7/29/2019 6.doc (1)

1/5

O R I G I N A L A R T I C L E

Screening and evaluation of probiotics as a biocontrolagent against pathogenic Vibrios in marine aquacultureA.V. Ravi1, K.S. Musthafa1, G. Jegathammbal1, K. Kathiresan2 and S.K. Pandian1

1 Department of Biotechnology, Alagappa University, Karaikudi, Tamil Nadu, India

2 CAS in Marine Biology, Annamalai University, Parangipettai, Tamil Nadu, India

Introduction

Aquaculture is the worlds fastest growing food-produc-

tion sector, with cultured shrimps and prawns (Suba-

singhe et al. 1998). However, there is a serious problem

with microbial disease outbreaks, leading to an annual

global loss of about US$3 billion in the shrimp-culture

industry alone (Lundin 1996). A major bacterial disease

of shrimps is vibriosis, which is caused by Vibrio species

that also indirectly affects the shrimps health by affect-

ing the water quality and stress (Lightner 1996; Sung

et al. 2001). Conventional approaches, such as the use of

disinfectants and antimicrobial drugs to control diseases,

have had limited success in the prevention or cure of

aquatic diseases. The massive usage of commercially

available antibiotics results in natural emergence of

antibiotic-resistant bacteria, which can transfer their

resistance genes to other bacteria that have never been

exposed to the antibiotics (Austin et al. 1995; Moriarty

1997). This has led to suggesting the usage of nonpatho-

genic bacteria as probiotic biocontrol agents instead of

antibiotics (Fuller 1978; Gatesoupe 1999; Mishra et al.

2001). A few species of bacteria, such as lactic acid

bacteria and Bacillus species, which constitute a large

part of microflora of gills, skin and intestinal tracts of

shrimps, are attempted as probionts against fish and

shellfish pathogenic bacteria (Skjermo and Vadstein

1999; Rengipipat et al. 2000). This probiotic approach to

disease control is not used much in shrimp larval

culture, and there are only a few reports on probiotics.

The present investigation has been made to screen pro-

bionts from marine samples against pathogenic Vibrios

isolated from infected fish and to evaluate the potential

of probiont in vivo and in vitro.

Keywords

Bacillus cereus, Paenibacillus polymyxa,

Penaeus monodon, probiotic, shrimp culture,

Vibrio.

Correspondence

A. Veera Ravi, Department of Biotechnology,

Alagappa University, Karaikudi 630 003,Tamil Nadu, India.

E-mail: aveeraravi@rediffmail.com

20070079: received 18 January 2007,

revised 30 March 2007 and accepted 2 April

2007

doi:10.1111/j.1472-765X.2007.02180.x

Abstract

Aims: The present work aims at finding potential probionts from marine

sources as a biocontrol agent against pathogenic Vibrio species in shrimp larval

culture.

Methods and Results: A total of 109 bacterial strains were isolated from sea-

water, sediment and marine fish-gut samples, and were screened for their ant-

agonistic activity against Vibrio species. Three strains (Q, Q1 and M) isolated

from the marine sediment were found antagonistic against Vibrio strains. Based

on 16S ribosomal DNA gene sequence analysis, the strain Q was identified as

Paenibacillus spp. (EF012164); Q1 as Bacillus cereus (DQ915582); and the M as

Paenibacillus polymyxa (DQ915580). Further, the two bacterial species, Paeniba-

cillus spp. and B. cereus were challenged separately at two different concentra-

tions of 104 and 105 CFU ml)1 for probiotic activity in the postlarvae of

Penaeus monodon against pathogenic Vibrio harveyi and Vibrio spp.

Conclusions: The present study identified the probiotic activity of Paenibacillus

spp., B. cereus and Pa. polymyxa against the pathogenic Vibrios in the postlar-

vae of P. monodon.

Significance and Impact of the Study: In vivo study reveals that the marine

bacterial species can be used as probionts against pathogenic Vibrios in shrimplarval culture practices.

Letters in Applied Microbiology ISSN 0266-8254

2007 The Authors

Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 219

7/29/2019 6.doc (1)

2/5

Materials and methods

Target pathogens

Two strains of Vibrio harveyi (MTCC 3438) and Vibrio

vulnificus (MTCC 1145) were obtained from the Insti-

tute of Microbial Technology, Chandigarh, India. Thethird strain was isolated from the skin mucus of infected

marine fish (Hemirhampus far) and identified as Vibrio

species by growing on thiosulphate citrate bile salts

sucrose agar medium (HiMedia, Mumbai, Maharastra,

India) followed by biochemical analysis (Laurent et al.

2000). All the three Vibrio strains were used as target

organisms, against which the probiotic bacteria were

screened for antagonistic activity.

Primary screening by replica plate method

The probiotic bacteria were isolated from seawater, sedi-

ment and gut content of healthy fish (Lates calcarifer).

The seawater and sediment samples were collected from

Point Calimere, located in the Bay of Bengal (Lat.

1018N and Long. 7952E). The seawater samples were

collected using Niskin water sampler, the sediment sam-

ples by using Peterson crab, and the samples were

brought to the laboratory aseptically in an insulated con-

tainer at 4C. The fish gut content was aseptically

removed from a live healthy fish obtained from a com-

mercial fish form. The samples were serially diluted, pla-

ted on Zobell marine agar (ZMA; Hi Media, India) and

incubated at room temperature for 2448 h. The colonies

from ZMA were replica plated on the Muller Hinton agarmedium (MHA; Hi Media, India) swabbed against target

bacterial strains and incubated at room temperature for

24 h. The colonies showing the zone of clearance against

the target Vibrio strains were maintained separately in

pure cultures (Mette et al. 2004).

Well-diffusion agar assay

The potential probionts (Q, Q1 and M) were further tes-

ted for their reproducible antagonistic activity in a well-

diffusion agar against the target strains (Mette et al.

2004). The test Vibrio strains were grown overnight at

37C in a medium containing alkaline peptone water pre-

pared in 10 g l)1 (pH 78 02), and these strains at the

cell density of 104 CFU ml)1 were seeded in three con-

centrations (10, 50 and 100 ll) with 10 ml of MHA med-

ium in the Petri plates. In this medium, wells with a

diameter of 3 mm were made and filled with 10 ll of live

suspension of probiotic culture with cell density of

105 CFU ml)1 that had already grown in marine nutrient

broth at room temperature. The Petri plates were incuba-

ted at room temperature (28 1C) for 24 h and

observed for the zone of clearance.

Molecular characterization of probiont

The DNA of three probionts, such as Q, Q1 and M, was

extracted by alkaline lysis method (Ausubel et al. 1990),and 16S rDNA was amplified by using eubacterial univer-

sal primers, namely forward primer 5 AGA-

GTTTGATCCTGGCTCAG 3 and reverse primer 5

ACGGCTACCTTGTTACGACTT 3(Andrew et al. 2001).

PCR was performed with a 50-ll reaction mixture con-

taining 2 ll (10 ng) of DNA as the template, each primer

at a concentration of 05 lmol l)1, 15 mmol l)1 of MgCl2and each deoxynucleoside triphosphate at 50 lmol l)1, in

addition to 1 U of Taq DNA polymerase along with buffer

as recommended (MBI Fermentas, Hanover, MD, USA).

After the initial denaturation for 45 min at 95C, there

were 40 cycles consisting of denaturation at 95C for

1 min, annealing at 55C for 1 min and extension at 72C

for 2 min and final extension of 5 min at 72C. The

amplification of 16S rDNA was confirmed by running the

amplification product in 1% agarose gel electrophoresis in

1 TAE buffer. The PCR product of 16S rDNA of the iso-

lates was sequenced, and further comparison was made

with previously available sequences in NCBI (National

Center for Biotechnology Information) using BLAST

(Basic Local Alignment Search Tool).

In vivo inhibition of pathogenic Vibrio

Hatchery-reared postlarvae of Penaeus monodon wereacclimatized under laboratory conditions for 24 h and fed

with freshly hatched Artemia salina nauplii. They were

introduced into four sets of troughs in triplicates, each

filled with filtered seawater, salinity maintained at 10 ppt,

pH at 78 02 and temperature at 30C. Set 1 was

inoculated with probionts at 104 and also 105 CFU ml)1

in rearing medium to facilitate their attachment and col-

onization on the larvae for 24 h. The concentration of the

probiotic strains was chosen based on the results obtained

in the well-diffusion agar assay. The probiont-treated lar-

vae after 1 day were then exposed to pathogenic Vibrio

strains at 104 CFU ml)1 for 1 h. Set 2 was inoculated

with pathogenic Vibrio strains alone at 104 CFU ml)1 in

rearing medium to serve as positive control. Set 3 was

inoculated with probionts alone at 104 and 105 CFU ml)1

to rearing medium to check whether the probiont was

pathogenic to larvae or not. Set 4 received no bacterial

inoculum and served as control. The CFU ml)1 in the

overnight culture of potential probionts and pathogenic

Vibrio strains were standardized from OD measurements

at 540 nm (UV-Vis Spectrophotometer U-2800; Hitachi,

Probiotics as a biocontrol agent A.V. Ravi et al.

220 Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 2007 The Authors

7/29/2019 6.doc (1)

3/5

Tokyo, Japan). Mortality in each set was recorded for

5 days and no water exchange was made during that per-

iod (Abraham 2004).

Results

Screening for antagonistic strains

The primary screening of 109 strains, isolated from sea-

water, sediment and gut content of healthy fish, revealed

that only three strains (Q, Q1 and M) isolated from mar-

ine sediments exhibited antagonistic activity against all

the Vibrio strains. Further confirmation on the antagonis-

tic potential of those three strains against V. harveyi, Vib-

rio spp. and V. vulnificus was made using well-diffusion

agar assay. Two strains Q and Q1 were observed to dis-

play the maximum antagonistic activity against the

V. harveyi and Vibrio spp., and they were further tested

for their potential in vivo (Table 1).

16S rDNA sequence analysis of probiont

The active probiotic bacterial isolates were subjected to

the 16S rDNA sequence analysis and identified the probi-

ont Q as Paenibacillus spp., Q1 as Bacillus cereus and M

as Paenibacillus polymyxa.

Challenging test of probiont with the postlarvae

of Penaeus monodon

The in vivo mortality of the larvae after treatment with or

without probionts Paenibacillus spp. and B. cereuschallenged against Vibrios were observed for 5 days

(Figs 1 and 2). The pathogenic Vibrio strains in the

absence of probionts caused total mortality of the larvae.

However, the larvae treated with probiont B. cereus

against V. harveyi exhibited a mortality of 373% at

104 CFU ml)1 and 403% at 105 CFU ml)1. The larvae

treated with probiont Paenibacillus spp. against V. harveyi

showed a mortality of 303% at 104 CFU ml)1 and 343%

at 105 CFU ml)1. When they were treated with probiont

B. cereus against Vibrio spp., the mortality was 227% at

104 CFU ml)1 and 163% at 105 CFU ml)1. The larvae

treated with probiont Paenibacillus spp. against Vibrio

spp. exhibited the mortality of 15% at 104 CFU ml)1 and

196% at 105 CFU ml)1. Whereas, the probiont Pa.

polymyxa showed least activity against Vibrio spp. and no

activity against the other two pathogens.

Discussion

The present study confirms the potential of probionts in

both in vitro and in vivo conditions to control pathogenic

Vibrios (Table 1, Figs 1 and 2). However, Mette et al.

(2004) have observed a maximum zone of clearance up

to 23 mm when pathogenic bacteria are challenged

against probiotic bacteria in vitro analysis, but in in vivo

assay, most of the probionts are pathogenic themselves to

the larvae of Scophthalmus maximus. Contrary to this, the

bacterial strains of B. cereus and Paenibacillus spp. do not

show any significant pathogenicity to the shrimp larvae in

our studies.

In the present study, total mortality of shrimp larvae

were observed when they were treated with Vibrios alone,

which confirms that the Vibrio strains are highly patho-

genic. When the larvae are pretreated with probiont and

then exposed to Vibrios, their mortality is significantly

(P < 0001) reduced. Two bacterial species, B. cereus and

Paenibacillus spp. exhibit better probiotic activity by con-

ferring the survival of shrimp larvae up to 85% when

treated against Vibrio spp. (Figs 1 and 2). This result

finds support of other workers. Vaseeharan and Ramasa-

my (2003) have recorded 90% reduction in the mortality

of P. monodon adults when challenged by the probiontBacillus subtilis against V. harveyi. A similar effect has

been observed with marine bacterium Alteromonas spp. at

106 CFU ml)1 that protects shrimp larvae of P. monodon

against V. harveyi with 104 CFU ml)1 by reducing the

mortality to 59% (Abraham 2004). Lone et al. (1999)

have observed a significant reduction in the mortality of

25% in rainbow trout (Oncorynchus mykiss) against Vibrio

anguillarum after pretreatment with Pseudomonas fluores-

cens AH2. Furthermore, similar effects have been observed

with beneficial marine bacteria in protecting the embryos

Table 1 Antagonistic activity of probiotic strains (M, Q and Q1) as zone of clearance in mm against different concentrations (ll) of Vibrios inwell-diffusion agar assay

Probiont

Vibrio spp. Vibrio harveyi Vibrio vulnificus

10 50 100 10 50 100 10 50 100

M 1133 115 1466 057 14 10

Q 1033 057 1133 057 20 00 10 00 1166 057 1466 057 0825 026 0887 087 10 00

Q1 2166 057 3466 057 33 173 2633 115 3133 23 2633 115 2105 054 2235 078 2066 115

Values are mean SD for three observations; , no probiotic activity.

A.V. Ravi et al. Probiotics as a biocontrol agent

2007 The Authors

Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 221

7/29/2019 6.doc (1)

4/5

of Homarus americanus (Gil and Fenical 1992), oyster lar-

vae (Douillet and Langdon 1994), larvae and adults of

penaeid shrimps (Maeda and Liao 1992; Maeda 1994;

Abraham et al. 2001).

The antagonistic effect of probionts can be attributed

to the bioactive compounds produced by them to inhibit

the pathogens. In the present study, probionts, such as

Paenibacillus spp. and B. cereus, exhibit zone of clearance

against pathogenic Vibrios on diffusion agar plates. This

demonstrates the production of antibacterial compounds

that diffused through the agar inhibiting the growth of

Vibrios. Previous workers have established that antimicro-

bial compounds are produced by probionts (Vaseeharan

and Ramasamy 2003; Mette et al. 2004). Further, it is

pertinent to note that the species of Paenibacillus, like Pa.

polymyxa and Paenibacillus thiaminolyticus produce

antibacterial compounds, such as polymyxin, octopytin

and baciphelacin (Slepecky and Hemphill 1992) and

Paenibacillus koreensis also produces an iturin-like anti-

fungal compound (Chung et al. 2000). Similarly, B. cereus

produces antibacterial compounds, like zwittermicin-A

and kanosamine (Jocelyn et al. 1996).

The result reveals that strains of Paenibacillus spp. and

B. cereus are effective in inhibiting the shrimp larval path-

ogens, like Vibrio spp. and V. harveyi both in vitro andin vivo. The probionts significantly (P < 0001) reduce the

mortality and do not have any pathogenic effect on the

shrimp larvae. Therefore, these bacterial probionts can be

used effectively in controlling the shrimp larval pathogen

that may substitute the use of antibiotics in aquaculture

which otherwise causes negative impacts.

Acknowledgements

The authors are thankful to DBTs Bioinformatics Infra-

structure Facility, Alagappa University, for the compu-

tinginternet facilities provided. Ms G. Jegathammbal

acknowledges the financial assistance rendered by the

Tamil Nadu State Council for Science and Technology,

India.

References

Abraham, T.J. (2004) Antibacterial Marine Bacterium Deter

Luminous Vibriosis in Shrimp Larvae. Pp. 34. NAGA,

World Fish Centre Quarterly.

Abraham, T.J., Shanmugam., S.A., Uma, A., Palaniappan, R.

and Dhevendaran, R. (2001) Biocontrol of shrimp bacterial

pathogens using penaeid larvae associated bacterium,

Ateromonas sp. J Aquacult Trop16

, 1122.Andrew, E.A., Melissa, G.B., Marc, E.F., Peter, G.V., Jonathan,

P.Z. and Sabino, Z. (2001) Diversity and detection of

nitrate assimilation genes in marine bacteria. Appl Environ

Microbiol 67, 53435348.

Austin, B., Stuckey, L.E., Robertson, P.A.W., Effendi, I. and

Griffith, D.R.W. (1995) A probiotic strain of Vibrio algino-

lyticus effective in reducing disease caused by Aeromonas

salmonicida, Vibrio anguillarum and Vibrio ordalli. J Fish

Dis 18, 9396.

Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J.

and Struhl, K. (1990) Current Protocols in Molecular Bio-

logy. New York: John Wiley & Sons, Inc.

Chung, Y.R., Chung, H.K., Inhwan, H. and Jongsik, C. (2000)Paenibacillus koreensis sp. nov, a new species that produces

an iturin-like antifungal compound. Int J Syst Evol Micro-

biol 50, 14951500.

Douillet, P.A. and Langdon, C.J. (1994) Use of a probiotic for

the culture of larvae of the pacific oyster (Crassostrea gigas

Thunberg). Aquaculture 119, 2540.

Fuller, R. (1978) Epithelial attachment and other factors con-

trolling the colonization of the intestine of the gnotobiotic

chicken by lactobacilli. J Appl Microbiol 46, 335342.

120

100

80

60

Mortality(%)

40

20

01

Paenibacillus spp. against Vibrio harveyi Paenibacillus spp. against Vibrio spp.2 3 4

Figure 2 Percentage mortality of Penaeus monodon postlarvae when

treated with Paenibacillus spp. at: (1) 104 CFU ml)1 against Vibrio har-

veyi; (2) 105

CFU ml)1

against V. harveyi; (3) 104

CFU ml)1

againstVibrio spp.; and (4) 105 CFU ml)1 against Vibrio spp. ( ), pathogen;

( ), probiont; (+) pathogen; ( ) probiont; ( ) control.

120

100

80

60

M

ortality(%)

40

20

01

Bacillus cereusagainst Vibrio harveyi Bacillus cereusagainst Vibrio spp.2 3 4

Figure 1 Percentage mortality of Penaeus monodon postlarvae after

5 days of treatment with Bacillus cereus at: (1) 104 CFU ml)1 against

Vibrio harveyi; (2) 105 CFU ml)1 against V. harveyi; (3) 104 CFU ml)1

against Vibrio spp.; and (4) 105 CFU ml)1 against Vibrio spp. ( ) ,

pathogen; ( ), probiont; (+) pathogen; ( ) probiont; ( ) control.

Probiotics as a biocontrol agent A.V. Ravi et al.

222 Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 2007 The Authors

7/29/2019 6.doc (1)

5/5

Gatesoupe, F.J. (1999) The use of probiotics in aquaculture.

Aquaculture 180, 147165.

Gil, M.S. and Fenical, W. (1992) Embryos of Homarus americ-

anus are protected by epibiotic bacteria. Biol Bull 182,

105108.

Jocelyn, L.M., Laura, S.S., Julie, C.L., Haiyin, H., Jon, C. and

Jo, H. (1996) Production of kanosamine by Bacillus cereus

UW85. Appl Environ Microbiol 62, 30613065.

Laurent, V., Hanglamong, H., Godelieve, C., Patrick, S. and

Willy, V. (2000) Selected bacterial strains protect Artemia

spp. from the pathogenic effects of Vibrio proteolyticus

CW8T2. Appl Environ Microbiol 66, 11391146.

Lightner, D.V. (1996) A Handbook of Shrimp Pathology and

Diagnostic Procedures for Diseases of Cultured Penaeid

Shrimp. Baton Rouge, LA: World Aquaculture Society.

Lone, G., Jette, M., Bettina, S., Ingrid, H. and Torben, F.N.

(1999) Inhibition of Vibrio Anguillarum by Pseudomonas

fluorescens Ah2, a possible probiotic treatment of fish. Appl

Environ Microbiol 65, 969973.

Lundin, G.G. (1996) Fish health and quarantine. In Global

Attempts to Address Shrimp Disease. p. 45. MarineEnvi-

ronmental Paper No. 4. Land, Water and Natural Habitats

Division, Environment Department, World Bank, Rome.

Maeda, M. (1994) Biocontrol of the larvae rearing biotope in

aquaculture. Bull Natl Res Inst Aquacult 1, 7174.

Maeda, M. and Liao, I.C. (1992) Effect of bacterial population

on the growth of a prawn larvae, Penaeus monodon. Bull

Natl Res Inst Aquacult 21, 2529.

Mette, H., Oivind, B., Ana, R., Janne, N., Jette, M., Sigmund,

J., Haze, D., Peter, A., et al. (2004) Selection and identifi-

cation of autochthonous potential probiotic bacteria from

turbot larvae (Scophthalmus maximus) rearing units. Syst

Appl Microbiol27

, 360371.

Mishra, S., Mohanty, S., Pattnaik, P. and Ayyappan, S. (2001)

Probiotics possible application in aquaculture. Fish

Chimes 21, 3137.

Moriarty, D.J.W. (1997) The role of microorganisms in aqua-

culture ponds. Aquaculture 151, 333349.

Rengipipat, S., Rukpratanporn, S., Piyatiratitivorakul, S. and

Menasaveta, P. (2000) Immunity enhancement in black

tiger shrimp (Penaeus monodon) by a probiont bacterium

(Bacillus S11). Aquaculture 191, 271288.

Skjermo, J. and Vadstein, O. (1999) Techniques for microbial

control in the intensive rearing of marine larvae. Aquacul-

ture 177, 333343.

Slepecky, R.A. and Hemphill, H.E. (1992) The genus Bacillus

nonmedical. In The Prokaryotes ed. Balows, A., Truper,

H.G., Dworkin, M., Harder, W. and Schleifer, K.H. 2nd

edn. Vol. II. pp. 16631696. New York: Springer.

Subasinghe, R., Bartly, D.M., Megladdery, S. and Barg, U.

(1998) Sustainable shrimp culture development: biotech-

nological issues and challenges. In Advances in Shrimp Bio-

technology ed. Flegel, T.W. pp. 1318. Bangkok: National

Centre for Genetic Engineering and Biotechnology.

Sung, H.H., Hsu, S.F., Chen, C.K., Ting, Y.Y. and Chao,

W.L. (2001) Relationship between disease outbreaks in

cultured tiger shrimp (Penaeus monodon) and the compo-

sition of Vibrio communities in pond water and shrimp

hepatopancreas during cultivation. Aquaculture 192,

101110.

Vaseeharan, B. and Ramasamy, P. (2003) Control of patho-

genic Vibrio spp. by Bacillus subtilis BT23, a possible probi-

otic treatment for black tiger shrimp Penaeus monodon.

Lett Appl Microbiol36, 8387.

A.V. Ravi et al. Probiotics as a biocontrol agent

2007 The Authors

Journal compilation 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 45 (2007) 219223 223