Supplemental Data

A Checkpoint Protein That Scans the

Chromosome for Damage at the Start of

Sporulation in Bacillus subtilis

Michal Bejerano-Sagie, Yaara Oppenheimer-Shaanan, Idit Berlatzky, Alex Rouvinski, Mor Meyerovich, and Sigal Ben-Yehuda

Figure S1. Mitomycin C (MMC) Activates the DisA DNA-Damage Checkpoint

Response

(A) Strains were induced to sporulate in DS sporulation medium for 24 h. The

percentage of sporulation was determined as the ratio of heat-resistant colony-forming

units to the total colony-forming units. The percentage of sporulation in the presence

of mitomycin C (MMC) was normalized to that of untreated cultures. MMC was

added at h 0 of sporulation at the indicated concentrations. (B) Fluorescence

microscopy images of cells from strains PY79 (wild-type) (images 1-3) and YA5

(∆disA::tet) (images 1'-3') at h 2.5 of sporulation without MMC (images 1 and 1') and

with 15 ng/ml MMC at h 2.5 (images 2 and 2') and at h 4.5 (images 3 and 3') of

sporulation. The cells were treated with the membrane stain FM1-43 (green). Scale

bar corresponds to 1 µm. (C) Quantitation analysis of representative experiments with

PY79 and YA5 sporulating cells as visualized by fluorescence microscopy. Left:

various concentrations of MMC were added at h 0 of sporulation, and the cells were

visualized at h 2.5. Right: time course analysis of cells undergoing sporulation in the

absence (*) or presence of 15 ng/ml MMC. At least 600 cells were counted for each

time point.

Figure S2. Production of RacA-GFP in the Presence and Absence of a DNA-

Damaging Agent

Production of RacA-GFP (green) during sporulation in strains SB272 (racA-gfp-spc,

thrC::racA-erm) (A and C) and SB382 (∆disA::tet, racA-gfp-spc, thrC::racA-erm) (B

and D). Cells were stained with FM4-64 (red), in the absence (A and B, h 2 of

sporulation) or presence (C and D, h 3 of sporulation) of 350 µg/ml nalidixic acid. As

shown, no significant difference was observed between the wild-type and the mutant

cells under normal conditions (A and B). However, in the presence of nalidixic acid

(C and D), 27% (165/600) of the DisA mutant cells had clearly visible RacA-GFP,

whereas less than 7% (41/620) of the wild-type cells exhibited fluorescence from

RacA-GFP at h 3 of sporulation.

Figure S3. DAPI Staining Does Not Significantly Affect the Localization of DisA-

GFP

MB3 (disA-gfp-spc) cells were stained with FM4-64 (red) with and without DAPI

(blue) and photographed at 200-400 msec intervals. DAPI images were the last ones

to be taken to eliminate any effect of UV irradiation. Shown is a single particle

tracking analysis (MetaMorph, Universal Imaging) of DisA-GFP foci from individual

MB3 cells with (black) and without (gray) DAPI staining. The mean velocity for

DAPI-stained cells was 0.22 µm/sec and the mean velocity for unstained cells was

0.21 µm/sec. At least 200 foci were examined for each treatment. Examples of DisA-

GFP movement in the presence and absence of DAPI staining are shown in the

Movies S14A and S14B.

Figure S4. DisA Is a Nonspecific DNA Binding Protein

Purified DisA-His6 was incubated with biotin-labeled PCR fragments and subjected to

Electrophoretic Mobility Shift Assay (EMSA) as described in the Supplemental

Experimental Procedures. Three different double-stranded DNA fragments (racA,

disA, and amyE loci) were tested and exhibited a similar binding activity (Kd 1-3x10-8

M). Shown is the binding of increasing amounts of DisA-His6 to a PCR fragment

from the racA locus (left panel). The DisA non-specific DNA binding activity was

inhibited upon the addition of 50 ng/µl poly (dI.dC) (*). When DisA-His6 was

incubated with 20 fmol of biotin-labeled 20-24 mer single-stranded oligonucleotides,

DNA-protein binding was not detected (right panel).

Figure S5. The DNA-Independent Movement of DisA-GFP Requires Energy

Time lapse microscopy of MB15 (disA-gfp-spc, spoIIAC::kan) cells treated with 1%

sodium azide at h 3 of sporulation. DisA-GFP foci (green) were visualized 5 min after

the addition of sodium azide. Cells were stained with DAPI (blue), FM4-64 (red,

upper left image) or visualized by phase microscopy (red, lower left image). Cells

were photographed at 1000 msec intervals.

Supplemental Experimental Procedures

Strains

B. subtilis strains (except for MB44) were derivatives of the wild-type strain PY79

(Youngman et al., 1984) and are listed in Table S1.

Plasmids

Plasmid constructions were performed in E. coli DH5α using standard methods.

pMB2, which contains the 3’ region of disA fused to gfp, was created by amplifying

the 3’ region of disA gene by PCR using the primers: 5'-acctaggaattcgcaaac

tggctgtcttgtaatcgcc-3' and 5'-aagtccgctcgagcagttgtctgtctaaataatgcttctc-3', which

replaced the stop codon with a XhoI site. The PCR-amplified DNA was digested with

EcoRI and XhoI and was cloned into the EcoRI and XhoI sites of pKL147 (spc)

(Lemon and Grossman, 1998), which contains the gfp coding sequence and a

spectinomycin resistance gene. pMB4 which contains a disA-his6 fusion, was created

by amplifying the disA ORF by PCR using the primers: 5'-gcctactaagctagcatggaaaaag

agaaaaaaggggc-3' and 5'-gtggtgctcgagcagttgtctgtctaaataatgcttctc-3', which replaced

the stop codon with a XhoI site. The PCR-amplified DNA was digested with NheI and

XhoI and was cloned into the pET24B His6-expression vector (Novagen) digested

with the same enzymes. pMB5, which contains the 3’ region of disA fused to gfp, was

created by amplifying the 3’ region of disA gene by PCR using primers as described

for pMB2. The PCR-amplified DNA was digested with EcoRI and XhoI and was

cloned into the EcoRI and XhoI sites of pKL168 (kan) (Levin and Grossman, 1998).

pMB9, which contains Phyper-spanc-disA with flanking amyE sequences and a

spectinomycin resistance gene, was constructed by amplification of the disA gene

(including its ribosomal binding site) using primers 5'-ctactaagctagccatta

ggaggataatagatggaaaaagagaa-3' and 5'-ctactaagcatgccagttgtctgtctaa ataatgcttctc-3'. The

PCR-amplified product was digested with NheI and SphI and was cloned into pDR111

(amyE:: Phyper-spanc -spc, a gift from David Rudner, HMS) digested with NheI and

SphI. pMB12, which contains the 3’ region of disA fused to gfp, was created by

amplifying the tetracycline resistance cassette from pDG1514 (Guerout-Fleury et al.,

1995) using primers: 5'-acctagt ctagatcttgcaatggtgcaggttgttct-3' and 5'-

acctagtctagagaattcctgttataaaaaaaggatcaa-3'. The PCR-amplified DNA was digested

with XbaI and was cloned into the XbaI sites of pMB2. pYA20, which contains the

homothallic switching endonuclease (HO) cut-site with flanking amyE sequences and

a chloramphenicol resistance gene, was created by amplifying the HO cut-site by PCR

using the primers: 5'-ccggaattccggaatttcagctttccgcaacagtataaattccg-3' and 5'-

cccgggatcccggaatttatactgttgcggaaagctgaaattccg-3', which contains the HO cut-site

sequence. The PCR-amplified DNA was digested with BamHI and EcoRI and cloned

into the BamHI and EcoRI sites of pDG364 (amyE::cat) (Harwood and Cutting,

1990). pYA21, which contains the HO endonuclease with flanking thrC sequences

and an erythtomycin resistance gene, was constructed by amplification of the HO

endonuclease gene from pRS109 (a gift from M. Kupiec ,TAU), using primers 5'-

aggtggtgaactactatgctttctgaaaacacgactattc-3' and 5'-cccgggatcccggaatttatactgttgc

ggaaagctgaaattccg-3'. The PCR-amplified product was digested with HindIII and SphI

and was cloned into pFG16 (thrC::Pspac-erm, a gift from F. Gueiros-Filho,

University of São Paulo) digested with HindIII and SphI. pYA23, which contains the

3’ region of the ctpA gene located at the chromosomal terminus region, was created

by amplifying the 3’ region of ctpA by PCR using the primers: 5'-

caaaggtgaagcttgaactgaac-3' and 5'-ctgccttactgcagcgttttatctgcgtcaaatacg-3'. The PCR-

amplified DNA was digested with HindIII and SphI and was cloned into the HindIII

and SphI sites of a vector (pUC19) containing a spectinomycin resistance gene.

pYA24, which contains the HO cut-site with flanking ctpA sequences and a

spectinomycin resistance gene, was created by digesting pYA20 with BamHI and

EcoRI. The resulting fragment from pYA20 was cloned into the BamHI and EcoRI

sites of pYA23.

DisA Purification

E. coli BL21(DE3)/pLysS (Invitrogen) harboring pMB4 was grown in LB and DisA-

His6 protein synthesis was induced with 1mM IPTG at OD600 0.6 for 2.5 h at 37°C.

The cells were pelleted, resuspended in Lysis buffer (300 mM NaCl, 50 mM

NaH2PO4, 10 mM Imidazole, 5 mM β-mercaptoethanol, 2% Triton x 100, 5 µg/ml

DNaseI, 0.2 mg/ml AEBSF Hydrochloride (Calbiochem), [pH 8.0]) sonicated on ice

and pelleted again. The supernatant was batch-bound to Ni-NTA resin equilibrated in

wash buffer (300 mM NaCl, 50 mM NaH2PO4, 10 mM Imidazole, 5 mM β-

mercaptoethanol, 2% Triton x 100, [pH 8.0]). The batch-bound supernatant was

poured over a column, washed twice in wash buffer containing 40 mM Imidazole and

then eluted in elution buffer (300 mM NaCl, 50 mM NaH2PO4, 250 mM Imidazole,

[pH 8.0]) at 4°C. Eluted fractions that contained more then 0.5 mg/ml protein were

pooled and used for further investigation.

Electrophoretic Mobility Shift Assay (EMSA)

EMSA was carried out using LightShift Chemiluminescent EMSA kit (Pierce) with

purified DisA-His6 and biotin-labeled PCR fragments from different chromosomal

loci, as detailed in Figure S6. Each reaction contained: DisA-His6 (at the indicated

amounts), 20 fmol biotin-labeled PCR fragments, 1 x Reaction Buffer (PIERCE), 5%

Glycerol, 0.05% NP-40, and 50 µg/ml BSA. Reactions were incubated for 30 minutes

on ice, run on a 6% acrylamide gel in TBE x 0.5, and then transferred to a Hybond-

N+ membrane (Amersham). Detection of the biotin-labeled DNA was performed

using Chemiluminescent Nucleic Acid Detection Module (PIERCE). The primers that

were used for the PCR reactions are listed in Table S2.

Fluorescence In Situ Hybridization (FISH) Followed by Immunofluorescence

Microscopy

FISH probe was generated as described in the Experimental Procedures. For FISH

analysis, B. subtilis cells producing DisA-GFP (MB3 and YA41) were induced to

sporulate in the presence of 0.5 mM IPTG. At h 1.5 of sporulation, 4 ml cells were

fixed in 3.7% formaldehyde for 15 min at RT followed by 15 min incubation on ice.

The cells were washed three times with PBS x 1 (140 mM NaCl, 3 mM KCl, 8 mM

Na2HPO4, 1.5 mM KH2PO4 [pH 7.4]). The cells were spun down and resuspended in

1 ml of GTE (50 mM glucose, 20 mM Tris-HCl [pH 7.5], 10 mM EDTA). Lysozyme

was added to the cells at a final concentration of 2 mg/ml and 50 µl of cells were

placed on an eight-well multitest slide (silicone isolators, Sigma) treated with poly-L-

lysine. After 1 min at RT, excess cells were removed by aspiration and the samples

were washed three times with PBS x 1 for 5 min. The cells were dried, washed with

50% ethanol for 2 min and allowed to dry again. Pre-hybridization, hybridization, and

the subsequent wash steps were performed as described by Jensen and Shapiro

(1999).

Next, a second round of fixation by the addition of 3.7% formaldehyde was

performed. Subsequently, cells were treated with 80% methanol for 1 min, washed 3

times with PBS x 1 for 5 min, and allowed to air dry. Blocking solution (2% BSA in

PBS x 1) was added to each well for 30 min at RT. A monoclonal anti-GFP antibody

(1:500 dilution, MBL), or polyclonal anti-DisA antibodies (1:5000 dilution) were

added to the blocking solution and cells were incubated with the antibodies overnight

at 4oC. Next, the cells were washed 10 times with PBS x 1, incubated in blocking

solution for 30 min, and a Cy2 secondary antibody (1:200 dilution, Jackson

ImmunoResearch) was added for 40 min. Cells were washed again 10 times with PBS

x 1 and visualized by fluorescence microscopy. A monoclonal anti-GFP antibody

produced a bright signal with a very low background level and was therefore chosen

for further investigation.

Table S1. B. subtilis Strains

Strain Genotype

IB12 disA-gfp-spc, ∆mbl::erm

MB3 disA-gfp-spc

MB15 disA-gfp-spc, spoIIAC::kan

MB16 disA-gfp-kan

MB21 Phyper-spanc-disA-spc

MB44 disA-gfp-tet, mreB::neo, amyE::Pxyl-mreBCD-spc

MB51 amyE::PracA-lacZ-cat, ∆disA::tet

MB52 spoIIE-lacZ-cat, ∆disA::tet��

MB55 spoIIE-lacZ-cat, rvtA11-spc

MB56 amyE::PracA-lacZ-cat, rvtA11-spc

RL1740 spoIIE-lacZ-cat

SB263 amyE::PracA-lacZ-cat

SB272 racA-gfp-spc, thrC::racA-erm

SB382 racA-gfp-spc, thrC::racA-erm, ∆disA::tet

SB442 amyE::PracA-lacZ-cat, rvtA11-spc, ∆disA::tet

SB443 spoIIE-lacZ-cat, rvtA11-spc, ∆disA::tet �

YA5 ∆disA::tet

YA36 amyE::HOcut-site-spc

YA41 disA-gfp-spc, amyE::HOcut-site-spc, thrC::PspacHOendo-erm

YA51 amyE::HOcut-site-spc, thrC::PspacHOendo-erm

YA52 amyE::HOcut-site-spc, thrC::PspacHOendo-erm, ∆disA::tet

YA57 disA-gfp-spc, thrC::PspacHOendo-erm

YA58 disA-gfp-kan, thrC::PspacHOendo-erm

YA60 disA-gfp-kan, thrC::PspacHOendo-erm, ctpA::HOcut-site-spc

IB12 was constructed using the following steps: First IB11 (∆mbl::erm) was

constructed using a long-flanking-homology PCR replacement strategy and then its

genomic DNA was transformed into MB3. MB3 was constructed by transforming

PY79 with pMB2. MB15 was constructed by transforming MB3 with genomic DNA

from RL1265 (spoIIAC::kan, a gift from R. Losick, HU). MB16 was constructed by

transforming PY79 with pMB5. MB21 was constructed by transforming PY79 with

pMB9. MB44 was constructed using the following steps: First PY79 was transformed

with pMB12 to create MB41 (disA-gfp-tet) and then MB41 genomic DNA was

transformed into JE2060 (mreB::neo, amyE::Pxyl-mreBCD-spc, a gift from J.

Errington, Oxford University). MB51 was constructed by transforming SB263 with

genomic DNA from YA5. MB52 was constructed by transforming RL1740 with

genomic DNA from YA5. MB55 was constructed by transforming RL1740 with

genomic DNA from IRN385 (rvtA11-spc, a gift from A. Grossman, MIT). MB56 was

constructed by transforming SB263 with genomic DNA from IRN385 (rvtA11-spc, a

gift from A. Grossman, MIT). RL1740, a gift from R. Losick, HU. SB263 was

constructed as described previously (Ben-Yehuda et al., 2003). SB272 was

constructed as described previously (Ben-Yehuda et al., 2003). SB382 was

constructed by transforming SB272 with genomic DNA from YA5. SB442 was

constructed by transforming MB56 with genomic DNA from YA5. SB443 was

constructed by transforming MB55 with genomic DNA from YA5. YA5 was

constructed using a long-flanking-homology PCR replacement strategy. YA36 was

constructed by transforming PY79 with pYA20. YA41 was constructed using the

following steps: First MB3 was transformed with pYA20 to create YA38 (disA-gfp-

spec, amyE::HOcut-site-cat) and then it was transformed with pYA21. YA51 was

constructed by transforming YA36 with genomic DNA from YA40

(thrC::PspacHOendo-erm). YA52 was constructed using the following steps: First YA5

was transformed with genomic DNA from YA36 to create YA47 (∆disA::tet,

amyE::HOcut-site-spc), and then it was transformed with genomic DNA from YA40

(thrC::PspacHOendo-erm). YA57 was constructed by transforming MB3 with pYA21.

YA58 was constructed by transforming MB16 with pYA21. YA60 was constructed

by transforming YA58 with pYA24.

Table S2. List of Primers

Primer Name Primer Sequence (5'-3')

ChIP-1U-amyE TAAAAGCATGTCGAACTGGTACTG��

ChIP-1L-amyE TGATTGATGACCGCGTCAACAATG��

ChIP-2U-racA CGCAGAGAAATCGATGATATTC

ChIP-2L-racA CGGTTTTTTTCTTGTTTTGG

FISH-1U TTGAAATGTGTCTTCACGCAGACTGA

FISH-1L ATAATGTGGCCTGCTGTGAGGA

FISH-2U TTATTAGGTGTTATCTATGCGTCTG

FISH-2L TTCTTACGGTCGTATGACTTTT

FISH-3U CCGATTATCATTACAGGATGGA

FISH-3L TATCTTTCAGCCGGCAGAAGAA

FISH-4U AACGGATTGTGCCCTTCGGAAG

FISH-4L CAATATCGTTCGCCGCAAGCCC

FISH-5U CCAAAACCTTCATTACGGGCTG

FISH-5L CCGATGTGAAGACTGGAGAATT

FISH-6U GATGTAGAGAAATATAATGGTTCGG

FISH-6L ATTTACCTGGCTCCAATGATTC

FISH-7U TATATCTATAAACATGATGGGAGCC

FISH-7L TTCCAAACGGATCATACAACTG

FISH-8U CGAGTATGTGAGCGCACTTGTG

FISH-8L GAGAAACAAGTTTCGCCATGAC

FISH-9U CTCAATCTATCGCCATCGCTGC

FISH-9L CGGCATTGCCCAGACGATGAAT

FISH-10U AAAACGTTTTCGGCCGTACATA

FISH-10L TGCCCTGATAACCAAAGTAAAA

EMSA-1U-PdisA* TGGAAATAATGAAGGATAGAGC

EMSA-1L-PdisA CCGGAATTCGCATGCCTCAACCCCCTCCTTTACTGACTTTG

EMSA-2U-disA ACCTAGGAATTCGCAAACTGGCTGTCTTGTAATCGCC

EMSA-2L-disA* GCCTTGGTTAAAATAAATCC

EMSA-3U-racA CGCAGAGAAATCGATGATATTC

EMSA-3L-racA* CGCTTTTTTTCTTGTTTTGG

*Biotin-labeled primers.

Supplemental References

Ben-Yehuda, S., Rudner, D. Z., and Losick, R. (2003). RacA, a bacterial protein that

anchors chromosomes to the cell poles. Science 299, 532-536.

Guerout-Fleury, A. M., Shazand, K., Frandsen, N., and Stragier, P. (1995). Antibiotic-

resistance cassettes for Bacillus subtilis. Gene 167, 335-336.

Harwood, C. R. and Cutting, S. M. (1990). Molecular Biological Methods for Bacillus

(New York: John Wiley and Sons).

Jensen,R., and Shapiro, L. (1999). The Caulobacter crescen-tus smc gene is required

for cell cycle progression and chromosome segregation. Proc Natl Acad Sci USA 96,

10661–10666.

Lemon, K. P., and Grossman, A. D. (1998). Localization of bacterial DNA

polymerase: evidence for a factory model of replication. Science 282, 1516-1519.

Levin, P. A., and Grossman, A. D. (1998). Cell cycle and sporulation in Bacillus

subtilis. Curr Opin Microbiol 1, 630-635.

Youngman, P., Perkins, J. B., and Losick, R. (1984). Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-borne erm gene. Plasmid 12, 1-9.

Supplemental Movie Legends

Movies S1–S14. Show FM4-64 (red) and DAPI (blue)-stained cells from DisA-GFP-

producing strains. DisA-GFP (green) is seen as foci. Cells were photographed at 200-

400 msec intervals and movies were prepared using MetaMorph 6.2r4 software.

Movies S1–S4. The dynamic localization of DisA-GFP foci is shown by time lapse

microscopy from individual cells of the DisA-GFP-producing strain (MB3) before

(Movies S1 and S3), and after (Movies S2 and S4) polar division. Correspond to

Figures 4A-4D, respectively.

Movie S5. A field of MB3 (disA-gfp-spc) cells at h 2.5 of sporulation.

Movie S6. MB3 (disA-gfp-spc) cells were fixed with 1% formaldehyde and visualized

at h 1 of sporulation.

Movies S7A and S7B. (A) MB3 (disA-gfp-spc) cells at h 1.5 of sporulation were

treated with 1% sodium azide, and DisA-GFP foci were immediately visualized. (B)

DisA-GFP foci of untreated control cells.

Movie S8. MB3 (disA-gfp-spc) cells were induced to sporulate in the presence of 350

µg/ml nalidixic acid and visualized at h 1.5 of sporulation.

Movie S9. YA41 (disA-gfp-spc, amyE::HOcut-site-cat, thrC::PspacHOendo-erm) cells at h

1.5 of sporulation after induction of the HO endonuclease (0.5 mM IPTG was added

at h 0). Corresponds to Figure 5A.

Movie S10. MB3 (disA-gfp-spc) cells were treated with 25 ng/ml MMC and

visualized at h 1.5 of sporulation. Corresponds to Figure 6A.

Movie S11. MB15 (disA-gfp-spc, spoIIAC::kan) cells at h 3 of sporulation.

Corresponds to Figure 6B.

Movie S12. IB12 (∆mbl::erm, disA-gfp-spc) cells were induced to sporulate and

visualized at h 1.5. Cells were photographed by phase contrast microscopy (red) and

DisA-GFP is shown in green.

Movie S13. MB44 (disA-gfp-tet, mreB::neo, amyE::Pxyl-mreBCD-spc) was depleted

for MreB for 15 cell generations in LB medium and visualized at OD600 1.6. Under

these conditions, a significant number of DisA-GFP foci was observed (we were

unable to induce sporulation in MreB-depleted cells and therefore we used vegetative

conditions for this experiment). Cells were photographed by phase contrast

microscopy (red) and DisA-GFP is shown in green.

Movies S14A and S14B. MB3 (disA-gfp-spc) at h 1.5 of sporulation with (A) and without (B) DAPI staining. Correspond to Figure S3.