8.2 structure of dna set up cornell notes on pg. 67 topic: 8.2 structure of dna essential question:...

12
8.2 Structure of DNA •Set up Cornell Notes on pg. 67 •Topic: 8.2 Structure of DNA •Essential Question: Explain the base- pairing rules. How many types of nucleotides are there? How do they differ? •Don’t forget to 2.1 Atoms, Ions, and Molecules Explain the base-pairing rules. How many types of nucleotides are there? How do they differ? 8.2 Structure of DNA Key Concept:DNA structure is the same in all organisms

Upload: kiersten-last

Post on 01-Apr-2015

223 views

Category:

Documents


3 download

TRANSCRIPT

Page 1: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

•Set up Cornell Notes on pg. 67

•Topic: 8.2 Structure of DNA

•Essential Question:

Explain the base-pairing rules. How many types of nucleotides are there? How do they differ?

•Don’t forget to add it to your T.O.Contents!

2.1 Atoms, Ions, and Molecules

Explain the base-pairing rules. How many types of nucleotides are there? How do they differ?

8.2 Structure of DNA

Key Concept:DNA structure is the same in all organisms

Page 2: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

KEY CONCEPT DNA structure is the same in all organisms.

Page 3: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

DNA is composed of four types of nucleotides.• Each nucleotide has three parts.

1. a phosphate group

2. a deoxyribose sugar

3. a nitrogen-containing basephosphate group

deoxyribose (sugar)

nitrogen-containingbase

1

2

3

Covalent bonds

base

backbone

Page 4: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

• The nitrogen containing bases are the only difference in the four nucleotides.

•Thymine- T

•Adenine- A

•Guanine- G

•Cytosine-C

BASES

Page 5: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

Page 6: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

Watson and Crick determined the three-dimensional structure of DNA by building models.

• They realized that DNA is a double helix– backbone on the outside– bases on the inside.

backbone

bases

Page 7: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

• Watson and Crick’s discovery built on the work of Rosalind Franklin and Erwin Chargaff.

– Franklin’s x-ray images suggested that DNA was a double helix of even width.

– Chargaff’s rules stated that A=T and C=G.

Page 8: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

TAC

G

Nucleotides always pair in the same way.

• the helix has a uniform width.– Ex: ladder

– A pairs with T

– C pairs with G

Page 9: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

• The backbone is connected by covalent bonds.

hydrogen bond covalent bond

• The bases are connected by hydrogen bonds.

backbone

Hydrogen bond

Bases (A,T,G,C)

Page 10: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

A

T

CC G

ATG

A

T

G C

Page 11: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

GATTACAATCGATCGATCTAATGTTAGCTAGCTA

TAGGACTACTAGTCGTA

ATCCTGATGATCAGCAT

Using the base pairing rules- complete the DNA strand:

Page 12: 8.2 Structure of DNA Set up Cornell Notes on pg. 67 Topic: 8.2 Structure of DNA Essential Question: Explain the base-pairing rules. How many types of nucleotides

8.2 Structure of DNA

Adenine (A) = GreenThymine (T) = PinkCytosine (C) = YellowGuanine (G) = Orange

Have Your DNA & Eat It Too

* I need to check your work before you eat the DNA!!!!!