2011 unc asheville volleyball media guide
DESCRIPTION
2011 UNC Asheville Volleyball Media GuideTRANSCRIPT
11
General InformationMedia Information / Athletics Communication ................................................................2Primary Media Outlets ..........................................................................................................3
Season PreviewOutlook ................................................................................................................................. 4-5
PlayersRoster .................................................................................................................................... 6-7Cindi Miller ........................................................................................................................... 8-9Hallie Morse .....................................................................................................................10-11Holly Shelton ...................................................................................................................12-13Chelsei Kenley .................................................................................................................14-15Meredith Foster ..............................................................................................................16-17Jaimie Dorfman ................................................................................................................18-19Rachel Wells .....................................................................................................................20-21Alex Stewart ....................................................................................................................22-23Newcomers .............................................................................................................................24
Coaching StaffHead Coach Frederico Santos .....................................................................................25-26Assistant Coach Kellen Petrone ........................................................................................27
Records Section2010 Recap .............................................................................................................................302010 Big South Honors .......................................................................................................31Big South Conference Records .........................................................................................32The Big South Conference ...........................................................................................33-34The Big South Network .......................................................................................................35Season Records .....................................................................................................................38Career Records ...............................................................................................................39-40Year-By-Year Results ......................................................................................................41-43All-Time Results ....................................................................................................................442010 Statistics ........................................................................................................................45Hall Of Fame ..........................................................................................................................46All-Time Letterwinners .......................................................................................................47
UNC AshevilleThe University of North Carolina Asheville .............................................................48-51Dr. Anne Ponder, Chancellor ..............................................................................................52Janet R. Cone, Director of Athletics ...........................................................................53-54Support Staff ....................................................................................................................55-56Head Coaches .........................................................................................................................57Rocky .......................................................................................................................................58NCAA .....................................................................................................................................59The Bulldog Athletics Association .....................................................................................60
Bulldog Coaching StaffHead Coach..................................................... Frederico Santos
.................................................................. (UNC Asheville, 2007)
Overall/years .................................................................... 46-31/3
at Asheville ..............................................................0-0/First year
Conference ..............................................................................N/A
Assistant Coach .................................................. Kellen Petrone
...........................................................................(Duquesne, 2008)
2011 Team Information2010 Record .........................................................................19-12
2010 Big South Record/Finish .....................................11-5/3rd
Home Record .......................................................................... 8-1
Away Record ............................................................................ 7-6
Neutral Record ....................................................................... 4-5
Starters Returning/Lost ........................................................ 4/2
Letterwinners Returning/Lost ...............................................8/3
Volleyball Support StaffAthletic Trainer ................................................Andrea Kaufman
Athletics Communication ..................................Matt Pellegrin
Justice CenterCapacity ................................................................................. 1,100
Press Box Phone ............................................... (828) 545-1121
Message To MediaThis edition of the 2011 UNC Asheville Volleyball media
guide has been prepared for you as you cover the Bulldogs
during the season. For additional information, photographs,
interviews with players and coaches, please contact Matt
Pellegrin or Mike Gore in the Athletics Communication
Offi ce.
CreditsEditorMike Gore
Designer:Matt Pellegrin
Contributors:Everett Hutto, Nic Bowman, Mike Gore, Matt Pellegrin
Photographers:Brett Whitsell, Everett Hutto, Rebecca Nelms Keil and
Blake Madden
On the cover: Rachel Guinane (left), Kelsey Benorden
(center) and Jenna Dover (right)
UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.
UNC ASHEVILLE MISSION STATEMENT
22
Athletics Media Communications
Mike Gore Associate Athletics Director for
External AffairsOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387
Email: [email protected]
Matt PellegrinDirector of Athletics Media Communication/
Volleyball ContactOffi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: [email protected]
Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com
Mailing Address:One University Heights
Justice Center, CPO #2600Asheville, N.C. 28804
COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.
Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.
Broadcasts: There are two phone lines at the Justice Center for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.
Photographers: Photo passes are limited to working press photo-graphers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.
Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home volleyball match. After the match, each media member will receive a box score of the match. Phone lines are available on press row and fax service is available upon request.
Press Row: UNC Asheville’s working facilities are located on the South side of the Justice Center between the benches. Space is very limited, so please contact us early. We ask press, radio and television personnel to enter through the main gate. Only working press and game day operations personnel are allowed at the press table during games. No spouses, dates, children or friends are allowed. Your cooperation is appreciated.
Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the volleyball coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.
Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.
Video Streaming: UNC Asheville will once again video stream all of its home volleyball matches live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For match highlights or video of matches please contact Matt Pellegrin
MEDIA INFORMATION
33
NEWSPAPERS
Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585
Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319
The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665
The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506
WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078
TELEVISION
WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618
WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430
WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305
RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310
WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835
WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875
Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Justice Center (1,100)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneDirector of Development and Alumni Relations: Ken Hogue Athletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904
PRIMARY ATHLETICS LOGO
SECONDARY ATHLETICS LOGOS
44
The UNC Asheville volleyball program enters a new era in 2011 but it’s an era that will have a fa-miliar face.
Frederico Santos, a Bulldog assistant coach from 2000 through the 2007 season, returns to UNC Asheville as the program’s new head coach. He takes over for long-time head coach Julie Tor-bett, who resigned last February. Torbett was the Bulldogs’ head coach for 17 years and won 302 matches. In a lot of those matches Asheville won, Santos was by Torbett’s side as an assistant.
The Brazilian native left Asheville in 2008 to become the head coach at Barry University in Mi-ami, Fla. Santos led the NCAA Division II Bucca-neers to a 46-31 record in three seasons. “It’s a great feeling to be back at UNC Asheville,” stated Santos. “There’s a level of famil-iarity here and a lot of great memories. It’s excit-ing to be coaching in Justice Center again, and I’m looking forward to being here.”
Santos’ fi rst team in Asheville is a little low on numbers with just 10 players.
“We know we have challenges with our num-bers,” declared Santos. “It is simply imperative that we stay away from injuries. However, we plan to be competitive in the Big South Conference just like we always have and hopefully be playing our best volleyball at the end of the season.”
With only 10 players, the Bulldogs need to be a versatile team this season.
“Everyone needs to be ready to play anywhere on the court,” admitted Santos. “We need to be to-tal volleyball players and be ready to play anywhere. Our team needs to have the highest volleyball IQ it can have.”
Asheville will be led this season by senior out-side hitter Cindi Miller. The Indiana native was a fi rst team All-Conference performer last year. She’s turned into a versatile player who isn’t just a great hitter but an outstanding passer and defensive player. It was the kind of player Santos envisioned when he fi rst started recruiting her before he left for Barry.
Cindi Miller
“Cindi is a driven player who works extremely hard,” stated Santos. “She’s an example for our en-tire team to follow.
“Cindi is a tremendous hitter but has the all-around game, as well,” he added. “When I watched her in high school, I thought she had a chance to be a very good player for us, but she has exceeded my expectations. We look for a big year from her both as a player and as a leader.”
Asheville returns senior setter Hallie Morse. Morse transferred to the Bulldog program in Janu-ary of 2010 from Syracuse. She split playing time with Rachel Guinane last season. Morse should be Asheville’s starting setter in 2011.
“It’s obvious Hallie is a talented setter,” ex-plained Santos. “Her height (5-10) is a real attribute for us. She’s an excellent athlete and good defen-sive player. We think we can use Hallie can be more than just a setter. She’ll help us in a lot of different places.”
Junior middle blocker Holly Shelton has shown fl ashes of brilliance over the past two seasons. At 6-1, Shelton can be a towering presence along the net.
2011 ASHEVILLE VOLLEYBALL:
55
Holly Shelton
“Holly’s size really makes her a threat in the middle,” commented Santos. “We can look for her to develop even more this season and fully reach her potential.”
Junior blocker Chelsie Kenley has played in spurts in her fi rst two years with the Bulldog pro-gram. Santos believes that Kenley, the tallest player on the squad at 6-2, could play in a number of places in 2011.
“We could play Chelsie at several positions this year. She may play in the middle or as a right-side or outside hitter,” explained Santos. “I believe Chelsie can challenge to play at any of those spots, and we will need her to do so.”
Sophomore middle blocker Meredith Foster was a key player for the Bulldogs in 2010. She played extremely well as a freshman.
“Meredith was a starter last season and con-tributed mightily,” said Santos. “I believe she has the potential to be an All-Conference player. We expect another good year from her this year.”
A newcomer who will compete for playing time on the front row will be sophomore Anna Moore. She’s a transfer from N.C. State and played for the Wolfpack in 2010.
“We’re really excited about having Anna in the program,” declared Santos. “She can play three different positions and her versatility is a real gift to us. Anna has a huge block, and we look for her to develop into a key player right away.”
The Bulldogs have some talent returning in the back row. Sophomore libero Alex Stewart put up some good numbers in 2010 as she was named Freshman of the Week twice. She also made the Big South All-Freshman team for her play.
“Alex is an excellent defensive player,” admit-ted Sanots. “I believe she’ll be one of the top liberos in the league once again this season. She reads op-ponents’ attack very well and just knows the game quite well.”
Sophomore defensive specialist Rachel Wells was a pleasant surprise for the Bulldogs last year. She really sparked Asheville with her defense and serving.
“Rachel has a lot of potential,” said Santos. “She will push Alex for playing time as a libero. Rachel plays defense very well and knows how to communicate. I look for big things from her this season.”
Sophomore setter Jaimie Dorfman will com-pete for playing time in 2011.
“I really like Jaimie’s attitude,” commented Santos. “She has come back in great shape and could push Hallie for playing time as a setter. I think Jamie can also help us in the back row or as a right-side hitter.”
Setter Lisa Riggsbee is the lone freshman on this year’s club.
“We’re pleased to have Lisa in our program,” stated Santos. “She’ll develop as a setter and com-pete for playing time.”
THE SANTOS ERA BEGINS
66
2220111 VVVVVOOOOOLLLLLLLLLLLLLLEEEEEEEEEEEEEEEEEYYYYYYYYYYYYYYYYYYYYYYYYBBBBBBBBBBBBBBBBBBAAAAAAAAAAAALLLLLLLLLLLLLLLLLLLLLLLLLLLL RRRRRRRRRRRRROOOOOOOOOSSSTTEERNNN o.o.o.o N N Namamameee e PoPoPoPPoPoPoPoos.s. Y YYYYYYYr.rrrrrr.rr H Ht.t. Homete owown n /// PrPrP evevioiousususssssssss SSSSSS SSSS SSS hchhchchhchcchc ooooolll
111 MM M MMMererredededededededededititititititittitithhhhhhh h h FFFFFFoFoostststststtststerererererererererererere M MMMMB B SoSoooo.. . ..... 6-6-0 0 HeHendnderersosonvilllle, , ,,, N.N.NN.N.N.N.N.NNNN CCCCC.CCCCCCCC / / W WWWWWWWWWWWesesesesessssesesseeeee tttttt ttttt HeHHeeeenddndn eerersosoooooonnnnnnnn n nnnnnn HHSHHS 22 22222222 CCCCC C Cininnnnndididdidiididdidididdd MMMMMMMM MM MMMililliilililiililllleleler r rrr rr OHOH S Sr.r 6666666-0-0 D DDDDDDDececcececeeecececececatataaaatttaaatattururuururuurur, ,, InnInnnInInnddddd.d.dd // / // BeBeBeBeBeBeeeellllllllllmmmmomomm ntntntnttt H HHHH H HSSSSSSSSSS
3 3 3333333 H HHololoololololo lylylyylylylylyy SSSSSS Shhhheheltlltltttononononnononn MMMMMMMM MM MBBBBBBBBBB B JJJrJrJrJJJJJJ .. 6-6-6--66666666666 000 0000000 00000 BrBrBrBrrrBrBBrBrBrBBB eveeveeevvvvevevaaarraararrddddddd,dd,ddd,dd,d NNNNN NNNN N NN CCC.C.CCCCC.C. . / / / BrBrBrBBrrBBrBrBrBrB eveveveveveee ara dd dd d HHHHHSHSHHHHH 7 H HHHHHHHHalalaaaaalala lililililliieeeeeeee MoMoMoMoooMoMoMoMMoMooMorsrsrsrsssrsrsrrsrseeeeeeeee S S SrSrSSSrrrSSrrSr. 55555555555-5-1010101010101000010 SS SS Statee Collolleleelegegegege, Pa. / SySySySySySySyySySS raracuuusesseeseseseeseseeess
88 88888888 JJJJJ JJaiaaiaaaaiiaiaimmimimmmiimim eeeeee DDDoDoDDoDDo ffffffffrfman SSS SoSo. 55-8 DuDuDuDuDuDDDDDurhrrrrrrr amam, , NN.N C. //////// CCC C CCCCCCC.E.EE. JoJoJoJooJooJooordrdrdrdrdrdrddrr an HHHHHHHSSSSSS999 R Racachehel l WeW lls DS So. 5-7 SSStatateeesvssssvs ilillelee, , ,,,, NNNNN.N.N.NN.NNNNN.N.NNNN.NN.C.C.C.CC / / / N N NNNNNNNNNNNNNNorthhhhhhh IIIIII Irredell
110 Liisasa R Rigiggsssbebbee S Fr. 5-8 ClClemmomomomomomoomoomomm nns, N.NNN.NN.NN.N.N.NN.NNNNNNNN.N.N.NN CCCCC.C.CCC.CCCCCC / / W WWWWWWeeeeesesesesesesst tt t tt Forsyth HS 12 2 AnAnnann M Mooooorere RS S SoS . 6-6-1 1 Raaaaaaaaleleleleleleleeeeigigi h,h, N NNNNNNNNNNNN CCCCCC.CCC. / NNNNNNN CCCC.CCC. State 113 3 AlAlexex SStetewawartrt L L SSo.o. 5 5-66 HHHHHHHenenndededdedededeedeedededd rrsonvivivivivivivilllllllllllllle,e,,,,, N NNNNNN CCCCC.CCC. //// / eWeWestststtstststtstsstss HHHHHHHHHH HHHHH HHeenenndededersrsrsrrsssrsononnononnnonnonono HHHHHH HHHHSSSSSS 114 4 ChChC elelsisiee KeKenlnleyey M MB BB Jr. 6-2 2222 22 222 ChChChChChhChChChChChChhCC riristiansnsnssssbbbbbubbuurgggggggggg, , ,,,VaVaVaVaVaaVaVaVaaVaaVaa. . ///////// // AAAuAAAAAuAuAuAuAuAAA buburnrnnrnnnnn HHH H HHH HHH HSSSSSSSS
HeHead CCoaoaaachchh: Freddddddddddeeererereerereeeee icico o SaSaaaSaaSaaaaaantnntntnntnnttososososososososossosoo ((((((((( ( ((UUUUUUNUNUNUUNUUU C C AsAsAAsAsAsAsAsAsAsAsAsheheheheehehehehehehheviiviviviviviviiv llllllll e, 200007)7)AsAsAsAssisisiststststaaant Coooooooooooaaaacaacaaa h:h: K Kelelelelellelen n PePetrtrttrrrrononnonoooonononnonnonoo eeeee e (((D(D(DD( uqqueueesnsnsnsne,eee 20008)8
77
BBuullldoogs bbyy YYYYYYYYYYYYYeeeeeeeeeeeeaarrrrrrrrrrrr S Seniors ((2)2) JuJuJuJuJuJuJJuJuJuuJuJuunininininininninnnininnin oorrroooorororoooororo sssssssss s (2(2(2(22(2(2( ) )))) S SSSSSopopopopopopophohohohooohohoohomomommomomomomomorerreererererrerer ss sssss sssss (55((5((5))) ) FrFrrFrFrF essesesshmhmhhhmmmhmhmmannan (((((( ( (1)11)11)1)1)1) C Cininindidi MMilli leler rrrr C CCCCCChheheehehellllslslsiieie K Keeenleey y JJaiiaimimim e e DoD rfrrfrfrfrfmamammmmam nn LiL sa RRigigiggggggggggsggsggsgsggg bebebebebbebebebeeeeeeeeeee HHHH lalallliliee MoMoMorrsrse e H HHololllyly S Shhellttonon M M Mererededddddditititttitititittthhhhhhhhhh h FoFoFoFoFoFoFoFFFFoFFoFFooststststtsstststtsttstssts eeerererrererrereererr AA A A AAAAAnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaa aa aa MoMooMoMooMMooMooMoMoMoMoMoMoMoMMoooooM orooororoorororrorroororrrorrorororreeeeee ee AAAA AA AAAAA leleeeleeeeleeleexxxxxxxxxx x x StSStStStStStStttSttSStewewewewarara ttt RRRRRRRRRRRaacaacacaacchhhehhehehehehehehehhh ll WWells
BBBBBBBBBBBBBBBuuuuulllllllllllllllllllllllllldddddddddddoooooooooggggggggggggssssssssssssss bbbbbbbbbbyyy SSSttaatteN Noor hthth CCararololini a a (7) ) InnnInnnndidiidididiiddianananananannnaaaaaa a (11(((1(1))))) Pennsylvania (1) ViVirgrgini ia (1))J JJJJaiaimimiimmieeeeeee DoDooDoDoDoDD rffrffrrfmamamamamamammamannnnn Cindi Miller HaHalllie Morse ChChelsie KenlnleyeyMMM M eredith Foster
AAnnnnna a MoMooororeeL Lisisa RiRiggggsbsbeeee
Holly SSheltl on Alex Stewart R achel l Wells
88
CINDI MILLEROH • 6-0 • SR • KNOXVILLE, TN
Overview: One of the top returning players in the Big South...versatile and consistent player for the Bulldogs who earned fi rst team All-Conference honors in 2010...will compete for Player of the Year honors as a senior...made Big South All-Rookie team in 2008…hard worker who came to Asheville from Decatur, Indi-ana…very good student who has made Big South Presidential Honor Roll for three straight years and Athletic Director’s 3.0 & Above Club for six consecutive semesters.
2010: Led Bulldogs in kills (3.87) and attack percentage (.201)...posted 18 double-doubles on the year (kills & digs)...had stretch where she had double-fi gures in kills in 25 of 26 matches...season-high of 24 kills came in home victory over Coastal Carolina (9-24)...posted 23 kills in fi ve-set victory over Charleston Southern (10-8)...registered 22 kills with 14 digs in home victory over CSU (11-6)...produced career-best 23 digs in home victory vs. Winthrop (11-5)...was named Big South Player of the Week twice during the season as she earned the award on Sept. 27 and Nov. 1...earned spot on All-Tournament team at South Alabama Invitational and ETSU Invitational...picked up 1,000th career kill vs. Presbyterian College (11-2).
2009: Third on team in kills with 2.66 per set average...hit .212 on the season....fi fth on team in blocks with .35 per set average...posted at least 10 kills 17 different matches with 20 in two match-es...career-high of 22 kills came in home victory over Liberty (10-10) as she hit .500 in that match...earned Big South Player of the Week honors for her play...posted 16 kills in home triumph over Charleston Southern (10-2)...had 17 kills at Coastal Carolina (10-17)...registered 20 kills in home loss to Coastal Carolina (11-3)...had at least 10 kills in seven of the last nine matches of the year...hit .533 with 10 kills in home victory over Charleston Southern (10-31)...produced 13 kills and six digs at Radford (9-25).
2008: Third on team in kills per game with 2.47 per game aver-age…was in double fi gures for kills in 18 matches and posted three double-doubles…was named Big South Freshman of the Week three times during the year, including back-to-back weeks in November…career-high of 20 kills came in thrilling home win over Winthrop (11-1)…posted at least 10 kills in nine straight matches…had 17 kills and hit .333 in upset home win over Liberty (11-7)…fi rst double-double of her career came in victory over ACC foe N.C. State with 11 kills and 10 digs…hit .400 and had 14 kills during Big South Tourney win over Winthrop (11-21)…had 12 kills and 12 digs in come-from-behind triumph at UNC Wilmington (9-20)…produced 14 kills and hit .379 during home win vs. Radford (11-8)…registered 11 kills and three service aces at Gardner-Webb (10-14).
Before UNC Asheville: Enjoyed a standout prep career at Bell-mont HS in Decatur, Ind., where she was a prep All-American...was an all-conference performer for three consecutive years and was the team MVP as a senior, leading the team in kills and blocks...made the All-Area team as a senior and also earned a spot on the All-State team...lettered for three years in basketball and track...was a all-conference performer in basketball as a sophomore and junior.
99
CC CINDI MMMMMMILLILILILILLLLLLLLELELLEL R GGP MPM K K KKK KKKK K/K/K/K/KK/KK/K/K/SSS SS S EE E E T TTT T TAAAAA PcPPcPcPcPcttttt t AAAA A A AA AAAA/S/S/SS/S/S SAASASASAAA S SSA/A/SS SSESESESSEEE R RRREE E DIDIDIDIG GG D/D/D/D/D/S SSSS BBBBS SSS BBBBA AAA TTTB BB B/S BBEEEE E E BBBHEHEHE2002002002008 18 188 18 127272727 31313131 3131313133333141431443143 22222222.4747 47 136136 90008 .88 . 619696 7 7 0.00.006 26 20 000 0.16666 1 19 19 9 20 20 15 156 16 1.23.23 9 9 3232 4141 0.30.32 000000 2 2002009 19 121 21 32 32 33332232322322223223223223223 2 22.2. 6666 136136 87 879 .9 .212212 3 0.0.02 44 0000.0.0.03 03 03 66 16 6 66 11 71 2 0.60 10 323 42 0.35 35 4 444 0444 2010 0 10 113 3300 0 440 40 437 37 37 37 7 7 73 33 .8787 1822 12622 9 .2.201 1 117 7 0.0 15 25 0.0.00.0.0.00.00 22222222 22222 22 22222227777 777 32 344 3.040 6 666 50 5 56 0 0.500. 4 4 3 TTOTTTTTT AL 361 93 101010101011010101101073 73737373 2.97 454 3056 .2033 27 2 0.0 07 07 49 49 00.0.00.0.1.10.. 4 54 54 54 5444 22222 6222 3 572 2 1.551.58 22 25 155 114 14 1393939933391 0.0.339 99 9 8 555888
1010
HALLIE MORSES • 5-10 • SR • STATE COLLEGE, PA
Overview: Senior setter who should be the Bulldogs full-time starter in 2011...transfer from Syracuse University...joined the program January of 2010 and participated in spring volleyball for the Bulldogs...excellent student who made the Big East All-Aca-demic team.
2010: Split starting setting job with Rachel Guinane...second on team in assists with 5.56 per set average...averaged 1.47 digs per set...registered 40 assists and four kills in home win over Charles-ton Southern (11-6)...season-high of 12 digs came in victory over Alabama State (9-4)...also had 33 assists and three blocks vs. Ala-bama State...had four kills in three different matches...posted at least 10 assists in 14 of the last 15 matches of the year.
Syracuse: Played in four matches for the Orange in 2009 and re-corded 18 assists with one kill against Niagara...had 19 assists and three digs and two kills vs. Brown...posted fi ve assists and one dig vs. Cornell...as a freshman in 2008, she played in 11 matches and 20 games...tallied a career-best 40 assists vs. Charleston South-ern...led team with 22 assists in win vs. Army...had 22 assists in victory over Ohio...registered 32 assists, two kills and two block solos vs. Akron.
High School: Two-time fi rst-team All-Pennsylvania honoree at State College HS in State College, Pa....four-year starter...was vot-ed Players Choice
1111
H HHHHHHHHHAAAALALAAAAAAAAAA LILIE E MOOOOMOOOOOOOOORSEEEEEEEEE GGP PP PPP P MP K K/S E T TTTTTA A PcPcct t A AA AAAAAA AA/S/S/S/S/SSSSS/SS/S/S SASA SSA/A/SSSSSSS SSSS SESE RE DIG D/S BS SS B BBBBBAAAA A A TTTTTTT TTTTBBBBBB BBBB BBBB BB/B/B/BBB/BBBBB SSSS S S S S BBBB BBBBBE E BBBBBBBBHEHE2010 0 73 3 2727 28 28 0.30.388 9 9 99 9 9 9 889 9 .2 .222213133313 131333 4 00660606 55.56.56666666666 10 1 00.14.14 10 10 0 0 0 0 000 107107107107 1.41 41.41.4777 7 33 3 1 1166 1919199 9 999 0.20.20.200.20 26666 6 66 1111 1 1 1 666 TOTTOTTOTTOTOTOTTOTTT ALALALALAALALAL L 73 73 73 737737733 2 27 27 28 8 0 00000.00 38 999999 9 99 9 999999999 88889 89 88888 .21321 40640666666666 5555.55.55.555 55 55 5566 6 6 6 6 6 10 10 10101010 0 10 10 10.10.10.144 4 4 4 10 10000 010 0 107 1.47 3 1666666666 6 66 11111 1 11 11 1 199999999 9 0.00000.0.0.0 0. 0.26226 2262626 6 6 6 6 11 1 1 111 6
1212
HOLLY SHELTONMB • 6-0 • JR • BREVARD, N.C.
Overview: Showed some real promise her fi rst two years and should make an even bigger contribution as a junior...talented mid-dle blocker from nearby Brevard HS.
2010: Led Bulldogs in blocks with 0.90 per set average...third on team in kills (1.29)...posted career-high of 11 kills in road victory at Charleston Southern (10-8)...had 10 kills vs. Liberty (10-16) and Winthrop (11-5)...registered nine kills and three blocks in key road win at South Alabama (9-3)...had seven blocks during home win over Charleston Southern (11-6) and at Winthrop (10-9)...helped lead Bulldogs to come-from-behind win over Radford (10-30) with eight kills and fi ve blocks.
2009: Averaged close to one kill per set (0.99)...second on team in blocks with 60 and 0.57 per set average...top hitting match came in her collegiate debut against UNC Wilmington (8-28) when she had a season-high 10 kills and hit .571 for the match...posted nine kills in come-from-behind triumph over The Citadel (8-29)...named registered seven kills in back-to-back league wins at Rad-ford (9-25) and Charleston Southern (10-2)...had eight blocks in home win over Gardner-Webb (9-22)...had four blocks in fi ve dif-ferent matches...was named Big South Rookie of the Week after fi rst four matches of the season.
Before UNC Asheville: Earned all-conference honors for three consecutive years at Brevard HS...made the Hendersonville Times-News All-Region team following senior year...averaged 14 kills and 12 digs per match for Blue Devil program...fi nished senior season with 337 kills and 73 blocks...led Brevard to 17-7 overall record and berth in the 2-A state playoffs...played for Biltmore Volleyball Academy.
1313
H HHHHHH OOOLOLOLOOLOOOOOOO LYLY S SHELTON GGGGGPPPP PP MPMPMP KK K/K/K//K/////SSSSSSS SSSS EE TTTAAA A PcPccccttttt AAA AA AA A A AAAAAAAAAA////S/S/S////////S SSA SA/S SE R E DDDDIIDDDID GGGG GG D/D/D//SS S SS BBSSS S S BBBBBAA TTTTTTTTTTB B BBBBBB B/B/SSS S B BB BEE BBB HHHEHE2000000 99 9 1119 050555 5 5 500000 32223322 2322 104040404 0000000.0.00 99 9 54 54 2626555555555 .1.1.1.1 .1 . 89889899 99 9 8989 7 07 0.00.007.0.070 0 0.00 0000 0 22222323 222 0.2.222 2 2 55 55 6660 0.575777 8 00002020101012 12020120201201012010 70 700 770 70 770 70 70 70 79999999999999 266266262626 26 110010010010101010 102222222222 22 1.1.1.292929 229 92929 333 3 3 7777 7 2525 2525 252533 3 3 3 3 .222.2 .2 .222555757 757 57 57 5 5 5 000.0.0..00..06 6 0 0.00 0 20 222 2220200 202222002 0 0.25.255 99 99 6 6 6 6 662 77771 00 .99000 11 1 TOTTOTOTTOTTOTTOTTOTTOTOT AAALALALALAL AL ALLALA 184841841841841841841841848848441888 55858585858585858 58 5 58 2020 202020 2006 16 16 16 16 16 16 1 12121212.12.12.12 9191 91 91919191 51 51 515151518 .8 .8888 .22322322322322222323 12 12121221212 0 000.00.00.000.0.00070707 0 00 0000 0.00.00.00.00.00.00.000000 000 00 0 000 00 2 444444442 42 43 03 033 03 03 03 0.23.23.23.23.2.2. 14 1414141414141 11111111111 7 17 17 17 17 17 17 13131 31 3331 0.70.70.70.7.70.7771 11 11 1 11 11 19 19 19 1999 1
1414
CHELSIE KENLEYMB • 6-2 • JR • CHRISTIANSBURG, VA
Overview: Junior middle blocker from Virginia who will be tallest player on this year’s team…learned a lot the past two years and should be ready for more playing time in 2010...has the potential to be a very good player…could play in the middle or on the right side...very good student who made Big South Presidential Honor Roll twice and four times earned a spot on Athletic Director’s 3.0 & Above Club.
2010: Appeared in 11 matches and averaged 1.26 kills per set...season-high of nine kills came in home victory over Mercer (10-26)...also hit .571 in Mercer match...had seven kills and hit .333 during win over Alabama State (9-4)...posted three kills in win over North Carolina A&T (9-18).
2009: Played in 16 matches and 50 sets...gave the Bulldogs a lift off the bench with her play...posted a career-best 12 kills in comeback win over The Citadel (9-29)...helped Asheville beat Big East foe Providence (9-19)with eight kills and two block solos...contrib-uted eight kills and two more blocks in key early-season road win at Radford (9-25)...contributed nine kills in victory over Winston-Salem State (9-18)...fi nished the season with 78 kills (1.56) and 15 blocks (0.30).
Before UNC Asheville: Enjoyed a standout prep career at Auburn HS in Riner, Va….senior year posted 126 block solos…four-year starter…helped lead Auburn to a district and regional championship as a senior…helped school set a school record with 24 wins and a berth in the semifi nals of the state playoffs…was named as District Player of the Year and fi rst team all-state…also earned Virginia High School League Group A State Female Athlete of the Year…named an Auburn HS Scholar Athlete…holds school record for most kills in a match with 31…set eight different school records at Auburn, including the all-time leader in career blocks with 237…second in career kills with 1069…lettered in basketball and was a second team all-region performer as a sophomore and junior…was a fi rst team all-region performer as a senior…all-district for three straight years…became second basketball player in Auburn history to score 1,000 career points.
1515
CHELSSSSSIEEIEIEIEIE KKENENLELEYY GGGGGG GGGG PPPPPPPPP PPP MPMPMMPMPMPM KK KKK K//K/K/K/KK SSS SS EEE EE EE TTA A PPct t A AAA/S SA SSSSA/A/A/A/A/A S SSSSS SE RE DIG G D/D//S B S BBBBAAA TT TTBBB B B/B/B//SSS S BB B BEEE E BB B BHEHEHEHE20020020020000020022 999 59 559 50 11111111 16 777766 6 66 66 6 8 18 18 1.5656.56 292 29 22224 .4 2192 2 2 222 0.04 0 0.000 0 000 0 0 2000 8 0.10.16 444 11111111 151515 15 000 0.30303030 22 02 02 0201201220122020200 0 0 10 11199999 9 999 999 11 224224444 24222 4 1.26 3 6 9 .3.3004 1 0.05 5 0 00.00.00000000 000 0 0 10 1 6 6 0. 0.32 32 0 3 3 3 3 3 00 0.16.16.16 111 00 00TOTTOTTOTOTOOTTTOTOTTTTTT AL AL ALL 666699 9 2727 222 102020202222220210 111. 1.1.484848484848 32 32323232 293 .22. 62 6 3 03 03 0003 0.04.04.0..04 0 0 00.00 0 000 33 1414 0.20.20 40 444 141414414 118 18 0.0 0.0 2626 3 03 03 03 0
1616
MEREDITH FOSTERMB • 6-0 • SO • HENDERSONVILLE, N.C.
Overview: Two-sport athlete at UNC Asheville as she also com-petes on the Bulldog track and fi eld squad in the spring...did an excellent job as a freshman blocker for Asheville..was a four-year starter as a middle hitter at nearby West Henderson HS...played at West with current teammate Alex Stewart...played club ball for Biltmore Academy.
2010: Second on team in blocks with 0.88 per game average...led Bulldogs in total blocks with 79...fourth on club in kills (1.24) and attack percentage (.229)...posted career-best 10 blocks with eight kills in road victory at Radford (10-1)...registered 11 kills in 21 swings in home victory over eventual Big South champion High Point (10-29)...had seven blocks in road win at Western Carolina (9-18)...garnered three service aces at Mercer (9-28).
Before UNC Asheville: Helped lead Falcon program to 106-4 overall record during her career...led team in blocks all four of her years playing...earned all-conference honors as sophomore, ju-nior and senior...made the All-Region team her fi nal three years at West...played for legendary coach Jan Stanley...helped Falcons win state championship as a junior and advance to state title game as a freshman and senior...helped lead club team to third-place fi nish in AAU tournament at Orlando...was the state high jump chamion her junior year...was the regional champion in the long jump as a sophomore and junior.
1717
MMMMEEERERREREDEDEDITITITH FOSTSTTTERERERER GP MPMP K K/K///S S E E TA Pct AA AA AA A A A/S/S/S SASASAAA SS SA/A/S S SE RRREE E E DIDIDIDIG GG G D/D/D/SS S S BBB BBBSS SSS B BB BAAA TB B B/SS BB B BE EE B BBBHEH20120120 0 90 999 29 292 12 12233 3 1. 1. 1.11 2224 24 4 43 349 .229 9 0.009 999 200 202 00.200.20.0.200 37 00 00 494949 9 0 000000 49.494.49 88 79 87 0.88 33 00 TOTTOTOTTTOT AL ALA 9999 99 229 9 123 2 1...2424 43 349 .229 9 0.09 09 2 2200 0.0 220 2002 3 337 7 7 7 00000 0 49449 49 0.49 8 779 87 0.88 3 3 000000
1818
JAIMIE DORFMANS • 5-8 • SO • DURHAM, N.C.
Overview: Sophomore setter from Durham who will compete for playing time...prepped at C.E. Jordan HS...played club volleyball for Club Red.
2010: Played in seven matches and eight sets...earned two assists in victory over Southeastern La. (9-3)...had three digs in win over Alabama State (9-4).
Before UNC Asheville: All-Conference setter at C.E. Jordan both as a junior and senior...named team MVP following her senior campaign...named to Carolina Region 17 Platinum All-Tournament team...was selected to the Carolina Region High Performance team.
1919
JAIMIE DODORFRFRFRFRFFFFFRFFMAMAMMMMMMMMM NNNN GGGGP P MPMP KKKK KK K/S SS E EE TTA Pcct t A A A/S SA SA//S SE RRRRRRRRRRRRRRRREEEE EEEEE EEEE DID G D/D/S BBSS SSS B A TB B/B/B/B/SS SS BBE E BBBBBBBBHEHEHEEEEHEHEEEE2012010 80 8888 777 7 000 0.000 0 0 0 3 .000 2 00.25 0 0.00 3 1 4444444444 0.50 0 0 0 0 0 0 0 0 0 0 00 0 00.0.00 0 00 0 0 0 00 0 TOTTOTTT ALAL LLLL L 88 8 8888 7 7 7 0 0.00 0 0 3 .000 0 22 0.225 0 0.00 3 11 44 444 00.0.000000 0.00.0 55550 50 0000 0 0 00.00.0000 0 0000000
2020
RACHEL WELLSDS • 5-7 • SO • STATESVILLE, N.C.
Overview: Did a nice job for Asheville as a freshman and was a key player in the back-row...will compete for more playing time in 2011 as a sophomore...excellent server...versatile player who can play both as a defensive specialist and as a setter.
2010: Second on team in service aces with 26 and 0.23 per set average...fourth on club in digs with a 2.56 mark...posted double-fi gure digs in 13 different matches...career-best 21 digs came in home victory over Big South champion High Point (10-29)...had 20 digs at Winthrop (10-9)...had season-high three services aces in home win against Coastal Carolina (9-24)...had 15 digs during home victory vs. Winthrop.
Before UNC Asheville: Part of a great program at North Iredell...led school to unbeaten season and 3-A state champion-ship as a junior...senior season was honored as the County Player of the Year, Conference Player of the Year and Piedmont Player of the Year...also named team MVP...named fi rst team All-Conference and All-County following junior year...played club for IC Stars
2121
RRACHEL LL WEWEWEWELLLLLLLLSSSS GGGGP P MPMPMPMPMPPMPMPMPP KKKKKK KK K/S E TA Pct A A A A/S/S SASA SSAA/S SE RE DIDDIDIG G G D/D/D/SSS S B B SS BA TTTTTTTTTTTTTBB B/S BE BHE20120201220120010100 0 1000000 10000 12 122 2212 2 3 3 333333 3 31111 1 1 1 11 0.01 6 443 -. -.116116 37 0.33 26 0.23 18 19 287 2222.56.5656.56 0 0 0 000000000 0.000 0 0 0TOTTOTOOOTOTTTTTTTTTT AL AL ALL 111121111222112222 3131 31 3113131 1111 0. 00 0.0101 6 6 43 433 -- .11.116 6 37 3737 0.33 26 0.23 18 19 287 2.52.52.56 6 0000000 00 0 000 0 0.0.0 00 000 00 0 0
2222
ALEX STEWARTL • 5-6 • SO • HENDERSONVILLE, N.C.
Overview: Sophomore libero who enjoyed an outstanding fresh-man season that saw her make the Big South All-Rookie team...was one of two signees from prep power West Henderson HS in nearby Hendersonville as she’s joined by former Falcon teammate Meredith Foster...enjoyed a fantastic prep career at West Hender-son and club career at Biltmore Academy.
2010: Led Bulldogs in digs with 4.33 average...was in double fi g-ures in digs in 28 matches...posted a career-high of 40 digs during home victory vs. Radford (10-30)...had 26 digs in three different matches...was named Defensive Player of the Week on Nov. 1...had at least 20 digs in eight different contests.
Before UNC Asheville: Four-year starter for legendary coach Jan Stanley at West Henderson...earned all-conference honors as a freshman, junior and senior...Falcon program went 106-4 dur-ing her career...named to All-Region team as a junior and senior...helped lead school to state title as a junior and runner-up in fresh-man and senior season.
2323
AAAALELELELEX XX XX STSTTTTSSTEWEWEEWEWEWEEWARARARARAARRTTT GGPP P MPMPMP KKKK K KK/K/S S S EEEE T T TA A PcPctt A A A A/S/S S SAA SASA/S/S S SE E RERERE DDDDDD IGIGIG DD/S BBBSBSBSBBSBSBSBSB BA TB BB/S/S BEBE BHBHHEEE2012012010 0 10 10 1616 331 33 00.00.0.00.00.000.03 3 333 6 66 2 2228 88 -.-.10710710710710710711 57 5757575 0 0 00 494949.49.44 13 3 13133 0 0 00.1111 12 2 12 22 111 1999 9 282828 2828 282828222 2 28288877 7 777 2. 2 56 56 6 6 6 0 0 0 00000000 0 0 0 00.00000000000 0 0 0 0TOTTOTTOTTOTTTTT ALAL ALAA 111111166 6 31313131 3 3 0000 0000.03.0.03.03.. 66 6 2828 28 -.-.1.111-.10070707707 7 55 5777 0.0. 0.494949 1 1 1333 0.0.111111 11 1 12 2 1919199999191911999 28282872878787728787287828878 2.52.52.522 6 6 6 0 0 0 0 00 00000000 0 0 0 0.0.0.0.0.0.0.0.0.0..00 00 00 00 00000000000000000000 00 0 0 0 0 000 0 000000 000000000000
2424
LISA RIGGSBEES • 5-8 • FR • CLEMMONS, N.C.
Overview: Freshman setter who will compete for playing time...enjoyed an excellent high school career at West Forsyth in Win-ston-Salem.
Before UNC Asheville: Was named the West Forsyth Athlete of the Year as a senior...earned All-Conference honors as a junior and senior...named to All-County team following senior season...served as team captain senior year and was also selected as team MVP...excellent athlete who also lettered in basketball, softball and track and fi eld.
ANNA MOORERS • 6-1 • SO • RALEIGH, N.C.
Overview: Transfer from N.C. State who should get a chance to play right away as a sophomore...saw signifi cant playing time for Wolfpack as a freshman...will probably play on the right side...enjoyed a great prep career at Enloe HS
N.C. State: Played in 17 matches and 60 sets...recorded 104 kills and 30 blocks during the year.
Before UNC Asheville: Played at Enloe High School under coach Branden Green ... recorded 236 kills senior year and earned 23 service aces during her senior campaign ... helped lead Enloe to a NCHSAA 4A playoff third round appearence for the fi rst time in program history in 2009... received fi rst-team all-district honors in 2009 ... won conference championship in 2007 and 2008 ... earned all-conference honors all four years ... named 2008 Cap 7 Player of the Year ... honored as team captain for two years ... Academic all-conference all four years ... also lettered two years in basketball.
2525
FREDERICO SANTOSHEAD COACH • FIRST SEASON
The 2011 season will be the fi rst year that Frederico Santos is head coach of the UNC Asheville volleyball program after serv-ing in the same position at Barry University in Miami.
“We are delighted to welcome Frederico Santos back to UNC Asheville as our next Head Women’s Volleyball Coach,” stated UNC Asheville Director of Athletics Janet Cone upon his hiring. “As our former assistant then associate head coach, he was a vital member of our staff and contributed signifi cantly to our success on the court, in the classroom, and in the community. While at Barry University, he has proven himself as a head coach. He gained valuable experience and is ready to be our program’s next leader.”
Santos is delighted to be returning to Asheville. He will start his new post on June 1. Santos inherits a Bulldog team that went 19-12 last year.
“I am absolutely thrilled with the opportunity to lead the UNC Asheville Volleyball program,” stated Santos. “What an hon-or it is for me to be able to work at my Alma Mater. My wife Na-thalie, my son Gabriel, my daughter Tatiana, and I are very excited to come back to the mountains of North Carolina, where we call home.
“I look forward to the challenge of Big South Conference Volleyball and hope to continue UNC Asheville’s tradition of ex-cellence on the court and in the classroom,” Santos added.
“I would like to offer my thanks to Chancellor Anne Ponder, Director of Athletics Janet Cone, Mike Gore, Terri Brne and the Search Committee for their confi dence in my ability to lead the program,” he also said.
“Finally, a personal thanks to my wife Nathalie for her love and support as well as to my father, Frederico Marcondes dos Santos, for his mentoring, encouragement, love and teaching,” de-clared Santos.
UNC Asheville’s Athletics Department will have a press conference for Santos later on in the summer when he gets to Asheville.
In three seasons as head coach at Barry, Santos led the Buc-caneers to a 46-31 overall record and an appearance in the South Regional Division II Tournament in 2010.
Last season, Santos led Barry to a solid year as the Bucca-neers posted a 16-7 overall record and an 11-5 mark in Sunshine State Conference. The Bucs picked up important wins over #22 Saint Leo and #25 Rollins in the regular season. Propelled by their conference play, the Bucs returned to the NCAA South Region Tournament for the fi rst time since 2006. Julia Teixeira earned
2626
Sunshine State Conference player of the Year, Daktronics South Region Player of the Year and spots on the First-Team All-Amer-ica team for Daktronics and the AVCA.
In 2009, the Bucs posted a 15-12 overall mark and went 6-10 in conference. In 2008, Santos’ fi rst season, the Bucs went 15-12; an improvement over 2007. The Bucs improved their con-ference record as well, going 5-11 on the season.
A native of Brazil, Santos has more than 20 years of inter-national playing and coaching experience at all levels of the sport. He spent eight seasons at UNC Asheville, including the last three as associate head coach under former head coach Julie Torbett. Santos assisted in all phases of the Bulldog program including recruiting, on-court coaching, travel and pre-game setup. While at Asheville, Santos helped the Bulldogs to a 135-124 overall record. The Bulldogs reached the Big South Conference Championship match three times during his tenure and won the regular season championship in 2002. The 2002 team was the most improved team in the country that season as Asheville fi nished with a 26-8 record.
Santos coached the Biltmore Juniors for more than fi ve years, leading the club to national fi nishes in each of the past fi ve years, including championships at the Asheville Hi Neighbor tournament in 2003 and 2004.
Santos has been playing volleyball all his life beginning with club teams in Rio de Janeiro. He moved to Reno, Nevada in 1990 and starred for the University of Nevada-Reno club team from 1992-1996 where he was a setter. His club team was ranked fi fth nationally by USA Today. In 1998, Santos played for the Reno Vol-leyball Club team as both a setter and outside hitter, leading the club to the USAV Nationals in Tucson, Arizona.
His coaching experience includes stops in Brazil, Iceland, Poland, Switzerland and Reno. Santos coached the Stjarnan Club team in Reykjavik, Iceland. He led the club to a 7-3 record in 2000 and a fi rst place fi nish in the fall tournament. The team also fi nished runner-up in the Icelandic Cup and Icelandic Champion-ships.
Santos has also worked with the men’s and women’s Bra-zilian national teams, which are among the best in the world. He earned his degree in the spring of 2007 from UNC Asheville.
Santos is married to the former Nathalie Steffen. Nathalie played volleyball for the Bulldogs from 1993 through 1996 and is a 1997 graduate of UNC Asheville.
On June 24, 2011 in front of a small crowd at Justice Center Fred Santos (left) was introduced as the new head coach of UNC Asheville Volleyball by director of athletics Janet R. Cone
Santos spent the past three seasons as head coach of NCAA Division II power Barry University in Florida.
2727
KELLEN PETRONEASSISTANT COACH • SECOND SEASON
Kellen Petrone is in his second year as an assistant coach with the UNC Asheville volleyball program. He helped lead the Bulldogs to a 19-12 overall record last season and third-place fi n-ish in the Big South Conference
Petrone comes to Asheville after working at Robert Morris University for one season. He helped direct the Colonials to 14 wins in 2009 and a semi-fi nal berth in the Northeast Conference Tournament. When head coach Rob Thomas resigned in February of 2010, Petrone served as interim head coach for the Robert Morris program during the spring season.
The Pittsburgh native has a varied background, both playing and coaching.
In 2004, Petrone founded the Duquesne men’s volleyball club team and served as its president from 2004-2008. In 2006, the Dukes fi nished tied for fi fth out of 32 teams in the Penn-Ohio Volleyball League and matched that fi nish in 2007. That same year, he was named to the Penn-Ohio Volleyball League All-Star team.
During the past several years, Petrone has been an assis-tant coach for several high caliber high school squads, while also coaching for United Volleyball Club. In the spring of 2005, Petrone began working as the assistant coach for the Fox Chapel High School boys’ volleyball team. During his fi rst year with the Foxes, the team was ranked third in the WPIAL and 16th in the state. In 2006, Fox Chapel captured a WPIAL Championship and was also a Pennsylvania state fi nalist and in 2008 the Foxes made it to a consecutive WPIAL fi nal.
In the fall of 2007, Petrone began his duties as assistant coach for the Moon Area High School girls’ team. That year, the Tigers won the WPIAL Championship and fi nished the season tied for eighth in the state.
Petrone began his playing career at Pittsburgh Central Catholic High School and in 2004 led the Vikings as high as No. 2 in the Pennsylvania state rankings throughout the course of the season. That same year, he was named to the All-WPIAL First Team and was all-section fi rst team selection. In addition, he was a mem-ber of the all-tournament team after Pittsburgh Central Catho-lic took home the championship at the 2004 Montour Volleyball Tournament. He was named an all-section all star in 2003.
Petrone graduated from Duquesne University in 2008 with a bachelor’s degree in marketing and entrepreneurship.
2828
2929
CCCCONFFEEEEEERRRRREEEEENCEEEEEEEEEEEEEE ///////////////////// RRRRRRRRREEEEEEEECCCCCCCCCCCCOOORRRDDDDDDDDDDDDDDDDDDDSSSSS
3030
2010 ASHEVILLE SEASONAsheville Has Four Honored By Big South
ROCK HILL, S.C. - The UNC Asheville volleyball team had four players honored by the Big South Conference at the league’s an-nual awards banquet Wednesday night at Winthrop University.
Junior outside hitter Cindi Miller earned fi rst team all-conference honors, while senior outside hitter Kelsey Benorden made the second team. Freshman libero Alex Stewart earned a spot on the All-Freshman team. Senior setter Rachel Guinane was named to the All-Academic team for the second straight year.
The Bulldogs are the third seed in the Big South Championship as play begins on Thursday with quarterfi nal action. Asheville will face sixth-seeded Charleston Southern starting at 2:30 p.m.
Miller enjoyed a sensational junior campaign. She averaged 3.90 kills per set to lead the Bulldogs. The Illinois native averaged 3.06 digs per set. Miller was named to two all-tournament teams dur-ing the year and was named Big South Player of the Week twice on the season.
Benorden was second on team in kills with a 3.40 average and in digs with a 3.57 average. She led Asheville in service aces with 33. The Knoxville native was named Big South Player of the Week twice during the season and was also named to two different all-tournament teams during the year.
Stewart, a native of Hendersonville, N.C. and former standout at West Henderson HS, led Asheville in digs with a 4.34 average dur-ing the season. Stewart was named Big South Defensive Player of the Week twice during the season.
Guinane averaged 7.96 assists per set this year. She has made the Big South Presidential Honor Roll three times during her career and also been named to the Athletic Director’s 3.0 & Above Club six different times.
Bulldogs Claim Third Seed For BSC Tourney
ASHEVILLE, N.C. - The UNC Asheville volleyball team will be third seed in the 2010 Big South Conference Championships to be held at the Winthrop Coliseum starting on Thursday. The Bulldogs will take on sixth-seeded Charleston Southern Thursday afternoon at 2:30 p.m. Asheville (19-11, 11-5 BSC) ended the season with wins in seven of their last eight matches. The Bulldogs were a preseason pick to fi nish in fi fth place but fi nished in third place for the fi rst time ever.
This will be just the third time Asheville has ever played Charles-ton Southern in the tournament. The Bulldogs knocked off the Lady Bucs in four sets during the quarterfi nals of the 1992 tour-nament as Asheville went on to win the tournament. The teams met again in the quarterfi nals of the 2001 tournament with the Bulldogs as a fi fth seed upset CSU in three sets.
The teams had two close matches this year. Asheville edged the Lady Bucs in fi ve sets in Charleston and then slipped past them in four sets on Nov. 6 at Justice Center.
The 2010 Big South Volleyball Championship begins Thursday, Nov. 18 with four matches, and concludes with the Championship game on Saturday, Nov. 20 in Rock Hill, S.C. The Big South’s tournament champion receives an automatic bid to the NCAA Volleyball Tour-nament. The Conference Championship schedule is as follows:
Thursday, Nov. 18 - Rock Hill, S.C.Match 1: No. 2 High Point vs. No. 7 Radford, 12:00pm ETMatch 2: No. 3 UNC Asheville vs. No. 6 Charleston Southern, 2:30pm ETMatch 3: No. 1 Liberty vs. No. 8 Gardner-Webb, 5:00pm ETMatch 4: No. 4 Winthrop vs. No. 5 Coastal Carolina, 7:30pm ET
Friday, Nov. 19 (semifi nials) - Rock Hill, S.C.Match 5: Match 1 winner vs. Match 2 winner, 4:30pm ETMatch 6: Match 3 winner vs. Match 4 winner, 7:00pm ET
Saturday, Nov. 20 (Finals) - Rock Hill, S.C.Match 7: Match 5 winner vs. Match 3 winner, 2:00pm
Volleyball Season Ends With Loss To CSU
ROCK HILL, S.C. - Led by Big South Player of the Year Amanda Hill, Charleston Southern advanced to the semifi nals of the Big South Conference Volleyball Championship with a 3-0 win over third-seeded UNC Asheville Thursday afternoon. The Lady Buc-caneers won the match, 25-19, 25-11, 25-18.
Hill recorded 19 on the afternoon and hit .294 in the match. Asheville (19-12) was led by Cindi Miller with eight kills and seven digs. Sophomore Holly Shelton was a bright spot in defeat with six kills and four blocks.
Senior Kelsey Benorden fi nished her career with seven kills and 10 digs. Alex Stewart had 12 digs, while Rachel Wells had 10 digs.
The Bulldogs simply could not get untracked in the match and fi nished with 20 hitting errors.
The match turned midway through the fi rst set. Asheville led 13-9 before Charleston Southern went on a 16-6 run to seize
control of the match and win the set 25-19. Hill had six kills in the opening set in 10 swings.
The second set was all CSU. They scored the fi rst fi ve points of the set and quickly build the lead to 12-3. The Bulldogs could get no closer and fell 25-11 to go down 2-0 at intermission.
The third set had CSU leading 4-3 before the Lady Bucs went on a 9-2 run to sprint to a 13-4 advantage. The Bulldogs tried to rally and crept to 21-16 as Rachel Olivo had two kills in a 3-0 run.
But Hill would get two more kills and two more attack er-rors would give the third set to the Lady Bucs, 25-18 and end Asheville’s season.
3131
BIG SOUTH OVERALLTeam W L Pct. W L Pct. Home Road Neu. L 10 Streakx-Liberty 14 2 .857 25 9 .735 8-1 10-4 7-4 8-2 L1y-High Point 13 3 .812 22 13 .628 11-2 8-6 3-5 8-2 L1UNC Asheville 11 5 .688 19 12 .613 9-1 7-6 3-5 7-3 L2Winthrop 10 6 .625 14 16 .467 8-3 3-8 3-5 5-5 L1Coastal Carolina 7 9 .438 14 18 .438 10-3 3-10 1-5 3-7 L5Charleston Southern 6 10 .375 13 20 .394 5-7 5-6 3-7 4-6 L1z-Presbyterian 6 10 .375 13 18 .419 5-5 6-9 2-4 4-6 W1Radford 5 11 .312 11 21 .344 5-7 4-10 2-4 4-6 L1Gardner-Webb 0 16 .000 5 27 .156 3-9 2-11 0-7 0-10 L11
x- Regular-Season Champion; y- Tournament Champion; z- ineligible for championship (reclassifying)
2010 BIG SOUTH STANDINGS
First Team All-ConferenceAmanda Hill, Charleston Southern
Karyl Bacon, LibertyMegan Smith, High Point
Chelsy Kimes, Coastal CarolinaCindi Miller, UNC Asheville
Amanda Kettles, PCJulie Hershkowitz, High Point
Second Team All-ConferenceBecca Toor, Winthrop
Stephanie Wallin, High PointKelsey Benorden, UNC Asheville
Loren Thomas, LibertyKaley Viola, WinthropJade Craycraft, LibertyKelly Haseman, Liberty
All-Freshman TeamJade Craycraft, Liberty
Maddie Simpson, High PointMeghan Laffi n, Coastal Carolina
Lillie Happel, LibertyAndrea Barman, PC
Alex Stewart, UNC AshevilleTyler Cockrell, Gardner-Webb
All-Academic TeamChelsy Kimes, Coastal Carolina
Karyl Bacon, LibertyCori Holeman, CSU
Evan Moffi t, Gardner-WebbAshley Dunlap, PC
Sara Felts, WinthropJulie Hershkowitz, High Point
Katelyn Meeks, RadfordRachel Guinane, UNC Asheville
Player of the YearAmanda Hill, Charleston Southern
Freshman of the YearJade Craycraft, Liberty
Coach of the YearShane Pinder, Liberty
Scholar-Athlete of the YearChelsy Kimes, Coastal Carolina
Big South Volleyball Championship
Thursday, Nov. 18 (First Round)#2 High Point 3 .......................................... #7 Radford 0#6 Charleston Southern 3 ............#3 UNC Asheville 0#1 Liberty 3 .................................... #8 Gardner-Webb 0#4 Winthrop 3 ............................ #5 Coastal Carolina 0
Friday, Nov. 19 (Semifi nals)#2 High Point 3 ................... #6 Charleston Southern 1#1 Liberty 3 .............................................. #4 Winthrop 2
Saturday, Nov. 20 (Finals)#2 High Point 3 .............................................#1 Liberty 0
All-TournamentAudi Gonzalez – High Point (MVP)
Megan Smith – High PointMaddie Simpson – High Point
Jade Craycraft – LibertyKaryl Bacon – LibertyKelsey Hall – Winthrop
Amanda Hill – Charleston Southern
3232
BIG SOUTH RECORDS
Regular Season Championships1990, 1991, 1992, 2002, 2009
Tournament Championships1991, 1992
NIVC Tournament1991
Tournament Runners-Up2003, 2005, 2006
Year Opponent Round Score W/L Site1986 Winthrop Quarters 1-3 L Radford1988 Winthrop Semifi nals 0-3 L Asheville1990 Augusta Quarters 3-0 W Charleston1990 Radford Semifi nals 1-3 L Charleston1991 Winthrop Quarters 3-0 W Asheville1991 Radford Semifi nals 3-0 W Asheville1991 Davidson Finals 3-1 W Asheville1992 CSU Quarters 3-1 W Conway1992 UNC Greensboro Semifi nals 3-1 W Conway1992 Liberty Finals 3-2 W Conway1993 Radford Quarters 1-3 L Rock Hill1994 Towson State Quarters 0-3 L Greensboro1995 Winthrop Quarters 2-3 L Greensboro1996 Liberty Quarters 2-3 L Baltimore1997 Coastal Carolina Quarters 2-3 L Asheville1998 Winthrop Quarters 3-1 W Asheville1998 Liberty Semifi nals 0-3 L Asheville1999 Elon Quarters 3-1 W Charleston1999 Radford Semifi nals 0-3 L Charleston2000 Winthrop Quarters 0-3 L High Point2001 CSU Quarters 3-0 W Lynchburg
Year Opponent Round Score W/L Site2001 Radford Semifi nals 0-3 L Lynchburg2002 High Point Quarters 3-1 W Rock Hill2002 Liberty Semifi nals 0-3 L Rock Hill2003 BSC Quarters 3-1 W Birmingham2003 Liberty Semifi nals 3-2 W Birmingham2003 Winthrop Finals 2-3 L Birmingham2004 Liberty Quarters 0-3 L Asheville2005 Liberty Quarters 3-0 W Asheville2005 Coastal Carolina Semifi nals 3-0 W Conway2005 Winthrop Finals 0-3 L Conway2006 Radford Quarters 3-0 W Asheville2006 Coastal Carolina Semifi nals 3-2 W High Point2006 Winthrop Finals 3-0 L High Point2007 High Point Quarters 3-2 W Lynchburg2007 Winthrop Semifi nals 1-3 L Lynchburg2008 Winthrop Quarters 3-1 W Asheville2008 Liberty Semifi nals 0-3 L Asheville2009 Radford Quarters 3-0 W Radford2009 Coastal Carolina Semifi nals 0-3 L Radford2010 Charleston Southern Quarters 0-3 L Rock Hill
• All-Time Big South Tournament Results •
Big South Tournament Record By Round Win Loss PctQuarterfi nals 13 9 .591Semifi nals 5 9 .357Finals 2 3 .400
Tournament Record by Opponent Win Loss .PctAugusta 1 0 1.000Birmingham-Southern 1 0 1.000Charleston Southern 2 1 .667Coastal Carolina 2 2 .500Elon 1 0 1.000Davidson 1 0 1.000High Point 2 0 1.000Liberty 3 5 .375Radford 3 4 .429Towson State 0 1 .000UNC Greensboro 1 0 1.000Winthrop 3 8 .273Totals 20 21 .488
The 2009 Big South Conference Regular Season Champion Bulldogs
3333
Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”
The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.
During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.
In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.
Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.
In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.
In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.
Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.
The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.
THE BIG SOUTH
3434
BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100
Charlotte, NC 28226Phone: (704) 341-7990
Fax: (704) 341-7991www.BigSouthSports.com
Founded 1983
PresidentPenelope W. Kyle, Radford University
Vice PresidentDr. Frank Bonner, Gardner-Webb University
SecretaryDr. Anne Ponder, UNC Asheville
CommissionerKyle B. Kallander
Associate CommissionerDawn Turner
Assistant Commissioner - Public RelationsMark Simpson
Assistant Commissioner - MarketingChad Cook
Director of Multimedia DevelopmentMark Bryant
Director of Administration & FinanceNancy Perkins
Assistant Director of MarketingTBA
Assistant Director of Public RelationsNic Bowman
Assistant Director of ComplianceSherika McLean
Marketing Assistant InternCaitlin Munchel
Public Relations Assistant InternBrittany Hill
Administrative Assistant InternTBA
Coordinator of Football Offi cialsDoug Rhoads
Coordinator of Men’s Basketball Offi cialsJoe Forte
Coordinator of Women’s Basketball Offi cialsCharlene Curtis
Coordinator of Baseball UmpiresTony Thompson
Coordinator of Volleyball Offi cialsDaniel Leake
Coordinator of Men’s Soccer Offi cialsPaul James
Coordinator of Softball UmpiresBetsy Kidd
Full-Time Member Institutions (11): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University.
Associate Members: Stony Brook University (football), Bucknell University (women’s golf), College of the Holy Cross (women’s golf).
Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (3) – Liberty University, Radford University, Virginia Military Institute.
Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball, Women’s Lacrosse (2012-13)
Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; John V. Griffi th, Presbyterian College, Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop.
BIG SOUTH QUICK FACTS
3535
3636
3737
HISTTTOORRYY // RREECCOORDDSS
3838
Attempts1. Gina Golkiewicz 1,980 19922. Elissa Steffen 1,539 19923. Kelsey Benorden 1,452 20074. Kelsey Benorden 1,448 20085. Kim Osborne 1,413 19966. Elif Unlu 1,376 20067. Courtney Tucker 1,351 19968. Kim Osborne 1,325 19939. Kelsey Benorden 1,320 201010. Gina Golkiewicz 1,295 1991
Kills:1. Gina Golkiewicz 623 19922. Elissa Steffen 550 19923. Kim Osborne 538 19964. Elif Unlu 512 20065. Cally Geiger 510 19966. Kelsey Benorden 500 20077. Elissa Steffen 489 19948. Courtney Tucker 480 19969. Cally Geiger 476 1997 Elif Unlu 476 2005
Attack Percentage:1. Ilona Fekete .385 19912. Lauren Ficker .350 20093. Ilona Fekete .335 19904. Rose Butler 325 2005 Jennifer Hutchins .325 19936. Ilona Fekete .321 19927. Amanda Wiles .309 20048. Jessica Jones .306 20009. Lauren Ficker .304 200810. Cally Geiger .301 1995
Assists:1. Lorelee Smith 1,852 19962. Danielle Meyer 1,591 19923. Amanda Wiles 1,524 20024. Amanda Wiles 1,506 20045. Lorelee Smith 1,436 19956. Kaitlyn McDaniel 1,409 2006 7. Amanda Wiles 1,374 20058. Lorelee Smith 1,343 19979. Danielle Meyer 1,306 199110. Jessica Beal 1,295 1998
Service Aces:1. Raquel Miotto 65 20092. Frida Sigurdardottir 62 20023. Gina Golkiewicz 60 19914. Sandi Potter 58 19985. Courtney Tucker 58 19966. Gina Golkiewicz 55 19927. Cally Geiger 54 19968. Kim Osborne 53 19959. Missy Allen 52 198910. Courtney Tucker 51 1995
Block Solos:1. Ilona Fekete 198 19902. Ilona Fekete 196 19913. Ilona Fekete 127 19924. Jennifer Hutchins 76 19935. Beth Cole 70 19876. Jennifer Hutchins 68 19917. Tina Bell 64 19898. Beth Cole 63 19869. Jennifer Hutchins 57 199010. Jennifer Hutchins 41 1992
Block Assists:1. Ilona Fekete 133 19902. Beth Cole 127 19893. Ashley Wrightenberry 116 2005 Heather Burns 116 20085. Ilona Fekete 114 19926. Beth Cole 113 19867. Allison Lambert 105 20048. Allison Lambert 104 20059. Rose Butler 99 200410. Ashley Wrightenberry 97 2007
Total Blocks:1. Ilona Fekete 331 19902. Ilona Fekete 288 19913. Ilona Fekete 241 19924. Beth Cole 197 19875. Beth Cole 176 19866. Jennifer Hutchins 152 19907. Jennifer Hutchins 147 19938. Jennifer Hutchins 134 19919. Ashley Wrightenberry 132 200510. Heather Burns 121 2008
Digs:1. Leslie Whitfi eld 763 20022. Gina Golkiewicz 739 19923. Raquel Miotto 721 20064. Raquel Miotto 718 20095. Raquel Miotto 667 20086. Elissa Steffen 656 19927. Raquel Miotto 582 20078. Gina Golkiewicz 544 19919. Elissa Steffen 528 199410. Courtney Tucker 509 1996 Elissa Steffen 509 1993
ASHEVILLE SEASON RECORDS
First TeamCindi Miller (2010)Kelsey Benorden (2008, 2009)Raquel Miotto (2006, 2008, 2009)Lauren Ficker (2009)Elif Unlu (2005, 2006)Amanda Wiles (2004)Frida Sigurdardottir (2002, 2003)Kelly Budnik (2002)Chandra Hicks (1999)Cally Geiger (1998)Lorelee Smith (1995, 1996, 1997)Kim Osborne (1995)Elissa Steffen (1994)Danielle Meyer (1993)Gina Golkiewicz (1991, 1992)Ilona Fekete (1990, 1991, 1992)Sandra Potter (1989)Holly Van Wagner (1987)
Big South Player of The YearIlona Fekete (1990)
Second TeamRaquel Miotto (2007)Kelsey Benorden (2007, 2010)Amanda Wiles (2005)Elif Unlu (2004)Amanda Wiles (2003)Leslie Whitfi eld (2002)Kelly Budnik (2000, 2001)Jennifer Baker (1999)Chandra Hicks (1998)Cally Geiger (1995, 1997)Elissa Steffen (1993)Kim Osborne (1993, 1994, 1996)
All-Tournament (Big South)Kelsey Benorden (2007, 2008)Raquel Miotto (2006)Emily Palma (2006)Allison Lambert (2005)Elif Unlu (2003, 2005)Amanda Wiles (2002)Rose Butler (2002)Bonny Sneed (2001)Kelly Budnik (2001)Kristie Brinkley (2000)Jennifer Baker (1999)Chandra Hicks (1998)Kim Osborne (1993)
Big South Tournament MVPDanielle Meyer (1992)
Big South Scholar-Athlete of the YearLorelee Smith (1997)
Big South Rookie of the YearKelly Budnik (2000)Kim Osborne (1993)
Big South All-Rookie TeamAlex Stewart (2010)Kelsey Benorden (2007)Cindi Miller (2008)Raquel Miotto (2006)Elif Unlu (2003)Amanda Wiles (2002)Rose Butler (2002)Bonny Sneed (2001)Kelly Budnik (2000)Kim Osborne (1993)
Big South Coach of the YearJulie Torbett (2009)
BIG SOUTH CONFERENCE HONORS
3939
ASHEVILLE CAREER RECORDSAttempts1. Kelsey Benorden 5,263 2007-102. Elissa Steffen 4,993 1991-943. Kim Osborne 4,727 1993-964. Elif Unlu 4,546 2003-065. Gina Golkiewicz 4,408 1990-926. Cally Geiger 4,204 1995-987. Kelly Budnik 3,755 2000-038. Rose Butler 3,630 2002-059. Courtney Tucker 3,333 1994-9610. Jennifer Baker 3,318 1996-99
Kills:1. Elissa Steffen 1,775 1991-942. Cally Geiger 1,761 1995-983. Kim Osborne 1,733 1993-964. Kelsey Benorden 1,731 2007-105. Elif Unlu 1,709 2003-066. Gina Golkiewicz 1,511 1990-927. Kelly Budnik 1,317 2000-038. Rose Butler 1,270 2002-059. Courtney Tucker 1,196 1994-96 Jennifer Baker 1,196 1996-99
Attack Percentage:1. Ilona Fekete .347 1990-922. Jennifer Hutchins .292 1990-933. Cally Geiger .266 1995-984. Frida Sigurdardottir .265 2000-035. Lorelee Smith .263 1994-97 6. Amanda Wiles .257 2002-057. Gina Golkiewicz .242 1990-928. Elissa Steffen .233 1991-949. Elif Unlu .231 2003-0610. Ashley Wrightenberry .229 2004-07
Assists:1. Lorelee Smith 5,904 1994-972. Amanda Wiles 5,613 2002-053. Danielle Meyer 5,187 1990-934. Rachel Guinane 3,466 2007-105. Jessica Beal 2,822 1998-006. Kaitlyn McDaniel 2,658 2006-097. Bonnie Sneed 1,076 2001-028. Katie Meindl 1,014 1999-009. Missy Allen 532 1989-9010. Amber Mendenhall 405 1988-92
Service Aces:1. Cally Geiger 198 1995-982. Raquel Miotto 164 2006-093. Gina Golkiewicz 150 1990-924. Kim Osborne 142 1993-96 Courtney Tucker 142 1994-966. Mellie Durham 134 1992-957. Khristine Ambrose 133 1997-008. Kelly Budnik 130 2000-039. Danielle Meyer 126 1990-9310. Elissa Steffen 121 1991-94
Block Solos:1. Ilona Fekete 521 1990-922. Jennifer Hutchins 242 1990-933. Beth Cole 133 1985-884. Cally Geiger 131 1995-985. Jenni Reynolds 101 1994-976. Jessica Jones 71 1999-027. Chandra Hicks 70 1996-998. Tina Bell 64 1989-909. Ursula Carswell 57 1994-95 Elizabeth Rodriguez 57 1998-01
Block Assists:1. Ashley Wrightenberry 351 2004-072. Ilona Fekete 339 1990-923. Cally Geiger 290 1995-98 Jennifer Hutchins 290 1990-935. Rose Butler 248 2002-056. Beth Cole 240 1985-887. Heather Burns 229 2005-088. Chandra Hicks 227 1996-999. Allison Lambert 209 2004-0510. Suzanne Aubel 208 1999-03
Total Blocks:1. Ilona Fekete 860 1990-922. Jennifer Hutchins 632 1990-933. Cally Geiger 421 1995-984. Ashley Wrightenberry 403 2004-075. Beth Cole 373 1985-886. Jenni Reynolds 307 1994-977. Rose Butler 289 2002-058. Chandra Hicks 287 1996-999. Jessica Jones 278 1999-0210. Suzanne Aubel 257 1999-03
Digs:1. Raquel Miotto 2,688 2006-092. Elissa Steffen 2,179 1991-943. Gina Golkiewicz 1,674 1990-924. Kelsey Benorden 1,535 2007-105. Mellie Durham 1,532 1992-956. Kelly Budnik 1,460 2000-037. Jennifer Baker 1,446 1996-998. Kim Osborne 1,396 1993-969. Leslie Whitfi eld 1,357 1999-0210. Krysti Havens 1,319 2002-05
Games Played:1. Danielle Meyer 515 1990-932. Lorelee Smith 514 1994-973. Kim Osborne 509 1993-964. Mellie Durham 505 1992-955. Amanda Wiles 504 2002-056. Amber Mendenhall 502 1988-927. Elissa Steffen 501 1991-948. Krysti Havens 498 2002-059. Jennifer Hutchins 497 1990-0310. Cally Geiger 496 1995-98
Big South Champions1991, 1992
Big South Regular Season Champions1990, 1991 (tie), 1992, 2002, 2009
Big South Tournament Runner-Up2003, 2005, 2006
National Invitational Volleyball Championship1991 (Dayton, Ohio)
NAIA District 26 Playoff1984
TEAM HONORS
4040
• Individual •
KillsMatch: 34, Kelsey Benorden vs. High Point, 11/15/07
Season: 623, Gina Golkiewicz, 1992Career: 1,775, Elissa Steffen, 1991-94
AttemptsMatch: 83, Kelsey Benorden vs. High Point, 11/15/07
Season: 1,980, Gina Golkiewicz, 1992Career: 4,993, Elissa Steffen, 1991-94
Attack Percentage (minimum 10 kills)Match: .688 (12-1-16), Lauren Ficker vs. Southern 11/15/07
Season: .385, Ilona Fekete, 1991Career: .347, Ilona Fekete, 1990-92
AssistsMatch: 83, Danielle Meyer, vs. Davidson, 1991
Season: 1,852, Lorelee Smith, 1996Career: 5,904, Lorelee Smith, 1994-97
Service AcesMatch: 7, Kelly Budnik vs. Elon, 10/20/01 and
Elif Unlu, vs. Montreat, 10/15/03Season: 65, Raquel Miotto, 2009
Career: 198, Cally Geiger, 1995-98
DigsMatch: 50, Leslie Whitfi eld vs. Western, 10/22/02
Season: 763, Leslie Whitfi eld, 2002Career: 2,688, Raquel Miotto, 2006-09
Block SolosMatch: 10, Ilona Fekete, vs. Davidson, 1991
Season: 198, Ilona Fekete, 1990Career: 521, Ilona Fekete, 1990-92
Block AssistsMatch: 9, Ilona Fekete, vs. Davidson, 1991 and
Heather Burns, vs. Liberty, 11/7/08Season: 133, Ilona Fekete, 1990Career: 339, Ilona Fekete, 1990
• Team •
Most WinsSeason: 32, 1992
Most MatchesSeason: 56, 1982 (29-27)
Consecutive WinsSeason: 17, 1992
Winning PercentageSeason: .846 (32-6 in 1992)
KillsMatch: 92 vs. Winthrop, Nov. 20, 1998
AttemptsMatch: 237, vs. Duquesne, Aug. 27, 2006
DigsMatch: 122, vs. Western Carolina, Oct. 22, 2005
Season: 2,370, 2002
INDIVIDUAL/TEAM RECORDS
Raquel Miotto (2006-09) holds the Big South record for most career digs with 2,688
4141
Overall Record: 12-23 Big South Record: 3-59/1 Tennessee-Martin W 3-09/2 UNC Wilmington L 1-39/3 Appalachian State L 0-39/3 UNC Charlotte L 2-39/6 at Tennessee Tech L 0-39/7 at Clemson L 0-39/13 at East Tennessee State L 0-39/15 Montana State W 3-29/16 vs. Howard W 3-09/16 at VCU L 0-39/17 vs. UNC Greensboro L 0-39/20 at Mars Hill W 3-19/23 Georgia Southern L 2-39/24 Georgia State L 0-39/24 Charleston L 0-39/26 at North Carolina A&T W 3-010/1 UMBC* L 2-310/4 at UNC Greensboro* L 0-310/8 at Winthrop W 3-010/8 vs. Bucknell L 1-310/8 vs. Howard W 3-010/12 North Carolina A&T W 3-010/15 at Liberty* L 1-310/16 at Radford* W 3-210/22 vs. Fla. International L 1-310/22 at Georgia State L 1-310/22 at Mercer L 0-310/23 at Georgia Southern L 1-310/25 at Winthrop* W 3-110/28 Charleston Southern* L 1-310/29 Coastal Carolina* W 3-011/2 at UNC Charlotte L 0-311/6 Towson State* L 0-311/9 East Tennessee State W 3-211/11 vs. Towson State^ L 0-3 *Big South Matches^Big South Tournament Match
Overall Record: 24-11 Big South Record: 4-39/1 vs. UNC Wilmington W 3-19/2 vs. North Carolina A&T W 3-09/2 at UNC Charlotte W 3-29/6 Mars Hill W 3-09/8 vs. UAB W 3-29/8 vs. Samford W 3-09/8 vs. Charleston Southern W 3-09/9 Wofford W 3-09/9 vs. UAB L 0-39/12 at Tennessee L 1-39/15 Florida A&M W 3-09/16 Tennessee State W 3-09/16 Appalachian State L 0-39/20 Wofford W 3-09/23 at Davidson W 3-09/26 South Carolina State W 3-09/29 vs. UCF L 0-39/30 vs. Troy State L 0-39/30 at Georgia State W 3-110/4 East Tennessee State W 3-110/8 at UNC Greensboro* L 1-310/11 at Appalachian State L 1-310/14 Liberty* W 3-010/15 Radford* W 3-010/18 at Wofford W 3-010/21 at Western Carolina W 3-210/24 Winthrop* W 3-110/26 Furman W 3-010/27 at Charleston Southern* W 3-210/28 at Coastal Carolina* L 2-311/1 UNC Charlotte W 3-211/2 North Carolina A&T W 3-011/4 at UMBC* L 0-3
11/7 at East Tennessee State L 1-311/10 vs. Winthrop^ L 2-3*Big South Matches^Big South Tournament Match
Overall Record: 21-16 Big South Record: 8-68/30 vs. UNC Wilmington W 3-18/31 vs. Western Carolina W 3-08/31 at UNC Charlotte L 1-39/6 vs. Georgia Tech L 0-39/6 vs. Charleston W 3-19/6 vs. Jacksonville State L 1-39/7 vs. Western Carolina W 3-19/7 at Furman W 3-09/7 vs. Georgia Tech L 0-39/11 Wofford W 3-19/11 Appalachian State W 3-19/20 vs. James Madison L 2-39/20 vs. East Carolina W 3-19/21 at Campbell W 3-09/21 vs. Mercer W 3-09/24 at East Tennessee State L 0-39/28 Liberty* W 3-19/29 Radford* W 3-010/1 at North Carolina L 0-310/2 at UNC Greensboro* L 2-310/6 at UMBC* L 0-310/8 at Wofford W 3-110/12 at Coastal Carolina* L 2-310/13 at Charleston Southern* W 3-010/16 at UNC Charlotte W 3-210/20 Coastal Carolina* L 0-310/23 Davidson L 2-310/26 Charleston Southern* W 3-010/27 at Winthrop* W 3-110/29 East Tennessee State W 3-011/2 at Liberty* L 2-311/3 at Radford* W 3-011/6 Winthrop* W 3-011/7 UNC Greensboro* W 3-011/10 UMBC* L 2-311/12 Tennessee L 0-311/15 vs. Liberty^ L 2-3*Big South Matches^Big South Tournament Match
Overall Record: 16-17 Big South Record: 5-78/29 vs. Western Carolina W 3-08/30 vs. Appalachian State W 3-18/30 at Wake Forest L 0-39/3 at East Tennessee State L 0-39/5 vs. UNC Charlotte L 0-39/6 at UNC Wilmington W 3-19/6 vs. Western Carolina W 3-09/9 High Point W 3-09/12 vs. Massachusetts L 1-39/13 at Penn State L 0-39/13 vs. West Virginia L 0-39/16 Appalachian State L 2-39/19 Providence L 0-39/20 Samford W 3-09/20 Belmont W 3-09/23 UNC Charlotte W 3-29/26 at Charleston Southern* W 3-09/27 at Coastal Carolina* L 0-39/30 at Davidson W 3-010/4 Liberty* L 2-310/5 Coastal Carolina* L 0-310/11 UMBC* W 3-210/17 at Liberty* L 2-310/18 at Radford* L 1-310/21 East Tennessee State W 3-210/25 at UM-Eastern Shore W 3-0
10/25 at UMBC* L 2-310/27 Winthrop* W 3-111/1 Tennessee L 1-311/4 at Winthrop* L 2-311/8 Charleston Southern* W 3-011/9 Radford* W 3-111/14 Coastal Carolina^ L 2-3*Big South Matches^Big South Tournament Match
Overall Record: 18-13 Big South Record: 3-59/1 at East Tennessee State L 0-39/8 Appalachian State L 1-39/11 UNC Wilmington W 3-09/12 UNC Charlotte L 0-39/12 Western Carolina L 2-39/18 at UNC Wilmington W 3-09/19 vs. High Point W 3-09/19 vs. UNC Greensboro L 1-39/22 at Tennessee L 1-39/25 vs. The Citadel W 3-09/26 vs. North Carolina A&T W 3-09/26 vs. Stetson W 3-09/26 at Coll. Of Charleston W 3-010/3 Liberty* L 2-310/4 Radford* L 1-310/6 at Winthrop* L 2-310/9 at High Point W 3-110/10 at Elon W 3-110/17 Charleston Southern* W 3-110/18 Coastal Carolina* W 3-110/20 East Tennessee State W 3-010/25 Winthrop* W 3-010/31 at Liberty* L 1-311/1 at Radford* L 0-311/6 Elon W 3-011/7 High Point W 3-011/10 North Carolina A&T W 3-111/13 at Charleston Southern W 3-111/14 at Coastal Carolina L 1-311/20 vs. Winthrop^ W 3-111/21 vs. Liberty^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 16-17 Big South Record: 8-69/3 vs. LaSalle W 3-09/3 vs. Evansville L 1-39/4 at Middle Tennessee L 0-39/4 vs. Coll. Of Charleston L 2-39/7 at Western Carolina L 1-39/11 Montreat W 3-09/14 East Tennessee State L 2-39/17 vs. Wofford W 3-09/18 at Mercer W 3-19/18 vs. North Carolina A&T W 3-09/24 vs. Bethune-Cookman W 3-09/24 at UCF L 1-39/25 vs. Rice L 0-39/25 vs. St. John’s L 1-39/28 at Appalachian State W 3-110/1 High Point* W 3-110/2 Elon* W 3-010/5 at Winthrop* L 0-310/8 at Charleston Southern* W 3-010/9 at Coastal Carolina* L 1-310/12 Tennessee L 0-310/15 Liberty* L 2-310/16 Radford* W 3-210/24 Winthrop* W 3-110/29 at High Point* W 3-010/30 at Elon* L 1-311/6 Charleston Southern* W 3-0
1994
1995
1996
1997
1998
YEAR-BY-YEAR RESULTS SINCE 1994
1999
4242
2005
11/7 Coastal Carolina* W 3-011/9 at East Tennessee State L 2-311/12 at Radford* L 1-311/13 at Liberty* L 0-311/19 vs. Elon^ W 3-111/20 vs. Radford^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 13-21 Big South Record: 5-99/1 at Georgia Southern L 0-39/2 vs. Florida International L 1-39/2 vs. Jacksonville L 0-39/8 vs. Drexel W 3-29/9 vs. Bucknell W 3-19/9 at Youngstown State L 0-39/12 East Tennessee State L 0-39/15 vs. Wofford W 3-19/15 at Mercer W 3-09/16 vs. Middle Tennessee L 2-39/19 at Tennessee L 0-39/22 Campbell L 0-39/22 Loyola (MD) W 3-09/23 Pittsburgh L 0-39/23 North Carolina A&T W 3-09/30 Charleston Southern* W 3-110/1 Coastal Carolina* W 3-110/4 Winthrop* L 1-310/7 at Liberty* L 0-310/8 at Radford* L 0-310/13 Elon* L 2-310/14 High Point* W 3-110/18 at East Tennessee State L 0-310/25 Western Carolina L 0-310/28 Liberty* L 0-310/29 Radford* L 0-310/31 Wofford W 3-111/3 at Charleston Southern* W 3-211/4 at Coastal Carolina* L 0-311/8 at Winthrop* L 1-310/10 at Elon* L 1-310/11 at High Point* W 3-011/14 Gardner-Webb W 3-111/17 vs. Winthrop^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 7-21 Big South Record: 5-98/31 Memphis L 0-39/1 South Alabama L 2-39/1 Morehead State L 0-39/4 at Gardner-Webb L 1-39/7 vs. Rutgers L 0-39/8 at Penn State L 0-39/8 vs. George Mason L 0-39/19 at Wofford L 0-39/21 at High Point* W 3-09/22 at Elon* L 2-39/25 at Coastal Carolina* W 3-19/29 Birmingham-Southern W 3-010/2 Charleston Southern* W 3-110/5 Liberty* L 0-310/6 Radford* L 0-310/14 Winthrop* L 0-310/17 at Western Carolina L 0-310/19 High Point* W 3-210/20 Elon* W 3-210/23 Coastal Carolina* L 2-310/26 at Samford L 1-310/27 at Birmingham-Southern L 2-310/30 at Charleston Southern* L 0-311/2 at Radford* L 0-311/3 at Liberty* L 0-3
11/9 at Winthrop* L 0-311/15 vs. Charleston Southern^ W 3-011/16 vs. Radford^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 26-8 Big South Record: 12-28/30 vs. UNC Wilmington W 3-08/30 vs. Mercer W 3-28/31 vs. Appalachian State L 2-38/31 at High Point W 3-29/6 vs. UMBC L 2-39/7 at Navy L 2-39/7 vs. Albany W 3-09/10 at Morris Brown W 3-09/13 vs. Wofford W 3-09/13 at Mercer W 3-29/14 vs. High Point W 3-19/17 High Point* W 3-19/24 at North Carolina A&T L 2-39/27 Liberty* W 3-19/28 Radford* W 3-210/1 at East Tennessee State W 3-110/3 Elon* W 3-010/11 at Charleston Southern* W 3-010/12 at Coastal Carolina* L 2-310/15 at Winthrop* L 0-310/16 Mars Hill W 3-010/16 Montreat W 3-010/19 Birmingham-Southern W 3-110/22 Western Carolina L 2-310/25 at Liberty* W 3-010/26 at Radford* W 3-111/1 at Elon* W 3-111/2 at High Point* W 3-011/8 Charleston Southern* W 3-211/9 Coastal Carolina* W 3-111/12 Winthrop* W 3-211/15 at Birmingham-Southern W 3-111/21 vs. High Point^ W 3-111/22 vs. Liberty^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 18-10 Big South Record: 9-59/5 vs. Elon W 3-19/5 vs. Mercer W 3-29/6 at UNC Wilmington L 2-39/12 vs. Loyola (MD) W 3-09/13 at VCU W 3-29/13 vs. Albany L 2-39/16 at Western Carolina L 0-39/26 Liberty* L 2-39/27 Birmingham-Southern* W 3-210/1 at Furman L 0-310/4 at Winthrop* L 1-310/7 at High Point* W 3-110/12 Charleston Southern* W 3-010/15 Montreat W 3-010/15 Mars Hill W 3-010/18 Coastal Carolina* W 3-110/25 at Birmingham-Southern* W 3-110/28 Radford* W 3-210/31 at Charleston Southern* W 3-011/1 at Coastal Carolina* L 1-311/4 High Point* W 3-111/7 Winthrop* L 0-311/11 North Carolina A&T W 3-011/14 at Liberty* L 0-311/15 at Radford* W 3-211/21 vs. Birmingham-Southern^ W 3-111/22 vs. Liberty^ W 3-211/23 vs. Winthrop^ L 2-3
*Big South Matches^Big South Tournament Match
Overall Record: 19-17 Big South Record: 8-69/1 at Appalachian State L 1-39/2 Lipscomb W 3-09/3 vs. Elon L 2-39/3 at North Carolina State L 0-39/4 vs. UNC Wilmington L 1-39/4 vs. Wofford W 3-29/10 at Campbell L 1-39/11 vs. Wofford W 3-19/11 vs. Western Carolina L 2-39/14 Charleston Southern* W 3-09/21 Furman L 2-39/24 vs. Memphis L 1-39/24 at UNC Greensboro W 3-09/25 vs. Florida Atlantic L 2-39/25 vs. Morgan State W 3-09/28 at North Carolina A&T W 3-110/1 vs. St. John’s L 1-310/1 at UMES W 3-210/2 vs. Delaware State W 3-010/2 vs. Niagara W 3-010/5 at Liberty* W 3-010/8 at Charleston Southern* L 1-310/9 at Coastal Carolina* W 3-210/15 Winthrop* L 2-310/16 Coastal Carolina* L 1-310/19 Western Carolina W 3-010/22 Liberty* L 0-310/23 Birmingham-Southern* W 3-110/26 at Radford* W 3-010/28 East Tennessee State W 3-211/2 at High Point* W 3-211/5 at Winthrop* L 0-311/9 High Point* W 3-111/11 Radford* W 3-011/13 at Birmingham-Southern* L 0-311/16 Liberty^ L 0-3 *Big South Matches^Big South Tournament Match
Overall Record: 25-7 Big South Record: 10-48/27 Appalachian State L 0-39/2 vs. Chattanooga W 3-19/3 vs. UNC Wilmington W 3-19/3 at North Carolina A&T L 2-39/9 vs. Memphis W 3-19/9 vs. Louisiana Tech W 3-19/10 vs. Flordia International W 3-09/10 at Mercer W 3-29/16 Samford W 3-19/17 Elon W 3-09/17 Western Carolina W 3-09/22 at Lipscomb W 3-09/24 at Birmingham-Southern* W 3-19/27 at Gardner-Webb W 3-09/30 Charleston Southern* W 3-110/2 Coastal Carolina* L 1-310/7 at Winthrop* L 1-310/8 at High Point* W 3-110/14 at Liberty* W 3-210/15 at Radford* W 3-010/21 High Point* W 3-010/23 Winthrop* L 0-310/28 at Charleston Southern* W 3-210/29 at Coastal Carolina* L 1-311/1 at East Tennessee State W 3-211/4 Radford* W 3-011/6 Liberty* W 3-011/10 at Western Carolina W 3-011/12 Birmingham-Southern* W 3-0
2000
2001
2002
2003
2004
YEAR-BY-YEAR RESULTS SINCE 1994
4343
11/15 Liberty^ W 3-011/19 at Coastal Carolina^ W 3-011/20 vs. Winthrop^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 15-18 Big South Record: 10-48/25 vs. Canisius L 2-38/25 vs. Rutgers L 1-38/26 at James Madison L 0-38/26 vs. Duquesne L 2-38/29 at Elon W 3-29/1 Cleveland State L 0-39/2 UNC Greensboro L 2-39/2 East Tennessee State L 1-39/8 at Mercer L 0-39/8 vs. UAB L 0-39/9 vs. Nicholls State L 1-39/15 vs. Louisiana-Monroe W 3-09/16 vs. Charlotte L 2-39/16 at Samford L 0-39/23 Birmingham-Southern* W 3-09/29 Liberty* W 3-010/1 Radford* W 3-110/3 at High Point* W 3-110/6 at Winthrop* L 0-310/13 Coastal Carolina* W 3-110/15 Charleston Southern* W 3-010/20 Winthrop* L 1-310/22 High Point* W 3-110/24 Montreat W 3-010/27 at Liberty* L 1-310/28 at Radford W 3-111/3 at Charleston Southern* W 3-111/4 at Coastal Carolina* L 1-311/7 Gardner-Webb L 1-311/11 at Birmingham-Southern* W 3-211/14 Radford^ W 3-011/17 vs. Coastal Carolina^ W 3-211/18 vs. Winthrop^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 12-22 Big South Record: 2-108/24 vs. TCU L 0-38/25 at Florida State L 0-38/25 vs. Florida Gulf Coast L 0-38/31 Western Carolina L 0-39/1 Kennesaw State L 2-39/1 USC Upstate W 3-19/7 vs. Missouri State L 0-39/8 at Chattanooga L 0-39/8 vs. Tennessee Tech L 0-39/11 North Carolina Central W 3-19/14 at Alabama State W 3-09/14 vs. Mississippi Valley State W 3-19/15 vs. Southern W 3-09/15 vs. Alabama A&M W 3-09/19 at East Tennessee State L 2-39/22 at Presbyterian L 0-39/23 Jacksonville L 1-39/28 at Coastal Carolina* L 0-39/29 at Charleston Southern* L 0-310/5 High Point* L 1-310/6 Winthrop* L 1-310/12 at Radford* L 1-310/14 at Liberty* L 0-310/19 at Winthrop* L 1-310/20 at High Point* L 1-310/23 at Gardner-Webb W 3-010/26 Charleston Southern* W 3-110/27 Coastal Carolina* L 1-311/2 Radford* W 3-1
11/3 Liberty* L 0-311/8 at USC Upstate W 3-211/10 Prebyterian W 3-111/15 vs. High Point^ W 3-211/16 vs. Winthrop^ L 1-3*Big South Matches^Big South Tournament Match
Overall Record: 18-14 Big South Record: 8-88/29 vs. Elon L 0-38/29 vs. Florida Gulf Coast W 3-2 8/30 vs. Maine L 2-39/5 vs. Hampton W 3-09/6 vs. Wofford L 1-39/6 at USC Upstate W 3-09/12 vs. William & Mary L 2-39/12 vs. Norfolk State W 3-09/13 at N.C. State W 3-29/16 at Western Carolina W 3-19/20 vs. Virginia Tech L 0-39/20 at UNC Wilmington W 3-29/23 North Carolina A&T W 3-0 9/26 High Point* L 2-310/4 at Winthrop* L 2-310/7 Presbyterian* L 1-310/10 at Radford* L 1-310/11 at Liberty* L 0-310/14 at Gardner-Webb* W 3-110/17 Charleston Southern* W 3-210/18 Coastal Carolina* L 2-310/25 at High Point* W 3-211/1 Winthrop* W 3-211/4 Gardner-Webb* W 3-011/7 Liberty* W 3-211/8 Radford* W 3-111/11 at Presbyterian* W 3-211/14 at Coastal Carolina* L 0-311/15 at Charleston Southern* L 2-311/21 Winthrop^ W 3-111/22 Liberty^ L 0-311/25 Wofford W 3-0
Overall Record: 25-10 Big South Record: 13-38/28 vs. UNC Wilmington L 1-38/28 vs. South Carolina State W 3-08/29 vs. Elon L 1-38/29 vs. The Citadel W 3-29/2 Western Carolina W 3-09/4 vs. N.C. State W 3-19/5 vs. The Citadel W 3-09/5 at USC Upstate W 3-09/11 vs. Savannah State W 3-09/11 vs. East Carolina L 1-39/12 vs. Wofford L 2-39/12 vs. Winston-Salem State W 3-09/18 vs. Winston-Salem State W 3-09/18 vs. Hampton W 3-09/19 vs. Providence W 3-19/19 vs. Wofford W 3-09/22 Gardner-Webb* W 3-19/25 at Radford* W 3-210/2 Charleston Southern* W 3-210/6 at Presbyterian* W 3-010/9 High Point* W 3-010/10 Liberty* W 3-110/16 at Winthrop* W 3-110/17 at Coastal Carolina* L 2-310/20 East Tennessee State L 2-310/24 Radford* W 3-010/27 Presbyterian* W 3-110/31 at Charleston Southern* L 2-311/3 at Gardner-Webb* W 3-111/6 at Liberty* W 3-1
11/7 at High Point* W 3-111/13 Coastal Carolina* L 2-311/14 Winthrop* W 3-211/19 at Radford^ W 3-011/20 vs. Coastal Carolina^ L 0-3*Big South Matches^Big South Tournament Match
Overall Record: 19-12 Big South Record: 11-58/27 vs. Davidson L 0-38/28 at James Madison L 0-39/3 vs. Stetson W 3-19/3 at South Alabama W 3-09/4 vs. Alabama State W 3-09/4 vs. Alabama A&M L 2-39/10 vs. UNC Greensboro L 1-39/11 vs. Austin Peay L 0-39/11 at ETSU L 1-39/18 vs. NC A&T W 3-09/18 at Western Carolina W 3-19/20 Gardner-Webb* W 3-09/24 Coastal Carolina* W 3-29/28 at Mercer W 3-010/1 at Radford* W 3-110/2 at High Point* L 0-310/5 at Presbyterian* W 3-110/8 at Charleston Southern* W 3-210/9 at Winthrop* L 1-310/16 Liberty* L 1-310/23 at Coastal Carolina* L 1-310/26 Mercer W 3-010/29 High Point* W 3-110/30 Radford* W 3-211/2 Presbyterian* W 3-011/5 Winthrop* W 3-211/6 Charleston Southern* W 3-111/9 at Gardner-Webb* W 3-011/13 at Liberty* L 2-311/18 vs. Charleston Southern^ L 2-3*Big South Matches^Big South Tournament Match
2006
2007
2008
2009
2010
YEAR-BY-YEAR RESULTS SINCE 1994
4444
ALL-TIME RESULTSTeam W L Alabama A&M 1 1Alabama State 2 0Albany 1 1Appalachian State 3 8Austin Peay 0 1Belmont 1 0Bethune-Cookman 1 0Birmingham-Southern 11 2Bucknell 1 1Campbell 1 2 Canisius 0 1Charleston, College of 3 1 Charleston Southern 28 7 Charlotte 4 6Chattanooga 1 1Citadel 3 0 Clemson 0 1Cleveland State 0 1Coastal Carolina 11 22 Davidson 1 2Delaware State 1 0Drexel 0 1Duquesne 0 1East Carolina 1 1 East Tennessee State 7 13 Elon 10 7Evansville 0 1Florida Atlantic 0 1Florida A&M 1 0Florida Gulf Coast 1 1Florida International 1 2Florida State 0 1Furman 2 2 Gardner-Webb 9 2George Mason 0 1Georgia Southern 0 3Georgia State 1 2Georgia Tech 0 2 Hampton 2 0High Point 28 4 Howard University 2 0Jacksonville 0 2Jacksonville State 0 1James Madison 0 2Kennesaw State 0 1LaSalle 1 0Liberty 13 25Lipscomb 2 0Louisiana-Monroe 1 0Louisiana Tech 1 0Loyola (Md) 2 0Maine 0 1Massachusetts 0 1Mars Hill 4 0Maryland-Eastern Shore 2 0Memphis 1 2 Mercer 9 2 Middle Tennessee 0 2
Team W L Mississippi Valley State 1 0Missouri State 0 1Montana State 1 0Montreat 4 0Morehead State 0 1Morgan State 1 0Morris Brown 1 0Navy 0 1Niagara 1 0Nicholls State 0 1Norfolk State 1 0North Carolina 0 1 North Carolina A&T 13 1 North Carolina Central 1 0North Carolina State 2 1Penn State 0 2Pittsburgh 0 1Presbyterian 6 2Providence 1 1Radford 23 12Rice 0 1Rutgers 0 2Samford 3 2Savannah State 1 0South Alabama 1 1 South Carolina State 2 0South Carolina Upstate 4 0Southeastern La. 1 0Southern 1 0St. John’s 0 2Stetson 2 0Tennessee 0 6Tennessee-Martin 1 0Tennessee State 1 0Tennessee Tech 0 2 Texas Christian 0 1Towson 0 2 Troy 0 1UAB 1 2UCF 0 2UMBC 1 6 UNC Greensboro 2 7 UNC Wilmington 8 4 Virginia Commonwealth 0 1 Virginia Tech 0 1Wake Forest 0 1 West Virginia 0 1Western Carolina 11 8 William & Mary 0 1Winston-Salem State 2 0Winthrop 13 25 Wofford 12 4Youngstown State 0 1
All-Time Results Since 1994
4545
ATTACK SET SERVE DIG BLOCKING ## PLAYER SUMMARY SP K K/S E TA Pct A A/S SA SE SA/S RE DIG Dig/S BS BA Total Blk/S BE BHE Points 2 Miller, Cindi 113 437 3.87 182 1269 .201 17 0.15 25 27 0.22 32 344 3.04 6 50 56 0.50 4 3 493.011 Benorden, Kelsey 117 395 3.38 159 1320 .179 31 0.26 33 10 0.28 31 417 3.56 8 36 44 0.38 9 3 454.04 Dover, Jenna 104 130 1.25 44 403 .213 5 0.05 0 0 0.00 0 51 0.49 10 47 57 0.55 14 3 163.51 Foster, Meredith 99 123 1.24 43 349 .229 9 0.09 20 37 0.20 0 49 0.49 8 79 87 0.88 3 0 190.53 Shelton, Holly 79 102 1.29 37 253 .257 5 0.06 0 0 0.00 2 20 0.25 9 62 71 0.90 11 1 142.012 Olivo, Rachel 77 87 1.13 29 236 .246 7 0.09 3 4 0.04 2 31 0.40 7 38 45 0.58 7 2 116.06 Guinane, Rachel 94 80 0.85 21 226 .261 743 7.90 12 11 0.13 0 145 1.54 7 32 39 0.41 9 11 115.07 Morse, Hallie 73 28 0.38 9 89 .213 406 5.56 10 10 0.14 0 107 1.47 3 16 19 0.26 1 6 49.014 Kenley, Chelsie 19 24 1.26 3 69 .304 1 0.05 0 0 0.00 1 6 0.32 0 3 3 0.16 1 0 25.515 Henson, Kate 5 6 1.20 5 18 .056 0 0.00 0 0 0.00 0 2 0.40 0 0 0 0.00 0 0 6.013 Stewart, Alex 116 3 0.03 6 28 -.107 57 0.49 13 12 0.11 44 502 4.33 0 0 0 0.00 0 1 16.09 Wells, Rachel 112 1 0.01 6 43 -.116 37 0.33 26 18 0.23 19 287 2.56 0 0 0 0.00 0 0 27.08 Dorfman, Jamie 8 0 0.00 0 3 .000 2 0.25 0 3 0.00 1 4 0.50 0 0 0 0.00 0 0 0.05 Parlier, Anna Beth 15 0 0.00 1 2 -.500 0 0.00 5 2 0.33 2 13 0.87 0 0 0 0.00 0 0 5.0 TEAM 18 UNC ASHEVILLE 117 1416 12.10 545 4308 .202 1320 11.28 147 134 1.26 152 1978 16.91 58 363 239.5 2.05 59 30 1802.5 Opponents 117 1562 13.35 746 4559 .179 1466 12.53 152 189 1.30 147 2072 17.71 69 252 195.0 1.67 45 38 1909.0
2010 COMBINED TEAM STATSRECORD: OVERALL HOME AWAY NEUTRALALL MATCHES 19-12 8-1 7-6 4-5CONFERENCE 11-5 7-1 4-4 0-0NON-CONFERENCE 8-7 1-0 3-2 4-5
TEAM STATISTICS AVL OPPATTACK Kills 1416 1562 Errors 545 746 Total Attacks 4308 4559 Attack Pct .202 .179 Kills/Set 12.1 13.4SET Assists 1320 1466 Assists/Set 11.3 12.5SERVE Aces 147 152 Errors 134 189 Aces/Set 1.3 1.3SERVE RECEPTIONS Errors 152 147 Errors/Set 1.3 1.3DEFENSE Digs 1978 2072 Digs/Set 16.9 17.7BLOCKING Block Solo 58 69 Block Assist 363 252 Total Blocks 239.5 195.0 Blocks/Set 2.0 1.7 Block Errors 59 45Ball handling errors 30 38ATTENDANCE Total 3942 4630 Dates/Avg Per Date 9/438 13/356 Neutral site #/Avg 9/35 Current win streak 0 - Home win streak 6 -
DATE OPPONENT W/L SCORE SCORE-BY-SET ATT!Aug 27 vs Davidson L 0-3 18-25,17-25,19-25 -!Aug 28 at James Madison L 0-3 23-25,15-25,13-25 350!Aug 28 vs Stetson W 3-1 23-25,25-15,25-23,25-18 100$Sep 03 vs Southeastern La. W 3-0 25-20,25-20,25-19 52$Sep 03 at South Alabama W 3-1 25-12,25-19,22-25,25-23 157$Sep 04 vs Alabama State W 3-0 25-13,25-14,25-7 24$Sep 04 vs Alabama A&M L 2-3 25-23,23-25,25-18,23-25,8-15 93%Sep 10 vs UNC Greensboro L 1-3 20-25,21-25,25-21,23-25 -%Sep 11 vs Austin Peay L 0-3 24-26,20-25,19-25 -%Sep 11 at ETSU L 1-3 14-25,25-22,23-25,20-25 161^Sep 18 vs NC A&T W 3-0 25-6,25-13,25-9 43^Sep 18 at Western Carolina W 3-1 25-17,22-25,25-17,25-19 103*Sep 20, GARDNER-WEBB W 3-0 25-16,25-18,25-16 361*Sep 24 COASTAL CAROLINA W 3-2 14-25,25-23,24-26,25-21,15-11 786Sep 28 at Mercer W 3-0 25-21,25-17,25-16 339*Oct 01 at RADFORD W 3-1 25-14,13-25,25-16,25-17 363*Oct 02 at High Point L 0-3 20-25,22-25,19-25 1106*Oct 05 at Presbyterian College W 3-1 22-25,25-16,26-24,27-25 218*Oct 08 at Charleston Southern W 3-2 24-26,25-23,22-25,27-25,15-12 357*Oct 9 at Winthrop L 1-3 21-25,22-25,25-21,24-26 452*Oct 16 LIBERTY L 1-3 25-23,24-26,20-25,19-25 568*Oct 23 at COASTAL CAROLINA L 1-3 12-25,14-25,25-23,17-25 261Oct 26 MERCER W 3-0 25-9,25-21,25-13 327*Oct 29 HIGH POINT W 3-1 25-20,25-23,14-25,25-19 461*Oct 30 RADFORD W 3-2 23-25,23-25,25-18,27-25,15-10 416*Nov 02 PRESBYTERIAN COLLEGE W 3-0 25-21,25-15,27-25 364*Nov 05 WINTHROP W 3-2 25-22,22-25,22-25,25-23,15-13 458*Nov 06 CHARLESTON SOUTHERN W 3-1 23-25,27-25,25-16,25-20 201*Nov 09 at Gardner-Webb W 3-0 25-23,25-16,25-19 135*Nov 13 at LIBERTY L 2-3 14-25,25-22,17-25,25-19,10-15 628^Nov 18 vs #6 Charleston Southern L 0-3 19-25,11-25,18-25 -
! - James Madison Invitational $ - South Alabama Invitational% - ETSU Buccaneer Classic ^ - Western Carolina Invitational* - Big South Conference Match
4646
FEKETEFEKETE
UNC ASHEVILLE HALL OF FAME
UNC Asheville’s Athletics Hall of Fame was established in 2003 and has had six classes inducted. A total of 20 athletes and administrators have been enshrined. Of those 20 inductees, four are former volleyball players: Ilona Fekete, Danielle Meyer, Elissa Steffen and Loralee Smith.
Ilona Fekete Thimmer (1990-92)Inducted in 2003
Ilona Fekete Thimmer established a tradition of great volleyball at UNC Asheville from 1990-92. She led the Bulldogs to three straight Big South Conference regular-season titles and two straight tournament crowns. She also led the nation in blocks as a sophomore in 1990 and was among the nation’s leaders in that category the next two seasons. The Pembroke Pines, Fla., native was the Big South Player of the Year in 1990 and was an all-conference and all-tournament selection for three seasons. She is the school’s all-time leader in total blocks and block solos. Thimmer was inducted into the inaugural class of the Big South Conference Hall of Fame. She and her family reside in Vero Beach, Fla.
Danielle Meyer Harrison (1990-93)Inducted in 2007
Danielle Meyer Harrison was the Bulldogs’ starting setter for four years and is third all-time on the career assist list with 5,187. She helped lead UNC Asheville to three straight Big South Conference regular-season championships and two tournament titles. She was the Co-MVP of the 1992 Big South Conference Tournament. The Bulldogs were 35-6 against Big South opponents during her career. She was an all-conference selection twice and was part of the 1991 UNC Asheville team that was selected to the National Invitational Volleyball Championships in Dayton, Ohio. She and her family reside in Illionis.
Elissa Steffen Mount (1991-94)Inducted in 2008
Elissa Steffen Mount enjoyed a sensational career for the Bulldogs. She is UNC Asheville’s all-time career leader in three different categories. Elissa is the all-time leader in kills (1,775), digs (2,179) and attempts (4,993). She was an all-conference performer as a junior and senior and was a part of two Big South Conference championship teams as a freshman and sophomore. Elissa helped lead UNC Asheville to its fi rst ever post-season tournament as a Division I school when the Bulldogs were selected to participate in the 1991 National Invitational Volleyball Championships. She and her husband Jeremy live in Hawaii with their two children.
Loralee Smith (1994-97)Inducted in 2009
Lorelee Smith was a three-time fi rst team Big South All-Conference selection. She completed her career as UNC Asheville and the Big South’s all-time leader in assists with 5,904 and that record still stands today. Lorelee also holds the school and Big South record for most assists in a season with 1,852 set in 1996. She was the 1997 Big South Conference Scholar-Athlete of the Year and twice earned All-Region All-Academic honors.
STEFFENSTEFFEN MEYERMEYER SMITHSMITH
4747
VOLLEYBALL PLAYERS IN UNC ASHEVILLE’S HALL OF FAME
• A •Missy Allen, 1989-90Khristine Ambrose, 1997-00Suzanne Aubel, 1999-2003Kim Ayscue, 1990-91
• B •Shannen Bagge, 2006-07Jennifer Baker, 1996-99Suzanne Barca, 2001-02Aretha Barnes, 1990Jessica Beal, 1998-2000Tina Bell, 1989-90Pat Bembry, 1983-84Kelsey Benorden, 2007-10Tricia Bivens, 1990Angie Boyte, 1987-88Amy Breitenstein, 1989Kristy Brinkley, 1999-2001Beth Brown, 1996-98Mellisa Brumbaugh, 1991Kelly Budnik, 2000-03Judy Burgess, 1983-84Heather Burns, 2005-08Rose Butler, 2002-05
• C •Kim Camby, 1986-88Cindy Carswell, 1984Ursula Carswell, 1994-95Kim Cass, 1988-92Tracy Clark, 1985Rebecca Clausen, 1998-99Beth Cole, 1985-88Tonya Collins, 1994Jonette Corn, 1990Laura Cowart, 1996Karie Crisp, 1995-96
• D •Kelly Danielson, 1996-97Belinda Deyton, 1995Jaimie Dorfman, 2010-Jenna Dover, 2007-10Mellie Durham, 1992-95
• F •Ilona Fekete, 1990-92Samia Fercha, 1997Lauren Ficker, 2006-09Meredith Foster, 2010-Fonda Frady, 1985,1987-88Pam Freeman, 1992-93
• G •Paige Garland, 1998Cally Geiger, 1995-98Tina Gilbert, 1988-89Laura Glass, 1984Gina Golkiewicz, 1990-92Allison Green, 1998-2000
Sherri Green, 1986Alysha Greer, 2006-07Karen Griffi ths, 1983-84Kathy Griffi ths, 1986Kim Groendel, 1984-85Rachel Guinane, 2007-10
• H •Sabrina Harrison, 1996-97Danielle Hartman, 2004Krysti Havens, 2002-05Tiffanie Hazel, 1997Chandra Hicks, 1996-99Brenda Hollingsworth, 1986Bridget Holliday, 2006-09Brooke Holliday, 2006-09Jennifer Hutchins, 1990-93
• J •Jennifer Jackson, 1988Alexa Jacobs, 2005Emily Jacobs, 2002-03Una Japundze, 2009Linwood Jaycocks, 1997-00Jessica Jones, 1999-2002
• K •Chelsie Kenley, 2009-Rory Kelly, 2003-04Jessica Keys, 1998Samantha King, 1997Neecole King, 1991Anne Kuester, 1994-97
• L •Jenna Lahmayer, 2000Allison Lambert, 2004-05Melinda Lee, 2004
• M •Angela Martin, 1986-87Kaitlyn McDaniel, 2006-09Katie Meindl, 1999-2000Amber Mendenhall, 1988-92Danielle Meyer, 1990-93Marie Meyer, 1983-85Cindi Miller, 2008-Raquel Miotto, 2006-09Adrienne Moore, 1999-2001Hallie Morse, 2010-Kim Mosteller, 1985Angie Mulkin, 1986-87Megan Murphy, 2002-05
• N •Hannah Neal, 2001Karen Noffsinger, 1984-85Ryan Norman, 2002-03
• O •Kelly O’Grady, 1988-90
Talia Ogle, 2003-05Rachel Olivo, 2008-10Sara Orozco, 1983-84Kim Osborne, 1993-96
• P •Emily Palma, 2006Anna Beth Parlier, 2009-10Robin Pentz, 1986Joy Perez, 1998Sandra Potter, 1987-89
• R •Carrie Ramsey, 1999Jenni Reynolds, 1994-97Lisa Roberts, 1983Elizabeth Rodriguez, 1998-2001
• S •Jessica Salyers, 2003-04Lia Scott, 2008Stephanie Scott, 1994Mallory Schaffert, 2005-06Holly Shelton, 2009-Frida Sigurdardottir, 2000-03Regan Simpson, 2008Courtney Skillman, 1997Tammy Sluder, 1985-86Lorelee Smith, 1994-97Bonny Sneed, 2001Elissa Steffen, 1991-94Joan Sterk, 1983-84Alex Stewart, 2010-Tracy Stradling, 1986
• T •Heather Terrell, 1998-2001Courtney Tucker, 1994-96
• U •Elif Unlu, 2003-06
• V •Holly VanWagner 1986-87
• W •Angela Ward, 1999Rachel Wells, 2010-Monica White, 1988Leslie Whitfi eld, 1999-2002Kim Wieters, 1987-90Amanda Wiles, 2002-05Nikki Williams, 1985Dana Wilson, 1994Tracy Winfree, 1986Mary Wortas, 1986-87Ashley Wrightenberry, 2004-07
*Current players in BOLD
ALL-TIME LETTERWINNERS
4848
4949
Fiske Guide Gives High Marks to UNC Asheville and its Environmental Studies ProgramFiske Guide Gives High Marks to UNC Asheville and its Environmental Studies Program
UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the country.”country.” “This public liberal arts university offers all the perks that are generally associated with pricier private “This public liberal arts university offers all the perks that are generally associated with pricier private institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville provides all this for a fraction of the cost of a private college.provides all this for a fraction of the cost of a private college. In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department stresses on-the-job internships in organizations involved with environmental issues. stresses on-the-job internships in organizations involved with environmental issues. The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money you’re saving, the University of North Carolina at Asheville will have you seeing green.” you’re saving, the University of North Carolina at Asheville will have you seeing green.”
UNC Asheville Ranked Among Nation’s Best Colleges by U.S. News & World Report UNC UNC Asheville received high marks in the 2011 edition of U.S. News & World Report’s “Best Colleges” rankings released on August 17. UNC Asheville ranked fi fth among National Liberal Arts Colleges in “The 2011 Up-and-Comers” list, which highlights schools with “the most promising and innovative changes.” This select list leads the overall rankings in the 2011 edition of the U.S. News & World Report “Best Colleges” guidebook, which will be available on-line August 17 and on newsstands August 24. UNC Asheville was also one of only 25 universities in the nation to make the U.S. News & World Report list of “stellar” schools for undergraduate research/creative projects. UNC Asheville, Duke, and UNC-Chapel Hill are the lone North Carolina representatives on this list. UNC Asheville, which founded the National Council for Undergraduate Research more than 20 years ago, has made this roster annually since it began nine years ago. In addition, UNC Asheville was included on the list of 39 National Liberal Arts Colleges with the strongest commitment to undergraduate teaching. U.S. News & World Report’s overall rankings include a number of factors, including fi nancial support from alumni, grades and test scores of incoming freshmen and admissions selectivity along with the quality of instruction and curriculum. UNC Asheville was ranked sixth among public institutions in the National Liberal Arts Colleges category and number 158 in the category overall. Again this year, UNC Asheville was recognized by U.S. News & World Report for affordability as measured by student debt. The university ranked 14th among National Liberal Arts Colleges for least debt among graduating students. This is consistent with fi ndings from other leading college rankings services. The 2011 edition of the “Fiske Guide to Colleges,” issued in July, called UNC Asheville “one of the best educational bargains in the country.” In January, Princeton Review named UNC Asheville to its “Best College Values for 2010” list.
UNC Asheville Named One of the 50 “Best Value” Public Colleges in the U.S. by Princeton Review
Rising costs in today’s challenging economy has pushed up the price of everything from gas to groceries. But there are still great values to be found in higher education, according to “Best Value Colleges for 2010” ranking released today from the Princeton Review. UNC Asheville was among just 50 institutions nationwide named to the “Best Value” Public Colleges list. The Princeton Review also published a 50 “Best Value” Private Colleges list, for a total of 100 colleges in all. UNC Asheville was the only college or university in Western North Carolina to make the list. This is the fourth year that UNC Asheville has been selected by the Princeton Review as one of the 50 best value public colleges in the country. According to the Princeton Review, the schools that made the “Best Value” list are “fi rst-rate institutions offering outstanding academics at a relatively low cost of attendance and/or generous fi nancial aid.” The Princeton Review praised UNC Asheville’s growing national academic reputation, noting that the University provides “students a private school experience at a public school cost.” It also favorably notes the University’s numerous academic options, small class size and strong focus on the liberal arts. The ranking applauds UNC Asheville’s accessible faculty and the diverse offering of student activities both on and off campus. The Princeton Review selected the top 100 institutions as its “Best Value” choices for 2010 based on its surveys of administrators and students at more than 650 public and private colleges and universities. The selection criteria covered more than 30 factors in three areas: academics, costs of attendance, and fi nancial aid, using the most recently reported data from each institution for the 2008-09 academic year.
UNC Asheville consistently ranks as one of the nation’s best values in higher education. It has made the Fiske Guide to Colleges’ “Best Buy” list for the past 16 years and is among the Kiplinger’s Personal Finance magazine’s 100 best value public colleges and universities. And according to U.S. News & World Report’s current college rankings, UNC Asheville is among the top 25 liberal arts colleges in the nation whose students graduated with the least debt in 2008.
WHAT OTHERS ARE SAYINGWHAT OTHERS ARE SAYING
5050
WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC AAA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuupppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....
HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s
AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 1919191919191919
MoMoMoststst PP Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchchhchhchhc oooololoololooolooolololoooolooloolo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititittittererererereere atatatturururureeee,e,ee,e, EEEEEE EEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnonnnnnnnnnno mmmemememeeeeeememeeemeeeem ntntntntntnntntntnntnntnnnnnnnntnntnn alalaalalalalalalaallllalallallalaaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuututututututututututututututtuuutuuuudididdidididididdidddididdidididididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,,ArArArArAAArt ttt anand d HiHiHiHiHHiHHiiiiiistsstssssssss oroory y y
FuFuFulblblblbbriririighghghghght t t t AAAAwwwwwwwwarararardsdsdsdssssss:: :: ::::::::::::: 3434343444343434343434344334444444444 s s ssttututututtt ddddeeeeeeeeeeenttttntntntntntnntntntnts s s hahahahavevevev reeeeececceceeeee eeieieieiieieiiiveveveveveveeveveed d ddd d d dddddddd thththhththhhhthththhee prprprpresesesestitit gigig ououuuus ss s s sss s awawawawaaawawawawawawawaaawwwaaawawawwaaaaaaaa aaaaaaaarararaaaaraaaaaaaaaaa dddddddddddd
UnUnUnUnnnnnnnnnnnnUnnUnUnUnU ddddedededdddddddddd rgrgrgrgrgggggrgggrggggraraaaaaaaaadduuuuuuaatatate e e ReReReReReRReRRRRReeRRRReRRRReRReRReesseseseseseseeeseeseseseesesesesesearaararrrararchchchch:::::: : : MoooMM rerer t thahan hhhahahhahahaaahhhahhahhalflflfflffffflff ooo oo o offff f f fffff ststststststuuuuuududuuuuu eeneenenennenee tttsttstststststststs ccc c cc c comomomomplplplpleeeeeteettettteeeteteteete eeeee e ee eeeeeeee ee oorooooorrrrooorrorrorooooooooo igigggggggggggggininininininininininnnaaaalalaaaaaaaaa rrrrrrrrr reeeeeeeseseeseeeee eaeaeaeaeaeaeaaaeaaeaaeeaeaeeaeee rcrcrccrcccccchhhhhh hhhhh hhhhhhh ininininininnninnniinnininiinnn ttttt t t tttttttttthhehheheheeheehehehehehehehehhehhhehhehhhhhehhhheiriririririiirir fi fififi fififi fifi ee ee e eldldldldlddlddd ooo o o oof f f f ffff stsstststststss udududududyyyyythththththhthht rrorororoororoororrorororouguguguggugggugugguggguggghhhhhh h hhh ththhhhthhhhe e eeeeee UnUnUnUnUnUnUnUnivivivivivviiverererererersisisisitytytytytyyyyy’s’s’s’s nn aaaatata ioionanan lllllly yy rrerererereerrrrrecococococooooocogngngngnnngngngnnnnng iziziizizzeeededddedededde UUUUUUndnddddndndddddndndnddddddddddeeeeerererereeeeeeee grgrgrgradadadadaa uauauuuauauauauaaaaaaauauauuauaaaauauattteteteteteeeteteteeeee R RRRRR RRReeseseseseseseseseeseseeese eeeeeaeaeaeaeeaeeeee rcrcrcrcrcrccrcrcrcrcrcrcrrrrcr h h hhhhhhhhh PrPrPrPPrPPrPrPrPrPPPPP ogooooogogogogogoogggooo rarrrararrararraraarrrararrrrarrrrrarrararrrarrrrarrrararamm.m.mmm.mmmmmm.m.m.m.mmmm.mmmmmmmmmmmm UU UUUUU NCNCNCNCNCNCNCCN A A AAAshsshshshshshs evevevevevevevvvililililillilllleleleleleleefofofounundedeed dd ththhhhhthhhhhhhheeeeeeee eee e NaNaNNaNaNaNaNaNaNaNaNNaNaatititittitititittiiitiononononononononnononnalalalalalalaaaa C C C Coooouuuuuuuooouuuoo ncncncncncnncncncililil f f fororor U UUUndddddnddndddddererrrrreerrrrgrgrggrgrgrgggggg adadadadaddaadadadaadadaddaduauauaauauaauauaauau teteteteeeteeeeetettetetett RR RRRRRRRR RRR RRRR RRR RR RRRRRRRRRResesesesesesessessesssesseesseeesesesesseseesssessse eeaeeaeaeaeaeaeeaeaeeaeaeeaeeeaeaeae rcrcrcrcrcrrch hh h hhhh momomommomomomoomomommomoooomooooooomoorererererererererererererrereerererererere t thhhahahahahahhaaahahahahaaahahahahhahahahaahhaaaaahaannnnnn n nnnn nnnnnnnnnnn n 22225252525525255225252555252522255252555 y yyyyy y yyy yyyyy y yyyyyyyyy yy yyyyyyyyyyyyeaeaeaeaeaeaeaeaeaeaeaeeeaeaeaeeaeaaeee rsssssrsssssssssssssrsssssssssssssrss a a aaa aaa aa gogogogogggooogoogogogogogogoogoggogoggoggogggogogggogogoggogggggogggg .. . .... . ..
SSStStStStStStStSStSSStStSStStStttudududuuuuuuuuuu y y y yy yyyy AbAbAbroroaaaadaddda a aaaaaaaaaaaaaandnddndndndndndnddndndndndndnddnddddnd SS S S S SSSSSSSSS SSSStutttututututututututtututttttutt ddydydydydyddydyddddddy A A AAA A AAAAAwwaway:y:y: 1 1 7 7 7 pepepeeeeeeercrcrcrrcrceeeneneenenene tt tt fofofoff s sssssssstututututuuutuuuuuuuudedededddddddededededddddededddddddddddd ntntnntnnnnntntnttntnnnntnnnnnnnnntttn ss s ssssss s ss sssssssssss ttatatatatatttatatatattatatatataatatatatattatakkekekekkekekekekekekkkkekekkkekkke a aaaa aa a aaa aaa aaadvdvdvdvdvddddvdvddvvdddvdvvvvvvananananannnannnananannnnannnnnnnnnnnnnttataattatagegeeggeegeegegegeeegeeeeegeeeeeegeeeeee o oo o o o o o oooooffffffff f f lelelelelleleeleeararararararararrararaararrarraarnininninininiininingngngngngngngngngngnngngnn ooooo oooooo oooo ooooooo ooooppppppppppppppppppppppppppp ortutunin titiiesesess i iiinnnnnnnotototoootototototthehheheheheheheehhhhh r rrrrrrrr rrrrrrr ststsss atatesesesesesssesesese aaanndddddddddndddddddddddddd ccccccc cc c cccc ccouououoouououououooououuuoouoouoouuuuouounntntntntnttnntntntntntntntnnntririririrrrirrrrrrrrr esessesesss www wwhihilele e eenrnrroolollolllllleleeleddddd d d ddddd atatattattt U U U U NCNCNNNNCNCNCCCCNCNCCNC A AAAA AAAAAAAAAAAAAAAAAAAAAAAAAshshshshhhhhhhshhhhhhhhhhhhhhhevevevvvvvvvevvevvvvvvvvvvvvvvevvvvviilillllii lellllllelelelllllelell .. . .
StStStStStSttududududu enenenene ttttt t ttt AtAtAtAtAtAtAAtAttAAAthlhlhlhhlhlhhhletetttttteee eeeeeeeeee GrGGrGrGrGrGrGrGGGrGGrG adddduauauauauauaauattiiititt onononnoon R R RRatatatate:e:ee: U UUUNCNCCCC AAAAshshhshevevevvilililililillelleell ss ssssssstuttuudededdennnnnntnntntnntntnnnnntnn -a---a-a-aththhleleeleteetetetet sss s ss ssss hahahahaahahahahahahaaahhaahahahavevevevvevevvveveve oooo oonnenenneneee o oo ooooooooooooooooff fffff ff ffffffffffffff thtttththththththththththttheeeee e hihhihihihihhihhhii hghhghghhghgheseseeeestt grr daduauaaatititionononnrarar tetess s s inininininninn t t t t tthheheeeeehe NNNNN N NNNNNCCCACAACAACAACAACAA.AA.A.AA.AAA. O OOOOOOOOOururururururururruurrururru s s ss s stututututttutudddeeeeeeeededeeedededeeeeedeennnnnnttttntnntnnnnntnntnnt aaa-a-athththththtththhthleleleleleleeletetetetetetetesssss s onononononon aaaa a aaththhtthhththllleleleelll tititit c scsssssscssssssssssssschohooooooooolallalalaalalalaaaaalalalal rsrsrsrsrssrsrsrsrsrsrsrssshihhihhihihihihihihhihihihhhihihiihihhihhihippspspspspspspspspspspspsspspspsppspspspspspspspsppsp w w wwwwwwwwww wwww ww ww wwhhhhohhohohhohohohohohhhho ppllalall y y lala l l fof urur y yyeaearsrsrsrssrsrss aaaaaa aat tttt tt UUNUNUNUNCCCCAAsAsAsAAAAAAAsAAsheheehheheheh viviiiviiivivivilllllllllllll e e e e ee hhhahahahahaveeeve aaa aaaaa 9999 9 999999999 99 pepepepepepepercrcrcrcrcrccenenenenenennntttttt t t grgrgrgrgrgradadadadadddaduuauauauauaatitititititit ononnoo rrratattatte.e..ee
FaFFaFacucucucucucultlttltlty:y:yy:y:yy: 222 2 222 211111111111 fff ff fulululuu l-l-l-l titititimemememee p prororooofefefesssssssorororororororoo s,s,sss,ssss 8 888885%5%5%5%5%%5%% ww w w ww wwwitititititititth h hhhhhh tetettettermrmrrrmrmmrminnnininnalalalalllaaal ddddddd d ddegegegegegegeggeggrerererererereeerr esesesesesesesesessessssess
COCCOCCCOCOPLPLPLPLACACACCAC::: UNNUNUNUNCCCCC AAsAAsAAsAsAsheheheheehevivivivillllllllleee e iiiiisisississ ttttttt t thhhhhehehhhhheeh nnnn newewewewew hhhhhhhhh heaeaeaeaeaddddqddqdqdquaauauaartrtrtttttrterereererersssss ffffofffofofoforrrrr thththththee ee CoCCCoCCoCoCoCoCoCoununununun iiicicicicicilllllll offofofofof PPPP P P bubbbbbububububu lilillililililiccccc c LiLLLLiLiLLLiLiLiLiLibbbbbebebbebbbeberararalllll AArAAAAAAAAArArArArtttststststs CCCCCCC C llollolololllleleeegegeges, a2525-member r ororgaganinizazatitionon of ff sts atte-e susupppporortetedd lililibebeberaral l artsts c c lolllelegeges s thaatat rrrecececooognize theh impmporortance offff lilibeberarall arartsts aa dnd sssccicienee cecc s education for succeess s innn a complex gloobbaball societetety.y.
CaCaCaaaaaaaaaaaaaaaampmmmmmmmmmmm us LifeRRRRReReReReRRReRReRReRR sisisisiss dedededededeeeeedeeencnnnnnnnnn e Halls: AAbooutt one-third of ststududenentsts l livive e on campus, whileeeeeeeeeeeeeee aa a a a a a a a a a aa aaaa aaa aaaanononononononnonononononononoonononooonononnonon ththththththththththththhththhthththththththththhthherererrerrrrrrrr t t tttt ttt ttttttttttt thihihihihihihihihihihihiihiihihihiihihihhihihhh rdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrddrdrddddddr lll l l l l lllivivivivivivivvvivivvvivvvvvvve withthinin a a one-milleerararrrarararaaaddididiididd usususususususus o oo o oo o oofffffff ffff f ff f cacccccccc mpmpusus.
AtAtAtAtAtAtAtAttA hlhlhlhlhlhlhletetetetetetticicicicicci ss:s:s:s:s:s:s: 11 11111444444 444 4 44444 NNNNNCNCNNNNNNNNNNNNN AAAA DDivvision 1 1 tetetetettettetetttttteet amamamamamamammammmamammmmmmmmms s ssssssssss
StStStSStStStStStSSStStStSStudududdudududuuududuuudenenenenneneneeenenent t ttt tttttt GrGrGrGrGrGGrGrGrGrGGrououououououououououo pspspspspspspspspsps:::: :: :: MoMoMoMoMoMoMMMoMMMMMMoooooooooMM rereeee t hah n 606006006006000600060006000000 c c cccccc c c c cccccccccccc clululululululululululuulullululululllulululululuuuubsbsbsbsbsbsbsbsbsbsbbsbssbsbbsbssbbsbbsbbs aandnd o ooorgrrrrrr annizizatatioonsns, raaaaaaaaaaaaaaaaaangngngngngnngngngngngngngngnggngnggngngngngnngnggininininininininininninininninnininnnninnnnnng ggg g gg g g g gg gggggggggggg frfrfrfrfrfrfrfrfrfrfrfrfrfrfrrfrfrfrrfrfrrromomomomomomomomomomomomomomomomomomomoomomomoomomoomomoommomoom h h h h hhh hhhhh hhhhhhhhhhhhhhhhonoooononononononononononononononoonoonoonoonnooonnnnnnoooroooorooooorooorororoorororooroooor s s s s s sococococoocieieieieietitititit esesesese ttttttttttto o ooo oooooo iniinininnnninnnntttttrttrtrtrtrtrtrtrttrttrrttrtt amamamamamamamaaamamaamaaaaaa uurururuuurururururuurrrrrruuuuu alaalalalalalalalalaaalalalalaaalaallaspspspsppspspspspspspororororororororororrtstststsstststststststststs
InInInInInInnIInnnInInIIntettttettetetetetetercrcrcrcrcrcrcuullulullullulululu ttttuttuttuturaaaaaararall l CeCCeCeCCeC ntntnttttttttttttterererererererererererererererrerre :: : : :: :::::: :: :: ThThThThThThThThThThThThThTTT e e eeee ee eeeee neneneeeeneennnneewwwwwwww wwwww InInInInInInntercultural Center houses coomfffffmfffffforororororororororooorortatatatatatatatatattatablblblblblblbblblbbblblbb eeeeeee ee spspspspspspsspspspsppacacacacacaa esesesese ffffoororrrrrrrrrrr m m m m m m m m m mmeeeeeeeeeeeeeeeeeeeeeeeetitititititittitittitingngngngngngngngngngngngs,s,s,s,sss s sss sssssssssssssssssssssococococococooocococococoocococooooocooocoococoococoococoocociaiaiaiaiaiaiaiaiaiaiaaaiaaiaiaiaiaiaaiaaaiaaaaiaiaai lllllllllllllllllllllllevevevvvvvvenennne tstsss a aaaaaaaandnndndndndnnd pp p p ppppppppppprorororororooogggrgrgrggggggggg amamamamamamammamamamamamamammms sssssssssssss inininnininiinininininninnninnvovovovovovovovovovovovovov lvlvlvlvvlvlvlvvlvlvlvlvlvininininninini g gggggggggg sussusuususssuchchchchccch dddddddivivivvviviviverererererererersesesesesesesesesse gg g gggg g g gggroroorororooorororor upupupupupuupuupuupupupuppsss ssssss ss s asasasasasasasasasasaassass AA AAAAAAAAAAAAAllllllllllllllllllllllliaiaiaaiaiaiiaaiaiaiancnncncncncncnncnccnncncnnnccce,e,e,e,e,e,e,e,e,e,eee, B B B B B B B B B Blaack Studddededdedededentntntntnnnnttttssss sss ss AsAsAsAAsAssAsssssssosososososososososoosocicicicicicicccc atatatatatioioioiioionn,n,n,n,n,n,n,nn, IIIIII III IIntntntntntntntntntnnn eeereererrrrrrrrrrreeerrrerrnanananananananananaanananannaanananaaanananananan ----------------------iiiitititititititittiititttitiionooononoonnnonoonnoonononnaaaalalallllalalalalal SS SSSSSSSSSS SStttututututuuttuudeeddddededdedededeenntntnnnttt AA A A AAAssssssssssss ococococcococococoocococococococcciaiaiaiaiaiaiaiaiaiaiaiaaiaiaiaatitititititititttititittittitionononoononononononononononononononon, ,,,,,, ,AsAsAsAsAsAsAsAAAAsAsAAAsAsAsA iaiaiaaiaiaiaiaiaiaiaiaiann nnnnnnnn nnnnnnn StStStStStSStSttS uudu entsss iin n n nnAsAsAsAsAshehehehehehehevivivivivivivilllllllllllllee,ee,e,eeeeeee HHHererererere mmmaaaammananananas ss s ssss OrOOOrOOOOrOOOOO guguggguuuuuuguulllllllllllllllllllllllllllosososososososososososososoososo osososososososososososo e ee ee e e eennnnnnnnnn LaLaaLaaLaLaaLaLaLaas sssAmA errrriiiciciiicicicicasasasasasasasasasasas ( (( ((((((((( (HOHOHHOHOHOHOHOHHHH LLLLALALALALALALALALALALALALALLALLLALAALALALALAALALALLAAALALALLA)))))))))))))))))))))))))))))))))))))
aannnnnnaaanna d ddd d d dd HHHiiiHH llllllllleleleleleeeeele . . . .
CCCCeCeCeCCeCeCeCeeC ntntnteeerrrereeee ffffororororr JJJJ ewewewewewewewewisisisisssssssisisi hh hh StStStStStStStStStStStStStSttS ududududududududududududududududieieieieieieieieieieieieieieieieees:s:s:s:ss:s:s:s:sss:s:s:s:s TT T T TT T T TT TTT TTTThehehehehehehehehehehehehehehehehee 2 2 222222222222266-6-6-6----666-6666666 yyeyeyyeyeeeeaarararararararar o o ooooooooooldldddddddddddd U U U U U U U U UUU UU UUUUUUUUNCNCNCNCNCNCNCCNCNCNCCNCCNCNNNNCNNNNN A A A A A AAAAAAAAAAsshsshshshshshsssshs evevevevvveveve ilililllelelelelee C C CCCCCCCCCCCCCCCeeneneenenennnnennneeenenentttttttteteeteeteteteteteter r rr r r r rrrrrrr ffffofofofofofofofofoffoffofofoff r rrrrrrrrrr r JeJJJJeJeeJeJeeeeeeeeeJeeeewiwwwiwwiwiwwwiiwiiwwwwww shhshshshshshshhsshsh S SSS tututututuudidididd eeesesesesseseseeeesssessesss p p p ppp p ppp pp pprrrrrorororrrrrrror vivividededeessss s sssssss aaaaaa a aaaaaaaaaa rereeeeeerere----------sosososososssssososoosososoururururururururururcecececececececcece f ff fffffffffffforororororororororor J J JJ JJ J JJJJeweweweweweweweweewwissisisisisisisi h hh h hhhh stststststststststststststs ududududdududududududdududududenenenenneneneenenentstststtstststsststs a aaaaaa aaaaas s sss ssssss wewewewewewewewewewewewelllllllllllllllllllllll a a aa aa aa aaaasssssssss sss hhhhohooststininnng g gg lelelectttururururesesesesesesssessessese ,,,, , fifi fi fifififififififififififififillmlmlmlmmllmmlmlm sssssssss ssssss sereerererererererrererererereeereerereeererrieieieieiieieieieieieeieieieieieieieeiei sss ss s sss s sssssssss ananananananananananananannaanaannndd dd d d dddddddddd otootototototototootototottoo hehhhhhehhhh rrr r rr r spssppppececececiiiaaaaaaaaaaaaial l l ll ll eveveveveveevevevvevvevevvvvvevvvvevvenenenentstststs f fff ororooorororrrrror tttthheheheheheheheheheeheheheeheheeheheheheeeheheeheeeAsAsAsAsAAsAAAAshehehhh viviv lllllle e cococommmmmmunununuu itittitititity.y.y.y.y.y.
5151
KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAsAsAsAssAsAssAsAAssssheheheheheheheeeheheeeeeeeeeeevivivivivivivivivivivivivvivivivvvvvv lllllllllllllllllllll ee e e eeeeeeeeeeee isisisisisisisisiisisiis ““ “ “ononononononononononononononnononnonoonoo e ee ee e e ee eeeeeeeeee ofoofoofofofofofofoofoofoofoffffoof ttt tt tttttttttthehehehehehehehhhhhheeeee b b bb bbbbbbbbbbeseseseseseseseseesesessesest t t tttttt ttttttt edededededededdededdeddddducucucuccucucucucucucuuucuuuu atatatatattatatatatatatatataa ioioioiooioioioioioiooiooioioiooooonanananaanannaananananannnaanaaaaal ll l llll bababababababaabababaababbaargrgrgrgrgrgrgrgrgrrgrgrggrgrgrgggggaaiaiaiaiaiaiaiaiaiaiaiaaaaaa nnsnsnsnsnsnsnssnnnn iiiiiiiinnnnn nnnnn nnnn thththtthhhhtththtththtthhthhe ee e ee e e eeeee e eee cococococococococooocococooooocococouununununununununuunuunuunuunununuuuntrtrtrtrtrtrtrtrttrrry.y.y.y.yyy.y.yyyy.y...” ”” ” ” ””””””””” -- -- - - FiFiFiFiFiFFiiiFiFiFiFiFiFiFiskskskskskkksksksksksksksksskkeeee ee eeee e e eeeeee GuGuGuGuGuGuGuuGuGuGuGuGuuuGuuGGGGGG ididididididdidiidddddddidddddddddee e ee eee eeee ee e eee ttttototototottttt CCCololollo leleeeleeeeeeegegegeggegeggeegegeggegegeeegeggggg s,s,s,sss, 2 2201010001000100 11111111
FoFoFFoFoFFoF r rr rr r sseseseseseseeseseeeseeseeseseseeeseevevevevevevvvvevvven nn nn n n cococococococococoooonnsnsnsnnsnsnsnsssnsnsnsnnnsnssnnsnnnn ececeecececeecececececececececececeececeeeecutututtututtuttttuttu ivivivivivivvivivivvvvvveee ee eee ee e eee yeyeyeyeyeyeyeyeyeyeyeeeeyeeeeyyeeyeyy aararararss,ss,, U UUU NCNCNCNCNCNC AA A AAA hshshshhss evevevvililillillelelele’ssssss EE E EEnvvnvnvnvirriririronoonononno memmemememm ntntntntnn alalalallal SSS S S Stututututtuudididididididiesseseseseses PPP PP Prorororororoooogrgrggrgrgrgrgrgrgrggggggg amamamamammmmm hhh hh hhassasasasaaa b b b bb beeeeeeeeeeeeeeeeeeeeeennnnnn nnnnn nananannanananaananamememememememmeddddd d totottotootototoo tttt t t t tthehhehehheeehehehe lilililililiistststststststtststststtsttsttt o ooooo ooooooooooo oof f fff fffffffff pprprpprprprprprrrre-e-e-e-e-e--e---e---ee prprprprprprprpprprprofofofofofoooooofoofofofofoooffofffofoofooooo eseseseseseseseseeeseeseeeseseseseseseesssesee sisisisissisisisisisissisisisiississss onononononononononononnonononononononoonnoonnonnonalalalaaalaalalalaa p p p pppp ppp pp pppproororoororogrgrgrgrgrgrgramamamamam wwww ww wwwiiiititttitiitttiitti hhhhhhhhhhhhh hhh h h unununuunu ususususuu uauauauauallllllllll ll ttttstssstststs rererererengngngngng hthhthhthhhthhthththtththhthth iiiiiiii ii innnnnn n prrprprprprp epepeepepeppparrararariiiiiiinininini gggg g tttststststs ddddddddddududududenenenenttttststststss ffffffffffff forororor ccc carararareeeeeeeersrrsrsr . . - FiFiFFiFiFiiFiFiFiiFiFiF kkkkkkkskskskkeeee GGGGGGGGGGGGGGGuGuGuGuGuididiidididddddddididididideeee etotototototttttottototo C C C CCCCCCC CC CCoololooololooololleleeleeleleeeeleeeeelegegegegegeegeegegegegeggggggggg sssssssssssssss
UNUNNUNUNNUNUNUNUNUNUNUNUNNUU C CCCCCCCCCCCCCCCCC AsAAsAsAAAsAsAAssAssAssAsAsAAAAssAssAsAAAAshehehehheheeheheehehhehhhehheeeeh vivivvvvivivivivivvvvvivivvvivvviviviiillllllllllllllllllllllllle eeeeee e iiisiisisiisisisisisisisisisssssss o o oo ooooooooooooooooooooneneneeeeeene o o oo oooofffff ffff thththe ee nannn titit onon’ss 1000000000 b besst t vavaavavavalullll eses in n pupublblicciccc ccolo leeleeegegeg s. -- - - -- - KiKiKiKiKiKiKiKKKKiplplplplplplppplpp ininnininniiniinnnnnnnnnnnngegegegeegeggegggggegegeggegggggggggg r’r’r’r’’’’’r’r’r sss s ssssssssss PePePPePePePePePePePePePPePPePePeePePeeePePP rrrrrrrsrsrsssssrrrrr ooooononnonoononnoo alalalallaalllaaaa FFF F F FFFFFiiinnnnninnnnanannnnnnnnnnana cececececececececeececeeee MMMMMMM MMMM M MMMM MMMagagagagagagagagggagaagaagagggazazaaazazazazazazazazazazzzza inininininininininininiinininii e,e,e,e,e,e,e,ee,eeee,e, 222 22 2 22222 222222220101010100101001000101010101010 0000000000000000000000
UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUNNNNNCNNCCNCNNNCNNNNCNCNNCCCCNCNNCNN A AAAAA AAA A AAAAAAAAAshshshshshshshshshhhhhshshsshsheeevevevevvvvveeveeevvilililiililiiilililiiiililiiiiillllii lelleleleleleeeeeleleeee iiii i iiii sssss sss s s ss s ssssss aaamamamamamammamammaa ononoonoononnnnnnnonnno g g jujujujujuujujuststststsststst 5 5555555555550 0 00000000000 inininnnininininststsststststtstsststststs itititititititutututuuuuuutuuutututioioioioioiioonsnsnsnsnnssnsnsns nnnnn n natattttatatatattataatatttioioioioioioooioooiooonwnwwwnwnwnnwnwwwnwwnwwwidididddiddididde ee eeeeee nonoteted d d asasa a a “ “BeBeBeststst V V Vala ueuee” ” ” pupup blblicic c cololleleleeeeeeeleleeeeeeegegegegegegegegegegegegeegegegege. . .. ..- --- -- - PPrPrPrPrPrPrPP inininnnnnninnnninnnnnnnnnceccecececececcccetototootoooon nnnnnn ReeReReReReReRReReReReReReReReReReRReeRRReReRReeeviiiivivivivivviiviv ewewewewewewewwwewwwwwwewwewwww,, , , 20202020202020200202020002020202022020202202222020011111000001
NUNNUNNNNC CCCCCC AsAshehevvvvvviviviviiivivvivvvvvvviv llllllleeeeee e eee isis t thehe ooooooooooooooonlnlnlnlnnnnnnnnlnlnnnlnlyyyy yy yyyyyyyy NoNoNoNNNooNorrtrtrthh h CaCaarorooolilinanaaaaaa i iinsnnsnn tititututitioonoo listeeeeed d d amamonong g NaNaN titiononnnalal L Libibereralala A AArtrts s CoCoC llllllllllllegegegegegegegesesesesesesses whwhosose e ststududddddddddddddddddenenenenenttttststtttttttttt g graraduduatate eeeeeeee wiwiw thththh tt hehheehe llllllllleaeastst aaamomooununnnt t fffofof ddddd d d bebbbbbbebebebe t.tttttttttt. - - UUUUUUUUUUUUU UU UU SSSSSSSSSS.S.SSSSSS. . NeNeNeNeNeNeNNeNeNeeeNeNeNeNeNewswswswswswswwswwswswswwsws &&&&&&&&& &&&& & && WWWWWWWWWWWWW W W WW Worororoorororooororoorooorldlddldldd RRRRR R RR RR RRRRRRepepepeepepeeepepepepeepeeppport’s s “AAmem rir caca’s’s BeBeBeBBBestst C Colleegegegegeggegegeegeeeegegggegegeeees,s,ssss,s,ss ”””” ”””””””””””” 20220202020202020220202022022000020202020202022202010101010011010101010000000101010000
ThThe e UNUNCC AsAsheheheeheehevivvivivivivivivivvvvviv lllllllllllllllllllllll eeeeeeeeeeeeeeee eeee “f“f“ff“ffffffffffffffacacacacacaaaacacaacacacacacaaacculllululuulluuuluuuluuluululultytytytytyttytytyytytyttyt hhhhhhhhhhhhhhhhhh hhhasasasasasasaaasasasasasaasaaasss a a aaaaaaa aaaannnnnnnnn n nnn unuuununununununununuunununununu ususuuuususususuusususususususssussuauauauauauuauauuaauauauauauuauuuau llllllllllllllllllllllllllyyyyyyyyyyyyyyyyy y stststtsttttstststsststttttrororrorororoorororoorororoorororongngngngngnngngngngngngngggnggg c c ccccccomomomomomomomommmmmimimmimmimim tmtmtmtmtmtmttmmeneneneenent t t ttt tototototototottt u uu uuuuuuuuuuuundndnnndndnndnndddddderererereeeeee grggrgrgg adadadaadaduauaauaauaaatetetetetetetetttte t ttt tt t ttteaeaeaeaeaeaeae hhhchchchhhhhchhchhhchhhchhhc iniinininininniiinininggggg.ggg.gg.g.gg” ”” ” ”””””””””””” - - - U.U.UUUUUUUUU S.S.SSS NeNews & & W Worldd R Repeeporort’t’s s “A“Amemeriricaca’s’s B Besest t CoCollllegegeses,”,” 2 20100100
UNNC C AsAshevillee is the onlly y pup blic liberall arts colleggee nonotted asa aa ““ToTop p UpUp-aandnd-C-Comomining g ScSchohoolol” ” amamonong g NaNaN tional Libeeral AArtrts Collllegges. UNNC Asheville is rrannkeed d fi fth h inin t thhis distinguisishehed d cac tegog ry. - UU.SS. NeN ws & Wororldd R Reporrt’t s “AAmeriricac ’s Best Colleges,”, 2201100
UUNC Ashevillle’s UnUndergrgradduate Reseearch Program haas bbeeeen ranknkeded aamom ng theh bbesest t inin tthehe n natatioion n fof r rnnine conseccutivee y yeaearrs. - - U.U S.S. N Newews & WoW rld Report’ss “AmAmerica’s Best Colleges,”” 200100
UUNC AsAsAsAsAsssshheheheheheeevivivivivivvilllllllllllleee eee isisisisisss aaaa a amoomomomomonngngngngngggg jj j j jjjjjusususuuuu t tt 212121 s s smamamallllll ss stattatatatetetete ss sschchchchchoooooooooooolslslslsls o ooonnnn nnnnn ththhhhhthththeee ee “““C“CCCoolo lllelegegegg AAA AAAA-LLisist”t”t” forrrrr offfffferrrriinining ggggg a aaa “a bbbbigigigigigg-leaguee eeducatioion.n.nn.n.nn””””””-- PaParararararararararaarr dedededeedededeedede m m m mm m mmmagagagggazzzzazazzazazazazazininininninininine,e,e,e,, 222 2 20101010 00000000
UNUNUNUNUNUNUNUNUNNUNNUNNCCCCC C CCCCC C AsAsAsAsAsAsAAsAsAsA hehehehehhhehehhhhhh vivivivvivivvivillllllllllllllle eeeeeeee isisisisisisisis o oooooo o o o oonenenenenenenennenneeenen oo oooooooff ff fff ththththththththththht ee e e eeee totototototopppp p p ppppp grgrgrrrrrrrggrreeeeeeeeeeeee nnn n nnn cococcooccc lllllllegegegegeeeeegegegegesesesesesesessse ii iiii i i innnnnn nn nn thhhhtht e eee SoSoSoSSooooooSoS ututututututututututhhhheeehehhhehhh aasaast.t.tt.t.ttt. -- -- Blueeee eeeeee RiRiRiRiRiRiRRiRiR dgdgdggdgdgdgdgdgdge OOuuuuuuuttdtdtdtddoooooooooooorsrsrsrsrsrsrsr ,, , , , , 20202002222 100000
UNUNUNUNUNUNUUNUNUNUUUNUNNCCCC CCCC C CC C AsAsAsAsAsAAsAsAAsAsAsAAAAshehehehheheheheeheheheheheheeeeevivivivivivivivivivivivivivvvv llllllllllllllllll e is lissteted d aammononnooononononononnnngggggggggg ggg jjjujujujujujustst 228686 UU.S.S. . cococococococoooccooollllllllleeeegegegeggegee eseseseseeeeseseseses a aaaaa aaaaa ddndndndnn uu uu inininininivevevevevvvvevv rsrsrsrssrsititititittieieieieieessss s thththhthtttt atatatatatt hhh hhavavavavavvaa eeeee eee dededededeedd momomomomoonsnsnsnsnsssn trtrtrtrtrrrratatatatatataatatttedededededededeeededeeee “ ““ “ anananaananaanananaa exexexexxxxxxxemememeeeeeeeemplplplplplplplplpllpplpppp aaarrrrararrararararraraaaaaa yyyyyyy yyyyyyyy cococococommmmmmmmmmmiiititititititititmememmemeememmeeemm ttntntntntnntntntntnnt ttt ttt tt ttoo ooooooo suuuusuusuusus stststst iiiiiaiiiaiaiaiinanaaaaanaannabibibbibibibbibibibbbibiib lililililillililililiillittytytytytyytytytytyt ”””””””.””.””. - - ---- “““ “ ““““ThThThThThThTThThThThTThhThThTT ee ee ee eeeee PrPrPrPrPrPrPrPrPrPrPrPPrPPP iniinninnnncecccetttooooonn n ReReeeReee iviviiivivivvv eewewewewewewwwewee ’’’sssss GGGGG GGG G GGGuiuiuiuiuiuiuiuiuiuuuiuuuuidededededededddedededdededde tt tttt t t oo oo ooo 2828228288282828282822822822 6 666 66 6 6666 GrGrGGGGrGrGrrGreeeee nnnn nn n CoCoCoCoCoCoooCoCCooooooollllllllllllllllllllllllllllegegegegegegggeseseseseeses””,,, 20202020200000202010101010010001000000010101001010100101010
AdAdAdAdAdAdAdAdAAAdAddmmimimimiimmmmimmiim ssssssssssssssssssssssssssssiioioooioooioioooioiooioi nsnsnsnsnsnsnsnnsnsnsnsnsnsnsssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111111111111111111111110-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 12111222122222211112212121212212211212909090909090900090900909000909090990090909999999090000
AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $4$4$4$44$ ,7,77,7,777777,777777777777772722772727272777277272727777727777 (((((( ( ((((((( (((((202020202020202020202020202222222 10101010101010100100000100100--1111-1-1-1-1-1-1-1-- 1)1)1)1)11))))11)1)1))
AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 7777777777,7777777777,7,554545454455454545545455545454545455545544555554444454445554545444444444444 4444 4 444444444444 (((2(2(2(2(2(2(2(2(2001010111000-0-0-0-0-000-000-0000 111111111111))))))))))))) ))) )
AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e HHoHoHoHooousususuuuuu inininnnnnininnnnnnnnnnnnnnnnnnnnnnnngggg ggggggggg anand ddd MeMeMeeMeeaalalalalalala PPPPPPPPPPPPPPPP PPPP alllaaaaaaaaaaaaaalalaaaaalannnnnnn nn n FeFeFeFeFeFeFeFeFeFeFeFeeFeFeFFFeFeeeseseseseeeeeeee : : $7$7$7$7$7777777 00000000,0,04044040404040400440404040 (((( (((((((((( ((((2222020202022222 11010101 ---1111- 1)11)))1)1)1)1))))111
FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fifi nannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..
5252
Dr. Anne Ponder became the sixth Chancellor of the University of North Caro-lina Asheville in October 2005.
Chancellor Ponder is a native of Asheville and a lifelong educator. She earned her bachelor’s, master’s and doctoral degrees in English from the University of North Carolina-Chapel Hill. She began her academic career at Elon College (now Elon University) in North Carolina, where she was the fi rst woman and fi rst pre-tenure professor to receive the Daniels-Danieley Award for Excellence in Teaching. During her nine years at Elon, she taught English and communications, and founded the college’s Honors Program.
She later joined Guilford College in North Carolina, where she was an associate professor of English and interdisciplinary studies and served as associate academic dean. At Kenyon College in Ohio, she served as professor of English and drama, academic dean, adding ‘vice president for information technology’ to her portfolio.
In 1995, she was selected to become president at Colby-Sawyer College, a private liberal arts college in New London, N.H., where she would serve for ten years.
At UNC Asheville, Chancellor Ponder has led a campuswide collaboration resulting in a fi ve-year Strategic Plan and then imple-mented an administrative reorganization that focuses University resources on the Strategic Plan’s highest priorities. As part of that strategy, the UNC Asheville campus now serves as the new na-tional headquarters for the Council of Public Liberal Arts Col-leges.
Chancellor Ponder is a nationally known expert on institu-tional effectiveness, strategic planning, and fundraising and re-source development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education, and has writ-ten a chapter on strategic planning for the book “Leading Ameri-ca’s Branch Campuses,” edited by Samuel Schuman and published by the American Council on Education.
In addition to serving the University, Chancellor Ponder is a member of the Mission Hospitals Audit Committee and the Asheville Area Chamber of Commerce Board of Directors. She also serves as a member of the Asheville Community and Eco-nomic Development Alliance.
Chancellor Ponder is the daughter of the late Herschel and Eleanor Ponder, both of whom traced their Asheville family roots back to the 1780s. She is married to Christopher Brookhouse, an award-winning writer and publisher previously on the English faculty at UNC Chapel Hill.
Dr. Anne PonderChancellor
University of North Carolina Asheville
5353
Janet R. ConeDirector of AthleticsSenior Administrator for University Enterprises
Janet R. Cone is in her eighth year as Director of Athletics at UNC Asheville. She also serves as the school as Senior Administrator for University Enterprises. Last year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.
Two years ago, Chancellor Anne Ponder appointed Cone to the newly-created position of Senior Administrator for University Enterprises. In this position, Cone oversees the Wilma Sherrill Center, manage specifi c community relationships and serve as a member of UNC Asheville’s fundraising team. She continues as a member of the Chancellor’s Senior Staff and assists Chancellor Ponder in more closely aligning the university with the North Carolina Center for Creative Retirement.
In 2009, Cone created the Asheville Sports Commission to help bring athletic events to the Asheville area. Her leadership helped land the Southern Conference
men’s and women’s basketball tournament to return to Asheville starting in 2012.
Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club that recognizes all student-athletes who make a 3.0 or better grade point average each semester. More than 700 student-athletes have made the club during Cone’s six years, and in 2009-10, a record number of student-athletes earned that distinction.
During that same time period, more than 600 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes have earned this impressive academic distinction. The Department of Athletics has also successfully hosted two Big South Conference Tournaments that produced revenue for the school.
Cone has overseen construction projects that has dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center for Health and Wellness/Kimmel Arena was fi nished last spring and is being used this semester. Funded partly through a $35 million state appropriation, Cone helped raise more than seven million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation on campus, attract major venue speakers and performances, and will secure a future home for men’s and women’s basketball teams.
The inaugural game in Kimmel Arena will be against UNC Chapel Hill on Nov. 13 and that game will be nationally televised by ESPNU. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that was completed n the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past two seasons and this spring will host the Big South Conference men’s and women’s tennis tournaments for the fi rst time in school history.
Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends.
In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. UNC Asheville Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi ts from each and every day.”
5454
In 2006-07, three different teams UNC Asheville teams won Big South Conference championships and advance to the NCAA Tournament. In May of 2006, the Bulldog baseball team completed an amazing run with their fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against top-seed UNC Chapel Hill in the College Cup. In March of 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.
The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics web-site, and the implementation of internet broadcasts and video-streaming for six different sports.
Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council.
Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.
In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the Budget, Compliance, Ad Hoc Committee on Publicity and Promotions and the Baseball, Men’s and Women’s Basketball and Men’s Soccer Committees. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. Starting in September, she will begin a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver.
Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.
Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.
Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.
Cone was born and raised in Summerville, South Carolina. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame last fall. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.
A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.
5555
MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS OF EXTERNAL AFFAIRS
Mike Gore is in his 26th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.
UNC ASHEVILLE SUPPORT STAFF
TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS / SENIOR WOMEN’S ADMINISTRATOR
Terri Brne begins her sixth year at UNC Asheville. She serves as Associate Athletics Director of Internal Affairs and is also the athletic department’s Director of Compliance and Sport Oversight. Brne came to UNC Asheville in the fall of 2006. She is responsible for the interpretation of rules by the NCAA and Big South Conference. Brne is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. In addition, Brne is the administrator for men’s and women’s soccer and baseball. She also serves as the Game Administrator for women’s basketball. The Illinois native was an assistant basketball coach at both South Dakota State and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance in NCAA Compliance. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her Master’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.
5656
Judith BohanBusiness Manager
Linda MarshallAssistant
Business Manager
Ken Hogue Director of
Development
Megan HammondsAssistant
Athletic Trainer, ATC
Harmon TurnerTicket Manager
Tim WhiteHead
Athletic Trainer, ATC
Kellen PetroneAssistant Volleyball
Coach
Mary CaseyAssistant Women’s
Soccer Coach
Dr. Herman HoltFaculty AthleticsRepresentative
Rebecca Nelms-KeilDirector of Student
Athlete Affairs
Erin Punter-SpenceDirector of Marketing
and Promotions
Matt PellegrinDirector of Athletics
Media Communications
ASHEVILLE SUPPORT STAFF
Aaron RembertAssistant Baseball
Coach
Andrea KaufmanAthletic Trainer, ATC
Brett CareyAssistant Men’s
Basketball Coach
Aaron SandersDirector of Sherrill
Center
Joe Burnette Assistant Men’sSoccer Coach
Tom HandAssistant
Tennis Coach
Curtis MettenAssistant Women’s Basketball Coach
Lauren PowellAssistant Women’sBasketball Coach
Nick McDevittAssistant Men’s
Basketball Coach
Joel WilliamsAssistant Track & Field
Coach
Adam PuettAssistant Cross Country Coach
Tiffany GwynnAssistant Women’sBasketball Coach
Donna PeekAdministrative
Assistant
5757
Betsy BloseWomen’s Basketball
10th year as head coach
Michele DemkoWomen’s Soccer
2nd year as head coach
Matt KernMen’s Soccer
2nd year as head coach
Tom SmithBaseball
3rd year as head coach
Jesse NormanCross Country/Track
5th year as head coach
Omar AhmadStrength and Conditioning
1st year as head coach
Lise GregoryTennis
5th year as head coach
Eddie BiedenbachMen’s Basketball
16th Year as head coach
Frederico SantosVolleyball
1st year as head coach
ASHEVILLE HEAD COACHES
5858
Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.
In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.
The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.
In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.
In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.
UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.
1990-2003
2004-Present
ROCKY
5959
Important NCAA Terms
A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):
(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)
Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.
Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.
Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.
Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.
Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.
Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.
Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.
Frequently Asked Questions
What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.
What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.
Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.
What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.
This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.
THE NCAA
6060
For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:
Champions in Athletics, Leaders in Life.
For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics
Justice Center, CPO #2600One University Heights
Asheville, NC 28804Phone: (828) 251-6459
Fax: (828) 251-6386www.uncabulldogs.com
“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”
--Rich Davis ’93, Jan Davis Tire Store
“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”
--Pat Britz ’90; former men’s soccer player
BULLDOG ATHLETICS ASSOCIATION