 9, 2000, pp. 717-725.



54

[22] Q. Q. Guo, “Study on the Photosynthetic Characteristics of Ramie Leaves in Different Varieties and Their Rela-tionship with Yield Formation of Ramie. II. The Physiol- Ecological Characteristics of Leaf in Photosynthesis,” Journal of Hunan Agricultural College, Vol. 17, No. 3, 1993, pp. 76-79.

[23] C. Stanghellini and J. A. Bunce, “Response of Photosyn-thesis and Conductance to Light, CO2, Temperature and Humidity in Tomato Plants Acclimated to Ambient and

Elevated CO2,” Photosynthetica, Vol. 29, 1993, pp. 487 -497.

[24] H. Z. Dong, W. J. Li, W. Tang and Z. H. Li, “Photosyn-thetic Characteristics of Field Grown Cotton Leaves,” Sh- angdong Agricultural Science, No. 6, 2000, pp. 7-10.

[25] F. H. Liu, S. M. Hou and X. N. Liang, “Gas Exchange Characteristics of Four Domesticated Primula Species,” New Zealand Journal of Crop and Horticultural Science, Vol. 34, 2006, pp. 403-411.

2010, 1, 1-54 · 2011. 9. 7. · the terms of a license issued by the national reproduction rights...

Documents