4 xiao-lin tian downloaded from //jb.asm.org/content/jb/early/2013/09/09/jb.00821-13.full.pdf · 70...

1

MecA Proteins Acts As A Negative Regulator of Genetic Competence 1

in Streptococcus mutans 2

3

Xiao-Lin Tian1, Gaofeng Dong

1, Tianlei Liu

1, Zubelda A. Gomez

2, Astrid Wahl

3, 4

Pascal Hols3 and Yung-Hua Li

1,2# 5

6

Department of Applied Oral Sciences1 7

Department of Microbiology and Immunology2 8

Dalhousie University, Halifax, Canada 9

Biochimie et Génétique Moléculaire Bacterienne3 10

Université catholique de Louvain 11

Louvain-la-Neuve, Belgium 12

13

Running title: MecA as a negative regulator of competence in S. mutans 14

15

#: Corresponding Author 16

Mailing Address: 17

5981 University Ave. Rm5215 18

Halifax, Nova Scotia 19

Canada, B3H 3J5 20

Tel: 1-902-494-3063 21

Fax: 1-902-494-6621 22

E-mail: [email protected] 23

JB Accepts, published online ahead of print on 13 September 2013J. Bacteriol. doi:10.1128/JB.00821-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on March 17, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

2

ABSTRACT 24

Streptococcus mutans develops competence for genetic transformation through a 25

complex network that receives inputs from at least two signaling peptides, CSP and XIP. 26

The key step of competence induction is the transcriptional activation of comX that 27

encodes an alternative sigma factor SigX (jX) controlling expression of late competence 28

genes essential for DNA uptake and recombination. In this study, we provide evidence 29

that MecA protein acts as a negative regulator in the posttranslational regulation of SigX 30

in S. mutans. Using luxAB transcriptional reporter strains, we demonstrate that MecA 31

represses expression of late competence genes in S. mutans grown in a complex medium 32

that is sub-permissive for competence induction by CSP. The negative regulation of 33

competence by MecA requires the presence of a functional SigX. Accordingly, 34

inactivation of MecA results in prolonged competence state of S. mutans under this 35

condition. We have also found that the AAA+ protease ClpC displays a similar repressing 36

effect on late competence genes, suggesting that both MecA and ClpC function 37

coordinately to regulate competence in the same regulatory circuit in S. mutans. This 38

suggestion is strongly supported by bacterial two-hybrid assays, which demonstrate that 39

MecA interacts with both SigX and ClpC, forming a ternary SigX-MecA-ClpC complex. 40

Western blot analysis also confirms that inactivation of MecA or ClpC results in the 41

intracellular accumulation of the SigX in S. mutans. Together, our data support the notion 42

that MecA mediates the formation of a ternary SigX-MecA-ClpC complex that sequesters 43

SigX, thereby, negatively regulating genetic competence in S. mutans. 44

45


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

3

INTRODUCTION 46

Competence development for genetic transformation is a mechanism by which 47

bacteria are able to take up and integrate exogenous DNA from their environments (1-3). 48

This enables the recipient organisms to acquire novel genes or heritable traits, promoting

49

the emergence of genetic variations, antibiotic resistance and rapid evolution of virulence 50

factors (4-6). Therefore, natural genetic transformation is an important mechanism 51

whereby bacteria adapt to changing environments (1, 6). 52

It is now known that competence development in the genus Streptococcus is 53

regulated by two different quorum-sensing systems (7-10). The ComCDE is the best-54

studied model system in the mitis group of streptococci such as S. pneumoniae, whereas 55

the ComRS is the newly discovered system that performs the same function in the 56

salivarius, mutans, pyogenic and bovis groups (8-10). Both signaling systems are found 57

to induce competence cascade by activation of comX that encodes an alternative sigma 58

factor SigX (8-13). In the case of ComCDE pathway, a competence-stimulating peptide 59

or CSP is secreted during bacterial growth and is detected by the ComD histidine kinase 60

of a two-component system ComDE (3, 6, 7). This leads to autophosphorylation of its 61

cognate response regulator ComE that in turn activates transcription of comX, triggering 62

the competence cascade or X-state (11, 12). In the ComRS pathway, the signaling system 63

involves sensing a sigX-inducing peptide (XIP) inside the cells after its internalization by 64

an oligopeptide permease transporter, Opp/Ami (9, 10, 13). Once internalized, the XIP 65

interacts with the ComR to form a ComR/XIP complex that activates transcription of 66

comX, triggering the competence cascade (8-10). Clearly, all groups of streptococci 67

require activation of comX to trigger the competence cascade despite different signaling 68


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

4

pathways involved, suggesting that transcriptional activation of comX gene differs 69

between different groups of streptococci (6-13). 70

Interestingly, Streptococcus mutans, an oral bacterium associated with dental 71

caries, possesses both ComCDE and ComRS systems that are shown to regulate genetic 72

competence (10, 13, 14). When grown in a complex medium, such as Todd-Hewitt broth, 73

S. mutans secretes, senses and responds to a signaling peptide pheromone or CSP through 74

the ComCDE pathway (Fig. 1). The ComCDE system coordinates the production of 75

several nonlantibiotic bacteriocins (mutacins) and also strongly induces expression of 76

comX, resulting in activation of competence in less than 10% of the population (14-16). 77

However, the pathway transmitting this signal from the ComE response regulator to 78

comX is unclear, since the ComE binding site is not identified in the promoter region of 79

comX in S. mutans (17). This missing link has been recently filled by identification of the 80

type II ComRS signaling system that directly controls transcription of comX in S. mutans 81

in response to XIP (10). When S. mutans is grown in a chemically defined medium 82

(CDM) with addition of synthetic XIP, competence activation through the ComRS 83

signaling system is superior, nearly involving the entire population (10, 18, 19). 84

However, XIP appears to be inactive and only CSP induces competence when S. mutans 85

is grown in a complex medium (18, 20). This phenomenon is interpreted as bimodal 86

behavior of S. mutans in response to a signaling peptide due to the change in medium 87

components (20). Such bimodal behavior still requires the presence of an intact copy of 88

comS that encodes the precursor of XIP (20). Thus, S. mutans can finely regulates 89

transcription of comX for genetic competence through a regulatory network that responds 90

to two signaling peptides, dependently on nutrient conditions in the environment. 91


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

5

Besides the transcriptional control of comX, the SigX protein is also the target of 92

posttranslational regulation in streptococci. In S. pneumoniae, the SigX is positively 93

regulated by ComW but is negatively controlled by ClpE/P, since ComW both stimulates 94

the activity of SigX and stabilizes the SigX against proteolysis by the ClpE/P complex 95

(21-23). Posttranslational regulation of competence is well documented in B. subtilis, in 96

which the master regulator ComK that triggers competence is sequestered in a ComK-97

MecA-ClpC complex (24-27). The ComK is activated when it is released from the 98

complex by a small protein ComS (25). Recently, a similar regulatory mechanism 99

involving sequestration of SigX by a SigX-MecA-ClpC complex has been reported in S. 100

thermophilus, in which the type I ComRS system primarily regulates expression of comX 101

for genetic competence (28, 29). The S. mutans genome lacks both comW and comK, but 102

it contains all genes that encode SigX, MecA, ClpC and ClpP (30-35). Whether MecA in 103

S. mutans played a functional role in regulation of the SigX activity and competence was 104

unknown. In this study, we aimed to gain genetic evidence of the functional role of MecA 105

in regulation of genetic competence in S. mutans. 106

107

MATERIALS AND METHODS 108

Bacterial strains, media and growth conditions. Bacterial strains and plasmids 109

used in this study are listed in Table 1. S. mutans wild-type strain UA159 was grown on 110

Todd-Hewitt medium plus 0.3% yeast extract (THYE), whereas all the mutants and 111

transcriptional reporter strains derived from S. mutans UA159 were maintained on THYE 112

supplemented with an appropriate antibiotic(s). For some experiments, S. mutans strains 113

were grown in a chemically defined medium or CDM prepared as described previously 114


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

6

(18, 36). Escherichia coli host strains for molecular cloning were grown in Luria-Bertani 115

(LB) medium supplemented with an appropriate antibiotic. 116

Assay for competence activation. A standard competence assay was carried out 117

to determine the effects of gene deletion on competence development (10, 22). S. mutans 118

UA159 was used as a positive control, while a comX deletion mutant (XT-D1 or XT-D2) 119

was used as a negative control. All the strains were grown either in a complex medium 120

such as THYE with use of CSP or in CDM medium with use of XIP. Both peptides were 121

commercially synthesized with 90% of the purity (BioBasic Inc., Ontario). Each peptide 122

was freshly dissolved in sterile distilled water as 1.0 mM, which was further diluted as 123

required. In THYE medium, an aliquot of CSP (at a final concentration of 500 nM) was 124

added into the cultures reaching to the early mid-log phase (O.D600 ≈ 0.30). In CDM 125

medium, an aliquot of XIP (at a final concentration of 1 µM) was added into the cultures 126

that reached to the mid-log phase (O.D600 ≈ 0.45). To study kinetics of transformation, 127

aliquots (0.5 ml) of samples were withdrawn in duplicate at 15-min intervals and exposed 128

to a transforming DNA (either 1 µg/ml of plasmid DNA or 10 µg/ml of chromosomal 129

DNA conferring an antibiotic marker) for 15 min. Each samples was added with 10 ng/ml 130

DNases and continued incubation for 45 min. The cell suspensions were taken from each 131

culture to spread on THYE plates plus an antibiotic for selection of positive 132

transformants or on THYE plates for total viable cell counts. Transformation frequency 133

was expressed as the ratio of transformants (antibiotic resistant colonies) to the total 134

number of recipient cells per milliliter cell suspension. 135

Construction of gene deletion mutants. To determine the effects of inactivation of 136

relevant genes on competence, individual gene deletion mutants were constructed by an 137


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

7

allelic replacement strategy using PCR-ligation mutagenesis (37). The primers used to 138

construct and confirm these mutants are listed in Table 2. For construction of the mecA 139

mutant (ΔmecA), for example, a 681-bp fragment (mecA-up) from the internal region of 140

the mecA start codon was amplified against S. mutans UA159 genomic DNA using 141

primers mecA-P1 and mecA-P2. Another 872-bp fragment (mecA-dw) was amplified 142

from the internal region of mecA stop codon using primers mecA-P3 and mecA-P4. Both 143

PCR products were digested, purified and ligated to AscI and FseI sites of an antibiotic 144

resistance cassette (37-39). The ligation products were transformed into S. mutans 145

UA159. Following double crossover recombination, the internal region of mecA was 146

completed replaced by an antibiotic cassette. Positive clones were selected from THYE 147

plates plus an appropriate antibiotic(s) for genetic confirmation by a PCR strategy (37). 148

The presence of the antibiotic marker with predicted sizes of the flanking regions in the 149

mutants but not in the parent indicated successful replacement deletion by the antibiotic 150

cassette. The double deletion mutants of ΔmecA-comX (XT-D5) and ΔclpC-comX (XT-151

D6) were also constructed by transforming the ΔcomX genomic DNA into other single 152

mutants. The confirmed double mutants should confer the resistance to two antibiotics. 153

Construction of complementation strain. To rule out potential polar effect on 154

the phenotype of mecA mutant, we constructed a S. mutans strain that harbored a low 155

copy Streptococcus-E. coli shuttle vector, pDL277 (39), which was constructed to carry a 156

wild type copy of mecA gene for genetic complementation of the defect in trans. Briefly, 157

the entire mecA along with its promoter region was amplified by PCR against S. mutans

158

UA159 genomic DNA using primers MecA-cp-F and MecA-cp-B. The amplicon was 159

ligated into Nco1 and EcoR1 sites of pDL277 and transformed into E. coli host DH5g. 160


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

8

Transformants selected from LB plates plus spectinomycin (50 µg/ml) were genetically 161

confirmed by restriction digestion analysis. A confirmed plasmid, named pCpmecA, was 162

transformed into ΔmecA mutant (XT-D3) to generate a complementary strain XT-Cp1, 163

which was resistance to both spectinomycin (500 µg/ml) and erythromycin (10 µg/ml). 164

Construction of luxAB transcriptional reporter strains and luciferase activity 165

assay. To monitor the promoter activities of comX and its controlled late competence 166

genes, cinA and comY, we constructed luxAB transcriptional reporter strains that harbored 167

a shuttle vector pWAR303 (10) carrying luxAB fusion to the promoter region of each of 168

these genes. Briefly, DNA fragments containing the promoter regions (≈300-500 bp) of 169

these genes were generated by PCR, purified and cloned into pWAR303 to generate 170

luxAB fusion plasmids (Table 1). The confirmed plasmids were then transformed into S. 171

mutans UA159 and relevant mutants for Lux reporter activity assay. Bacterial growth 172

(optical density at 590 nm) and luciferase activity (bioluminescence at 590 nm) of the 173

reporter strains were assayed at regular intervals in a micro-plate reader (Synergy HT, 174

Biotek, USA). One percent nonanal (Sigma-Aldrich) was used to assay the luciferase 175

activity, since the LuxAB-catalyzed luciferase activity requires the presence of nonanal 176

as a substrate (18, 28). Briefly, aliquots (300 たl) of cell cultures were transferred to the 177

wells of a pre-warmed (37°C) microtiter plate. Aliquots (50 たl) of the solution containing 178

1% nonanal (diluted in mineral oil) in a volatile form were placed in the spaces between 179

the wells of the microplate, which was then covered with the lip. The microtiter plate was 180

placed in the prewarmed reader (37°C) for incubation and readings at a setting of time 181

intervals of every 15 min for 5 hrs. The results were expressed in relative luminescent 182

units (RLU) divided by cell density of the cultures. 183


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

9

Construction of SigX-His plasmids and detection of the SigX-His by Western 184

blot analysis. To investigate the effect of mecA or clpC deletion on the cellular levels of 185

the SigX, we constructed a shuttle vector pSigX-His that carried a wild copy of comX 186

with a C-terminal His-tag by a two-step cloning strategy. In the first step, we amplified 187

the entire comX gene (except stop codon) from the S. mutans genome using primers 188

XHis-EcoR1-F and XHis-Notl-B1 and cloned it into an expression vector pET-21b(+) 189

(Novagen). The confirmed clone was designated as pET-21b-SigX. In the second step, 190

we used a new primer XHis- SphI-B2 and XHis-EcoR1-F to amplify the insertion and its 191

C-terminal His-tag from pET-21b-SigX and cloned it into E. coli-Streptococcus shuttle 192

vector pDL277 (39). A confirmed clone, named pSigX-His, was transformed into S. 193

mutans UA159 and the MecA- and ClpC-deficient mutants. We then examined the 194

abundance of the SigX protein in crude cell extracts from the S. mutans strains. S. mutans 195

UA159 and the MecA- and ClpC-deficient mutants were grown in THYE medium to 196

induce competence by adding CSP. Aliquots of samples were then taken at different cell 197

densities representing different growth phases to prepare crude protein lysates from these 198

S. mutans strains. The cellular levels of the SigX in these strains were estimated by 199

Western blot analysis using an anti-His-tag antibody (GeneScript, NJ, USA). 200

Construction of bacterial two-hybrid (B2H) plasmids and two-hybrid assay. 201

To obtain the evidence of direct interactions between MecA, SigX, ClpC and ClpP, a 202

bacterial two-hybrid (B2H) system (BACTH System Kit, Euromedex) was used to 203

construct a range of two-hybrid plasmids, which allowed an easy assay of functional 204

interactions between two putative interacting proteins (40). The coding sequences of 205

mecA, comX, clpC and clpP were amplified by PCR from S. mutans UA159 genomic 206


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

10

DNA using specific primers listed in Table 2. In the first step, each of these PCR 207

products was digested with XbaI and KpnI, purified and cloned into plasmids pUT18, 208

pUT18C, pKT25, and pKNT25, respectively, using an E. coli host XL-1 (Stratagene). 209

The positive clones were selected from LB plates plus either ampicillin (100 µg/ml) or 210

kanamycin (50 µg/ml) for genetic confirmation by colony PCR and restriction digestion 211

analysis. In the second step, the confirmed constructs, in combinations of two compatible 212

plasmids, were transformed into the E. coli adenylate cyclase deficient strain BTH101 213

(cya-99) for B2H assays. A full list of constructed B2H plasmids is shown in Table 1. 214

Six clones from each combination were tested on MacConkey indicator agar plates 215

containing 1% (wt/vol) maltose supplemented with both ampicillin (50 µg/ml) and 216

kanamycin (50 µg/ml). The same clones were also tested on Luria-Bertani (LB) agar 217

plates containing X-gal (40 µg/ml) and IPTG (0.5 mM) supplemented with these two 218

antibiotics. All the plates were incubated and maintained at 30°C for 40 hours before 219

assessment of the B2H results. 220

221

RESULTS 222

The S. mutans genome contains a homolog of MecA from B. subtilis. The 223

genome of S. mutans UA159 contains an open reading frame, designated as SMU.245, 224

which encodes a putative homologue to MecA protein from B. subtilis (30). The MecA 225

protein of S. mutans consists of 240 amino acid residues with a predicted molecular mass 226

of 28,042 da and a pI value of 4.30. The gene immediately upstream of mecA is SMU.244 227

that encodes a putative bacitracin resistance protein, while the gene downstream is rgpG 228

that encodes a protein involved in the biosynthesis of cell wall rhamnose-glucose 229


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

11

polysaccharides (41). The sequence alignment reveals that the MecA protein in S. mutans 230

is highly homologous to those in S. agalactiae A909 (67% identity), S. pyogene M1 GAS 231

(63% identity) and S. thermophilus LMD-9 (57% identity). The MecA proteins are well 232

conserved among S. mutans strains, since all four sequence-completed S. mutans strains 233

UA159, GS-5, NN2025 and LJ23 contain a putative MecA in their genomes (30, 33-35). 234

In particular, MecA proteins in S. mutans strains share high levels of conservation at the 235

N-terminal domain (NTD) and C-terminal domain (CTD) with those of S. thermophilus 236

and B. subtilis (24-28), suggesting that MecA in S. mutans might act as an adaptor protein 237

to interact with its partners to regulate competence and stress response in the manners 238

similar to those in S. thermophilus and B. subtilis (24-28). 239

Inactivation of MecA results in increased expression of late competence genes 240

without affecting comX transcription. To determine the functional role of MecA in the 241

regulation of competence genes, we constructed several transcriptional reporter strains 242

that harbored a low-copy shuttle vector pWAR303 containing a promoterless luxAB fused 243

to the promoter of comX, comY or cinA (10). The promoter of comX (PcomX) was chosen, 244

since it integrates all the signals from the early stage of competence. The promoters of 245

two late competence genes comY and cinA (PcomY and PcinA) were selected, since they 246

encode the machinery for DNA uptake and recombination and their transcription is 247

directly controlled by SigX (10, 15, 42). These reporter constructs were then transformed 248

into S. mutans wild type UA159 (MecA+) and the MecA-deficient mutant (MecA

–) to 249

generate a set of reporter fusion strains (Table 1). All the reporter strains were grown in 250

THYE medium to monitor their luciferase reporter activities (RLU/OD600) in response to 251

CSP (500 nM). The results showed that all the reporter strains of the MecA-deficient 252


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

12

background XT-Lx4 (PcomX;;luxAB, mecA–), XT-Lx5 (PcomY;;luxAB, mecA

–) and XT-Lx6 253

(PcinA;;luxAB, mecA–) grew more slowly than the wild-type control strains XT-lx1 254

(PcomX;;luxAB, wt), XT-Lx-2 (PcomX;;luxAB, wt) and XT-Lx3 (PcomX;;luxAB, wt) (Fig. 2). 255

However, the PcomX reporter activities of both type strains similarly increased, reached to 256

the peaks and then declined, although the peak of the MecA-deficient strain appeared 257

slightly latter than in the control strain (Fig. 2A). No significant difference in the reporter 258

activities was observed between these two reporter strains, suggesting that deletion of 259

mecA gene had little impact on the transcriptional level of comX in S. mutans. In contrast, 260

the reporter activity of PcomY-luxAB fusion reporter in the MecA-deficient strain was 261

hundred-fold higher than the wild type control strain, which showed nearly no induction 262

in the reporter activity (Fig. 2B). Similar results were also observed when PcinA-luxAB 263

fusion reporter was examined in the MecA-deficient mutant and the wild type control 264

(Fig. 2C). The results suggest that inactivation of MecA appeared to relieve its repression 265

of late competence genes comY and cinA. To confirm if the reporter activities resulted 266

from SigX-driven transcription of PcomY-luxAB or PcinA-luxAB, we transformed these 267

plasmids into a double mutant XT-D5 (mecA–, comX

–) to generate two new reporter 268

strains XT-lx10 (PcomY::luxAB, mecA–, comX

–) and XT-lx11 (PcomY::luxAB, mecA

–, 269

comX–). We then examined the lux reporter activities of these strains. The result showed 270

little reporter activity in the double deletion mutants (data not shown), suggesting that 271

MecA repressed late competence genes, such as comY and cinA, through the SigX but not 272

through another regulatory protein. Together, these data indicate that the regulation of 273

late competence genes by MecA requires the presence of an intact SigX protein, although 274

MecA does not affect transcription of comX in S. mutans. 275


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

13

Inactivation of MecA results in prolonged competence state. To determine 276

whether the increased expression of late competence genes in the MecA-deficient mutant 277

had a positive effect on its transformability, we first evaluated transformation efficiency 278

of this mutant (ΔmecA) in comparison with parent UA159 (positive control) and ΔcomX 279

(negative control) grown in THYE. The results showed that the MecA-deficient strain 280

transformed with almost the same efficiency as UA159 in response to CSP (Fig. 3A). 281

Under the same condition, however, the comX deletion mutant (ΔcomX) completely lost 282

its transformability. So did the double deletion mutant ΔmecA-comX under the same 283

condition (data not shown). The results indicated that inactivation of MecA did not 284

reduce transformation efficiency of S. mutans unless comX was inactivated. The results 285

were consistent with the specific luciferase reporter activities between strains XT-Lx1 286

(PcomX::luxAB, wt) and XY-Lx4 (PcomX::luxAB, MecA–), which showed similar levels of 287

the promoter activity of comX in response to CSP (Fig. 2A). The data confirmed that 288

inactivation of MecA did not directly affect the expression of comX in S. mutans. 289

We then examined kinetics of genetic transformation of these strains in response 290

to CSP. As expected, parent UA159 was rapidly induced to take up the transforming 291

DNA with the maximal transformation frequency peaking between 40-80 min post CSP 292

addition (Fig. 3A). The transformation frequency then declined to the basal level 293

afterward. In contrast, the ΔmecA mutant showed a slow increase in transformation 294

frequency peaking around 120-150 min post CSP addition, which was consistent with its 295

slower growth rate. However, the MecA-deficient strain maintained relatively high levels 296

of transformation frequencies for 2-3 hours and declined slightly when the cultures 297

reached the late log phase. The results suggested that inactivation of MecA resulted in 298


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

14

prolonged competence state (X-state) for genetic transformation in S. mutans. To further 299

confirm the results, we constructed a MecA complementation strain, designated XT-Cp1 300

(MecA complementation), to assay kinetics of its transformation. We found that 301

reintroduction of the wild copy of mecA into the mecA deletion mutant almost completely 302

restored the wild type phenotype for transient uptake of transforming DNA (Fig. 3A). 303

MecA is ineffective to repress the expression of comY and cinA when S. 304

mutans is grown in CDM. The functional role of MecA protein was further evaluated by 305

growing S. mutans strains in CDM, a chemical defined medium that was recently found 306

to be permissive for competence development of S. mutans (10, 18-20). In this medium, 307

S. mutans is reported to develop high levels of competence in response to XIP (18-20), 308

thereby, facilitating study of the effect of MecA on competence regulation. We first 309

examined kinetics of genetic transformation of parent strain UA159 (positive control), 310

ΔmecA, XT-Cp1 (MecA complementation) and ΔcomX (negative control) grown in 311

CDM in response to XIP. Surprisingly, we found that except mutant ΔcomX all the 312

strains showed similarly high and persistent levels of transformation in CDM (Fig. 3B). 313

In consistence with these results, the specific luciferase activities of two late competence 314

gene, PcomY::luxAB and PcinA::luxAB, showed persistent increases in their reporter activities 315

(Fig. 4A and B). The reporter activities slightly decreased when the cultures reached the 316

late log phase but still maintained significantly higher levels over the times. In contrast, 317

the specific luciferase activities of the comX promoter, PcomX::luxAB, still showed a 318

transient increase but rapidly declined afterward (Fig. 4C). However, there was little 319

difference in the reporter activities in all three promoters of PcomY, PcinA and PcomX 320

between the MecA-deficient strains and the wild type control strains. Interestingly, the 321


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

15

ClpC-deficient strain showed a similar pattern of transformation to the MecA-deficient 322

strain in the CDM (Fig. 3B). Together, the results suggested that when competence 323

induction reached a threshold level under the permissive condition such as in the CDM, 324

the depletion of MecA had little impact on late competence genes. Under this condition, 325

transcriptional activation of comX and late competence genes might represent the 326

dominant mechanism for competence development. The patterns of developing such high 327

and persistent competence state in these strains appeared to be consistent with the recent 328

reports by growing S. mutans in CDM (18-20), but was contrast to the typical transient 329

pattern of the competence state in S. pneumoniae (11, 12, 22). 330

ClpC and MecA display similar repressing effects on late competence genes. 331

By comparing transformability in several mutants, including the clpC knockout mutants, 332

we found that the ClpC-deficient strain showed a similar temporal pattern of 333

transformation profiles to the MecA-deficient mutant both in THYE and CDM media 334

(Fig. 3). We hypothesized that ClpC protein might also act as a repressor of the late 335

competence genes in a similar manner to the MecA in S. mutans. Therefore, we set forth 336

the experiments to test this hypothesis. We also transformed the reporter fusions into the 337

ClpC-deficient mutant to examine the effects of clpC deletion on the promoter activities 338

of comX, comY and cinA in response to CSP. Interestingly, we found that deletion of clpC 339

had little impact on the activity of PcomX::luxAB fusion compared to the wild-type strain 340

(Fig. 5A), suggesting that deletion of clpC did not affect transcriptional level of comX. 341

We then examined the reporter activities of PcomY-luxAB and PcinA-luxAB fusions in the 342

ClpC-deficient strains in comparison with the wild type background. The results showed 343

little induction in the reporter activities of PcomY-luxAB and PcinA-luxAB fusion reporters in 344


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

16

the wild type background. In contrast, these two fusion reporters in the ClpC-deficient 345

strains showed as high as hundred-fold increases in their Lux reporter activities (Fig. 5B 346

and C). Notably, deletion of clpC resulted in the activation of comY and cinA in a manner 347

very similar to that in the MecA-deficient strain, suggesting that MecA and ClpC 348

function coordinately to regulate late competence genes, comY and cinA, in the same 349

regulatory circuit of S. mutans. 350

Both MecA and ClpC negatively affect the accumulation of the SigX in vivo. 351

To determine the effect of deletion of either mecA or clpC on the cellular levels of the 352

SigX protein, we constructed a shuttle vector pSigX-His that harbored a wild copy of 353

comX with a C-terminal His-tag. This construct, designated as pSigX-His, was then 354

transformed into S. mutans UA159 and the MecA- and ClpC-deficient mutants to 355

generate three strains XT-His1 (UA159-pSigX-His), XT-His2 (ΔmecA-pSigX-His) and 356

XT-His3 (ΔclpC-pSigX-His). These strains were grown in THYE medium to induce 357

competence by adding CSP. Western blot analysis using an antibody specific to the His-358

tag was used to detect and estimate cellular levels of the SigX in crude protein extracts 359

from the S. mutans strains. The result showed that the intracellular levels of the SigX 360

protein were undetectable in all the strains without addition of CSP. Following addition 361

of CSP, however, the SigX protein was detectable but remained low to moderate levels in 362

the wild type control strain (Fig. 6). In contrast, both the MecA- and ClpC-deficient 363

strains XT-His2 and XT-His3 showed much higher levels of the SigX protein than that in 364

the wild type background. The results clearly indicate the cellular accumulation of the 365

SigX protein in the MecA- and ClpC-deficient mutants, further suggesting that both 366

MecA and ClpC negatively affect the cellular levels of the SigX protein in S. mutans. 367


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

17

MecA interacts with both SigX and ClpC in the bacterial two-hybrid assays. 368

To obtain evidence of direct interactions between MecA and SigX or between MecA and 369

ClpC or ClpP, we constructed a range of bacterial two-hybrid (B2H) plasmids using a 370

B2H system (BACTH System Kit, Euromedex). In this system, two putative interacting 371

proteins were genetically fused to two complementary fragments, T18 and T25, which 372

constituted the catalytic domain of the adenylate cyclase (40). The plasmids allowed the 373

production of all possible combinations of N and C fusion proteins between T18 and T25 374

as well as full-length protein partners. When the fusion proteins interacted with each 375

other, a functional complementation between the T25 and T18 fragments resulted in 376

adenylate cyclase activity and cyclic AMP (cAMP) production, thereby, turning on the 377

transcription of the lac operon (28, 40). The production of adenylate cyclase from 378

transformants of the E. coli cya mutant BTH101 could be detected either on MacConkey 379

indicator plates (positive interactions indicated by red colonies) or on LB plates 380

supplemented with X-gal and IPTG (positive interaction indicated by blue colonies). 381

Next, all combinations of fusion proteins between MecA and SigX, ClpC or ClpP were 382

tested in the B2H system. The results showed that all combinations of fusion proteins 383

between MecA and SigX or between MecA and ClpC gave positive interaction signals 384

with each other (Fig. 7). However, all combinations of fusion proteins between MecA 385

and ClpP gave negative interaction signals with each other, although both ClpC and ClpP 386

showed interactions or some self-interactions (data not shown). Similarly, all negative 387

control strains, such as T18 or T25 with these protein partners as well as T18 and T25 388

had no color change on the indicator plates, although some self-interactions were 389

observed between MecA fusion proteins, which was previously explained as potential 390


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

18

oligomerization process by both the NTD and CTD of MecA in B. subtilis (24-26). 391

Together, the results from the B2H assays provide strong evidence that MecA acts as an 392

adaptor protein to interact with both SigX and ClpC, likely mediating the formation of a 393

ternary SigX-MecA-ClpC complex in S. mutans. 394

395

DISCUSSION 396

Streptococcus mutans regulates competence for genetic transformation through a 397

complex regulatory network that receives inputs from at least two signaling peptides, 398

CSP and XIP. The key step of competence induction by either of these signaling peptides 399

is the transcriptional activation of comX that encodes an alternative sigma factor SigX 400

(jX) controlling expression of late competence genes essential for DNA uptake and 401

recombination (6-8, 11-13). Although much is known of the regulatory cascade leading to 402

transcriptional activation of comX, the posttranslational regulation of SigX in this species 403

remains unexplored. In this study, we demonstrate by genetic approaches that the MecA 404

protein acts as a negative regulator of genetic competence in S. mutans grown in a 405

complex medium, the growth condition that is sub-permissive for competence 406

development of S. mutans in response to CSP. The negative regulation of competence by 407

MecA protein involves a mechanism that requires the presence of the functional SigX. 408

Using luciferase reporter strains, we confirm that MecA represses late competence genes, 409

such as comY and cinA, without affecting the transcriptional activation of comX gene. 410

The results suggest that the increased reporter activities of PcomY;;luxAB and PcinA;;luxAB 411

in the MecA-or ClpC-deficient strains are likely due to the increased stability of SigX 412

under the competence sub-permissive condition. The evidence to support this suggestion 413


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

19

is that Western blot detects an intracellular accumulation of the SigX protein in both 414

MecA- and ClpC-deficient strains but not in the wild-type control strain grown in the 415

complex medium. Therefore, the inactivation of MecA or ClpC likely relieves its control 416

on SigX, resulting in an increased level of free SigX that in turn activates transcription of 417

late competence genes comY and cinA. This finding is also supported by the observation 418

that inactivation of MecA or ClpC results in prolonged competence state of S. mutans 419

grown in the complex medium. However, the results are intriguing, since the expression 420

of late competence genes comY and cinA based on the luciferase reporter strains suggests 421

a shut off mechanism, although the intracellular levels of SigX was relatively stable in 422

the MecA- and ClpC-deficient strains at the same growth phases. The mechanism behind 423

this discrepancy is unclear. One possibility is that the stable level of SigX may be reused 424

for additional activation of competence. Another possibility is that the loss in the Lux 425

activity may result from depletion or a low level of its FMN cofactor in the medium. 426

Regardless the discrepancy, the data clearly suggest that inactivation of MecA or ClpC 427

results in an increase in the abundance or/and stability of SigX during competence 428

development. The work using B2H assay suggests that MecA likely interacts with SigX 429

and mediates the formation of a tertiary SigX-MecA-ClpC complex, which sequesters 430

SigX of S. mutans grown in the complex medium. Such a tertiary complex has been 431

proposed to interact with the serine protease ClpP, leading to degradation of SigX in the 432

closely related species S. thermophilus (28, 29). The negative regulation of the SigX by 433

MecA and ClpC may be also true for S. mutans based on the data from this study. 434

Recent studies from S. thermophilus have revealed that the AAA+ protease ClpC 435

has been involved in the negative regulation of competence in a manner similar to the 436


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

20

MecA in this species (27, 28). Concerning the potential role of ClpC in competence 437

regulation, we have extended our investigation into Clp proteins in this study. Our results 438

from reporter assays, B2H assay and Western blot analysis confirm that ClpC protein 439

works coordinately with MecA in the same regulatory circuit to regulate competence 440

development in S. mutans. The results indicate that MecA interacts with both SigX and 441

ClpC proteins in S. mutans, strongly suggesting the possibility that MecA may target the 442

SigX for degradation by ClpC/P protease. Such regulated proteolysis appears to be 443

similar to MecA-mediated ComK degradation by ClpC/P in B. subtilis (24-27). This 444

suggestion is supported by several lines of the evidence: 1) MecA and ClpC deprivations 445

relieves the transcriptional control of the late comY and cinA genes in a similar manner 446

and without cumulative effects; 2) B2H assays suggest that MecA interacts with both 447

SigX and ClpC, likely forming a ternary SigX-MecA-ClpC complex that is analogous to 448

ComK-MecA-ClpC complex in B. subtilis (24-27); and 3) the inactivation of MecA or 449

ClpC resulted in the intracellular accumulation of SigX protein in S. mutans. The 450

evidence from this study suggests that MecA functions coordinately with ClpC 451

machinery for regulated proteolysis of SigX in S. mutans. Thus, the functional role 452

played by MecA in S. mutans appears to act as an anti-sigma factor for regulation of 453

competence. This finding is highly consistent with recent reports from S. thermophilus, in 454

which MecA is found to target SigX to ClpC for degradation (27, 28). The implication of 455

an adaptor protein acting as an anti-sigma factor in Clp machinery-dependent manner was 456

previously reported in both Gram-negative and Gram-positive bacteria (43). In the case 457

of E. coli, for example, the adaptor protein RssB specifically targets Sigma S (jS) or 458

RpoS to ClpXP for degradation, regulating the levels of RpoS in the stationary phase or 459


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

21

general stress response in E. coli (44). Anther example is adaptor protein RsiW that acts 460

as an anti-sigma factor in the control of sigma factor W (jW) during alkaline stress in B. 461

subtilis (45). Regulated proteolysis of a master regulator by an adaptor protein along with 462

a Clp-machinery for regulation of competence and stress response is well conserved 463

among low GC-content Gram-positive bacteria, including streptococci (22-27, 43-45). 464

This emphasizes the importance of fine control of genetic competence and stress response 465

that have been positively selected through microbial evolution. However, further work 466

may be required to investigate how MecA mediates degradation of SigX protein by 467

ClpC/P protease in S. mutans. 468

Recently, several studies have shown that S. mutans can develop a high level of 469

competence for genetic transformation when it is grown in CDM, a growth medium that 470

is permissive for competence development in response to XIP (10, 18-20). It has been 471

found that the resulting competence state induced by XIP in CDM can persist for hours 472

until the late log phase (18). This response does not only provide the basis for a bioassay 473

for XIP pheromone in CDM, but also provides a favorable condition to examine 474

regulation of competence genes including comX and the late competence genes (18, 19). 475

We have examined the effect of MecA on competence development of S. mutans grown 476

in CDM. Interestingly, the negative regulation of genetic competence by MecA appears 477

to be ineffective when S. mutans is grown in CDM in response to XIP. Surprisingly, we 478

have found little difference in the Lux reporter activities between the MecA-deficient 479

strains and the wild type control strains. In consistence with the reporter activities, both 480

the MecA-deficient mutant and the wild type control strain show similarly high levels of 481

transformation in CDM medium. The evidence suggests that depletion of MecA has little 482


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

22

impact on competence induction when the transcription of comX is strongly activated by 483

the ComRS system, which represents a dominant mechanism for competence activation. 484

The results appear to be highly consistent with a recent report of S. thermophilus that 485

MecA is not a repressor of the late comGA operon when the organism is grown under the 486

competence permissive condition or in CDML (28). Thus, the negative regulation of 487

SigX by MecA or ClpC appears to be bypassed when S. mutans is grown in CDM or 488

under the competence permissive condition. 489

Based on the results presented in this study and current knowledge of the 490

functional role of MecA in S. thermophilus and B. subtilis (24-29), we propose the 491

following model for the posttranslational control of SigX in S. mutans (Fig. 1). In a 492

complex medium or under a sub-permissive condition, SigX (σX) is produced at a basal 493

level and sequestrated by MecA that also binds the ClpC ATPase subunit of the Clp 494

machinery. This ternary complex interacts with the serine protease ClpP, leading to the 495

degradation of the SigX. Therefore, the basal level of free SigX is insufficient to induce 496

transcription of late competence genes. In contrast, the negative control exerted by MecA 497

would be bypassed when growth condition is permissive for competence induction such 498

as in CDM, possibly via MecA saturation, due to a high level of accumulation of SigX. 499

Consequently, the SigX would be free to associate with the core RNA polymerase and 500

specifically recognize the com box in the promoter regions of many late competence 501

genes to activate their transcription. To confirm this model, further work is needed to 502

investigate MecA-mediated degradation of SigX by the ClpC/P protease. 503

504

505


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

23

ACKNOWLEDGMENTS 506

This work was supported by NSERC Discovery Grant RGPIN-311682-07 and by 507

CIHR Operating Grant MOP-115007. YH Li was a recipient of Nova Scotia-CIHR 508

Regional Partnership Program Award. The work of P. Hols was funded by the 509

Interuniversity Attraction Poles Programme initiated by the Belgian Science Policy 510

Office and FNRS. A. Wahl and P. Hols are respectively postdoctoral researcher and 511

research associate at FNRS. We thank Dr. Donald Morrison in the University of Illinois 512

at Chicago for luxAB reporter plasmids pWAR303 and pWAR304. We also thank Dr. 513

Song Lee at Dalhousie University for expression plasmid pET-20b(+). The authors 514

declare that they have no competing financial interests. 515

516

REFERENCES 517

1. Lorenz MG, Wackernagel W. 1994. Bacterial gene transfer by natural genetic 518

transformation in the environments. Microbiol. Rev. 58:563-602. 519

2. Chen I, Dubnau D. 2004. DNA uptake during bacterial transformation. Nat. Rev. 520

Microbiol. 2:241-249. 521

3. Håvrstein LS, Hakenbeck R, Gaustad P. 1997. Natural competence in the genus 522

Streptococcus: evidence that streptococci can change pherotype by interspecies 523

recombinational exchanges. J. Bacteriol. 179:6589-6594. 524

4. Johnsborg O, Eldholm, V, Håvarstein, LS. 2007. Natural genetic transformation: 525

prevalence, mechanisms and function. Res. Microbiol. 158:767–778. 526

5. Dowson CG, Barcus V, King S, Pickerill P, Whatmore A, Yeo M. 1997. 527

Horizontal gene transfer and the evolution of resistance and virulence determinants in 528

Streptococcus. Appl. Bacteriol. Symp. Ser. 26:42S-51S. 529

6. Claverys JP, Prudhomme M, Martin B. 2006. Induction of competence regulons as 530

a general response to stress in gram-positive bacteria. Annu. Rev. Microbiol. 60:451–531

475. 532


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

24

7. Martin B, Quentin Y, Fichant G, Claverys J-P. 2006. Independent evolution of 533

competence regulatory cascades in streptococci? Trend Microbiol. 14:339-345. 534

8. Havarstein LS. 2010. Increasing competence in the genus Streptococcus Mol. 535

Microbiol. 78:541-544. 536

9. Fontaine L, Boutry C, de Frahan MH, Delplace B, Fremaux C, Horvath P, 537

Boyaval P, Hols P. 2010. A novel pheromone quorum-sensing system controls the 538

development of natural competence in Streptococcus thermophilus and Streptococcus 539

salivarius. J. Bacteriol. 192:1444–1454. 540

10. Mashburn-Warren L, Morrison DA, Federle MJ. 2010. A novel double-541

tryptophan peptide pheromone controls competence in Streptococcus spp. via an Rgg 542

regulator. Mol. Microbiol. 78:589–606. 543

11. Lee MS, Morrison DA. 1999. Identification of a new regulator in Streptococcus 544

pneumoniae linking quorum sensing to competence for genetic transformation. J. 545

Bacteriol. 181:5004-5016. 546

12. Luo P, Morrison DA. 2003. ComX is a unique link between multiple quorum 547

sensing outputs and competence in Streptococcus pneumoniae. Mol. Microbiol. 548

54:623-633. 549

13. Federie MJ, Marrison DA. 2012. One if by land, two if by sea: signaling to the 550

ranks with CSP and XIP. Mol. Microbiol. 86:241-245. 551

14. Li YH, Lau PC, Lee JH, Ellen RP, Cvitkovitch DG. 2001. Natural genetic 552

transformation of Streptococcus mutans growing in biofilms. J. Bacteriol. 183:897-553

908. 554

15. Lemme A, Gröbe L, Reck M, Tomasch J, Wagner-Döbler I. 2011. Subpopulation-555

specific transcriptome analysis of competence-stimulating-peptide-induced 556

Streptococcus mutans. J. Bacteriol. 193:1863–1877. 557

16. van der Ploeg JR. 2005. Regulation of bacteriocin production in Streptococcus 558

mutans by the quorum-sensing system required for development of genetic 559

competence. J. Bacteriol. 187:3980–3989. 560

17. Hung DC, Downey JS, Ayala EA, Kreth J, Mair R, Senadheera DB, Qi F, 561

Cvitkovitch DG, Shi W, Goodman SD. 2011. Characterization of DNA binding 562


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

25

sites of the ComE response regulator from Streptococcus mutans. J. Bacteriol. 563

193:3642-3652. 564

18. Desai K, Mashburn-Warren L, Federle MJ, Morrison DA. 2012. Development of 565

competence for genetic transformation of Streptococcus mutans in a chemically 566

defined medium. J. Bacteriol. 194:3774–3780. 567

19. Khan R, Rukke HV, Ricomini Filho AP, Fimland G, Arntzen MØ, Thiede B, 568

Petersen FC. 2012. Extracellular identification of a processed type II ComR/ComS 569

pheromone of Streptococcus mutans. J. Bacteriol. 194:3781-3788. 570

20. Son M, Ahn SJ, Guo Q, Burne RA, Hagen SJ. 2012. Microfluidic study of 571

competence regulation in Streptococcus mutans: environmental inputs modulate 572

bimodal and unimodal expression of comX. Mol. Microbiol. 86:258–272. 573

21. Luo P, Li H, Morrison DA. 2004. Identification of ComW as a new component in 574

the regulation of genetic transformation in Streptococcus pneumoniae. Mol. 575

Microbiol. 54:172–183. 576

22. Piotrowski A, Luo P, Morrison DA. 2009. Competence for genetic transformation 577

in Streptococcus pneumoniae: termination of activity of the alternative sigma factor 578

ComX is independent of proteolysis of ComX and ComW. J. Bacteriol. 191:3359–579

3366. 580

23. Chastanet A, Prudhomme M, Claverys JP, Msadek T. 2001. Regulation of 581

Streptococcus pneumoniae clp genes and their role in competence development and 582

stress survival. J. Bacteriol. 183:7295–7307. 583

24. Schlothauer T, Mogk A, Dougan DA, Bukau B, Turgay K. 2003. MecA, an 584

adaptor protein necessary for ClpC chaperone activity. Proc. Natl. Acad. Sci. U. S. A. 585

100:2306–2311. 586

25. Liu J, Zuber P. 1998. A molecular switch controlling competence and motility: 587

competence regulatory factors ComS, MecA, and ComK control sigma D-dependent 588

gene expression in Bacillus subtilis. J. Bacteriol. 180:4243–4251. 589

26. Persuh M, Turgay K, Mandic-Mulec I, Dubnau D. 1999. The N- and C-terminal 590

domains of MecA recognize different partners in the competence molecular switch. 591

Mol. Microbiol. 33:886–894. 592


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

26

27. Turgay K, Persuh M, Hahn J, Dubnau D. 2001. Roles of the two ClpC ATP 593

binding sites in the regulation of competence and the stress response. Mol. Microbiol. 594

42:717–727. 595

28. Boutry C, Wahl A, Delplace B, Clippe A, Fontaine L, Hols P. 2011. Adaptor 596

protein MecA is a negative regulator of the expression of late competence genes in 597

Streptococcus thermophilus. J. Bacteriol. 193:1777-1788. 598

29. Biornstad TJ, Havarstein LS. 2011. ClpC acts as a negative regulator of 599

competence in Streptococcus thermophilus. Microbiol. 157:1676–1684. 600

30. Ajdic D, McShan WM, McLaughlin RE, Savić G, Chang J, Carson MB, 601

Primeaux C, Tian R, Kenton S, Jia H, Lin S, Qian Y, Li S, Zhu H, Najar F, Lai 602

H, White J, Roe BA, Ferretti JJ. 2002. Genome sequence of Streptococcus mutans 603

UA159, a cariogenic dental pathogen. Proc. Natl. Acad. Sci. USA. 99:14434-14439. 604

31. Klein, MI, Bang S, Flório FM, Höfling JF, Gonçalves RB, Smith DJ, Mattos-605

Graner RO. 2006. Genetic diversity of competence gene loci in clinical genotypes of 606

Streptococcus mutans. J. Clin. Microbiol. 44:3015-3020. 607

32. Lemos, JC, RA. Burne. 2002. Regulation and physiological significance of ClpC 608

and ClpP in Streptococcus mutans. J. Bacteriol. 184:6357-6366. 609

33. Aikawa C, Furukawa N, Watanabe T, Minegishi K, Furukawa A, Eishi Y, 610

Oshima K, Kurokawa K, Hattori M, Nakano K, Maruyama F, Nakagawa I, 611

Ooshima T. 2012. Complete genome sequence of the serotype k Streptococcus 612

mutans strain LJ23. J. Bacteriol. 194:2754-2755. 613

34. Biswa S, Biswas J. 2012. Complete genome sequence of Streptococcus mutans GS-5, 614

a serotype c strain. J. Bacteriol. 194:4787-4788. 615

35. Maruyama F, Kobata M, Kurokawa K, Nishida K, Sakurai A, Nakano K, 616

Nomura R, Kawabata S, Ooshima T, Nakai K, Hattori M, Hamada S, Nakagawa 617

I. 2009. Comparative genomic analyses of Streptococcus mutans provide insights into 618

chromosomal shuffling and species-specific content. BMC Genomics. 5:310-358. 619

36. van de Rijn I, Kessler RE. 1980. Growth characteristics of group A streptococci in a 620

new chemically defined medium. Infect Immun. 27:444-448. 621


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

27

37. Lau PCY, Sung CK, Lee JH, Morrison DA, Cvitkovitch DG. 2002. PCR ligation 622

mutagenesis in transformable streptococci: application and efficiency. J. Microbiol. 623

Methods 49:193-205. 624

38. Ouyang J, Tian XL, Versey J, Wishart A, Li YH. 2010. The BceABRS four-625

component system regulates bacitracin-induced cell envelope stress response in 626

Streptococcus mutans. Antimicrob. Agents Chemother. 54:3895-3906. 627

39. Dunny GM, Lee LN, LeBlanc DJ. 1991. Improved electroporation and cloning 628

vector system for gram-positive bacteria. Appl. Environ. Microbiol. 57: 1194-1201. 629

40. Karimova G, Pidoux J, Ullmann A, Ladant D. 1998. A bacterial two-hybrid 630

system based on a reconstituted signal transduction pathway. Proc. Natl. Acad. Sci. 631

U. S. A. 95:5752–5756. 632

41. Yamashita Y, Shibata Y, Nakano Y, Tsuda H, Kido N, Ohta M, Koga T. 1999. A 633

novel gene required for rhamnose-glucose polysaccharide synthesis in Streptococcus 634

mutans. J. Bacteriol. 181: 6556-6559. 635

42. Merritt J, Qi FX, Shi WY. 2005. A unique nine-gene comY operon in Streptococcus 636

mutans. Microbiol. 151:157-166. 637

43. Battesti A, Gottesman S. 2013. Roles of adaptor proteins in regulation of bacterial 638

proteolysis. Curr. Opin. Microbiol. 16:140-147. 639

44. Zhou Y, Gottesman S, Hoskins JR, Maurizi MR, Wickner S. 2001. The RssB 640

response regulator directly targets jS for degradation by ClpXP. Gene Dev. 15:627-641

637. 642

45. Frees D, Savijoki K, Varmanen P, Ingmer H. 2007. Clp ATPases and ClpP 643

proteolytic complexes regulate vital biological processes in low GC, Gram-positive 644

bacteria. Mol. Microbiol. 63:1285–1295. 645

646

647

648

649

650

651

652


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

28

FIGURE LEGENDS 653

Figure 1. A proposed model describing the competence regulatory network in S. mutans. 654

The key step of competence development in S. mutans is the transcriptional activation of 655

comX, which is regulated by two quorum-sensing signaling systems, the ComCDE and 656

the ComRS. These signaling systems along with their dedicated signaling peptides, CSP 657

and XIP are described. In a complex medium (CM), CSP interacts with the ComDE that 658

activate the transcription of comX by an unknown mechanism, triggering the competence 659

cascade in less than 10% of the population. In CDM medium (CDM), the ComRS system 660

senses XIP inside the cell after its internalization by an oligopeptide permease transporter 661

Opp. Once internalized, the XIP interacts with ComR to form a ComR/XIP complex, 662

which binds to the ComR-box and activates transcription of comX and comS, triggering 663

the competence cascade in nearly all cells of the population. However, a low level of 664

SigX can be sequestrated by MecA-mediated formation of a ternary SigX-MecA-ClpC 665

complex, which further interacts with ClpP for degradation of SigX. 666

Figure 2. Luciferase reporter activities (RLU/OD600) of competence-specific promoters 667

PcomX, PcomY and PcinA in S. mutans wild type backgrounds (MecA+), XT-Lx1, XT-Lx2, 668

XT-Lx3, and the MecA-deficient strains (MecA−), XT-Lx4, XT-Lx5, XT-Lx6, grown in 669

THYE medium. (A) Bacterial growth (open symbols) and specific luciferase activities 670

(black symbols) of PcomX-luxAB reporter strains of MecA+ background (triangles) and 671

MecA− background (circles). (B) Bacterial growth (open symbols) and specific luciferase 672

activities (black symbols) of PcomY-luxAB reporter strains of MecA+ background 673

(triangles) and MecA− background (circles). (C) Bacterial growth (open symbols) and 674

specific luciferase activities (black symbols) of PcinA-luxAB reporter strains of MecA+ 675

background (triangles) and MecA− background (circles). 676


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

29

Figure 3. Kinetics of genetic transformation in S. mutans strains grown in THYE with 677

addition of CSP (A) or in CDM with addition of XIP (B). S. mutans UA159 (wt), XT-D1 678

(comX–, negative control), XT-D4 (mecA

–), XT-CpMecA (mecA complementation) and 679

JL-clpC (clpC–) were grown in either THYE or CDM. Following addition of CSP or XIP, 680

half milliliter samples were withdrawn in duplicate at 15-min intervals and exposed to a 681

transforming DNA at 37°C for 15 min followed by treatment of 10 ng/ml DNase I for 682

additional 45 min. The cell suspensions were serially diluted and spread on THYE plates 683

plus an appropriate antibiotic for selection of transformants and on THYE plates for total 684

viable cell counts. The data were then plotted. 685


of PcomX, PcomY or PcinA in S. mutans wild type strains (MecA+) and the MecA-deficient 687

strains (MecA−) grown in CDM. (A) Bacterial growth (open symbols) and specific 688

luciferase activities (black symbols) of PcomY-luxAB reporter strains of MecA+ background 689

(triangles) and MecA− background (circles). (B) Bacterial growth (open symbols) and 690

specific luciferase activities (black symbols) of PcinA-luxAB reporter strains of MecA+ 691

background (triangles) and MecA− background (circles). (C) Bacterial growth (open 692

symbols) and specific luciferase activities (black symbols) of PcomX-luxAB fusion strain of 693

MecA+ background (triangles) and MecA

− background (circles). 694


PcomX, PcomY and PcinA in S. mutans wild type strains (ClpC+) and the ClpC-deficient 696

strains (ClpC−), XT-Lx7, XT-Lx8, XT-Lx9, grown in THYE. (A) Bacterial growth (open 697

symbols) and specific luciferase activities (black symbols) of PcomX-luxAB reporter strains 698

of ClpC+ background (triangles) and ClpC

− background (circles). (B) Bacterial growth 699


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

30

(open symbols) and specific luciferase activities (black symbols) of PcomY-luxAB reporter 700

strains of ClpC+ background (triangles) and ClpC

− background (circles). (C) Bacterial 701

growth (open symbols) and specific luciferase activities (black symbols) of PcinA-luxAB 702

reporter strains of ClpC+ background (triangles) and ClpC

− background (circles). 703

Figure 6. Western analysis of the cellular levels of SigX protein in the S. mutans strains 704

that harbored a shuttle vector pSigX-His using the anti-His antibody. All the S. mutans 705

strains were grown in THYE to induce competence with (+) or without (–) addition of 706

CSP. The crude protein extracts were prepared from the cultures of these strains growing 707

in the mid-log phase (≈ 0.5 at OD600), approximately one hour following addition of CSP. 708

Before probed with the anti-His antibody, the membrane was cut as two: the upper part 709

stained with Ponceau S solution as a protein loading control and the lower part containing 710

the SigX-His analyzed by Western blot using the anti-His antibody. WT: XT-His1; 711

MecA–: XT-His2; ClpC

–: XT-His3. 712

Figure 7. Bacterial two hybrid assays showing two-hybrid interactions between different 713

protein partners. (A) Interactions of MecA-SigX, MecA-ClpC and SigX-ClpC were 714

assayed on MacConkey indicator plate with 1% maltose. All the plates were incubated at 715

30°C for 36 h before assessment of color changes. (B) Interactions of MecA-SigX, 716

MecA-ClpC and SigX-ClpC were assayed on LB plates plus X-gal and IPTG. T18 and 717

T25 correspond to the empty vectors pUT18 (or pUT18C) and pKT25 (or pKNT25), 718

respectively. (C) Interactions of ClpP-SigX, ClpP-MecA, ClpP-ClpC and MecA-SigX 719

were also assayed on MacConkey indicator plates with 1% maltose. (D) Summary of 720

interactions between the interacting hybrid protein partners detected by B2H assays. The 721

arrows indicate positive interactions. 722


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

31

Table 1 Bacterial Strains and Plasmids used in This Study 723

Strain Relevant Characteristics Source or

Reference

S. mutans

UA159 Wild type, the genome sequence reference strain 30

XT-D1 UA159 but ΔcomX::spec, Specr This study

XT-D2 UA159 but ΔcomX::kan, Kanr This study

XT-D3 UA159 but ΔmecA::erm, Ermr This study

XT-D4 UA159 but ΔmecA::spec, Specr This study

JL-clpC UA159 but ∆clpC::kan, Kanr 32

JL-clpP UA159 but ∆clpP::kan, Kanr 32

XT-D5 UA159 but ∆mecA::spec, ΔcomX::kan, Specr, Kan

r This study

XT-D6 UA159 but ∆clpC::kan, ΔcomX::spec, Kanr, Spec

r This study

XT-CpMecA XT-D3 carrying pCpMecA, Emr, Spec

r This study

XT-Lx1 UA159 carrying pWAR304 (PcomX::luxAB), Emr, This study

XT-Lx2 UA159 carrying pYH-PcomY (PcomY::luxAB), Emr, This study

XT-Lx3 UA159 carrying pYH-PcinA (PcinA::luxAB), Emr, This study

XT-Lx4 XT-D4 carrying pWAR304 (PcomX::luxAB), Emr, Spec

r This study

XT-Lx5 XT-D4 carrying pYH-PcomY (PcomY::luxAB), Emr, Spec

r This study

XT-Lx6 XT-D4 carrying pYH-PcinA (PcinA::luxAB), Emr, Spec

r This study

XT-Lx7 JL-clpC carrying pWAR304 (PcomX::luxAB), Emr, Kan

r This study

XT-Lx8 JL-clpC carrying pYH-PcomY (PcomY::luxAB), Emr, Kan

r This study

XT-Lx9 JL-clpC carrying pYH-PcinA (PcinA::luxAB), Emr, Kan

r This study

XT-Lx10 XT-D5 carrying pYH-PcomY (PcomY::luxAB), Emr, Spec

r, Kan

r, This study

XT-Lx11 XT-D5 carrying pYH-PcinA (PcinA::luxAB), Emr, Spec

r, Kan

r, This study

XT-His1 UA159 carrying pSigX-His, Specr This study

XT-His2 XT-D3 carrying pSigX-His, Emr, Spec

r This study

XT-His3 JL-clpC carrying pSigX-His, Kanr, Spec

r This study

E. coli

DH5α Cloning host Invitrogen

XL1-blue Cloning host Stratagene

BTH101 Adenylate cyclase deficient (cya) reporter strain Euromedex

Plasmids

pUT18 pUC19 containing T18 fragment of CyaA under the control of the

Plac promoter for in-frame X-T18 fusions, Ampr

Euromedex

pUT18C pUC19 containing T18 fragment under the control of the Plac

promoter for in-frame T18-X fusions, Ampr

Euromedex

pKT25 pSU40 containing T25 fragment of CyaA under the control of the

Plac promoter for in-frame T25-X fusions, Kanr

Euromedex

pKNT25 pSU40 containing T25 fragment of CyaA under the control of the

Plac promoter for in-frame X-T25 fusions, Kanr

Euromedex

pXT18-1 pUT18-Plac-mecA-cyaA, ampr, MecA-T18 fusion protein This study


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

32

pXT18-2 pUT18C-Plac-cyaA-mecA, ampr, T18-MecA fusion protein This study

pXT25-1 pKT25-Plac-cyaA-mecA, kanr, T25-MecA fusion protein This study

pXT25-2 pKNT25-Plac-mecA-cyaA, kanr, MecA-T25 fusion protein This study

pXT18-3 pUT18-Plac-comX-cyaA, ampr, SigX-T18 fusion protein This study

pXT18-4 pUT18C-Plac-cyaA-comX, ampr, T18-SigX fusion protein This study

pXT25-3 pKT25-Plac-cyaA-comX, kanr, T25-SigX fusion protein This study

pXT25-4 pKNT25-Plac-comX-cyaA, kanr, SigX-T25 fusion protein This study

pXT18-5 pUT18-Plac-clpC-cyaA, ampr, ClpC-T18 fusion protein This study

pXT18-6 pUT18C-Plac-cyaA-clpC, ampr, T18-ClpC fusion protein This study

pXT25-5 pKT25-Plac-cyaA-clpC, kanr, T25-ClpC fusion protein This study

pXT25-6 pKNT25-Plac-clpC-cyaA, kanr, ClpC-T25 fusion protein This study

pXT18-7 pUT18-Plac-clpP-cyaA, ampr, ClpP-T18 fusion protein This study

pXT18-8 pUT18C-Plac-cyaA-clpP, ampr, T18-ClpP fusion protein This study

pXT25-7 pKT25-Plac-cyaA-clpP, kanr, T25-ClpP fusion protein This study

pXT25-8 pKNT25-Plac-clpP-cyaA, kanr, ClpP-T25 fusion protein This study

pWAR303 A shuttle vector containing promoterless luxAB, Emr 10

pWAR304 pWAR303 having a fusion of PcomX::luxAB, Emr 10

pYH-PcomY pWAR303 having a fusion of PcomY::luxAB, Emr This study

pYH-PcinA pWAR303 having a fusion of PcinA::luxAB, Emr This study

pCpMecA pDL277::mecA and its promoter region, Specr This study

pDL276 E. coli-Streptococcus shuttle vector, Kanr 39

pDL277 E. coli-Streptococcus shuttle vector, Specr 39

pET-21b(+) E. coli expression vector, Ampr Novagen

pET21bSigX pET21b::comX, Ampr This study

pSigX-His pDL277::SigX-His, Specr This study

724

725

726

727

728

729

730

731

732

733


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

33

Table S2. Primers Used in This Study 734

735

Primers*

Nucleotide Sequence (5’ -> 3’)

Purpose

∆comX-P1

∆comX-P2

∆comX-P3

∆comX-P4

GTTGGTAGTAGCGCATGACTG

GGCGCGCCTTGTTGCCAATCTTCACGAG

GCTGGCCGGCCCACTTTTTGGGAAGGCAAAG

GGTTCTACAATTTCACCTTTACCTG

comX

mutation

∆mecA-P1

∆mecA-P2

∆mecA-P3

∆mecA-P4

CCATCAAGGTGTTGAACCGC

GGCGCGCCCTTTCAGGCAAGTCCAGCTCATCC

GCTGGCCGGCCCGCTGGTAGAGGAACAAAGACACG

GACAACAGCAACTGCCGTTG

mecA

mutation

Erm-P1

Erm-P2

GGCGCGCCCCGGGCCCAAAATTTGTTTGAT

GCTGGCCGGCCAGTCGGCAGCGACTCATAGAAT

Erm

marker

Spec-P1

Spec-P2

GGCGCGCCACTAATAACGTAACGTGACTGGC

GCTGGCCGGCCAAGTAGTTTCCGATATGGACGAG

Spec

marker

Kan-P1

Kan-P2

GGCGCGCCGACGAAGAGGATGAAGAGGATG

GCTGGCCGGCCAAGTAGTTTCCGATATGGACGAG

Kan

marker

CpMecA-F

CpMecA-B

CGGGATCCAGGTGGTATTTTGCTGGGAACC

GGAATTCCCGCATTTGGATTATCAACTGCC

Compl.

mecA

PcomY-KpnI-F

PcomY-PstI-B

GGGGTACCCGTGGTGGTTTTTAGATGATTG

AACTGCAGCGTGCTTTATTTTGAACAGCTTC

luxAB

reporter

PcinA-KpnI-F

PcinA-PstI-B

GGGGTACCCGGTCTTGGGTGAACTTTACAC

AACTGCAGCGTTCCAACAGCAATGATCTCAG

lucAB

reporter

MecA-XbaI-F

MecA-KpnI-B

GCTCTAGAGATGGAAATGAAACAAATCAGC

GGGGTACCCGGTATCATCTAGCTTATCCAATC

B2H

ComX-XbaI-F

ComX-KpnI-B

GCTCTAGAGATGGAAGAAGATTTTGAAATTG

GGGGTACCCGGTACAATCACATGTTCCATTC

B2H

ClpC-XbaI-F

ClpC-KpnI-B

GCTCTAGAGATGACCGATTACTCATTAAA

GGGGTACCCGACACTGAAGTAGGGTAAAG

B2H

ClpP-XbaI-F

ClpP-KpnI-B

GCTCTAGAGATGATTCCTGTAGTTATTGA

GGGGTACCCCATGGTTTTTCTACTCAAC

B2H

pUT18-5’

pKT25-5’

BACTH-RV2

GAGCAGATTGTACTGAGAGTG

CTGCGCAACTGTTGGGAAGG

GGAAACAGCTATGACCATG

B2H

validation

Xhis-EcoRI-F

Xhis-NotI-B1

Xhis-SphI-B2

CGGAATTCATTGTATTGAGTTGAATCGG

AAGCGGCCGCGTATTTTTCCTTAAAATCACTTAAT

ACATGCATGCCAAAAAACCCCTCAAGAC

SigX-His

736 *: The engineered restriction sites are underlined: GGCGCGCC, AscI; GGCCGGCC, FseI; 737

GGATCC, BamHI; GAATTC, EcoRI; TCTAGA, XbaI; GGTACC, KpnI; CTGCAG: PstI; 738

GCGGCCGC, NotI; GCATGC, SphI. 739


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

740


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

CSP

ComAB

ATP

CSP

ComDXIP

Opp

P-

ATPADP

ATPADP

ComE

?ComR

ComS

X

?

?comCclpB

active in CM

inactive in CDM

comXcomR comSnlmAB

immB

ClpC MecA

SigX (ıX)

cinA-recA

comED

Bacteriocins ClpP

ıX

comYA-D

Competence Degradation


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

2000

2500

0.8

1A

2000

2500

0.8

1

B

2000

2500

0.8

1C

500

1000

1500

0.2

0.4

0.6

OD

59

0

500

1000

1500

0.2

0.4

0.6

OD

59

0

500

1000

1500

0.2

0.4

0.6

OD

59

0

0

0 100 200 300

Time (min)

0 0

0 100 200 300

Time (min)

0 0

0 100 200 300

Time (min

0


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

10A100

B

0.1

1

UA159 (wt)

XT-D1 (comX-)1

10

UA159 (wt)

XT D1 (comX )

0.01

XT-D4 (mecA-)

XT-CpMecA

JL-clpC (clpC-)

0.1

1 XT-D1 (comX-)

XT-D4 (mecA-)

XT-CpMecA

JL-clpC (clpC-)

0.001

0 50 100 150 200 250

Time (min)

0.01

0 50 100 150 200 250

Time (min)


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

1500

2000

2500

0.6

0.8

1

59

0

A

1500

2000

2500

0.6

0.8

1

59

0

B

1500

2000

2500

0.6

0.8

1

90

C

0

500

1000

0 100 200 300

0

0.2

0.4

OD

5

0

500

1000

0 100 200 300

0

0.2

0.4 OD

0

500

1000

0 100 200 300

0

0.2

0.4

OD

59

0 100 200 300

Time (min

0 100 200 300

Time (min

0 100 200 300

Time (min)


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

B 2500 1C

1500

2000

2500

0.6

0.8

1

D590

A

1500

2000

2500

0.6

0.8

1

OD59

B

1500

2000

2500

0.6

0.8

1

OD

590

C

0

500

1000

0 100 200 300

0

0.2

0.4

O

0

500

1000

0 100 200 300

0

0.2

0.4

0

500

1000

0 100 200 300

0

0.2

0.4

O

0 100 200 300

Time (min)Time (min)

0 100 200 300

Time (min)


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

CSP – + – + – +

Strains WT MecA- ClpC-


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

MecA-T18 T18-MecAT18

MecA-T25 T25-MecAT25A. B. T25

SigX-T25

T25-SigX

SigX-T18

T18-SigXg

T25-ClpC

ClpC-T25

g

T18 Cl C

ClpC-T18

T18

T25-ClpC T18-ClpC

ClpP-T18/ MecA-T25/C DT18-ClpP T25-MecA

S

C.

SigX-T25 SigX-T18

S

D.

SigX ClpC

ClpC-T25

T25-SigX T18-SigX

ClpP-T18

MecA

T25-ClpC T18-ClpP ClpP


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

4 xiao-lin tian downloaded from //jb.asm.org/content/jb/early/2013/09/09/jb.00821-13.full.pdf · 70...

Documents