Analytical Biochemistry 395 (2009) 237–243

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

A dual reporter approach to quantify defects in messenger RNA processing

Ayan Banerjee, Mimi C. Sammarco, Scott Ditch, Ed Grabczyk *

Department of Genetics, Louisiana State University Health Sciences Center, New Orleans, LA 70112, USA

a r t i c l e i n f o

Article history:Received 2 June 2009Available online 3 September 2009

Keywords:mRNASplicingNuclear exportUAP56NXF1Dual reporter assay

0003-2697/$ - see front matter � 2009 Elsevier Inc. Adoi:10.1016/j.ab.2009.08.040

* Corresponding author. Fax: +1 504 568 8500.E-mail address: egrabc@lsuhsc.edu (E. Grabczyk).

1 Abbreviations used: mRNA, messenger RNA; mRNP,RT-PCR, reverse transcription polymerase chain reactihybridization; NXF1 (or NXF1/TAP), nuclear export fatarget; DLR, dual luciferase; hRLUC, humanized renluciferase; PBS, phosphate-buffered saline; ASF, alternshort hairpin RNA; SDS, sodium dodecyl sulfate; DTT,mentary DNA; UV, ultraviolet; GAPDH, glyceraldehydeASF/SF2, alternative splicing factor/splicing factor 2 Manesulfonic acid].

a b s t r a c t

Splicing and nuclear export are vital components of eukaryotic gene expression. Defects in splicing due tocis mutations are known to cause a number of human diseases. Here we present a dual reporter systemthat can be used to look at splicing or export deficiencies resulting from an insufficiency in components ofthe cotranscriptional machinery. The constructs use a bidirectional promoter to coexpress a test reporterand a control reporter. In the splicing construct, maximal expression of the test reporter is dependent onefficient splicing and splicing-related nuclear export, whereas the control reporter is an intronlesscomplementary DNA expression cassette. The dual reporters allow a robust ratiometric output that isindependent of cell number or transfection efficiency. Therefore, our construct is internally controlledand amenable to high-throughput analysis. As a counterscreen, we have a nonsplicing control constructin which neither reporter bears an intron. We demonstrate the sensitivity of our construct to defects innuclear export by depleting UAP56 and NXF1, essential components of the cotranscriptional machinery.

� 2009 Elsevier Inc. All rights reserved.

Eukaryotic gene expression is a complex process involving sev-eral pre-mRNA (messenger RNA)1 processing steps that culminatein nuclear export and translation of the mature mRNA. As it emergesfrom RNA polymerase II, the nascent pre-mRNA interacts with alarge number of proteins that determine whether it is spliced andexported from the nucleus. Multiple lines of evidence point to acotranscriptional assembly of messenger ribonucleoprotein (mRNP)particles in which transcription, splicing, and export factors act inconcert [1,2]. The machinery involved in these processes is largelyconserved from yeasts to metazoans. In yeast, the THO/TREX proteincomplex aids in transcription elongation and couples transcriptionto mRNA export [3,4]. THO is a four-protein complex (Hpr1, Tho1,Mft1, and Thp2) that associates with mRNA export proteins Sub2and Yra1 within the larger TREX (transcription/export) complex[5]. Mutations in the THO/TREX constituent proteins can lead to ahyperrecombination phenotype and impaired gene expression [6,7].

As the model for cotranscriptional events is better formulated,additional proteins are being identified as important for efficient

ll rights reserved.

messenger ribonucleoprotein;on; FISH, fluorescence in situctor 1; FRT, Flp recombinaseilla luciferase; FLUC, fireflyative splicing factor; shRNA,

dithiothreitol; cDNA, comple--3-phosphate dehydrogenase;OPS, [3-(N-morpholino)prop-

mRNP assembly. A mutation or an insufficiency in one or more ofthese proteins would likely cause a breakdown in the processingof mRNA and reduced gene expression in the subset of genes usingthat export pathway.

A number of human diseases result from splicing abnormalities[8,9]. Many of the studies analyzing these disorders have looked atalternative splicing and exon skipping as a result of sequencevariations in splice donor and acceptor sites in individual genes[10–12]. Currently, the most common method to look for splicingdeficiencies involves RNA isolation and reverse transcription poly-merase chain reaction (RT-PCR), which can be time-consuming.Differing efficiencies of amplification in RT-PCR can also lead to er-rors in calculating the levels of spliced and unspliced products.Microinjection of radiolabeled RNA or plasmid DNA into nucleihas been used to demonstrate the importance of splicing for nucle-ar export [13,14]. Rodrigues and coworkers evaluated the role ofREF/Aly, an export factor, in nuclear export of mRNA by microin-jecting REF antisera into Xenopus oocyte nuclei along with labeledmRNAs. Nuclear injections are usually followed by analysis usingfluorescence in situ hybridization (FISH) [13,14] or resolution ofnuclear and cytoplasmic fractions on denaturing polyacrylamidegels followed by autoradiography [15]. These techniques have pro-ven to be invaluable for the understanding of cotranscriptionalprocesses. However, the protocols mentioned above can be techni-cally challenging and laborious. A fast and easy transfection-basedreporter assay would be useful in providing a quick screen of splic-ing abnormalities that could then be further characterized by otherprotocols.

Here we describe a reporter system designed to provide a sen-sitive assay for breakdowns resulting from deficits in components

238 Dual reporter to quantify defects in mRNA processing / A. Banerjee et al. / Anal. Biochem. 395 (2009) 237–243

of the cotranscriptional machinery. This system uses a bidirec-tional tetracycline inducible promoter and coexpresses two lucifer-ase reporters, one of which contains an intron. Optimal expressionof the test reporter is dependent on splicing and splicing-relatedexport similar to a native gene, whereas that of the control reporteris not. To probe the sensitivity of our construct to defects in mRNAprocessing, we chose to knock down proteins that have a well-characterized function in splicing and export. We demonstrate thatthe depletion of UAP56 and nuclear export factor 1 (NXF1) leads toa reduction in expression of our splicing reporter compared withan intronless control.

Materials and methods

Plasmids and cloning

An intronless construct (BI-16) with a bidirectional promoter[16] was our control and served as the base for the minigene con-struct (SPLCX) (Fig. 1A). The promoter consists of two asymmetriclengths of the Invitrogen Pcmv (2x-TetO2) promoter joined tail totail. This promoter has been previously characterized in detail byour laboratory [16]. Human FXN exon 1 and 2 sequences were PCRamplified from genomic DNA. Using the numbering on chr9 March2006, the FXN exon 1 splice donor is at (70840683) followed by a con-sensus GTAAGT. Nested PCR was used to insert a BglII restriction sitefollowed by an ATG at frataxin amino acid 42 (70840642) and an SpeIsite after 100 bp of the intron (70840783) to make fragI. The FXNsplice acceptor is at (70851121) preceded by 16/20 consensus inthe �20 region. Nested PCR was used to insert an XbaI site 50 to thelast 90 bp of intron I (70851031) and after 60 bp of exon 2(70851181) and to insert an AflII site (creating an in-frame TAA)and BglII and HindIII sites (creating frag2). PCR was used to add Bam-HI, XmaI, and XhoI to one side of a 361-bp fragment of the CAT genefrom pSV2CAT (4969–4608 bp, GenBank M77788), and XbaI wasadded to the other side to make frag3. Frag1 and pREX [17] werecut with BglII and SpeI and were ligated. The resulting plasmid wascut with SpeI and BamHI and was ligated to XbaI and BamHI cut frag2.

Fig. 1. The SPLCX construct splices effectively. (A) Schematics of BI-16 (intronless conconstructs express firefly (FLUC) and renilla (hRLUC) reporters driven by a bidirectional tregions from the FXN first intron upstream of the hRLUC reporter. (B) RNA was preparedshows that PCR amplification of reverse-transcribed (+RT) RNA using primers flanking tpurified and sequenced. No unspliced or mis-spliced products were seen. (C) Sequencelocation of the splice junction. The translation reinitiation leader features two stop codon

Frag3 and the plasmid with fragments 1 and 2 were cut with HindIII,and frag4 was inserted. The final intermediate plasmid was cut byBglII, which flanks 1, 2, 3, and 4, and the fragment was ligated intoBamHI cut pcDN/FRT/FL-/TETBI/RL [16] to create the SPLCX con-struct lacking the translational reinitiation spacer. This was cut withNcoI (partial) and AflII, and the 75-bp reinitiation spacer from GAP-43 transgene [18] was cut with AflII and NcoI and then ligated to com-plete the SPLCX reporter construct.

Cell culture, transfections, and cell lines

Transient transfections using 250 ng of our reporter plasmidswere carried out using Lipofectamine 2000 (Invitrogen) as perthe manufacturer’s protocol. For establishing stable cell lines, com-mercially available HEK 293 Flp-In T-REx cells (Invitrogen) werecotransfected with 100 ng of the vector carrying our reporter con-struct and 900 ng of pOG44 using Lipofectamine 2000. HEK 293Flp-In T-REx cells have a single stably integrated Flp recombinasetarget (FRT) site and constitutively express Tet repressor. Thesecells are designed for use with Invitrogen’s Flp-In system. Cellstransfected to make stable cell lines were selected with hygromy-cin (75 lg/ml) and blasticidin (15 lg/ml). Individual colonies werepicked and expanded under antibiotic selection.

Dual luciferase assay

The dual luciferase (DLR) assay was performed using a DLR as-say kit (Promega) according to the manufacturer’s directions.Briefly, cells were lysed with Passive lysis buffer (Promega), and20 ll of lysate was assayed in white 96-well luminescence plates(Dynex). Luciferase expression was measured using a Veritas dualinjector plate reader luminometer (Turner Biosystems). Lysates ob-tained from a doxycycline-induced control cell line [16] were usedas a positive control. Ratios were calculated for expression of seapansy luciferase (Renilla reniformis) to firefly luciferase (Photinuspyralis) (humanized renilla luciferase [hRLUC]/firefly luciferase[FLUC]). All ratios were normalized to the average ratios of the fourpositive controls.

trol construct) and SPLCX (intron-bearing construct for splicing and export). Bothetracycline inducible promoter. SPLCX contains the splice donor and splice acceptorfrom HEK 293 cells that were transfected with the SPLCX construct. The gel image

he splice sites produced a robust band of the expected spliced size. This band wasof the spliced PCR product showing the expected frataxin partial peptide and thes in each frame (underlined) and a Kozak consensus sequence (in bold) at the ATG.

Dual reporter to quantify defects in mRNA processing / A. Banerjee et al. / Anal. Biochem. 395 (2009) 237–243 239

Nuclear isolation

Nuclear isolation was performed using the protocol describedby Greenberg and coworkers [19]. Cells were scraped in cold phos-phate-buffered saline (PBS) and pelleted at 500g and 4 �C for 5 min.The cell pellet was resuspended in NP-40 lysis buffer (10 mM Tris–HCl [pH 7.4], 10 mM NaCl, 3 mM MgCl2, and 0.5% [v/v] NP-40) andincubated on ice for 5 min. Nuclei were centrifuged at 500g, andthe supernatant containing the cytoplasmic fraction was saved.

shRNA-mediated depletion

For depleting UAP56, NXF1, and alternative splicing factor (ASF),we used the pLKO.1 vector system from Open Biosystems that conferspuromycin resistance and drives short hairpin RNA (shRNA) expres-sion from a human U6 promoter. The shRNA sequences for UAP56,NXF1, and ASF correspond to TRCN0000074384, TRCN0000007581,and TRCN0000001094, respectively, on the Open Biosystems shRNAdatabase. HEK 293 cells were transfected with either the emptypLKO.1 vector or the vector carrying the protein-specific shRNA con-struct and were selected with 1 lg/ml puromycin.

Immunoblotting

Cells were lysed in 2� Laemmli buffer (2% sodium dodecyl sul-fate [SDS], 20% glycerol, 100 mM Tris [pH 6.8], and 125 mM dithi-othreitol [DTT]). Whole cell lysate (100 lg) was resolved on an 8%resolving SDS polyacrylamide gel (37.5:1). Proteins were trans-ferred to an Immobilon-P membrane (Millipore) using a semi-drytransfer apparatus (Bio-Rad). The membrane was blocked in 20%evaporated Carnation milk in PBS for 1 h at room temperatureand then was incubated with either mouse anti-human UAP56antibody (1:1000 dilution) or mouse anti-actin antibody (1:5000)overnight at 4 �C. A horseradish peroxidase-conjugated goat anti-mouse secondary antibody (Pierce) was then used (1:10,000dilution), followed by detection using the ECL Advance chemilumi-nescence kit (Amersham). A Kodak Gel Logic 440 Imaging Systemwas used for imaging, and band intensities were analyzed usingKodak Molecular Imaging Software (version 4.0.5f7). The statisticalsignificance in the difference between the mean band intensities ofvarious samples was determined using an unpaired Student’s t test,assuming unequal variance in the data groups.

cDNA synthesis and real-time PCR

RNA was extracted from whole cells, nuclei, or cytoplasmicsamples using TRI Reagent (Molecular Research Center). First-strand complementary DNA (cDNA) synthesis was carried outusing the Sidestep II QPCR cDNA Synthesis Kit (Stratagene), asper the manufacturer’s protocol. Quantitative real-time PCR reac-tions were set up using the iQ SYBR Green Supermix (Bio-Rad). Pri-mer sets for FLUC and hRLUC were obtained from IDT and used at afinal concentration of 200 nM. Primer set for PCR to demonstratesplicing: FR1XF1, tgggaagttcttcctgaggt; RL5-80F, ggagtccagcacgttc-attt. Primer sets for real-time PCR on nuclear and cytosolic sample:FLUC sense, aagattcaaagtgcgctgctggtg; FLUC antisense, ttgcctga-tacctggcagatggaa; hRLUC sense, aatggctcatatcgcctcctggat; hRLUCantisense, tggacgatcgccttgatcttgtct.

Real-time analysis was conducted using an MX3000P sequencedetection system from Stratagene. Standard curves for each primerset (FLUC and hRLUC) were made using serial dilutions of the pBI-16-FTH plasmid, which expresses both reporters [20]. These stan-dard curves were then used in MX3000P software (version 2.0)to calculate the copy number for FLUC and hRLUC. The cycling con-ditions were as follows: 10 min at 95 �C, followed by 40 cycles of

95 �C for 30 s, 55 �C for 1 min, and 72 �C for 30 s. Analysis was doneusing MX3000P software.

Northern blot

For FLUC and hRLUC mRNA detection, cells were electroporatedwith 50 lg of plasmid at 250 V and 1000 lF using a Gene Pulserapparatus (Bio-Rad) and were plated overnight in media containing1 lg/ml doxycycline. For all Northern blots, RNA was isolated usingTRI Reagent. RNA (20 lg) was resolved on a denaturing 1% MOPS/formaldehyde–agarose gel and was transferred to a HyBond N+membrane (Millipore). The RNA was ultraviolet (UV) crosslinkedto the membrane for 1 min, and then the membrane was prehybrid-ized in ULTRAhybe (Ambion) at 65 �C for 1 h. RNA probes radiola-beled with [a-32P]UTP (MP Biomedicals) were synthesized usingin vitro transcription with T 7 RNA polymerase from HindIII linear-ized plasmids carrying FLUC, hRLUC, NXF1, ASF, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in an antisense orientationto a T 7 promoter. The prehybridized membrane was incubated withprobe overnight at 65 �C. The membrane was washed, air dried, andexposed to a phosphorscreen overnight. A Typhoon phosphorimagerwas used to obtain an image, followed by analysis of band intensitieswith Kodak Molecular Imaging Software. The statistical significanceof the difference between the mean band intensities of various sam-ples was determined using an unpaired Student’s t test, assumingunequal variance in the data groups. For measuring NXF1 and ASFknockdowns, their respective mRNA band intensities were normal-ized to that of GAPDH and compared with similarly normalizedvalues obtained from wild-type cells.

Results and discussion

A bidirectional construct demonstrates enhanced nuclear export of aprocessed reporter

To study the influence of cotranscriptional processing on geneexpression, we designed a pair of bidirectional reporter constructs:an intron-bearing splicing and export construct (SPLCX) and a sim-ple intronless cDNA control construct (BI-16) [16] (Fig. 1A). Theconstructs coexpress FLUC and hRLUC reporters under the controlof a bidirectional tetracycline inducible promoter. SPLCX has an in-tron with splice donor and acceptor sites cloned upstream of thehRLUC reporter (Fig. 1A). For hRLUC to be effectively expressedfrom SPLCX, successful splicing of the intron and export of thehRLUC mRNA are required. FLUC reporter expression does not re-quire splicing and serves as an internal control. Expression of bothreporters (FLUC and hRLUC) from BI-16 is independent of splicing.To confirm successful splicing in the SPLCX construct, we reversetranscribed RNA from transiently transfected cells and analyzedhRLUC splicing by PCR. The RT-PCR showed a spliced product atthe expected size and did not detect any unspliced product(Fig. 1B). The spliced product was gel purified and sequenced toverify correct splicing (Fig. 1C).

To determine whether there was a differential subcellular dis-tribution of the spliced and unspliced reporter mRNAs in SPLCX,we fractionated cell extracts into nuclear and cytoplasmic fractionsand measured the levels of hRLUC and FLUC mRNA. For SPLCX,real-time PCR indicated approximately 3-fold more hRLUC mRNAin the cytoplasm as compared with the nucleus (Fig. 2). In cells car-rying the intronless control construct BI-16, hRLUC mRNA was notpreferentially exported to the cytoplasm. FLUC mRNA levels forboth constructs were similar in the nucleus and cytoplasm (Fig. 2).

Splicing has been shown to recruit the TREX complex to mRNA,which in turn mediates active export of the message via the nucle-ar pore complex [21]. In accordance with this, our spliced hRLUC

Fig. 2. Splicing enhances nuclear export of hRLUC mRNA. Shown is real-time PCRanalysis of FLUC (left) and hRLUC (right) mRNA levels in the nuclear andcytoplasmic compartments of BI-16 and SPLCX cell lines. A significantly increasedlevel of hRLUC mRNA was observed in the cytoplasm for SPLCX when comparedwith the nuclear fraction. BI-16 did not demonstrate a similar distribution of theintronless hRLUC mRNA. Error bars represent standard errors of the mean of fourindependent experiments, and the asterisk (�) indicates P < 0.05.

Fig. 3. Splicing enhances hRLUC expression in the SPLCX construct. Luciferaseexpression from BI-16 and SPLCX was analyzed in transient transfections and stablecell lines. The average hRLUC/FLUC ratios for SPLCX transient transfections andstable cell lines are shown in comparison with the BI-16 control that has beennormalized to 1. Significant increases of approximately 2.4- and 2.8-fold in averagehRLUC/FLUC ratios were observed when comparing SPLCX with the BI-16 controlconstruct in transient transfections and stable cell lines, respectively. Error barsindicate standard errors of the mean of 12 replicates from four independentexperiments, and each asterisk (�) indicates P < 0.05.

240 Dual reporter to quantify defects in mRNA processing / A. Banerjee et al. / Anal. Biochem. 395 (2009) 237–243

reporter shows a significant advantage in nuclear export over theunspliced controls (P < 0.05). This increased export of hRLUC mostlikely is the result of the SPLCX spliced message being cotranscrip-tionally processed like a native pre-mRNA molecule.

Enhanced nuclear export corresponds to increased hRLUC expression

All of our constructs contain an internal control in the form ofthe second reporter (FLUC). The expression of the test reporter(hRLUC) can be normalized to that of the control reporter (FLUC).This ratiometric output makes the assay independent of cell num-ber and transfection efficiency, and so our system is ideal for high-throughput screening. Luciferase expression from SPLCX and BI-16was analyzed after transient transfections into HEK 293 cells(Fig. 3). Transient transfections demonstrated an approximately2.4-fold increase in expression of the hRLUC reporter from SPLCXwhen compared with BI-16. We also established stable cell lineswith single copy integration of our constructs into the same uniquechromosomal location using the Invitrogen Flp-In system to deter-mine whether a single copy reporter system would yield differentresults. Luciferase expression from the stable cell lines showed anapproximately 2.8-fold enhanced hRLUC expression over an unpro-cessed hRLUC (Fig. 3). Luciferase expression from our constructs, asfor any gene, is dependent on mRNA translation, which in turnrelies on efficient nucleocytoplasmic export of the message viathe nuclear pore. Splicing has been shown to play a key role inthe recruitment of the export machinery to metazoan mRNA and,therefore, is vital for optimal expression.

The spliced hRLUC reporter is sensitive to depletion ofcotranscriptional proteins

We have demonstrated that the enhanced hRLUC expressionfrom the SPLCX construct corresponded to an increased nuclear

export of its message. Because splicing and export are intricatelylinked, we wanted to investigate how sensitive our reporter systemwould be to defects in cotranscriptional processing. The humanorthologs of the TREX complex mentioned previously, Sub2 andYra1 (UAP56 and REF/Aly, respectively), are recruited to thepre-mRNA during a late step of splicing [21,22]. UAP56 is anATP-dependent RNA helicase belonging to the DEAD/H-box familythat plays an important role in spliceosome assembly [23,24].Recent reports suggest that UAP56 acts as an intermediate be-tween splicing and export by recruiting REF/Aly to the mRNA[25]. REF/Aly is an export factor that acts as an adaptor by interact-ing with NXF1/TAP, which in turn promotes export of mRNAthrough nuclear pore complexes [26,27]. We used shRNA to de-plete UAP56 and used Western blots to demonstrate an approxi-mately 50% knockdown of protein expression (Fig. 4A). Wetransiently transfected the UAP56-depleted cells with SPLCX orthe control BI-16 to analyze hRLUC expression (Fig. 4B). A substan-tial decrease in hRLUC/FLUC ratios from SPLCX was seen in cellswith UAP56 knocked down when compared with control cells withnormal UAP56 levels (P < 0.05) (Fig. 4B). BI-16 was not sensitive toUAP56 depletion and did not show a significant decrease in hRLUC/FLUC ratios.

To determine the cause of the altered expression, nuclear andcytoplasmic fractions were prepared from UAP56-depleted cellstransiently transfected with either SPLCX or the BI-16 construct.The subcellular distribution of the hRLUC message was analyzedby real-time RT-PCR. Lowered levels of cytoplasmic hRLUC mRNAtranscribed from SPLCX were observed in cells with reduced levelsof UAP56 (cf. Figs. 2 and 4C). BI-16 did not demonstrate a change inhRLUC mRNA distribution in response to UAP56 knockdown(Fig. 4C). Northern blot analysis of FLUC and hRLUC mRNA was car-ried out on wild-type and UAP56 knockdown cells transfected withBI-16 or SPLCX (Fig. 4D). A percentage of unspliced hRLUC mRNAwas observed in SPLCX-transfected cells. The UAP56-depleted cellselectroporated better than the wild-type cells and showed highernet levels of hRLUC and FLUC mRNA. Densitometric analysis ofthe bands showed that the ratio of unspliced to spliced hRLUCmRNA did not show a significant increase in the UAP56 knockdowncells as compared with wild-type cells transfected with SPLCX

Dual reporter to quantify defects in mRNA processing / A. Banerjee et al. / Anal. Biochem. 395 (2009) 237–243 241

(Fig. 4E). This indicates that the depletion of UAP56 to 50% ofnormal levels was primarily affecting the export and not the splic-ing of the hRLUC reporter. This could be because the remaining 50%of the protein is sufficient to carry out its functions in spliceosomeassembly but falls short in recruiting export factors. This preferen-tial effect of UAP56 depletion on SPLCX demonstrates its respon-siveness to splicing-related export deficiencies. The stable celllines carrying a single copy of the SPLCX construct failed to showa similar response to UAP56 depletion (data not shown). Residual

levels of UAP56 could be enough for the processing of the singlecopy transgene in the stable cell lines. Transient transfections ex-pose the cell to multiple copies of the constructs, and depletedUAP56 levels may be insufficient to cope with the increased de-mand for pre-mRNA processing.

To confirm the sensitivity of SPLCX, we depleted two additionalcotranscriptional processing factors: NXF1/TAP and ASF/SF2 (splic-ing factor 2). Northern blot analysis of mRNA levels demonstrated22% and 24% decreases in NXF1 and ASF, respectively (Fig. 5A). Themodest level of knockdown obtained for these proteins may reflecttheir importance for cellular survival. Cells with a more severeknockdown of these vital proteins might not survive, resulting ina selected population of cells with protein levels adequate for sur-vival. Transient transfection of BI-16 and SPLCX into NXF1-de-pleted cells showed a significant decrease (P < 0.05) in hRLUC/FLUC ratios for SPLCX, but not for BI-16, as compared with wild-type cells. On the other hand, knockdown of ASF to similar levelsdid not yield similar results. Neither SPLCX nor BI-16 showed a sig-nificant change in hRLUC/FLUC ratios. This absence of an effectcould be because ASF is a splicing factor belonging to the SR pro-tein family. SR proteins are known to be functionally redundant,and other splicing factors such as SC35 have been previouslyshown to successfully replace ASF in splicing reactions [28,29]. Itis also possible that the modest decrease in protein levels maybe insufficient to see an effect because the residual ASF is capableof fulfilling its physiological function.

Conclusion

Splicing is emerging as a pivotal cotranscriptional process thatlinks the nascent mRNA to the export machinery and the eventualtransition from transcription to translation in metazoans [21]. Aswe learn more about the intricate network of proteins involvedin the complexes linking the splicing and export of mRNA, therearises a need for sensitive high-throughput assays to evaluate theroles of various proteins involved in these processes. Splicing re-porter systems have been used in the past to study aberrant splic-ing [30,31], but those studies focused primarily on alternativesplicing and exon skipping as a result of cis-acting mutations insingle genes. Here we have designed a reporter system that canbe used to study defects in RNA metabolism caused by deficiencies

Fig. 4. Depletion of UAP56 decreases nuclear export of hRLUC from the splicingconstruct. (A) Depletion of UAP56 by shRNA. Anti-UAP56 antibody (Abnova)produces a doublet (shown here). Western blots showed an approximately 50%decrease in the higher band in cells transfected with a vector expressing a UAP56-targeting shRNA when compared with cells transfected with the empty pLKO.1vector. The lower band also shows a marked decrease in intensity. b-Actin was usedas a loading control. Knockdowns were done four times with the representative blotshown. (B) UAP56 depletion decreases hRLUC/FLUC ratio from SPLCX. Dualluciferase assays from transient transfections carried out after knocking downUAP56 (+shRNA) demonstrate a significant decrease in hRLUC/FLUC ratios in SPLCXwhen compared with cells with wild-type levels of UAP56 (+pLKO.1). Error barsrepresent standard errors of the mean of 18 replicates from six independentexperiments, and the asterisk (�) indicates P < 0.05. (C) UAP56 depletion impedesnuclear export of the spliced SPLCX hRLUC mRNA. Nuclear and cytoplasmicfractions from UAP56-depleted cells transiently transfected with BI-16 or SPLCXwere analyzed for FLUC and hRLUC mRNA levels using real-time RT-PCR. Nopreferential nuclear export of hRLUC mRNA expressed from BI-16 or SPLCX is seenwhen UAP56 is depleted. Error bars represent standard errors of the mean of threeindependent experiments. (D) Northern blot analysis of total mRNA levels of hRLUCand FLUC transcribed from BI-16 and SPLCX in wild-type and UAP56-depleted cells.Wild-type and UAP56-depleted cells electroporated with either BI-16 or SPLCXwere analyzed for unspliced mRNA products. Some unspliced message wasobserved in both SPLCX-transfected cell types. (E) Percentage unspliced SPLCXhRLUC mRNA in wild-type and UAP56-depleted cells. Densitometric analysisshowed no significant increase of the unspliced product in UAP56-depleted cellswhen compared with wild-type cells.

3

Fig. 5. Depletion of NXF1 and depletion of ASF have different effects on the splicing construct. (A) shRNA-mediated depletion of NXF1 and ASF. Northern blot analysis wascarried out on wild-type cells and cells transfected with NXF1 or ASF shRNA. Densitometric analysis showed 22% and 24% decreases of NXF1 and ASF, respectively, whencompared with wild-type cells. GAPDH mRNA was used for normalization. The bars represent residual mRNA levels expressed as a percentage of wild-type levels. (B) NXF1depletion decreases hRLUC/FLUC ratios of the splicing construct. Dual luciferase assays from transient transfections carried out after knocking down NXF1 (+shRNA)demonstrate a significant decrease in hRLUC/FLUC ratios in SPLCX when compared with cells with wild-type levels of NXF1 (+pLKO.1). Depletion of ASF does not decreasehRLUC/FLUC ratios. Error bars represent standard errors of the mean of three independent experiments, and the asterisk (�) indicates P < 0.05.

242 Dual reporter to quantify defects in mRNA processing / A. Banerjee et al. / Anal. Biochem. 395 (2009) 237–243

in proteins involved in splicing-mediated cotranscriptional events.We demonstrated the sensitivity of the assay by transfecting thereporter construct into cells deficient in three different cotran-scriptional proteins. Depletion of UAP56 to 50% of wild-type levelsresulted in the decreased nuclear export and expression of thesplicing reporter. A modest decrease was sufficient to see a pheno-type from NXF1-depleted cells but did not elicit a response fromcells with similarly decreased levels of ASF. The response seen inthe NXF1 knockdown cells indicates that the splicing reporter issensitive enough to detect an effect in the window of proteindepletion before cell viability is affected. Transfecting the constructinto various cell lines would provide a quick screen of any splicing/export deficiencies resulting from depletion or lack of a target pro-tein. The ratiometric output reduces variability due to differingtransfection efficiencies. Furthermore, other splice acceptor anddonor pairs of interest can be easily cloned into the construct toanalyze a different subset of processing proteins. The BI-16 con-struct and FLUC expressed from SPLCX under control of the samepromoter as hRLUC provide excellent controls in our system. Theassay produces a self-controlled ratiometric luciferase readout thatprovides a sensitive and reproducible, albeit indirect, measure ofsplicing and related processes via a simple reporter assay. Our sys-tem provides an easy measure of effective gene expression and issuited for high-throughput analysis.

Acknowledgments

This work was supported in part by a grant from the NationalInstitutes of Health (NIH, R01NS046567) and by a grant fromFriedreich’s Ataxia Research Alliance (FARA) to E.G.

References

[1] T. Maniatis, R. Reed, An extensive network of coupling among gene expressionmachines, Nature 416 (2002) 499–506.

[2] N. Proudfoot, Connecting transcription to messenger RNA processing, TrendsBiochem. Sci. 25 (2000) 290–293.

[3] T. Fischer, K. Strasser, A. Racz, S. Rodriguez-Navarro, M. Oppizzi, P. Ihrig, J.Lechner, E. Hurt, The mRNA export machinery requires the novel Sac3p–Thp1pcomplex to dock at the nucleoplasmic entrance of the nuclear pores, EMBO J.21 (2002) 5843–5852.

[4] P. Huertas, A. Aguilera, Cotranscriptionally formed DNA:RNA hybrids mediatetranscription elongation impairment and transcription-associatedrecombination, Mol. Cell 12 (2003) 711–721.

[5] S. Chavez, T. Beilharz, A.G. Rondon, H. Erdjument-Bromage, P. Tempst, J.Q.Svejstrup, T. Lithgow, A. Aguilera, A protein complex containing Tho2, Hpr1,Mft1, and a novel protein, Thp2, connects transcription elongation with mitoticrecombination in Saccharomyces cerevisiae, EMBO J. 19 (2000) 5824–5834.

[6] S. Chavez, A. Aguilera, The yeast HPR1 gene has a functional role intranscriptional elongation that uncovers a novel source of genomeinstability, Genes Dev. 11 (1997) 3459–3470.

[7] J.I. Piruat, A. Aguilera, A novel yeast gene, THO2, is involved in RNA pol IItranscription and provides new evidence for transcriptional elongation-associated recombination, EMBO J. 17 (1998) 4859–4872.

[8] G.S. Wang, T.A. Cooper, Splicing in disease: disruption of the splicing code andthe decoding machinery, Nat. Rev. Genet. 8 (2007) 749–761.

[9] M.J. Moore, P.A. Silver, Global analysis of mRNA splicing, RNA 14 (2008) 197–203.[10] J. Tazi, N. Bakkour, S. Stamm, Alternative splicing and disease, Biochim.

Biophys. Acta 1792 (2009) 14–26.[11] J.P. Orengo, T.A. Cooper, Alternative splicing in disease, Adv. Exp. Med. Biol.

623 (2007) 212–223.[12] D. Baralle, M. Baralle, Splicing in action: assessing disease causing sequence

changes, J. Med. Genet. 42 (2005) 737–748.[13] M.J. Luo, R. Reed, Splicing is required for rapid and efficient mRNA export in

metazoans, Proc. Natl. Acad. Sci. USA 96 (1999) 14937–14942.[14] P. Valencia, A.P. Dias, R. Reed, Splicing promotes rapid and efficient mRNA

export in mammalian cells, Proc. Natl. Acad. Sci. USA 105 (2008) 3386–3391.

[15] J.P. Rodrigues, M. Rode, D. Gatfield, B.J. Blencowe, M. Carmo-Fonseca, E.Izaurralde, REF proteins mediate the export of spliced and unspliced mRNAsfrom the nucleus, Proc. Natl. Acad. Sci. USA 98 (2001) 1030–1035.

[16] M.C. Sammarco, E. Grabczyk, A series of bidirectional tetracycline-induciblepromoters provides coordinated protein expression, Anal. Biochem. 346(2005) 210–216.

[17] E. Grabczyk, K. Usdin, Generation of microgram quantities of trinucleotiderepeat tracts of defined length, interspersion pattern, and orientation, Anal.Biochem. 267 (1999) 241–243.

[18] J. Vanselow, E. Grabczyk, J. Ping, M. Baetscher, S. Teng, M.C. Fishman, GAP-43transgenic mice. Dispersed genomic sequences confer a GAP-43-likeexpression pattern during development and regeneration, J. Neurosci. 14(1994) 499–510.

[19] M.E. Greenberg, L.A. Greene, E.B. Ziff, Nerve growth factor and epidermalgrowth factor induce rapid transient changes in proto-oncogene transcriptionin PC12 cells, J. Biol. Chem. 260 (1985) 14101–14110.

[20] M.C. Sammarco, S. Ditch, A. Banerjee, E. Grabczyk, Ferritin L and H subunits aredifferentially regulated on a post-transcriptional level, J. Biol. Chem. 283(2008) 4578–4587.

[21] S. Masuda, R. Das, H. Cheng, E. Hurt, N. Dorman, R. Reed, Recruitment of the humanTREX complex to mRNA during splicing, Genes Dev. 19 (2005) 1512–1517.

[22] N. Custodio, C. Carvalho, I. Condado, M. Antoniou, B.J. Blencowe, M. Carmo-Fonseca, In vivo recruitment of exon junction complex proteins totranscription sites in mammalian cell nuclei, RNA 10 (2004) 622–633.

[23] J. Shen, L. Zhang, R. Zhao, Biochemical characterization of the ATPase andhelicase activity of UAP56, an essential pre-mRNA splicing and mRNA exportfactor, J. Biol. Chem. 282 (2007) 22544–22550.

[24] H. Shen, X. Zheng, J. Shen, L. Zhang, R. Zhao, M.R. Green, Distinct activities ofthe DExD/H-box splicing factor hUAP56 facilitate stepwise assembly of thespliceosome, Genes Dev. 22 (2008) 1796–1803.

Dual reporter to quantify defects in mRNA processing / A. Banerjee et al. / Anal. Biochem. 395 (2009) 237–243 243

[25] I. Taniguchi, M. Ohno, ATP-dependent recruitment of export factor Aly/REF ontointronless mRNAs by RNA helicase UAP56, Mol. Cell. Biol. 28 (2008) 601–608.

[26] K. Strasser, E. Hurt, Yra1p, a conserved nuclear RNA-binding protein, interactsdirectly with Mex67p and is required for mRNA export, EMBO J. 19 (2000)410–420.

[27] F. Stutz, A. Bachi, T. Doerks, I.C. Braun, B. Seraphin, M. Wilm, P. Bork, E.Izaurralde, REF, an evolutionary conserved family of hnRNP-like proteins,interacts with TAP/Mex67p and participates in mRNA nuclear export, RNA 6(2000) 638–650.

[28] X.D. Fu, A. Mayeda, T. Maniatis, A.R. Krainer, General splicing factors SF2and SC35 have equivalent activities in vitro, and both affect alternative 50

and 30 splice site selection, Proc. Natl. Acad. Sci. USA 89 (1992) 11224–11228.

[29] A. Mayeda, A.M. Zahler, A.R. Krainer, M.B. Roth, Two members of a conservedfamily of nuclear phosphoproteins are involved in pre-mRNA splicing, Proc.Natl. Acad. Sci. USA 89 (1992) 1301–1304.

[30] G. Singh, T.A. Cooper, Minigene reporter for identification and analysis of ciselements and trans factors affecting pre-mRNA splicing, BioTechniques 41(2006) 177–181.

[31] T.A. Cooper, Use of minigene systems to dissect alternative splicing elements,Methods 37 (2005) 331–340.