2019 construction of lentivirus-based reference material for rt-pcr detection of middle east...

IP 9120081107 On Sun 12 May 2019 215737Copyright American Scientific Publishers

Delivered by Ingenta

Copyright copy 2019 American Scientific PublishersAll rights reservedPrinted in the United States of America

ArticleJournal of

Nanoscience and NanotechnologyVol 19 5510ndash5516 2019

wwwaspbscomjnn

Construction of Lentivirus-Based Reference Material forRT-PCR Detection of Middle East Respiratory Syndrome

Coronavirus and Its Application in ExternalQuality Assessment

Donggen Zhou1 dagger Yunpeng Li23 dagger Junhua Li2 Junping Yu2 Hang Yang2 and Hongping Wei2lowast1Ningbo International Travel Healthcare Center Ningbo 315012 China

2Key Laboratory of Special Pathogens and Biosafety Wuhan Institute of Virology Chinese Academy of Sciences Wuhan 430071 China3University of Chinese Academy of Sciences Beijing 100039 China

Nucleic acid amplification technology (NAT) has been the most used one for rapid detection ofMiddle East Respiratory Syndrome coronavirus (MERS-CoV) since MERS-CoV was first detectedin 2012 It is important to develop stable and safe reference materials for assessing the qualityof NAT kits and performing an external quality assessment (EQA) in different laboratories In thisstudy the MERS-CoV RNA fragments including upE ORF1b and N were packed within humanimmunodeficiency virus type 1 (HIV-1)-like particles The lyophilized virus-like particles (VLPs) werefound to be stable at 37 C or below and safe to be used not only as the control material forPCR detection of MERS-CoV but also as the reference material for EQA In an EQA organized byNingbo International Travel Healthcare Center in China 49 participating institutions achieved 100agreement in detecting MERS-CoV using various commercial diagnosis kits and different extractionmethods However different Ct values reported by different sites for the same sample implied that aneed exists to standardize the RNA extraction method andor the PCR detection conditions betweenthe laboratories

Keywords Middle East Respiratory Syndrome Coronavirus Virus-Like Particles ExternalQuality Assessment Reference Material

1 INTRODUCTIONSince the Middle East Respiratory Syndrome coronavirus(MERS-CoV) was first identified on 22 September 20121

it has caused several outbreaks In the latest of them whichtook place in 2015 186 South Koreans were infected and38 of them died Due to a lack of effective interventionand treatment early diagnosis and isolation are the primarymethods to control MERS-CoV infection2 The methodused most commonly and frequently for early detectionof MERS-CoV is the real-time reverse transcription poly-merase chain reaction (RT-PCR) targeting upE3 ORF1aor ORF1b fragments of MERS-CoV45

Most of the MERS-CoV detection kits utilize plasmidsor in vitro-transcribed RNA as the positive control for

lowastAuthor to whom correspondence should be addresseddaggerThese two authors contributed equally to this work

the assay However these materials do not offer a con-trol for the extraction procedure Recombinant bacterio-phages such as MS2 could be used to control the efficiencyof RNA extraction protocol and the presence of PCRinhibitors in RT-PCR assays6ndash8 Since the maximum loadvolume of MS2 for foreign genes is about 2 kb it appearsnecessary to construct recombinant bacteriophages capa-ble of accommodating different RNA targets of MERS-CoV Although wild-type virus preparations could be usedas controls910 their use is limited to laboratories whichhave access to biosafety level 3 facilities11 Furthermoreinactivation of a high-titer virus stock by a single methoddoes not assure safety and most published procedures thatinactivate viruses through a combination of methods mayresult in disruption of viral RNA making its suitability asNAT standard uncertain12

5510 J Nanosci Nanotechnol 2019 Vol 19 No 9 1533-48802019195510007 doi101166jnn201916591



Zhou et al Construction of Lentivirus-Based Reference Material for RT-PCR Detection of MERS-CoV and Its Application in EQA

Because camels constitute the natural reservoir ofMERS-CoV it is believed that another MERS-CoV out-burst is inevitable China is one of the countries in clos-est contact with the Middle East and a large number ofpeople enter and exit China especially in harbor citiesAs a result there is a risk that MERS-CoV enters Chinaagain Screening of high-risk populations from MERS-CoV affected regions is therefore essential not only for thecontrol and prevention of MERS-CoV in China natives butalso as a part of the global task of fighting the infectionThe availability of reference materials for the compari-son of the sensitivity of different assays for the validationof recently developed point-of-care technologies and forthe harmonization of inter- and intra-laboratory results istherefore fundamental for the control of MERS-CoV

In the present study we packed the MERS-CoV RNAfragments into human immunodeficiency virus type 1(HIV-1)-like particles using a lentiviral packaging systemThe final product is in the form of pellets which are safenon-replicating freeze-fried specimens that can functionas the control material for the entire diagnostic procedurefrom viral RNA extraction to nucleic acid amplificationAn external quality assessment (EQA) based on the virus-like MERS-CoV organized by the Ningbo InternationalTravel Healthcare Center and involving 49 laboratories inChina has shown that the virus-like particles (VLPs) arealso suitable for use as the reference material for preparingthe sample panel in the EQA

2 MATERIALS AND METHODS21 Plasmids PreparationThe nucleotide sequences of MERS-CoV upE (27180 bpndash27514 bp) ORF1b (17700 bpndash19000 bp) and Nseq(28500 bpndash30000 bp) were from the NCBI (GenBankaccession number KT0291391)13 Fragment 1bN con-taining ORF1b and Nseq was synthesized by Gen-Script Company (Nanjing China) Fragment upE wasprovided by Professor Zhengli Shi (Wuhan Institute ofVirology Chinese Academy of Sciences China) Thesetwo fragments were sub-cloned into the pCMV-MCS-CopGFP vector (clone sites and primers used are listedin Table I) forming the expression plasmids pCMV-MCS-upE and pCMV-MCS-1bN Lentiviral vector pCMV-MCS-CopGFP is a commercial lentiviral vector in whichthe Cytomegalovirus (CMV) major immediate early pro-moter (MIEP) is upstream of the multi-cloning sites

Table I The primers used in this study

Name Sequence (5primendash3prime)

MERSVLP-upE-F CGAATTCCTACATTCCACTGTTTMERSVLP-upE-R CGTGGATCCCGTTAAACCCACTCGTCAGMERSVLP-1bN-F CGGAATTCTTTTATTACTGCCAATCCMERSVLP-1bN-R TCGGATCCAGGTGACAGTCTTTAACAT

Note Underlining denotes the clone sites

and it contains green fluorescence protein (GFP) as areporter gene The constructed plasmids were confirmedby sequencing (Tsingke Co Wuhan China) and analyzedby the DNAstar MegAlign software

22 Expression and Purification of MERS-CoV VLPsThe MERS-CoV VLPs were produced by the third gen-eration lentivirus packaging system which contains fourplasmids pCMV-MCS-CopGFP PLP1 PLP2 and VSVGTo block the expression of MERS-CoV proteins startcodons were removed from every fragment To increasethe biosafety of the system the long terminal repeats in thelentiviral vectors are defective (U3) an internal promoteris missing and the envelope protein is not expressed inthe transfected cells rendering the HIV-like particles non-infectious The lentiviral particles were generated by trans-fection of 5times106 HEK293T-17 (ATCC CRL-11268) cellsin a 10 cm dish with a mixture of 18 L of lipofectamine3000 reagent (Promega) 12 g of PLP1 6 g of PLP23 g of VSVG 9 g of pCMV-MCS-upE or pCMV-MCS-1bNin and 650 L Dulbecco modified essentialmedium (DMEM Gibco) After incubation for 5 min atroom temperature the mixture was added drop-wise to8 mL of DMEM supplemented with 10 fetal calf serumThe cells were then cultivated at 37 C with 5 CO2

for 72 hours The supernatant was harvested and filteredusing a 045 M filter (Millipore) The VLPs in the super-natant were purified by ultracentrifugation at 201400 g at4 C on a 20 sucrose cushion in 50 mM sodium phos-phate buffer using the SW70 rotor in a Beckman OptimaLE-80K Ultracentrifuge Subsequently the pellets werewashed once with phosphate buffer saline (PBS pH 74)and harvested by ultracentrifugation at 201400 g at 4 Cfor 1 hour Finally the MERS-CoV VLPs were resus-pended in 100 L PBS (pH 74) with 5 trehalose dehy-drate (Sigma) and 1 Bovine Serum Albumin (BSA) ata concentration of about 108ndash109 copiesmL and freeze-dried

23 Freeze-Drying ProcedureIn separate procedures the final preparations were asepti-cally dispensed in 01 mL aliquots into 2 mL glass vialsThe mixture was pre-frozen at minus80 C for 12 hours fol-lowing by lyophilization at minus56 C for 6 hours in a freeze-dryer (ScanVac CoolSavetrade 55-9 Germany)

24 Transmission Electron MicroscopyA 20 L aliquot of MERS-CoV VLPs solution in thesupernatant after the sucrose-purification was soaked witha Formvar carbon-coated copper grid for 10 minutes Thegrids were then removed and washed 3 times in pure waterAfter that the grids were stained with 20 L of 2 phos-photungstic acid (PTA pH 68) for 30 s air-dried andanalyzed by transmission electron microscopy (H-7000FAHitachi)

J Nanosci Nanotechnol 19 5510ndash5516 2019 5511



Construction of Lentivirus-Based Reference Material for RT-PCR Detection of MERS-CoV and Its Application in EQA Zhou et al

25 Assessment of MERS-CoV VLPsThe number of copies of RNA in the freeze-driedMERSVLPs powder was quantified using droplet digi-tal PCR (ddPCR) The ddPCR was conducted utilizing aQX200trade ddPCR system (Bio-Rad) according to the man-ufacturerrsquos recommendations Briefly the lyophilized pow-der was reconstituted with 140 L water and RNA wasextracted using a QIAamp viral RNA minikit (Qiagen)The obtained RNA was collected with 60 L water Sub-sequently 5 L of RNA solution were reverse-transcribedin cDNA using the GoScripttrade Reverse Transcription sys-tem (Promega USA) with specific primers in accordancewith the manufacturerrsquos instructions Finally PCR reac-tion mixture was prepared by mixing 11 L of 2times Super-mix 025 M of each of the probes 09 M of eachprimer 2 L of the cDNA solution and water for a totalvolume of 22 L The primers and probes were boughtfrom Liferiver (Shanghai China) Droplets were gener-ated using the Automated Droplet Generator (Bio-Rad)in which a vacuum was applied to the outlet wells to

(A)

(B)

Figure 1 (A) MERS-CoV sequences of upE (Dark blue) and 1bN (Pink) were subcloned into the lentiviral vectors between the restriction sitesEcoR1 and BamH1 respectively The main elements of the lentiviral vector used for the production of viral RNA and incorporation within the HIV-likeparticle are indicated (B) A representative image of MERS-CoV VLPs obtained by negative staining and transmission electron microscopy The averageparticle size is 100 nm (average of 6 fields)

partition simultaneously the PCR mixtures into nanoliter-sized droplets The obtained PCR plate was subsequentlyheat-sealed with pierceable foil using a PX1trade PCR platesealer (Bio-Rad) and amplified in a conventional thermalcycler (C100 Touch Bio-Rad) The thermo-cycling param-eters were set as follows initial denaturation at 95 C for10 min followed by 40 cycles of denaturation at 94 Cfor 30 s annealing at 60 C for 1 min (temperature ramp2 Cs) and final extension at 98 C for 10 min After thereactions were completed the 96-well plate was fixed intoa plate holder and placed in a Q200 Droplet Reader (Bio-Rad) The data obtained were analyzed using the providedsoftware package (QuantaSoft Bio-Rad) Droplet countsbelow 10000 droplets were considered unacceptable andtherefore discardedThe stability of the lyophilized VLPs powder was tested

by storing the powder at 4 C room temperature and37 C for one week After this time the copies of RNA inthe freeze-dried MERS-CoV VLPs powder were checkedagain using the above procedure

5512 J Nanosci Nanotechnol 19 5510ndash5516 2019




Table II DNA content in MERS pseudoviral particles determined byddPCR

Concentration ofReverse pseudoviral Percentage of the total

Sample transcription particles (copiesmL) concentration ()

MERS-upE + 127times1010 100MERS-upE minus 36times108 276MERS-1bN + 101times1010 100MERS-1bN minus 105times108 102

26 Sample Panel Preparation and ExternalQuality Assessment (EQA)

A panel consisting of three negative and seven positivesamples ranging from 8times102 to 5times107 copiesmL of theVLPs was designed for use in an external quality assess-ment (EQA) organized by Ningbo International TravelHealthcare Center Briefly one bottle of the lyophilizedpowder was reconstituted using 1 mL of a virus preser-vation solution (DMEM supplemented with 01 BSA10 glycerol and antibiotics) and 10 fold serial dilutionsfrom 102 to 107 copiesmL were prepared A 140 Laliquot of each sample was extracted using the QIAampviral RNA mini kit (Qiagen US) following the manu-facturerrsquos instructions and eluted in 60 L water Com-mercial PCR kit (Liferiver Shanghai China) was usedto test the solutions At the same time 100 aliquots of40 L were taken from the solutions with three differentconcentrations of the MERS-CoV VLPs (Sample SP 1times106 copiesmL Sample NP 5times105 copiesmL and Sam-ple LP 1times105 copiesmL) A homogeneity validation testwas performed by randomly selecting 10 aliquots for theRT-PCR test To evaluate the stability of the reconstitutedparticles another 4 aliquots of 40 L were taken fromthe SP NP and LP solutions of the sample and stored atminus70 C minus20 C 4 C and 37 C for 7 days respectivelyThe RT-PCR test was performed at 1 3 and 7 days todetermine the stability of the sample during the storage

Figure 2 Standard curves for qPCR determination of MERS-CoV upEVLPs (squares) and MERS-CoV 1bN VLPs (dots) after RNA extractionby a commercial kit The extracted RNA was tenfold diluted serially from107 to 102 copiesL The slope of the MERS-CoV upE VLP standardcurve is minus3350 (R2 = 099981) The slope of the MERS-CoV 1bN VLPsstandard curve is minus3244 (R2 = 099537)

Table III Stability of the freeze-dried MERS pseudoviral particles after7 days of storage at different temperatures

Temperature

Sample minus20 C 4 C 37 C

MERS-upE 0lowast minus04946 minus06204MERS-1bN 0 00679 minus06919

Notes lowastThe upE and ORF 1b genes of two types of pseudoviral particles weredetected by ddPCR After calculating the copy number of virus the difference ofcopy number under each temperature and temperature was expressed by delta Log(copiesmL) Log (T C) minusLog (minus20 C)

The EQA was attended by 49 laboratories most of themunder the authority of the Chinese Entry-exit Inspectionand Quarantine Bureau and Centers for Disease Controland Prevention of China A sample panel consisting ofdifferent concentrations of the MERS-CoV VLPs was pre-pared and transported to the laboratories in an ice boxThe test results were collected and evaluated within onemonth

3 RESULTS AND DISCUSSION31 Generation of MERS-CoV Virus-Like ParticlesTwo constructed lentiviral vectors pCMV-MCS-1bN con-taining MERS-CoV ORF1b and N and pCMV-MCS-upE containing upE are illustrated in Figure 1(A) Afterexpression the pellets obtained were visualized by trans-mission electron microscopy to confirm that VLPs wereproduced As shown in Figure 1(B) the average particlesize was 100 nM similar to that reported previously14

The concentrations of MERS-CoV upE VLPs determinedby the ddPCR assay were 4701plusmn1102times108 copiesmLwhile those of MERS-CoV 1bN VLPs were 2730plusmn1483times 108 copiesmL By comparing the copy numbersobtained without reverse transcription (Table II) the plas-mid DNA contamination in the VLP solutions was lowfrom 1 to 276 of the total copy numbers obtained withreverse transcription

32 Evaluation of MERS-CoV VLPs as the PositiveControl Material in NAT

By reconstituting the lyophilized MERS-CoV VLPs withPBS buffer the resulting solution could be used as

Figure 3 Homogeneity of the MERS-CoV VLPs solution prepared byreconstituting the lyophilized powder with the virus protection solutionSample SP 1times106 copiesmL Sample NP 5times105 copiesmL and Sam-ple LP 1times105 copiesmL The histogram indicates average Ct values ofeach sample Dots show the CV of repeated qPCR assays





Figure 4 Stability of the VLPs solutions after one week of storage at different temperatures from 1 to 7 days Samples were assessed by quantitativeRT-PCR detection of ORF1b and upE

the positive control in the NAT assay kits As shownin Figure 2 good linearity (R2 = 099537 for MERS-CoV 1bN VLPs and R2 = 099981 for MERS upEVLPs) was obtained using the commercial qPCR kit totest serial dilutions of the VLP ranging from 102 to

Table IV Performance of 49 laboratories participating in the external quality assessment of MERS pseudoviral particles

NA extraction NA extraction NA detection qPCR Sample Agreement with theNo kita method methodb platform panelc expected results ()

1 RNAeasy Magnetic bead A ABI 7500 fast SPNPLPN 1002 KINGFISHER Magnetic bead A ABI viia7 SPLPNN 1003 Un Un A ABI stepone SPLPNN 1004 Un Un A Roche LC480 SPNPLPN 1005 Daan gene Magnetic bead C Qiagen RGQ SPLPNN 1006 Un Un A ABI 7500 SPNPLPN 1007 Un Un A Roche LC20 SPLPNN 1008 QIAamp Spin column A ABI 7300 SPNPNN 1009 Un Un F ABI 7500 SPNPLPN 10010 QIAamp Spin column A ABI 7500 SPNPLPN 10011 PROMEGA Spin column A ABI 7500 NPLPNN 10012 Un Un A ABI stepone plus NPLPNN 10013 QIAamp Spin column A ABI Qb NPLPNN 10014 Un Un A ABI 7500 SPNPLPN 10015 QIAamp Spin column B ABI 7500 fast SPNPLPN 10016 QIAamp Spin column A ABI stepone plus NPLPNN 10017 QIAamp Spin column A Cephid PCR SPNPNN 10018 QIA EZ1 Magnetic bead D ABI viia7 NPLPNN 10019 Un Un A ABI 7500 SPNPLPN 10020 QIAamp Spin column A Roche LC480 SPNPNN 10021 ZJ bio-tech Magnetic bead A ABI 7500 SPNPNN 10022 QIAamp Spin column A Agilent MX3005P SPLPNN 10023 QIAamp Spin column A Qiagen RGQ SPNPLPN 10024 Un Un A Qiagen RGQ SPNPLPN 10025 Un Un A ABI stepone plus SPNPNN 10026 Un Un A ABI viia7 SPNPLPN 10027 QIAamp Spin column A ABI 7500 SPNPLPN 10028 QIAamp Spin column B ABI 7500 SPNPNN 10029 Un Un A ABI 7500 SPNPLPN 100

107 copiesmL The lyophilized powder of the MERS-CoV VLPs was quite stable and no significant differencesin the form of Log (copiesmL) were found using theddPCR after storing at minus20 C 4 C and 37 C for 7 days(Table III)





Table IV Continued


30 Un Un A ABI 7500 SPNPLPN 10031 High viral RNA Magnetic bead A Roche LC480 SPNPNN 10032 QIAamp Spin column B ABI 7500 SPNPNN 10033 ZJ bio-tech Magnetic bead A ABI 7500 fast SPNPLPN 10034 Un Un A ABI 7500 SPNPNN 10035 Un Un A ABI 7500 SPNPLPN 10036 Un Un A Biorad CFX96 touch SPNPNN 10037 Un Un A Roche LC480 SPNPNN 10038 QIA EZ1 Magnetic bead E ABI 7300 SPNPLPN 10039 Un Un A Roche LC 96 SPNPLPN 10040 QIAamp Colo A ABI 7500 SPNPNN 10041 Un Un A ABI 7500 SPNPLPN 10042 Tianlong Magnetic beads G ABI 7500 SPNPLPN 10043 QIAamp Spin column H ABI 7500 SPNPNN 10044 Un Un B ABI 7500 SPNPLPN 10045 Un Un A ABI viia7 SPNPLPN 10046 QIA EZ1 Magnetic bead A ABI 7500 SPNPLPN 10047 Un Un A ABI 7500 SPNPLPN 10048 MagMax Magnetic bead A Roche LC480 SPNPNN 10049 Un Un A RGQ SPNPLPN 100

Notes aQIAamp QIAamp viral RNA minikit (Qiagen) KINGFISHER KingFisher pure RNA tissue kit (Thermo Scientific) PROMEGA SV total RNA isolation system(Promega) Daan gene Daan gene viral RNA kit RNeasy RNeasy minikit (Qiagen) ZJ Bio-Tech ZJ Bio-Tech viral RNA kit QIA EZ1 Qiagen EZ1 virus mini kit(Qiagen) High viral RNA High pure viral RNA kit (Roche) Tianlong Tianlong viral RNA kit MagMax ABI Life Technologies AM 1836 MagMAX-96 ViralRNAisolation kit bA ZJ Bio-Tech Co Ltd Shanghai China B BioPerfectus Technologies Jiangsu China C Daan Gene Co Ltd Guangzhou China D Primers and probesrecommended by the US CDC E Primers and probes recommended by the China CDC F Mokobio Biotechnology Co Ltd Nanjing China G TianLong Bio-Tech CoLtd Suzhou China H Shanghai Huirui Biotechnology Co Ltd Shanghai China cSP SP sample NP NP sample LP LP sample N Negative sample Un Unknown

33 Evaluation of MERS-CoV VLPs as the ReferenceMaterial in EQA

The EQA required a sample panel with different concen-trations Therefore the homogeneity of the MERS-CoVVLP solutions reconstituted with the virus preservationsolution was tested As shown in Figure 3 repeated assaysof the solutions showed very low variations with CV lessthan 06 The analysis of the stability of the sample panelunder different storage temperatures documented that theMERS-CoV VLP solutions were stable after storing atminus70 C minus20 C and 4 C for at least one week (Fig 4)However the Ct values of the MERS-CoV VLPs solutions

Figure 5 Scatter diagram showing the Ct values (y-axis) for differentsamples (x-axis) obtained by all the laboratories participating in the EQA

stored at 37 C increased gradually over time indicat-ing that the MERS-CoV VLPs were degraded slowly at37 C These results showed that the sample panel solu-tions prepared from the lyophilized MERS-CoV VLP pow-ders should be stored under cool conditions

34 EQA Results of the 49 LaboratoriesAs summarized in Table IV after testing the sample panelconsisting of four different concentrations of the MERS-CoV VLPs (negative control LP NP and SP) all the 49laboratories reported negative and positive results 100that were correct This high accuracy was achieved despitedifferent extraction methods and detection kits being usedHowever the Ct values between different labs varied sig-nificantly (Fig 5) when testing the VLP solutions at thesame concentration level

4 CONCLUSIONBecause RT-PCR detection of MERS-CoV involves manysteps from RNA extraction to reverse transcription andto PCR any of the steps can cause the detection fail-ure Therefore it is important to employ a positive controlmaterial which can be used to monitor the entire processof the RT-PCR detectionIn this study we have used the lentivirus system to

pack extraneous MERS-CoV RNA fragments inside virus-like particles1516 The first advantage of this approach isthat the final VLPs are safe for in vitro use because they





lack the self-reproduction ability Secondly the lyophilizedpowders of the MERS-CoV VLPs are stable during stor-age at 4 C and even at 37 C for over a week Theseresults imply that the lyophilized powders are suitable foruse as the positive control material in PCR detection kitsIt should be noted that although the lentivirus system has alarger packing capacity (4 k maximum) than MS2 bacterio-phages and could be exploited to load more MERS-CoVgenes the whole MERS-CoV genome is still too large tobe encapsulated into one HIV-1 VLP However since com-mercial diagnosis kits commonly target only 1 or 2 con-served gene fragments of MERS-CoV the load capacityof the lentivirus packing system should not be a limitingfactor in constructing positive controls in PCR kitsBesides being used as the positive control material in

PCR detection kits the constructed MERS-CoV VLPswere also employed to prepare a sample panel for EQAThe VLP solutions obtained by reconstitution with thevirus preservation solution were found to be homogenousand stable at 4 C for over a week The initial EQAresults from 49 laboratories demonstrated that the con-structed VLPs are well suited as the reference material forEQA At the same time the different Ct values reportedfrom different sites for the same sample suggest the needto standardize the RNA extraction method andor the PCRdetection conditions among the laboratories Nanotechnol-ogy has drawn a great attention of scientists particularlyin the biomedical field There is a need to integrate nan-otechnology with the findings of this study in futureIn conclusion we have successfully constructed two

MERS-CoV VLPs and demonstrated that they are stableand safe to be used as the positive control in PCR detec-tion kits and can serve as the reference material in EQA

Acknowledgment This work was supported byScientific Research Grant (No 2016IK176 and2017IK251) from the General Administration of CustomPR China

References and Notes1 K Shirato T Yano S Senba S Akachi T Kobayashi T Nishinaka

T Notomi and S Matsuyama Virol J 11 139 (2014)2 I M Mackay and K E Arden Virol J 12 255 (2015)3 V M Gorman I Eckerle T Bleicker A Zaki O Landt

M Eschbach-Bludau S van Boheemen R Gopal M BallhauseT M Bestebroer D Muth M A Muumlller J F Drexler M ZambonA D Osterhaus R M Fouchier and C Drosten Eurosurveillance17 3 (2012)

4 D Pereyaslov P Rosin D Palm H Zeller D Gross C S Brownand M J Struelens Eurosurveillance 19 26 (2014)

5 V M Corman M A Muller U Costabel J Timm T BingerB Meyer P Kreher E Lattwein M Eschbach-Bludau A NitscheT Bleicker O Landt B Schweiger J F Drexler A D OsterhausB L Haagmans U Dittmer F Bonin T Wolff and C DrostenEurosurveillance 17 2 (2012)

6 S Blaise-Boisseau C Hennechart-Collette L Guillier andS Perelle J Virol Methods 166 48 (2010)

7 J Dreier M Stormer and K Kleesiek J Clin Microbiol 43 4551(2005)

8 K J Rolfe S Parmar D Mururi T G Wreghitt H Jalal H Zhangand M D Curran J Clin Virol 39 318 (2007)

9 A R Trombley L Wachter J Garrison V A Buckley-BeasonJ Jahrling and L E Hensley Am J Trop Med Hyg 82 954(2010)

10 J S Towner T K Sealy T G Ksiazek and S T Nichol J InfectDis 196 S205 (2007)

11 C Reusken M Niedrig S Pas P Anda S Baize R Charrel A DCaro C Drosten M D Fernandez-Garcia L Franco S GuntherI Leparc-Goffart B Martina D Pannetier A Papa M P Sanchez-Seco O Vapalahti and M Koopmans J Clin Virol 62 124(2015)

12 G J Wang Y Sun K Zhang T T Jia M J Hao D ZhangL Chang L Zhang R Zhang G Lin R Peng and J Li Plos One10 e0151695 (2015)

13 M Shahkarami C Yen C Glaser D X Xia J Watt and D AWadford Emerg Infect Dis 21 1664 (2015)

14 E Papanikolaou G Kontostathi E Drakopoulou M GeorgomanoliE Stamateris K Vougas A Vlahou A Maloy M Ware andN P Anagnou Virus Res 175 1 (2013)

15 M A Muller V S Raj D Muth B Meyer S Kallies S L SmitsR Wollny T M Bestebroer S Specht T Suliman K ZimmermannT Binger I Eckerle M Tschapka A M Zaki A D OsterhausR A Fouchier B L Haagmans and C Drosten Mbio 3 17 (2012)

16 F Lori F D Veronese A L Devico P Lusso M S Reitz andR C Gallo J Virol 66 5067 (1992)

Received 9 August 2018 Accepted 12 September 2018





Because camels constitute the natural reservoir ofMERS-CoV it is believed that another MERS-CoV out-burst is inevitable China is one of the countries in clos-est contact with the Middle East and a large number ofpeople enter and exit China especially in harbor citiesAs a result there is a risk that MERS-CoV enters Chinaagain Screening of high-risk populations from MERS-CoV affected regions is therefore essential not only for thecontrol and prevention of MERS-CoV in China natives butalso as a part of the global task of fighting the infectionThe availability of reference materials for the compari-son of the sensitivity of different assays for the validationof recently developed point-of-care technologies and forthe harmonization of inter- and intra-laboratory results istherefore fundamental for the control of MERS-CoV

In the present study we packed the MERS-CoV RNAfragments into human immunodeficiency virus type 1(HIV-1)-like particles using a lentiviral packaging systemThe final product is in the form of pellets which are safenon-replicating freeze-fried specimens that can functionas the control material for the entire diagnostic procedurefrom viral RNA extraction to nucleic acid amplificationAn external quality assessment (EQA) based on the virus-like MERS-CoV organized by the Ningbo InternationalTravel Healthcare Center and involving 49 laboratories inChina has shown that the virus-like particles (VLPs) arealso suitable for use as the reference material for preparingthe sample panel in the EQA

2 MATERIALS AND METHODS21 Plasmids PreparationThe nucleotide sequences of MERS-CoV upE (27180 bpndash27514 bp) ORF1b (17700 bpndash19000 bp) and Nseq(28500 bpndash30000 bp) were from the NCBI (GenBankaccession number KT0291391)13 Fragment 1bN con-taining ORF1b and Nseq was synthesized by Gen-Script Company (Nanjing China) Fragment upE wasprovided by Professor Zhengli Shi (Wuhan Institute ofVirology Chinese Academy of Sciences China) Thesetwo fragments were sub-cloned into the pCMV-MCS-CopGFP vector (clone sites and primers used are listedin Table I) forming the expression plasmids pCMV-MCS-upE and pCMV-MCS-1bN Lentiviral vector pCMV-MCS-CopGFP is a commercial lentiviral vector in whichthe Cytomegalovirus (CMV) major immediate early pro-moter (MIEP) is upstream of the multi-cloning sites

Table I The primers used in this study

Name Sequence (5primendash3prime)

MERSVLP-upE-F CGAATTCCTACATTCCACTGTTTMERSVLP-upE-R CGTGGATCCCGTTAAACCCACTCGTCAGMERSVLP-1bN-F CGGAATTCTTTTATTACTGCCAATCCMERSVLP-1bN-R TCGGATCCAGGTGACAGTCTTTAACAT

Note Underlining denotes the clone sites

and it contains green fluorescence protein (GFP) as areporter gene The constructed plasmids were confirmedby sequencing (Tsingke Co Wuhan China) and analyzedby the DNAstar MegAlign software

22 Expression and Purification of MERS-CoV VLPsThe MERS-CoV VLPs were produced by the third gen-eration lentivirus packaging system which contains fourplasmids pCMV-MCS-CopGFP PLP1 PLP2 and VSVGTo block the expression of MERS-CoV proteins startcodons were removed from every fragment To increasethe biosafety of the system the long terminal repeats in thelentiviral vectors are defective (U3) an internal promoteris missing and the envelope protein is not expressed inthe transfected cells rendering the HIV-like particles non-infectious The lentiviral particles were generated by trans-fection of 5times106 HEK293T-17 (ATCC CRL-11268) cellsin a 10 cm dish with a mixture of 18 L of lipofectamine3000 reagent (Promega) 12 g of PLP1 6 g of PLP23 g of VSVG 9 g of pCMV-MCS-upE or pCMV-MCS-1bNin and 650 L Dulbecco modified essentialmedium (DMEM Gibco) After incubation for 5 min atroom temperature the mixture was added drop-wise to8 mL of DMEM supplemented with 10 fetal calf serumThe cells were then cultivated at 37 C with 5 CO2

for 72 hours The supernatant was harvested and filteredusing a 045 M filter (Millipore) The VLPs in the super-natant were purified by ultracentrifugation at 201400 g at4 C on a 20 sucrose cushion in 50 mM sodium phos-phate buffer using the SW70 rotor in a Beckman OptimaLE-80K Ultracentrifuge Subsequently the pellets werewashed once with phosphate buffer saline (PBS pH 74)and harvested by ultracentrifugation at 201400 g at 4 Cfor 1 hour Finally the MERS-CoV VLPs were resus-pended in 100 L PBS (pH 74) with 5 trehalose dehy-drate (Sigma) and 1 Bovine Serum Albumin (BSA) ata concentration of about 108ndash109 copiesmL and freeze-dried

23 Freeze-Drying ProcedureIn separate procedures the final preparations were asepti-cally dispensed in 01 mL aliquots into 2 mL glass vialsThe mixture was pre-frozen at minus80 C for 12 hours fol-lowing by lyophilization at minus56 C for 6 hours in a freeze-dryer (ScanVac CoolSavetrade 55-9 Germany)

24 Transmission Electron MicroscopyA 20 L aliquot of MERS-CoV VLPs solution in thesupernatant after the sucrose-purification was soaked witha Formvar carbon-coated copper grid for 10 minutes Thegrids were then removed and washed 3 times in pure waterAfter that the grids were stained with 20 L of 2 phos-photungstic acid (PTA pH 68) for 30 s air-dried andanalyzed by transmission electron microscopy (H-7000FAHitachi)






(A)

(B)
















Temperature
























Table IV Continued









































(A)

(B)
















Temperature
























Table IV Continued
















































Temperature
























Table IV Continued


















































Table IV Continued





































2019 construction of lentivirus-based reference material for rt-pcr detection of middle east...

Documents