a basic review of genetics dr. danny chan associate professor assistant dean (faculty of medicine)...
TRANSCRIPT
![Page 1: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/1.jpg)
A basic review of genetics A basic review of genetics
Dr. Danny ChanAssociate Professor
Assistant Dean (Faculty of Medicine)
Department of Biochemistry Department of Biochemistry The University of Hong KongThe University of Hong Kong
![Page 2: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/2.jpg)
Cells and genesCells and genes
50,000,000,000,000 cells
![Page 3: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/3.jpg)
Nucleus (99.9% of the genes)
Cells and genesCells and genes
Mitochondria (few more genes)
~20, 0000 genes
![Page 4: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/4.jpg)
Genes are on DNAGenes are on DNA
Cytosine
Thymine
Guanine
Adenine
OCH2OO P
O
O-
N
N
O
CH3
OCH2OO P
O
O-
N
N
O
NH2
OCH2OO P
O
O-
H
O
N
N
O
NH2
N
N
OCH2OO P
O
O-
N
N
N
N
NH2
3’
5’
DNA sequence genetic code genes
DDeoxyriboseNNucleicAAcids
![Page 5: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/5.jpg)
Genes determine why we are the way we are!Genes determine why we are the way we are!
![Page 6: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/6.jpg)
Genes are passed on from one Genes are passed on from one generation to the nextgeneration to the next
Genetic traitsGenetic traits
You have inherited genes from your father that make proteins
instructing your hair cells or eye cells to produce hairs and eyes that are the same colours
and shape as your father.
Genetic traits can also be a behavior, feelings, or responses to a given environment
![Page 7: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/7.jpg)
DNA are super-coiled into chromosomesDNA are super-coiled into chromosomes
chromosome
![Page 8: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/8.jpg)
22 pairs of autosomes and 1 pair of sex chromosomes
Human GenomeHuman Genome
Autosomes Sex chromosomes
![Page 9: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/9.jpg)
24 pairs of chromosomes
Other primate chromosome numbersOther primate chromosome numbers
21 pairs of chromosomes
![Page 10: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/10.jpg)
Other speciesOther species
30 pairs of chromosomes
39 pairs of chromosomes
4 pairs of chromosomes
![Page 11: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/11.jpg)
The genome projectsThe genome projects
![Page 12: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/12.jpg)
How similar are we to other species?How similar are we to other species?
~98.5%~93%
![Page 13: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/13.jpg)
How about with other humans?How about with other humans?
~99.5%
What makes us different
from one another?
![Page 14: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/14.jpg)
Variations in DNA sequence or Variations in DNA sequence or PolymorphismsPolymorphisms
• Variable number tandem repeats (VNTRs)
• Microsatellites
• Single nucleotide polymorphisms (SNPs)
• Small insertions and deletions (Indels)
• Copy number variations (CNVs)
![Page 15: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/15.jpg)
Variations in DNA sequence or Variations in DNA sequence or PolymorphismsPolymorphisms
• Variable number tandem repeats (VNTRs)
• Microsatellites
• Single nucleotide polymorphisms (SNPs)
• Small insertions and deletions (Indels)
• Copy number variations (CNVs)
![Page 16: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/16.jpg)
Repeat units of nucleotides 1-6bp in length
The most widely used are the (CA)n microsatellites
CACACACACACACACACACACACA
CACACACACACACACACACACACACACACACA
6 (CA) allele6 (CA) allele
8 (CA) allele8 (CA) allele
MicrosatellitesMicrosatellites
![Page 17: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/17.jpg)
are substitutions, insertions or deletions of a single base
TCGAGAGGCTAGGCTAGGA
TCGAGAGGCCAGGCTAGGASubstitutionSubstitution
T-alleleT-allele
C-alleleC-allele
TCGAGAGGCTTAGGCTAGGA
TCGAGAGGCAGGCTAGGA
InsertionInsertion (+) allele(+) allele
(-) allele(-) allele
Single nucleotide polymorphisms (SNPs)Single nucleotide polymorphisms (SNPs)
deletiondeletion
![Page 18: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/18.jpg)
SNPs arise during DNA replicationSNPs arise during DNA replication
Opportunities for errors
Single base errors/changes create
3 x 109 bases
SNPs SNPs
101077 SNPs SNPs
![Page 19: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/19.jpg)
Genetic differences and similarities Genetic differences and similarities between peoplebetween people
You
Rest of the world
Genetic signature
![Page 20: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/20.jpg)
Some SNPs affect the way we lookSome SNPs affect the way we look
![Page 21: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/21.jpg)
Some affect our susceptibility to diseasesSome affect our susceptibility to diseases
![Page 22: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/22.jpg)
Others affect our response to drugs/painOthers affect our response to drugs/pain
![Page 23: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/23.jpg)
or .. no differences!or .. no differences!
.. in health, personalities or responses to the environment
![Page 24: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/24.jpg)
SNPs affecting gene functionSNPs affecting gene function
mRNA
Gene
t-RNA
Newly synthesized
protein
ProteinAlteredProtein
![Page 25: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/25.jpg)
Protein function and phenotypeProtein function and phenotype
ProteinAlteredProtein
Alteredproteinfunction
AlteredPhenotyp
e
![Page 26: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/26.jpg)
Mum Dad
Hair color Hair color
Height Height
Longevity Longevity
Body fat Body fat
Intelligence Intelligence
Eye color Eye color
A pair of homologous chromosomesA pair of homologous chromosomes
![Page 27: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/27.jpg)
2 sets1 set
1 set
oocyte
SpermSomatic cell
![Page 28: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/28.jpg)
Meiosis I Meiosis II
Diploid cell
Fourhaploid cells
DNAreplication
Homologouschromosome
pairing
Meiosis (making sperm or oocytes)Meiosis (making sperm or oocytes)
![Page 29: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/29.jpg)
Genetic recombination in meiosisGenetic recombination in meiosis
Doubling Cross-over and exchange DNA
Genes get shuffled during recombination
![Page 30: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/30.jpg)
Phenotypes Phenotypes
Observable or measurable traits
Genes + environment
Begins in the womb and continues throughout life
![Page 31: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/31.jpg)
Phenotypes Phenotypes
Differences in some phenotype are determined mostly by genes
Height
How genes influence personality, behavior and perception is less well understood
![Page 32: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/32.jpg)
We can now interrogate SNPs across our genome all at once
Understand how some SNPs are affecting our phenotype
… … from our genomefrom our genome
Genotype-phenotype relationship
Learning more about our phenotypes Learning more about our phenotypes
![Page 33: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/33.jpg)
Correlating genetic variations and diseasesCorrelating genetic variations and diseasesphenotypesphenotypes
• Family linkage analysis
• Case-control association study
Need a large pedigree!Need a large pedigree!
![Page 34: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/34.jpg)
Correlating genetic variations and diseasesCorrelating genetic variations and diseasesphenotypesphenotypes
• Case-control association study
Need a large cohort!Need a large cohort!
![Page 35: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/35.jpg)
• Rare genetic diseases
• Common diseases
![Page 36: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/36.jpg)
Rare genetic diseases Rare genetic diseases
Single gene
Monogenic disorder
Early-onset
Rare
(Osteogenesis imperfecta)
(1:30,000 – 1:70,000)
(prenatal)
![Page 37: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/37.jpg)
An autosomal dominant
disease for which the gene resides on this chromosome
![Page 38: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/38.jpg)
6 (CA) allele CACACACACACA
8 (CA) allele CACACACACACACACA
7 (CA) allele CACACACACACACA
1 (CA) allele CA
2 (CA) allele CACA
3 (CA) allele CACACA…
…
![Page 39: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/39.jpg)
5 65 6 4 74 7 2 32 3
Marker studiedMarker studied
![Page 40: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/40.jpg)
2 32 3 1 51 5 4 44 4
Marker studiedMarker studied
![Page 41: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/41.jpg)
1 51 5 3 53 5 6 76 7
Marker studiedMarker studied
![Page 42: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/42.jpg)
2 42 4 2 52 5 2 72 7
Marker studiedMarker studied
![Page 43: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/43.jpg)
1 31 3 1 21 2 4 54 5
Marker studiedMarker studied
![Page 44: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/44.jpg)
22 4 4 22 5 5 22 7 7
Marker studiedMarker studied
![Page 45: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/45.jpg)
((24)4) ((25)5) ((27))(33)(33) (14)(14)
((23)3)
((26)6) (1(12)) ((26)6)
((24)4)
(16)(16)
(14)(14)
(46)(46)
(34)(34) (13)(13) (58)(58)
(18)(18)
(13)(13) (78)(78)
(18)(18)
(47)(47)
(46)(46) (67)(67)
Genotype other family membersGenotype other family members
The key is to identify a genetic marker that is always inherited by family members with the disease but not
by those who do not have the disease
![Page 46: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/46.jpg)
Disease geneDisease geneGene resides hereGene resides here
Fine mappingFine mapping
Define the region of maximal linkageDefine the region of maximal linkage
Causative mutation!
![Page 47: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/47.jpg)
• The logarithm (in base 10) of the odds of linkage
– the ratio of the likelihood that loci are linked to the likelihood that they are not linked
• A LOD of 3.0 = odds of 1000/1 in favour of linkage
– Equivalent to a 5% chance of error
Logarithm of odds (LOD) scoreLogarithm of odds (LOD) score
Degree of linkageDegree of linkage
![Page 48: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/48.jpg)
• Advantages:– Localization of areas associated with increase
disease risk across the genome
– Can study multiple markers simultaneously
• Disadvantages– Multi-generational cases difficult to recruit with
high mortality conditions
– Difficult to study late-onset diseases/traits
– Difficult to study complex traits
Family linkage studiesFamily linkage studies
![Page 49: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/49.jpg)
Genetics
Many genes may be involved
Environment
Interactions between environment and genes
2 4
1
3
Interaction between genes
(common)
(Risk factors)
Diabetes
Osteoporosis
Osteoarthritis
Alzheimer
Cancer
Complex traitsComplex traits
![Page 50: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/50.jpg)
• Linkage deals with a specific genetic relationship between loci on a chromosome
• Association describes a statistical relationship between genes or genetic variants and the disease/trait of interest
Association study for complex traitsAssociation study for complex traits
![Page 51: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/51.jpg)
Case Control
Large Cohort required
Good phenotype definition
Case-Control Association StudiesCase-Control Association Studies
![Page 52: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/52.jpg)
Allele 1(T)
Allele 2 (A)
Gene A
An example for one SNP in a geneAn example for one SNP in a gene
Case Control
![Page 53: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/53.jpg)
Allele 2 is a possible risk allele
Uneven distribution of the SNP variants indicates an association
Control case association studyControl case association study
Case Control
![Page 54: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/54.jpg)
• Identifies disease susceptibility gene variants by comparing genetic variants between people with and without the disease of interest.
• Any particular association between a genetic variant and a disease does not mean that the variant is important in causation.
Association studiesAssociation studies
![Page 55: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/55.jpg)
“a huge assistance in high throughput mapping of polygenic
diseases and a minor pest”
Linkage disequilibrium (LD)Linkage disequilibrium (LD)
![Page 56: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/56.jpg)
LD relates to recombination eventsLD relates to recombination events
The nonrandom association between alleles in a
population due to their tendency to be co-inherited
because of reduced recombination between them
Hot spots
Cold spots
![Page 57: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/57.jpg)
Gro
up o
f ext
ant
Gro
up o
f ext
ant
chro
mos
omes
chro
mos
omes
Ancestral segmentAncestral segmentNew segment introduced by recombinationNew segment introduced by recombination
MutationMutation
Ancestral Ancestral chromosomechromosome
![Page 58: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/58.jpg)
Gro
up o
f ext
ant
Gro
up o
f ext
ant
chro
mos
omes
chro
mos
omes
Ancestral segmentAncestral segmentNew segment introduced by recombinationNew segment introduced by recombination
MutationMutationSNPsSNPs
Ancestral Ancestral chromosomechromosome
![Page 59: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/59.jpg)
Ancestral segmentAncestral segmentNew segment introduced by recombinationNew segment introduced by recombination
MutationMutation
Ancestral Ancestral chromosomechromosome
Gro
up o
f ext
ant
Gro
up o
f ext
ant
chro
mos
omes
chro
mos
omes
![Page 60: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/60.jpg)
Ancestral Ancestral chromosomechromosome
Polymorphisms within regions Polymorphisms within regions of reduced recombination will of reduced recombination will
mark the same associationmark the same association
Haplotype blockHaplotype block
polymorphic segment of DNA marking an ancestral variantpolymorphic segment of DNA marking an ancestral variant
LD MapLD Map
![Page 61: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/61.jpg)
To identify all common DNA polymorphisms
The International HapMap ProjectThe International HapMap Project
Started October 2002 Define the LD pattern for
different populations
![Page 62: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/62.jpg)
Microsatellites SNPsSNPs
~ 107 to choose from
Using high density of SNPs for disease huntingUsing high density of SNPs for disease hunting
Enhancing mappingAccuracy and speed
![Page 63: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/63.jpg)
Genome wide association scan (GWAS)Genome wide association scan (GWAS)
Now able to assess ~2.5M SNPs in a genome all at once
Various platforms are available for mostly common SNPs (>5 % in the general population)
![Page 64: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/64.jpg)
NHGRI GWA Catalogwww.genome.gov/GWAStudies
Published Genome-Wide Associations through 12/2010, 1212 published GWA at p<5x10-8 for 210 traits
Missing heritabilityMissing heritability
Rare SNPs with strong effect not yet identified?Rare SNPs with strong effect not yet identified?
![Page 65: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/65.jpg)
Next generation sequencingNext generation sequencing
![Page 66: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/66.jpg)
1000 genomes project1000 genomes project
http://www.1000genomes.org
![Page 67: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/67.jpg)
Goal of the 1000 genomes projectGoal of the 1000 genomes project
Rare genetic Rare genetic variantsvariants
Common genetic Common genetic variantsvariants
Diabetes
Osteoporosis
Osteoarthritis
Alzheimer
Cancer
Cystic fibrosis
Huntington disease
Osteogenesis imperfecta
Achondroplasia
Knowledge gap?
discover >95 % ofdiscover >95 % of
SNPs, CNVs, indelsSNPs, CNVs, indels~1% across the genome,0.1-0.5% in gene regions
?
![Page 68: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/68.jpg)
• Small insertions and deletions (indels)
• Copy number variations (CNVs)
• miRNA
• Epigenetic controls
Other variations for considerationOther variations for consideration
Mega load of genetic data will be available .. Mega load of genetic data will be available .. Are we ready with the phenotype information? Are we ready with the phenotype information?
![Page 69: A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry Department of Biochemistry](https://reader036.vdocument.in/reader036/viewer/2022062422/56649ef45503460f94c07ff6/html5/thumbnails/69.jpg)
PhenotypePhenotype
PhenotypePhenotype
PhenotypePhenotype
PhenotypePhenotype
$$
$$$$
$$$$$$
$$$$$$$$$$
GenotypeGenotype
GenotypeGenotype
GenotypeGenotype
GenotypeGenotype