Awl

Da

b

a

ARRA

KPEAE

1

itvaaaotipapoecap

0d

Enzyme and Microbial Technology 46 (2010) 1–8

Contents lists available at ScienceDirect

Enzyme and Microbial Technology

journa l homepage: www.e lsev ier .com/ locate /emt

functional comparison of the TET aminopeptidases of P. furiosus and B. subtilisith a protein-engineered variant recombining the former’s structure with the

atter’s active site

ivya Kapoora, Balvinder Singhb, Subramanian Karthikeyana, Purnananda Guptasarmaa,∗

Division of Protein Science & Engineering, Institute of Microbial Technology, Sector 39-A, Chandigarh 160036, IndiaDivision of Bioinformatics, Institute of Microbial Technology, Sector 39-A, Chandigarh 160036, India

r t i c l e i n f o

rticle history:eceived 5 March 2009eceived in revised form 7 August 2009ccepted 5 September 2009

eywords:rotein engineering

a b s t r a c t

We have produced and characterized three microbial tetrahedral (TET) aminopeptidases: the previouslyuncharacterized Bacillus subtilis aminopeptidase (BsuAP), a Pyrococcus furiosus aminopeptidase (PfuAP),and a protein-engineered PfuAP-derived ‘designer’ aminopeptidase (MutAP) in which the entire activesite of PfuAP is replaced with that of BsuAP through the making of 9 non-contiguous structure-guidedmutations. The temperature/pH values of optimal function of MutAP (60 ◦C/pH 7.0) were found to becomparable to those of its progenitors, BsuAP (70 ◦C/pH 7.5) and PfuAP (80 ◦C/pH 8.0). The Km of MutAP

nzyme engineeringctive site transplantationnzyme characterization

(3.8 mM) was similar to that of PfuAP (5.0 mM) and unlike that of BsuAP (20.8 mM); however, unlikePfuAP, MutAP showed severe substrate-based inhibition like BsuAP, at substrate exceeding 5 mM con-centration. MutAP thus inherits certain characteristics from each of its progenitors. At the same time, theKcat of MutAP was ∼185-fold lower than that of PfuAP and ∼300-fold lower than that of BsuAP, indicatingan unanticipated slowing down of activity. The results provide tentative evidence that ‘structure-guidedtransplantation’ of active sites between proteins can help in recombining enzyme characteristics in

ated

interesting and unanticip

. Introduction

Enzymes performing the same (or similar) chemical functionsn different organisms generally turn out to have similar overallhree-dimensional structures, and also show significant conser-ation of their amino acid sequences, polypeptide chain lengthsnd domain organization. In particular, in the regions of theirctive sites, a high degree of conservation of residue identitiesnd structural positions is observed. However, such conservationf residue identities and positions is never complete, and varia-ions are seen even amongst homologous enzymes; in particular,n enzymes sourced from entirely unrelated domains of life. It isossible that differences observed in the physical and chemicalspects of enzyme functional behavior (e.g., differences in the tem-erature, or pH, of optimal function, differences in reaction rates,r other enzymatic parameters) amongst structurally homologous

nzymes performing identical chemical reactions upon identi-al substrates, result from these differences in residue usagest active sites. Comparison of residue usages amongst enzymeserforming identical functions in unrelated organisms sourced

∗ Corresponding author. Tel.: +91 172 2636680; fax: +91 172 2690585.E-mail address: pg@imtech.res.in (P. Guptasarma).

141-0229/$ – see front matter © 2009 Elsevier Inc. All rights reserved.oi:10.1016/j.enzmictec.2009.09.003

ways, to help create novel enzymes.© 2009 Elsevier Inc. All rights reserved.

from very different domains of life could provide important cluesto the extent to which differences in functional behavior derivedirectly from differential residue usages at active sites, especiallyif such comparison could be combined with the actual experimen-tal ‘notional transplantation’ of active sites amongst homologousproteins, through rational residue mutations designed to replacethe active site of one protein with that of a homologous pro-tein.

In this paper, we have performed such a comparative exam-ination of the functional behavior of two proteins with partlyoverlapping and partly distinct sets of substrate-binding andcatalytically important residues. We chose to work with aminopep-tidases. Aminopeptidases are an important class of enzymes withwell-known applications in the therapeutic treatment of certaincancers, as well as in the enzymatic residue-by-residue degrada-tion of proteins at their N-termini, especially in N-terminal aminoacid sequencing by non-conventional methods which is critical toadvances in protein biochemistry and proteomics. In particular,deblocking aminopeptidases (of the variety that we have worked

with, in this paper) have been found to be invaluable in the removalof the N-terminal blocking group otherwise preventing proteinsequencing by Edman degradation (e.g., see US Patent 6194190describing the important applications of amino terminal deblock-ing enzymes).

2 icrob

tstadtahmepw

Tarrgfeca

hstpbgasc

sPco2(afi(Iu(T(Lr(t

eBSmPtoiwB

ia

D. Kapoor et al. / Enzyme and M

Thus, one of the two proteins we chose to work with is a puta-ive aminopeptidase sourced from a mesophile bacterium (Bacillusubtilis) which has not yet been demonstrated to be an aminopep-idase; the other protein is a homolog from the hyperthermophilerchaeon, Pyrococcus furiosus, which is known to function as aeblocking aminopeptidase. Following the detailed characteriza-ion of these two proteins, we performed a transplantation of thective site of one of these proteins onto the structural scaffold of theomologous protein, to examine whether this constitutes a viableethod for the carrying-over of functional characteristics from one

nzyme to the other. The transplantation effort resulted in a newrotein with significantly slowed-down aminopeptidase activity,ith important implications for protein sequencing applications.

We now proceed to introduce the two proteins in greater detail.he structure of the B. subtilis protein (PDB ID:1VHE) becamevailable some years ago, following its deposition by a bacte-ial structural genomics group [1]. The protein, which we shallefer to as BsuAP, was classified as a potential aminopeptidase, orlucanase, based on bioinformatics analysis. There have been nourther reports about this protein in the literature. We cloned andxpressed the gene encoding this B. subtilis protein in Escherichiaoli, and provide data in this paper to confirm that it is truly anminopeptidase, and also that it shows deblocking activity.

Pertinently, the structure of an aminopeptidase from Pyrococcusorikoshii (PDB ID:1Y0Y), which we shall refer to as PhoAP, has sub-equently been solved [2,3]. This aminopeptidase is referred to ashe TET aminopeptidase, because of the tetrahedral geometry it dis-lays in the crystal structure. The structures of 1Y0Y and 1VHE haveeen compared, and reported as being highly structurally homolo-ous [2]. The nature of the active site in 1Y0Y has been determined,nd it has been reported that a total of 23 amino acid residues con-titute the pockets and surfaces determining substrate specificity,atalytic activity and release in PhoAP.

There is a PhoAP-homologous enzyme from P. furiosus, which wehall refer to as PfuAP, which shows ∼97% sequence identity withhoAP [4]. All but one of the 23 active site residues of PhoAP areonserved at analogous locations in PfuAP. Comparing the residuesf the P. horikoshii and P. furiosus enzymes, the roles played by the3 residues in the P. furiosus enzyme can be delineated as followsthe corresponding residue numbers for the P. horikoshii enzymere mentioned within parentheses). The S1 hydrophobic speci-city pocket is made up of seven residues: Ile233 (Ile238), Leu288Leu293), Thr232 (Thr237), Asp286 (Glu291), Lys256 (Lys261),le317 (Ile322), and Gly291 (Gly296). The S1′ pocket is madep of six residues: Gly210 (Gly215), Leu211 (Leu216), Glu208Glu213), His318 (His323), Thr293 (Thr298), and Arg215 (Arg220).he product release pocket consists of seven residues: His243His248), Gln245 (Gln250), Val246 (Val241), Asp286 (Glu291),eu289 (Leu294), Thr72 (Thr78) and His63 (His68). The remainingesidues, especially Asp177 (Asp182), Asp230 (Asp235) and Glu207Glu212) are involved in catalysis, with Glu207 (Glu212) acting ashe general base for peptide hydrolysis.

Along with BsuAP, we have also cloned and expressed the genencoding PfuAP to compare its functional features with those ofsuAP. Further, we substituted the residues constituting the S1,1′, catalytic and exit pockets of PfuAP by those of BsuAP, throughutational substitutions of all non-conserved residues. Between

hoAP’s 23 active site residues and BsuAP’s corresponding (struc-urally analogous) residues, 10 residues are different. However, onef these differences is identical to that describing the single residuen PfuAP which is different from PhoAP, and so only 9 mutations

ere required to be made to transform PfuAP’s active site intosuAP’s active site.

The overall rationale/plan of this work was thus to character-ze both (i) BsuAP, and (ii) PfuAP, and to (iii) examine whethern ‘active-site transplant-carrying’ form of PfuAP (which we call

ial Technology 46 (2010) 1–8

‘MutAP’) bearing BsuAP’s active site, effectively recombines thefunctional characteristics of the two progenitor enzymes in anyinteresting ways, with the purpose of stimulating further exper-iments of this nature, with other enzymes.

2. Materials and methods

2.1. Design of a mutant aminopeptidase (MutAP)

Structural superimposition of the polypeptide backbones of P. horikoshiiaminopeptidase, PhoAP (PDB ID:1Y0Y), and B. subtilis aminopeptidase, BsuAP (PDBID:1VHE), was done using the software, LSQMAN [5]. From these, it can be seen thatthe 23 active site residues of PhoAP are mostly conserved in the P. furiosus aminopep-tidase, PfuAP, at analogous positions, with only one exception. Likewise, it can beseen that in BsuAP, 14 of these 23 residues are conserved, with only 9 substitutedby other residues. We mutated these 9 residues in PfuAP into their counterparts inBsuAP, and produced a mutant enzyme that we call ‘MutAP’. The structure-basedalignment of the sequences of BsuAP, PfuAP and PhoAP is shown in SupplementaryFig. S2. The positions of the 23 residues involved in activity, the 9 residues in BsuAPthat are different in PfuAP, and the 14 residues that are conserved between BsuAPand PfuAP are all shown highlighted in Supplementary Fig. S2.

2.2. Gene cloning, protein expression and purification

Genes encoding both BsuAP and PfuAP were amplified from the genomic DNA ofthe respective organisms. P. furiosus genomic DNA was a kind gift from Dr. MichaelW.W. Adams. B. subtilis genomic DNA was prepared from the type strain available inthe Microbial Type Culture Collection (MTCC) at Chandigarh, India. The gene encod-ing a mutant aminopeptidase (MutAP) was designed as described in the sectionimmediately above, and synthesized through splicing by overlap extension basedPCR reaction (SOE-PCR). The gene encoding BsuAP was cloned into the pQE-30 (Qia-gen) vector and expressed in XL-1 Blue E. coli cells. Genes encoding PfuAP and MutAPwere cloned into the pET-23a vector and expressed in BL21DE3pLysS E. coli cells.

The details of PCR conditions used along with primer sequences, strains usedfor protein expression and protein purification profiles (with protocols used) areprovided below for PfuAP, BsuAP and MutAP.

Towards cloning and purification of P. furiosus aminopeptidase (PfuAP) undernon-denaturing conditions, the gene encoding the full-length aminopeptidase wasamplified from genomic DNA of P. furiosus by PCR using primers:

• 5′-ACTTATACTATCGCTAGCGTGGACTATGAACTTTTAAAAAAGG-3′ and• 5′-ACTTATACTATCCTCGAGAATCTTTAGTTCATGTATATG-3′ .

The PCR conditions used were: an initial denaturation at 95 ◦C for 5 min fol-lowed by 30 cycles, each consisting up of template denaturation at 95 ◦C for1 min, primer annealing at 50 ◦C for 2 min and polymerase extension at 72 ◦Cfor 3 min. The polymerase used was PCR Extender system from Eppendorf andthe amplified gene was cloned into an expression vector pET23a using NheIand XhoI restriction sites which were included in the primers (underlined insequences). The vector incorporated a 6× His affinity tag at the C-terminus ofthe gene before the stop codon. The plasmid was then transformed into BL21(DE3) pLysS for overexpression of the protein with affinity tag. The proteinwas purified using the standard protocol of Ni-NTA IMAC (Qiagen) under non-denaturing conditions. The purification profile of P. furiosus aminopeptidase isshown below.

Towards cloning and purification of B. subtilis aminopeptidase (BsuAP) undernon-denaturing conditions, the DNA fragment encoding the full-length aminopep-tidase was obtained from genomic DNA of B. subtilis by PCR using primers:

• 5′-ACTTATACTATCGGATCCGCAAAATTAGATGAAACATTGACC-3′ and• 5′-ACTTATACTATCAAGCTTCTATTGGTAAGTAATTTCGTCAACCG-3′ .

The PCR conditions used were: an initial denaturation at 95 ◦C for 5 min fol-lowed by 30 cycles, each consisting of template denaturation at 95 ◦C for 1 min,primer annealing at 50 ◦C for 2 min and polymerase extension at 72 ◦C for 3 min.Deep Vent DNA polymerase was used for the PCR. The amplified gene was clonedinto an expression vector pQE30 using BamHI and HindIII restriction sites incorpo-rated in the primers (underlined in sequences). The 6× His affinity tag was obtainedfrom the vector at the N-terminus and the stop codon was included in the primersequence before Hind III site. The plasmid with cloned gene was transformed intoXL-1 Blue for protein expression and the protein was purified using the standard pro-tocol of Ni-NTA IMAC (Qiagen) under non-denaturing conditions. The purification

profile of B. subtilis aminopeptidase is shown below.

Towards cloning and purification of mutant aminopeptidase (MutAP) undernon-denaturing conditions, the gene encoding the mutant aminopeptidase wassynthesized by splicing by overlap extension PCR (SOE-PCR) using P. furiosusaminopeptidase DNA as template and mutagenic primers to incorporate mutationsat the required sites. The following primers were used to perform SOE-PCR:

icrobial Technology 46 (2010) 1–8 3

TTGGGATAGCTGC-

GATCG-

(

Annealingtemp./time

Extensiontemp./time

Product (bp) Enzyme Mg2+ conc.(mM)

45 ◦C; 1 min 72 ◦C; 1 min 246 bp Deep Vent 4 mM60 ◦C; 2 min 72 ◦C; 3 min 447 bp Deep Vent 4 mM60 ◦C; 2 min 72 ◦C; 3 min 138 bp Deep Vent 6 mM50 ◦C; 2 min 72 ◦C; 3 min 162 bp Deep Vent 6 mM55 ◦C; 2 min 72 ◦C; 3 min 213 bp Deep Vent 4 mM55 ◦C; 2 min 72 ◦C; 3 min 567 bp Deep Vent 4 mM50 ◦C; 2 min 72 ◦C; 3 min 792 bp Deep Vent 4 mM5

6

a1Cwpns

2

tv2oTi(

2

etFsra

2

hs

2

(s1cFApaaicm

D. Kapoor et al. / Enzyme and M

(1) 5′-ACTTATACTATCGCTAGCGTGGACTATGAACTTTTAAAAAAGG-3′

(2) 5′-CTTTTCAATTTGCGTGACCATCAGTCCAATTTGATCCATATGGG-3′

(3) 5′-ATGGTCACGCAACTTGAAAAGAATGGATTTCTCAGAGTTGCTCC-3′

(4) 5′-GGCACTTGTTTTCGCACCTCTTAACCCAACCTCCTCCTGCACTGTGGCC-3′

(5) 5′-GGTGCGAAAACAAGTGCCTTTGGAATTAATCCCGATTACGGTTTTGCGATTGATG3′

(6) 5′-CATTATAATGATTGCAGTGCCCTTTCCAAGTTGAGTTTGAGCCTTTTTCTCTGG-3′

(7) 5′-CCAGAGAAAAAGGCTCAAACTCAACTTGGAAAGGGCACTGCAATCATTATAATG3′

(8) 5′-GTCTGTACCTCCCCCGGCAATAATATCCCACTGG-3′

(9) 5′-CAGTGGGATATTATTGCCGGGGGAGGTACAGACGCTGGGGC-3′

10) 5′-ACTTATACTATCCTCGAGAATCTTTAGTTCATGTATATG-3′

Rxn no. Forwardprimer

Reverseprimer

Template DNA

1 Primer1 Primer2 Pyrococcus furiosus aminopeptidase DNA2 Primer3 Primer4 Pyrococcus furiosus aminopeptidase DNA3 Primer5 Primer6 Pyrococcus furiosus aminopeptidase DNA4 Primer7 Primer8 Pyrococcus furiosus aminopeptidase DNA5 Primer9 Primer10 Pyrococcus furiosus aminopeptidase DNA6 Primer3 Primer6 Products of reactions 2 and 37 Primer1 Primer6 Products of reactions 1 and 68 Primer7 Primer

10Products of reactions 4 and 5

9 Primer1 Primer10

Products of reactions 7 and 8

The amplified gene was cloned into an expression vector pET23a using NheInd XhoI restriction sites which were included in the primers (underlined in primerand 10) and an affinity tag of six histidines was introduced into the gene at the

-terminus using the vector sequence before the stop codon. The resultant plasmidas transformed into BL21 (DE3) pLysS for overexpression of the protein and therotein was purified using the standard protocol of Ni-NTA IMAC (Qiagen) underon-denaturing conditions. The purification profile of mutant aminopeptidase ishown below.

.3. Gel filtration chromatography

The Bio-Rad Duo-Flow chromatographic system was used to perform gel fil-ration chromatography using an Amersham Superdex-200 Tricorn column (bedolume∼24 ml) with a void volume of 8–9 ml. The column was pre-equilibrated with0 mM Phosphate buffer pH 8.0, containing 300 mM NaCl. Equal volumes (100 �l)f BsuAP, PfuAP and MutAP of equal concentration (∼0.4–0.5 mg/ml) were loaded.he calibration of the Superdex-200 Tricorn was performed by using the follow-ng standards: vitamin B12 (1.3 kDa), myoglobin (17 kDa), ovalbumin (44 kDa), IgG158 kDa), thyroglobulin (670 kDa)

.4. Circular dichroism spectroscopy

Far-UV CD spectra were collected on a Jasco J-810 spectropolarimeter. Withach protein, a concentration of 0.1 mg/ml was used and the spectra were acquiredhrough scanning in the range of 250–190 nm, using a cuvette of 0.1 cm path length.or measuring thermal stability, the same cuvette was used with a 0.9 cm metalpacer block heated by the Peltier attachment of the J-810 instrument, at a heatingate of 3 ◦C/min. The raw data were converted to mean residue ellipticity (MRE) datand plotted.

.5. Dynamic light scattering

A Delsa-Nano-Zetasizer from Beckman-Coulter was used to determine theydrodynamic volume and polydispersity profile of each protein, using proteinamples of 2.0 mg/ml concentration, for dynamic light scattering experiments.

.6. Aminopeptidase activity assays

For aminopeptidase activity assays, the chromogenic substrate, H-Ala-pNABachem), was used. A stock solution of 500 mM substrate was made in dimethylulfoxide (DMSO), and the working substrate concentration used in assays was0 mM for temperature and pH profile studies of activity. The working substrateoncentration used for other activity studies was varied between 0.1 and 50 mM.or deblocking activity experiments, the substrate used was Ac-Ala-pNA (Bachem).ll other conditions were as described above for H-Ala-pNA. For temperature and

H profiles of activity, PfuAP and BsuAP were incubated at a variety of temperatures,nd using different values of pH, using protein of 1 mg/ml final concentration in thessay, along with 10 mM substrate, in 20 mM Tris buffer of pH 7.0, using 10 minncubations, and monitoring change in absorbance at 405 nm (with subtraction ofontrol). With MutAP, incubation was done for 1 h, and using 10 mg/ml protein; itay be noted that data above 80 ◦C could be underestimated, due to some thermal

5 ◦C; 2 min 72 ◦C; 3 min 342 bp Deep Vent 2 mM

0 ◦C; 1 min 72 ◦C; 2 min 1080 bp Deep Vent 4 mM

precipitation observed above this temperature. For pH vs. activity profiles, citratebuffer was used for pH values 3, 4, 5 and 6; Tris for pH 7 and 8 and carbonate-bicarbonate for pH 9 and 10, with PfuAP incubated at 60 ◦C, BsuAP at 70 ◦C, andMutAP at 60 ◦C, all other conditions remaining the same as above. For determina-tion of Km and Kcat , BsuAP and PfuAP were used at 0.2 mg/ml final concentration, andMutAP at 2.0 mg/ml, with 30 min incubations at 50 ◦C. Substrates used were eitherH-Ala-pNA, or the blocked substrate, Ac-Ala-pNA, with use of various substrate con-centrations. In all assays, an initial delay was observed to precede the linear rise inabsorbance prior to saturation of the detector. In no case did we monitor the reac-tion to observe the saturation of the reaction itself, mainly because we used highprotein and substrate concentrations to obtain high signal/noise ratio data for theinitial velocity measurements. All data plotted in the graphing software Origin 8.0and initial velocities were estimated as the slopes of the linear range of the rise inabsorbance for each substrate concentration. Subsequently, data were transformedinto Hanes plots plotting substrate concentration [S] (in molar terms) on the x-axis,and the ratio [S]/v on the y-axis, where v was the slope obtained for that substrateconcentration. The Hanes plot data was subjected to linear fitting and the equations(y = mx + C) determined for each protein/enzyme were used to determine Km as thex-intercept of the line (−Km) for a y value of zero. The amount of substrate releasedper unit time per unit amount of protein/enzyme used (Kcat) was calculated, forcomparisons amongst the different samples, for the reaction using a substrate con-centration of 1 mM H-Ala-pNA, using an extinction coefficient of 9910 M−1 cm−1 forcolor development at 405 nm.

3. Results and discussion

3.1. BsuAP, PfuAP and MutAP have similar hydrodynamicvolumes

Fig. 1 shows data from both gel filtration (panels A, C and E)and dynamic light scattering (DLS) (panels B, D and F) for the threeproteins. The gel filtration data was collected using 0.4–0.5 mg/mlprotein in 20 mM phosphate (pH 8.0) containing 300 mM NaCl. TheDLS data was collected using concentrations of 2 mg/ml in the samebuffer, in the absence of salt. In all three proteins, it is clear thatthe primary population consists of either a single peak eluting at10.6 ml (in BsuAP; panel A) or two closely spaced peaks at elu-tion volumes of 9.5 ml and 10.5 (in MutAP and PfuAP; panels Cand E). The 9.5 ml elution corresponds to a size of approximately∼700 kDa. It is known from the crystal structures of BsuAP andPfuAP that these proteins possess a dimerization domain, and that

the basic structural unit is a dimer. This dimer, made up of twoidentical subunits of ∼40 kDa each, is observed to trimerize into ahexamer, which then further dimerizes into a tetrahedron-shapeddodecamer with a molecular weight of ∼480 kDa [1,2]. Thus, the9.5 ml elution of a ∼700 kDa species probably corresponds to two

4 D. Kapoor et al. / Enzyme and Microbial Technology 46 (2010) 1–8

F P, Mup utiond ment

ahrtt

ippl∼o(mfscd

ig. 1. Panels A, C and E present gel filtration chromatograms of the purified BsuAeaks are marked with vertical lines to draw attention to the correspondence of elistribution data against hydrodynamic diameter, for the same order of proteins as

ssociated ∼480 kDa dodecamer, behaving like an object with aydrodynamic radius smaller than expected. The 10.5 elutions cor-espond to expected molecular weights of ∼400 kDa, indicatinghat populations with these elution volumes might correspond tohe dodecamer with tetrahedral geometry.

In MutAP, the population of the dodecamer is seen to bencreased in relation to the presumed double-dodecamer, as com-ared to PfuAP. In the case of BsuAP, only the dodecamericopulation is seen. In addition, in BsuAP, there is also a popu-

ation eluting at ∼14 ml with an estimated molecular weight of60 kDa. We think that this population could correspond to any onef the following three states: (i) an equilibrium between the dimer∼80 kDa) and monomer (∼40 kDa) forms, (ii) a partially unfolded

onomer with a hydrodynamic radius larger than that expectedor a monomer, or (iii) a very compact dimer. There are also smallerpecies visible in all three proteins, at 17.0 and 19.5 ml, which couldorrespond to degradation products that become dissociated, andetectable, on account of the presence of 300 mM salt.

tAP and PfuAP proteins, respectively, on a Superdex-200 Tricorn column. Elutionsvolumes between panels. Panels B, D and F plot dynamic light scattering intensityioned above.

To examine further whether the proteins form loose polydis-perse aggregates of dodecamers, or monodisperse populations, wecollected DLS data which is shown in Fig. 1B, D and F. These figurespresent data on the hydrodynamic radii of the three proteins, inthe absence of salt. BsuAP, PfuAP and MutAP can be clearly seento have a population with a diameter of ∼17–19 nm. In MutAP, inaddition to this population, there is also a minority population ofprotein with a diameter of ∼650 nm (not seen in the panel, becauseof the scale used for comparison with the other two proteins).

3.2. BsuAP, PfuAP and MutAP are highly thermostable

The far-UV CD spectrum of BsuAP (Fig. 2A) is quite different

from that of MutAP (Fig. 2C), and PfuAP (Fig. 2E), while the spectraof MutAP and PfuAP are entirely similar to each other, as would beexpected, considering that only nine amino acid residues are of dif-ferent identity in the two proteins. All three proteins can be seen tobe highly structured, with similar MRE signal strengths and spectral

D. Kapoor et al. / Enzyme and Microbial Technology 46 (2010) 1–8 5

F d PfuAa above

sa(wfcbapsiDt

3d

tua

ig. 2. Panels A, C and E present far-UV CD spectra of the purified BsuAP, MutAP ant 216 nm with changing temperature, for the same order of proteins as mentioned

hapes indicative of both alpha helical content (from the two neg-tive bands at 208 and 222 nm) and beta sheet and other contentfrom the signal strength of only about −10,000 deg cm2 dmol−1,hile this would have been expected to be four to five times higher

or a purely helical protein). BsuAP appears to have a higher heli-al content than the other two proteins, because the negative CDand at 222 nm is much more pronounced in this protein (Fig. 2E),lthough the negative band at 208 nm is quite similar in all threeroteins (Fig. 2A, C and E). All three proteins are of similar thermaltabilities. Heating up to a temperature of 98 ◦C results in no signif-cant loss of secondary structural content in any of them (Fig. 2B,

and F), suggesting that these enzymes are folded into extremelyhermally stable three-dimensional structures.

.3. BsuAP, MutAP and PfuAP are all aminopeptidases, witheblocking activity

Fig. 3A shows raw data profiles of rise in absorbance with passingime of incubation at 50 ◦C (pH 8.0) for BsuAP acting against the reg-lar substrate, H-Ala-pNA. Fig. 3B shows similar profiles of activitygainst the blocked substrate, Ac-Ala-pNA. There is a rise in the ini-

P proteins, respectively. Panels B, D and F plot changes in mean residue ellipticity.

tial absorbance with increasing substrate concentration, as mightbe expected. What is immediately obvious from a cursory perusal ofthe data is that at intermediate concentrations the slope (reactionvelocity) becomes similar for different concentrations, In the corre-sponding profiles for the activity of MutAP against regular (Fig. 3C)and blocked substrates (Fig. 3D), also this trend is seen. It may benoted that the protein concentration used for the MutAP profilesis 10-fold higher (2.0 mg/ml) than that used for BsuAP and PfuAP(0.2 mg/ml). With PfuAP, the activity against regular and blockedsubstrates is shown, respectively, in Fig. 3E and F.

Fig. 4 shows the Michelis–Menten plots for all three proteins. Itis clearly seen that BsuAP shows extremely non-Michelis–Mentenkinetics, with severe substrate-based inhibition at higher con-centrations of substrate, whereas PfuAP shows only a very mildinhibition. BsuAP is also seen to be nearly twice as active as PfuAPat low substrate concentrations. Strikingly, in the inset to Fig. 4, it is

observed that PfuAP carrying BsuAP’s active site (i.e., MutAP) showssevere substrate-based inhibition like BsuAP and entirely unlikePfuAP, suggesting that this is a functional characteristic dependenton the microstructural features of the active site of BsuAP whichhave survived transplantation onto the structure of PfuAP.

6 D. Kapoor et al. / Enzyme and Microbial Technology 46 (2010) 1–8

F 5 nma proteis

kcuoa

TM

ig. 3. Panels A, C and E raw activity data showing changes in the absorbance at 40nd increasing concentrations of substrate, for purified BsuAP, MutAP and PfuAPubstrate Ac-Ala-pNA, for the same order of proteins as mentioned above.

Since two of the three proteins displayed non-Michelis–Menten

inetics, of course, the entire range of data could not be used foronstructing Hanes plots for determination of Km. Therefore, wesed only the data for the initial concentrations prior to the onsetf substrate-based inhibition, and the determined values of Km

re shown in Table 1. The table also shows the Kcat values for the

able 1easured enzyme kinetic parameters of the progenitor aminopeptidases (Bsu AP and Pfu

Enzyme Substrate used Kma

Bsu AP 1 mM H-Ala-pNA 20.80 mMPfu AP 1 mM H-Ala-pNA 5.05 mMMut AP 1 mM H-Ala-pNA 3.80 mM

a In a Hanes plot, the x-intercept for y = 0 is equal to Km .b Molar extinction coefficient, ε, used for H-Ala-pNA was 9910 M−1 cm−1.

(generated by hydrolysis of the regular substrate H-Ala-pNA) as a function of time,ns, respectively. Panels B, D and F plot similar data for the N-terminally blocked

three enzymes and the equations, and other parameters (e.g., molar

extinction coefficient of hydrolysed substrate, etc.) used for calcu-lation of Km and Kcat. It may be noted that although MutAP showssevere substrate-based inhibition like its BsuAP progenitor, its Km

of ∼3.8 mM is much closer to that of its PfuAP progenitor (∼5 mM),signaling that the mutant protein takes some characteristics from

AP) and the active transplant-carrying aminopeptidase (Mut AP).

Kcatb Hanes plot slope (m) and y-intercept (C) [y = mx + C]b

21.20 pmol �g−1 min−1 y = 69.1262x + 1.438512.96 pmol �g−1 min−1 y = 449.03x + 2.270.07 pmol �g−1 min−1 y = 9100.36x + 34.52

D. Kapoor et al. / Enzyme and Microb

Fig. 4. Michaelis–Menten data for the three proteins, BsuAP (filled square), MutAP(M

Fa

square with centre cross) and PfuAP (open square). The inset shows the data forutAP using an expanded scale.

ig. 5. Panels A, C and E present temperature vs. relative activity profiles for the purified Bctivity profiles, for the same order of proteins as mentioned above.

ial Technology 46 (2010) 1–8 7

both of its progenitors, although its overall activity is much poorerthan both of its progenitors, being ∼185-fold poorer than PfuAP and∼300-fold poorer than BsuAP.

3.4. BsuAP, PfuAP and MutAP are all optimally active between 60and 80 ◦C

Fig. 5 shows the temperature vs. activity and pH vs. activityprofiles of all three proteins. The temperature of optimal activity(Topt) and pH of optimal activity (pHopt) of BsuAP are seen to be70 ◦C, and pH 7.5, respectively (Fig. 5A and B). Likewise the Topt

and pHopt of PfuAP are seen to be 80 ◦C, and pH 8.0, respectively(Fig. 5E and F), while those of MutAP are seen to be 60 ◦C and pH7.0–8.0, respectively (Fig. 5C and D). In other words, while BsuAPis from a mesophile organism, its thermal stability (Fig. 2B) andits Topt are almost indistinguishably close to those of PfuAP, whichis from a hyperthermophile archaeon. While this came to us as a

big surprise, as we were expecting this protein to have a muchlower Topt, it may be noted that many secreted proteins from Bacil-lus species display an unusually high thermostability, despite theorganism’s being a mesophile. Another thing that came to us as asurprise was the finding that MutAP has a much lower Topt than

suAP, MutAP and PfuAP proteins, respectively. Panels B, D and F plot pH vs. relative

8 icrob

taaea

7oaltepasst

3

srtctstyaatapst

[

[

[

[

D. Kapoor et al. / Enzyme and M

he PfuAP progenitor from which it inherits all but 9 of its aminocid residues. Interestingly, MutAP showed thermal precipitationt temperatures above 80 ◦C, and this could explain the appar-ntly lower Topt, since we could have underestimated the activityt higher temperatures owing to protein precipitation.

Notably, the pH of optimal activity of BsuAP turned out to be.0–8.0, very close to the pH of 8.0 determined to be the pH ofptimal activity of the P. furiosus homolog. The comparably highctivities seen at pH values of 6.0 and 9.0 (both >80%), and the shal-ow rate of drop of activity away from the pH range of 7.0–8.0,ogether suggest that BsuAP is capable of acting with comparablefficiencies at acidic as well as alkaline pH values close to neutralH, which is not something shared by PfuAP. Both PfuAP and MutAPlso display severe precipitation at pH 4.0 and below, explaining theharp drop in activity at low pH values. Thus, obviously, BsuAP isuperior to PfuAP both in terms of its overall activity and in terms ofhe range of temperatures and pH over which it shows high activity.

.5. General discussion

Recently, we happened to successfully transplant the entireubstrate-binding and catalytically active surface of a cellulase,eplacing it with that of another homologous cellulase, based onhe rational remodeling of the entire solvent-exposed face of aurved beta sheet responsible for forming a groove and grippinghe cellulose chain substrate [6]. In the present paper, we end uphowing how transplantation of the active site alone (rather thanhe entire active surface involved in substrate-binding and catal-sis) can affect chemical parameters associated with the enzymectivity of the progenitor proteins, such as the rate of catalysis, theffinity for the substrate, and the nature of substrate-based inhibi-

ion. Interestingly, lowering of the rate of catalysis of an enzyme liken aminopeptidase, without compromising substrate affinity, couldotentially be of utility in experiments and applications requiringlow progressive removal of N-terminal residues. This is somethinghat we appear to have achieved through the active site transplan-

[

[

ial Technology 46 (2010) 1–8

tation experiment. The other thing of note is the ‘carrying-over’of the substrate-based inhibition from the enzyme active as activesite ‘donor’ to the enzyme acting as ‘acceptor. These results areof importance not just in research relating to aminopeptidases,but also in the possible carrying out of such experiments in otherenzymes as well, to develop novel reagents with the recombinedproperties of multiple enzyme progenitors.

Acknowledgements

DK thanks the CSIR, New Delhi, for a doctoral research fel-lowship. PG thanks CSIR, INSA and DBT, New Delhi, for grants toresearch protein folding, aggregation, stability and engineering.Dr. Michael W.W. Adams (University of Georgia, Athens, USA) isthanked for kindly providing us with a gift of P. furiosus genomicDNA.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.enzmictec.2009.09.003.

References

1] Badger J, Sauder JM, Adams JM, Antonysamy S, Bain K, Bergseid MG, et al. Struc-tural analyses of a set of proteins resulting from a bacterial genomics project.Proteins 2005;60:787–96.

2] Borissenko L, Groll M. Crystal structure of TET protease reveals complementaryprotein degradation pathways in prokaryotes. J Mol Biol 2005;346:1207–19.

3] Russo S, Baumann U. Crystal structure of a dodecameric tetrahedral-shapedaminopeptidase. J Biol Chem 2004;279:51275–81.

4] Tsunasawa S. Purification and application of a novel N-terminal deblockingaminopeptidase (DAP) from Pyrococcus furiosus. J Protein Chem 1998;17:521–2.

5] Kleywegt GJ. Use of non-crystallographic symmetry in protein structure refine-ment. Acta Crystallog Sect D 1996;52:842–57.

6] Kapoor D, Kumar V, Chandrayan SK, Ahmed S, Sharma S, Datt M, et al. Replace-ment of the active surface of a thermophile protein by that of a homologousmesophile protein through structure-guided ‘protein surface grafting’. BiochimBiophys Acta 2007;1784:1771–6.