3 - phase shunt reactors tkfc · nynas nytro libra. lugs determined for lifting the complete...
TRANSCRIPT
3 - PHASE SHUNT
www.ege.cz
TT RRRRRREEAAAAAAACCCCCCCTTTTTTTTOOOOOOOORRRRRRRSSSS
3 - PHASE SHUNT REACTORS
TKFC
provided with a zinc layer using spray zinc metallizing method.
The expansion tank is equipped with an oil level gauge.
Fig.2 TKFC 3-phase shunt reactor – corrugated tank with an expansion tank and an air drier
Bushings are of various types: porcelain DIN or EN bu-shings, Euromold or Connex cable connectors.
The reactor oil temperature is monitored by a ther-mometer.
Typical transformer oil used in TKFC shunt reactors is Nynas Nytro Libra.
Lugs determined for lifting the complete reactors are placed on the cover or on tank walls under the cover.
The shunt reactors are equipped with an oil drain val-ve placed at the bottom of the reactor.
If required the shunt reactors can be equipped with bi-directional wheels.
TKFC – 3-phase shunt reactors are used to com-pensate the reactive power.
With the development of renewable electric power sources the compensation of reactive power gains more significance.
TKFC - 3-phase shunt reactors are designed for the fixed value of the reactive power.
Typical parameters of the TKFC reactors are:- networks of 6, 10, 15, 20, 35 kV- power up to 8000 kVA- connection group Y or YN
Typical TKFC reactors are placed in a corrugated wall tank and are hermetically sealed or equipped with an expansion tank and the air breather.
Fig.1 TKFC 3-phase shunt reactor – 500kVA - corrugated tank – hermetically sealed
Smaller corrugated wall tanks are hot dip galvanized and painted (if required). Typical colour shade is RAL 7033. Larger tanks are provided with zinc paint. The expansion tank is normally equipped with an oil level gauge.
Alternatively larger TKFC shunt reactors are placed in a corrugated tank or a tank equipped with radiators and with an expansion tank and an air drier. Radia-tors are hot dip galvanized and painted, the tanks are
3 - PHASE SHUNT REACTORS
Tel.: 00420 38 77 64 412Fax.: 00420 38 77 64 603
EGE, spol. s r.o.Novohradská 34, 370 08 České BudějoviceCzech Republic
E-mail: [email protected]