A Maize Early Responsive to Dehydration Gene, ZmERD4,Provides Enhanced Drought and Salt Tolerancein Arabidopsis

Yinghui Liu & Huiyong Li & Yunsu Shi & Yanchun Song &

Tianyu Wang & Yu Li

Published online: 11 June 2009# Springer-Verlag 2009

Abstract Early responsive to dehydration (ERD) genescould be rapidly induced to respond to dehydration and tovarious other abiotic stresses. Here, we report on an ERDgene (ZmERD4) from maize cloned by rapid amplification ofcomplementary DNA (cDNA) ends. The ZmERD4 cDNAhad a total length of 2,536 bp with an open reading frame of2,196 bp, 5′-untranslated region (UTR) of 48 bp, and 3′-UTRof 292 bp. The gene encoded a predicted polypeptide of 732amino acids. The ZmERD4 protein shared a high amino acidsequence similarity with ERD4 of Oryza sativa andArabidopsis thaliana. A reverse-transcription polymerasechain reaction analysis revealed that ZmERD4 was constitu-tively expressed in different tissues. RNA gel blot showedthat ZmERD4 could be induced by both drought and salt

stress and also responded to abscisic acid treatment, but itwas not induced by low temperature (4°C). TransgenicArabidopsis plants constitutively expressing the ZmERD4gene under the control of the 35S cauliflower mosaic virus35S promoter exhibited slightly smaller-sized leaves undernormal growing conditions. Moreover, 35S::ZmERD4 trans-genic plants displayed enhanced tolerance to water deficit andhigh salinity when compared to wild-type plants. Altogether,these findings suggested that ZmERD4 played an importantrole in early stages of plant adaptation to stress conditions andmight be useful in improving plant tolerance to abiotic stress.

Keywords ZmERD4 . Stress . Gene expression .Maize .

Transgenic Arabidopsis

AbbreviationsERD early responsive to dehydrationABA abscisic acidRT-PCR reverse-transcription polymerase chain

reactionORF open reading frameCaMV 35S cauliflower mosaic virus 35S promoter

Introduction

Plants respond to water stress, a major environmental factorthat affects plant growth and development, at physiological,cellular, and molecular levels. There are several reportedplant genes that are induced by water stress, and these playvarious functions in stress tolerance (Bray 1997; Ingramand Bartels 1996; Shinozaki and Yamaguchi-Shinozaki1997; Seki et al. 2007). Water stress-induced genes can be

Plant Mol Biol Rep (2009) 27:542–548DOI 10.1007/s11105-009-0119-y

Yinghui Liu and Huiyong Li contributed equally to this study.

Y. Liu :Y. Shi :Y. Song : T. Wang (*) :Y. Li (*)Institute of Crop Science, Chinese Academy of AgriculturalSciences/The National Key Facility for Crop Gene Resources andGenetic Improvement (NFCRI), 12 Zhongguancun South Street,Beijing 100081, Chinae-mail: wangtianyu@263.come-mail: yuli@mail.caas.net.cn

Y. Liue-mail: leely519@126.com

Y. LiuHebei North University,Zhangjiakou 075000 Hebei Province, China

H. LiThe Cereal Crops Institute,Henan Academy of Agricultural Sciences,1 Nongye Road,Zhengzhou 450002, China

divided into two categories based on the time of induction,i.e., responsive to dehydration and early responsive todehydration (ERD; Shinozaki and Yamaguchi-Shinozaki1997). To date, a total of 16 complementary DNAs (cDNAs)for ERD genes have been isolated from 1-h-dehydrated A.thaliana (Yamaguchi-shinozaki 1998; Kiyosue et al. 1994a,b). These genes are associated with ClpA/B adenosinetriphosphate (ATP)-dependent protease, heat shock protein(HSP) 70-1, S-adenosyl-methionine-dependent methyltrans-ferases, membrane protein, proline dehydrogenase, sugartransporter, senescence-related gene, heat shock protein,glutathione-S-transferase, group II LEA (late embryogenesisabundant) protein, chloroplast and jasmonic acid biosynthesisprotein, hydrophilic protein, and ubiquitin extension protein,among others (Kiyosue et al. 1993, 1994a, b, 1997; Simpsonet al. 2003; Taji et al. 1999).

In Arabidopsis, ERD1 encodes a ClpA (ATP bindingsubunit of the caseinolytic ATP-dependent protease) homol-ogous protein, which is not only induced by dehydration butit is also upregulated during both natural and dark-inducedsenescence; however, it does not respond to either cold orabscisic acid (ABA) treatment (Kiyosue et al. 1993, 1997).Three ERDs (ERD2, ERD8, and ERD16) are identified asHSP cognates (AtHSP70-1, AtHSP81-2, and ubiquitinextension protein, respectively), which are responsive todehydration stress in A. thaliana. Signaling pathways forexpression of these genes under conditions of dehydrationstress are not primarily mediated by ABA (Kiyosue et al.1994a, b). ERD5 encodes a precursor of proline (Pro)dehydrogenase (ProDH), which is a mitochondrial enzymeinvolved in the first step of the conversion of Pro to glutamicacid (Nakashima et al. 1998). ERD6 encodes a putative sugartransporter that is induced not only by dehydration but alsoby cold treatment (Kiyosue et al. 1998). ERD10 and ERD14are very similar to those of group II LEA proteins that arestrongly induced in rosette plants of Arabidopsis within 1 hby dehydration, cold and ABA, but not by 2,4-dichloro-phenoxy-acetic acid, 2,4-D, benzyl adenine, and gibberellicacid (Kiyosue et al. 1994a, b). ERD15, a small acidic protein,is a negative regulator of the early stages of stress-relatedABA signaling in plants and mediates crosstalk betweenabiotic and biotic stress responses (Kariola et al. 2006). InArabidopsis, ERD4 is an integral protein with ten predictedtransmembrane domains; however, its function has not beenwell characterized although it has been identified as part ofthe chloroplast envelope proteome (Froehlich et al. 2003).

In a previous study, a suppression subtractive hybridiza-tion (SSH) library was constructed using drought-treatedunpollinated silks and ears of maize (Li et al. 2007). A uni-expressed sequence tag (EST) set was found to share a highsequence similarity with ERD4 genes of both O. sativa andA. thaliana. In this study, cloning and functional analysis ofa novel ZmERD4 gene from maize are presented.

Materials and Methods

Plant Material and Stresses Treatment

A drought-tolerant maize inbred line “CN165” was used.Plants were grown in pots of 30 cm in diameter and 50 cmin depth, each containing 20-kg soil mix (soil–vermiculite–organic fertilizer=3:2:1) and maintained under a rainoutshelter. Prior to subjecting plants to a stress treatment, equalvolumes of water were applied to each pot every other dayto keep the plants in all pots under uniform water statusconditions.

Two-week-old seedlings were subjected to either salt(100 mM NaCl), cold (4°C), or ABA (100 μM) stresses.Five seedlings were harvested at each given time points andimmediately frozen in liquid nitrogen. Slow soil droughtstress was applied by withholding water until the soilhumidity reached 30–35%. At each time point, five seed-lings were harvested after 1, 2, 3, 4, 5, and 7 days andimmediately frozen in liquid nitrogen. Nonstressed controlplants were grown in parallel and harvested at similar timepoints. All tissues collected for RNA extraction were storedat −70°C until needed.

Isolation of Full-Length cDNA of ZmERD4

Primers for rapid amplification of cDNA ends (RACE) weredesigned according to a 426-bp EST, obtained from apreviously constructed SSH library (Li et al. 2007), cor-responding to a gene homologous to ERD4 of rice (japonicacultivar group, XP_476646). Total RNA was extracted fromunpollinated ears and silks of maize, collected at six timepoints, and bulked equally, using the Invitrogen Trizolreagent protocol (Invitrogen, San Diego, CA, USA). Poly(A) RNA was isolated using Oilgotex according to themanufacturer’s protocol (Qiagen, Hilden, Germany).

cDNA templates for 5′- and 3′-RACE were synthesizedusing the SMARTTM RACE cDNA Amplification Kit(Clontech, Palo Alto, USA). Primer sequences for 5′- and3’-RACE were as follows: ZmERD4-R1, 5′-GGCTGGAAGCAGGGGCACGAGAAC-3′, and for ZmERD4-F1, 5′-GGTGTCGCATACTTTGCCCTCGGA-3′. A specific nested5′-RACE primer was also designed as follows: ZmERD4-R-N: 5′- AAGCAGGGGCACGAGAACGGACGC-3′. All am-plified RACE fragments were sequenced three times for eachsample.

Based on 5′-RACE and 3′-RACE results, full-lengthprimers for ZmERD4 were designed as follows (includinginitiation and termination codons): ZmERD4-F2, 5′- AAACGAACAGCACCAGAACC -3′, and ZmERD4-R2, 5′- CCATCAGAAATCCCACACGAAT -3′. Amplification andsequencing of the full-length cDNA of ZmERD4 wererepeated using three replicates.

Plant Mol Biol Rep (2009) 27:542–548 543

RNA Gel Blot Analysis and RT-PCR

Total RNA was extracted from different tissues at differentdeveloping stages and under different stress treatment con-ditions using the Trizol reagent according to the manufacturer’sprotocol (Invitrogen). Total RNA (20 μg) was separated on1.0% agarose gel denatured with formaldehyde. Followingelectrophoresis, gels were blotted onto a Hybond-N+nylonmembrane (Amersham, Little Chalfont, UK). The ZmERD4 3′-untranslated region (UTR) labeled with 32P-dCTP was used asa probe. Northern blot hybridization was performed using thestandard protocols, and signals were captured using theMolecular Imager FX System (Bio-Rad, CA, USA).

Semiquantitative RT- PCR was conducted using thefollowing ZmERD4-specific primers, ZmERD4-F3: 5′-TCCTCTGTGCTGTCCATCTTG-3′ and ZmERD4-R3: 5′-GCCTTGTGCCCTCAGTATTAC-3′. A 1.0-μg total RNAtemplate was used in the PCR reaction mix in a one-step RT-PCR kit (Takara, Tokyo, Japan). A maize Actin gene, used asa control, with the following primer: Actin-F1, 5′-GCATCACACCTTCTACAACGA-3′, and Actin-R1, 5′-CAGCCTGGATAGCAACATACAT-3′. PCR conditions were as follows:3 min at 95°C, 28 cycles of 30 s at 94°C, 30 s at 58°C, and90 s at 72°C, and a final extension step of 5 min at 72°C.

The ZmERD4 Construct and Transformation of Arabidopsis

The full-length cDNA of ZmERD4 was digested with NcoIand BstEII, subcloned into the corresponding site of themodified pCAMBIA-3301 cloning vector and driven by thecauliflower mosaic virus (CaMV) 35S promoter. The fusiongene construct was transferred to Agrobacterium tumefa-ciens strain GV3101.

Transformation of Arabidopsis was performed using thefloral dip method (Clough and Bent 1998). Seeds wereharvested and placed on the selection medium containingphosphinothricin (0.05%) to identify transgenic plants.Presence of the transgene was confirmed by PCR analysis.The messenger RNA (mRNA) levels of ZmERD4 weredetected by RNA gel blots. Homozygous T4 lines wereobtained by self-crossing and used in stress treatmentexperiments.

Drought and Salt Stress Treatments of Wild-Typeand Transgenic Arabidopsis

For drought stress, transgenic and control plants weregrown for 4 weeks with a constant watering before thewater was withheld. Water was withheld for 15 days, andthen plants were provided with a daily water regime. Allsurviving plants were scored after 5 days. In total, eightpots (four plants in each pot) of transgenic Arabidopsiswere used in this assay and repeated three times.

For salt stress, transgenic and control seeds were sown inPetri plates containing Murashige and Skoog (MS) mediumsupplemented with different NaCl concentrations, including0, 75, and 100 mM. Five plates were used in each NaCltreatment and about 30 seeds were soiled on each plate.Plates were incubated at 4°C for 2 to 3 days to ensureuniform germination and then incubated at 22°C. Percentseed germination was scored after 7 days.

All above experiments were repeated three times.

Bioinformatics Analysis of ZmERD4

The full-length cDNA of ZmERD4 was subjected to BLASTnand BLASTx analyses. The amino acid sequence wasdeduced using the DNAMAN software (version 5. 0, www.lynnon.com). The ClustalW was used for amino acidsequence alignment (http://www.ch.embnet.org/software/ClustalW.html). Prediction of the ZmERD4 protein structurewas conducted used the following website: http://www.expasy.org. Transmembrane prediction was conducted usingTMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) and SOSUI engine v. 1.11 software (http://bp.nuap.nagoya-u.ac.jp/sosui/sosui_submit.html).

Results

Molecular Cloning and Tissue-Specific ExpressionAnalysis of ZmERD4

Using RACE, the full-length ZmERD4, of 2,536 bp in length(GenBank accession no. EU348754), was obtained. TheZmERD4 gene consisted of 2,196-bp open reading frame(ORF), 48-bp 5′-UTR, and 292-bp 3′-UTR. The ORF waspredicted to encode a polypeptide of 732 amino acids. Thededuced amino acid of ZmERD4 shared sequence similarityto ERD4 of other plants, e.g., 81% to OsERD4 from O. sativa(BAC82906), 57% toAtERD4 fromA. thaliana (NP_564354),and 56% to a Brassica rapa ERD4 (ABV89652).

Based on RT-PCR analysis, mRNA levels of ZmERD4 inroots, stems, leaves, silks, and ears were similar (Fig. 1),

R ST L S I E

ZmERD4

Actin

Fig. 1 Expression analysis of ZmERD4 by RT-PCR. RNA wasextracted from different tissues and used for RT-PCR. The presenceof ZmERD4 mRNA was detected by PCR amplification of a 400-bpproduct. R, ST, L, SI, and E correspond to mRNA isolated from root,stem, leaf, silk, and ear tissues, respectively. Actin from maize wasamplified as an internal control using specific primers

544 Plant Mol Biol Rep (2009) 27:542–548

thus suggesting that this gene was constitutively expressedat the transcription level.

Responses of ZmERD4 to Different Abiotic Stressesand ABA Treatment

Transcripts of ZmERD4 in maize leaves were induced after1 day following drought stress and reaching highest levels

by the second day following drought treatment (Fig. 2a).However, there were no significant differences in transcriptlevels following cold (4°C) treatment, indicating thatZmERD4 was not induced under low-temperature stress(Fig. 2b). ZmERD4 also responded to high ABA andsalinity treatments, and the highest levels of transcriptswere detected at 3 and 6 h following treatment, respectively(Fig. 2c, d). These data suggested that ZmERD4 was a

0h 1h 3h 6h 10h 18h 24h

ZmERD4

rRNA

ZmERD4

rRNA

0d 1d 2d 3d 4d 5d 7dba

c d0h 1h 3h 6h 12h 24h0h 3h 12h 24h1h 6h

Fig. 2 Expression of ZmERD4 in maize seedlings subjected to variousstress treatments. a Drought treatment over a period of 7 days. b Coldtreatment at 4°C for 24 h. c Treatment with 100 µM ABA for 24 h. dTreatment with 100 mM NaCl for 24 h. Approximately, micrograms

of total RNA was blotted and hybridized with a 32P-labeled ZmERD4cDNA probe. rRNA stained with ethidium bromide is shown as aloading control

WT 35S::ZmERD4

c

WT 35S::ZmERD4 lines

ZmERD4

rRNA

4 13 15 20 24 25

a

b

500bp

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Fig. 3 Molecular characteriza-tion and phenotypes of ZmERD4overexpressing transgenicArabidopsis plants. a Detectionof ZmERD4 transgenic by PCRusing genomic DNA isolatedfrom control plants (1 and 2)and transgenic lines (3 to 15).Molecular marker is shown onthe left. b mRNA levels of4-week-old wild-type andindependent 35S::ZmERD4transgenic lines grownunder normal conditions.c Morphological comparisons of3-week-old plants of wild-typeand ZmERD4 overexpressinglines under normal growthconditions

Plant Mol Biol Rep (2009) 27:542–548 545

stress-related gene and might be involved in plant adapta-tion to environmental stresses.

Phenotypic and Expression Analysis of ZmERD4in Transgenic Arabidopsis Plants

Over 30 independent transgenic lines were generated; thesewere confirmed to carry the ZmERD4 by PCR analysis(Fig. 3a). Transcript levels of the ZmERD4 under normalgrowth conditions in T4 transgenic lines were furtherdetected by Northern blot analysis (Fig. 3b). Transgeniclines 4, 13, 24, and 25, exhibiting high ZmERD4 mRNAaccumulation, were selected for further analysis.

Under normal growth conditions, transgenic lines consti-tutively overexpressing ZmERD4 demonstrated slight growthretardation compared with wild-type control plants (Fig. 3c).

Overexpression of ZmERD4 Enhanced Drought and SaltTolerance in Arabidopsis

All wild-type (control) plants subjected to drought stress bywithholding water for 15 days displayed wilting; however,most transgenic plants continued to exhibit normal growth(Fig. 4a). After rewatering for 5 days, the majority of

control plants was unable to recover and eventually died,whereas most of transgenic lines continued to be healthy(Fig. 4b). Approximately 80–90% of transgenic plantssuccessively survived and continued to grow, as opposedto wild-type plants (44.44%) under severe water stressconditions (Fig. 4b).

When plants were subjected to salt stress, significantdifferences were observed between transgenic and wild-type plants for a number of parameters (Fig. 5a–c). Theroots and shoots of control plants were reduced about 40%in the presence of 75 mM NaCl than the normal condition(0 mM NaCl), while growth of the transgenic was lessimpaired (28–29% reduction) by this high salinity (Fig. 5d).In addition, germination of wild-type seeds was reduced by38% and 78% under 75 and 100 mM NaCl, respectively.On the other hand, germination of transgenic seeds of lines4 and 25 was less affected, with 10–20% reduction under75 mM NaCl and 40–50% reduction under 100 mM NaCl,respectively (Fig. 5e). Thus, both seed germination andseedling growth of 35S::ZmERD4 transgenic plants weremore tolerant to high salinity than that of wild-type plants.These findings, in conjunction with drought stress results,indicated that ZmERD4 might be involved in plantresponses that counteract unfavorable growth conditions.

Discussion

To survive drought and high-salinity conditions, plantsrespond and adapt to stresses by inducing expression of anumber of genes. It has been reported that ERDs are rapidlyinduced in response to various stresses (Shinozaki andYamaguchi-Shinozaki 1997). A total of 16 ERD genes havebeen isolated from Arabidopsis that had been dehydratedfor a short duration, 1 h (Kiyosue et al. 1994a, b). So far,only few members of the ERDs have been characterized byfunctional analysis studies, such as ERD1, ERD14, andERD15 (Simpson et al. 2003; Alsheikh et al. 2003; Kariolaet al. 2006). ERD4, a putative integral protein, wasidentified as a part of the chloroplast envelope proteome(Froehlich et al. 2003), but functional analysis of thecorresponding gene(s) has not been well reported. Thus,analysis of the function of ZmERD4 might shed some lighton the molecular mechanisms involved in the response ofmaize to water stress as well as to other stress conditions.

Some ERD genes in Arabidopsis, such as AtERD1,AtERD2, AtERD8, and AtERD16, could not be regulated byABA (Kiyosue et al. 1993, 1994a, b, 1997). But AtERD10and AtERD14 could be induced under ABA treatment(Kiyosue et al. 1994a, b). In this study, ZmERD4 was alsoinduced in the presence of ABA, and transcript levelsreached highest levels after 3 h under ABA treatment(Fig. 2). This indicated that expression of ZmERD4 was

WT 4 13 240

20

40

60

80

100

surv

ival

rat

e

WT35S-ZmERD4

b

a

Fig. 4 Responses of wild-type and transgenic ZmERD4 Arabidopsisunder water stress conditions (grown under a daily water regime for4 weeks, followed by 15 days of no water and then 5 days ofrewatering). a Following 15 days of withheld water, wild-type plantsdisplayed wilting, while transgenic plants appeared to exhibit normalgrowth. b Frequency of survival of plants following 5 days ofrewatering. Each bar corresponds to mean values of at least 20 plants±SD of three replications

546 Plant Mol Biol Rep (2009) 27:542–548

under the ABA-dependent pathway. The expression pat-terns of ZmERD4 were very similar to those of AtERD4which could be induced by both drought and ABA (Huanget al. 2008).

To explore the function of ZmERD4, 35S::ZmERD4transgenic Arabidopsis plants were generated. Ectopicexpression of ZmERD4 contributed to a clearly distinctphenotype in comparison with control plants. More im-portantly, overexpression of ZmERD4 enhanced toleranceof transgenic plants to both drought and salt stresses (Figs. 4and 5). The precise role of ZmERD4 in stress responseremains unknown and further studies must be conducted toelucidate this role. Nevertheless, this novel maize ERD4gene is involved in plant adaption to stress conditions andmay function in the defense mechanism against abioticstresses. Further analyses are currently being undertaken toassess those physiological and molecular mechanismsinvolved.

The results of protein structural analysis have shown thatZmERD4 has nine protein kinase C (PKC) phosphorylationsites and 14 casein kinase II (CK2) phosphorylation sites(data not shown). As CK2 and PKC play important roles incell cycle regulation and cell signal transduction, thepresence of phosphorylation sites in ZmERD4 suggeststhat it may be regulated by CK2 and PKC and likely to beinvolved in cell signal transduction pathways. Additionally,

three N-myristoylation sites have been identified in theZmERD4 protein. N-terminal myristoylation plays a vitalrole in membrane targeting and signal transduction in plantresponse to environmental stress. This is essential for thefunction of the protein in mediating membrane associationsor protein–protein interactions (Ishitani et al. 2000; Johnsonet al. 1996). Furthermore, the secondary structure ofZmERD4 contains 11 transmembrane regions. Comparedto ERD4 in Arabidopsis (AtERD4), ZmERD4 is an integralmembrane protein with 11 predicted transmembranedomains, while AtERD4 has ten transmembrane domains.Integral membrane proteins, a large family of receptors,attach cells to the matrix and exert extraordinary controlson cell adhesion, migration, proliferation, and survival.Integrins recognize cues encoded by the extracellularmatrix and convert them into complex biochemical signalsthat control the behavior of cells (Deepak et al. 2005;Shimaoka et al. 2002; Vinogradova et al. 2004).

In conclusion, ZmERD4 is a novel drought-related genein maize. Our results demonstrate that this novel maizeZmERD4 gene functions in the early stages of plantadaptation to stress conditions and may be useful inimproving tolerance to abiotic stresses in plants. However,further studies are required to understand the interactionbetween ZmERD4 and other genes and evaluate models ofphysiological and biochemical functions of ZmERD4.

WT 35S::ZmERD4

35S::ZmERD4

WT

ba

WT 35S::ZmERD4

35S-ZmERD4 WT

d e

c

Fig. 5 Response of Arabidopsis plants to salt stress. Seeds of wild-type and transgenic plants (of lines 4 and 25) were germinated in amedium supplemented with 0 mM (a), 75 mM (b), and 100 mM NaCl

(c). Length of seedlings was compared (d). Germination of wild-typeand transgenic lines in the presence of 75 mM NaCl (left) and100 mM NaCl (right; e). Values correspond to means ± SD (n=30)

Plant Mol Biol Rep (2009) 27:542–548 547

Acknowledgements The research was supported by the 973 project(grant no. 2006CB101700), the 863 project (grant no.20060110Z1141), and the National Natural Science Foundation (grantno. 30571133).

References

Alsheikh MK, Heyen BJ, Randall SK (2003) Ion binding properties ofthe dehydrin ERD14 are dependent upon phosphorylation. J BiolChem 278:40882–40889. doi:10.1074/jbc.M307151200

Bray EA (1997) Plant responses to water deficit. Trends Plant Sci2:48–54. doi:10.1016/S1360-1385(97)82562-9

Clough SJ, Bent AF (1998) Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana.Plant J 16:735–743. doi:10.1046/j.1365-313x.1998.00343.x

Deepak S, Chua GH, Li KB, Tang F, Krishnan A (2005) pSLIP: SVMbased protein subcellular localization prediction using multiplephysicochemical properties. BMC Bioinformatics 6:152.doi:10.1186/1471-2105-6-152

Froehlich JE, Wilkerson W, Ray WK, McAndrew RS, Osteryoung KW,Gage DA, Phinney BS (2003) Proteomic study of the Arabidopsisthaliana chloroplastic envelope membrane utilizing alternativesto traditional two-dimensional electrophoresis. J Proteome Res2:413–425. doi:10.1021/pr034025j

Huang DQ, Wu WR, Suzanne RA, Adrian JC (2008) The relationshipof drought-related gene expression in Arabidopsis thaliana tohormonal and environmental factors. J Exp Bot 59:2991–3007.doi:10.1093/jxb/ern155

Ingram J, Bartels D (1996) The molecular basis of dehydrationtolerance in plants. Annu Rev Plant Physiol Plant Mol Biol47:377–403. doi:10.1146/annurev.arplant.47.1.377

Ishitani M, Liu J, Halfter U, Kim CS, Shi W, Zhu JK (2000) SOS3function in plant salt tolerance requires N-myristoylation andcalcium binding. Plant Cell 12:1667–1677

Johnson LN, Noble MEM, Owen DJ (1996) Active and inactiveprotein kinases: structural basis for regulation. Cell 85:149–158.doi:10.1016/S0092-8674(00)81092-2

Kariola T, Brader G, Helenius E, Li J, Heino P, Tapio PE (2006) Earlyresponsive to dehydration 15, a negative regulator of abscisicacid responses in Arabidopsis. Plant Physiol 142:1559–1573.doi:10.1104/pp.106.086223

Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1993) Characteriza-tion of a cDNA for a dehydration-inducible gene that encodes aClp A, B-like protein in Arabidopsis thaliana L. Biochem BiophysRes Commun 196:1214–1220. doi:10.1006/bbrc.1993.2381

Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994a) Character-ization of Two cDNAs (ERD10 and ERD14) corresponding to

genes that respond rapidly to dehydration stress in Arabidopsisthaliana. Plant Cell Physiol 35:225–231

Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994b) Cloning ofcDNA for genes that are early responsive to dehydration-stress(ERDs) in Arabidopsis thaliana L.: identification of three ERDsas HSP cognate genes. Plant Mol Biol 25:791–798. doi:10.1007/BF00028874

Kiyosue T, Shinozaki K, Yamaguchi-Shinozaki K (1997) A nucleargene encoding a chloroplast-targeted Clp protease regulatorysubunit homolog is not only induced by water stress but alsodevelopmentally upregulated during senescence in Arabidopsisthaliana. Plant J 12:851–861. doi:10.1046/j.1365-313X.1997.12040851.x

Kiyosue T, Abe H, Yamaguchi-Shinozaki K, Shinozaki K (1998)ERD6, acDNA clone for an early dehydration-induced gene of Arabidopsis,encodes a putative sugar transporter. Biochim Biophys Acta1370:187–191. doi:10.1016/S0005-2736(98)00007-8

Li HY, Wang TY, Shi YS, Fu JJ, Song YC, Wang GY, Li Y (2007)Isolation and characterization of induced genes under droughtstress at the flowering stage in maize (Zea mays). DNA Seq18:445–460. doi:10.1080/10425170701292051

Nakashima K, Satoh R, Kiyosue T, Yamaguchi-Shinozaki K,Shinozaki K (1998) A gene encoding proline dehydrogenase isnot only induced by proline and hypoosmolarity, but is alsodevelopmentally regulated in the reproductive organs of Arabi-dopsis. Plant Physiol 118:1233–1241. doi:10.1104/pp.118.4.1233

Seki M, Umezawa T, Urano K, Shinozaki K (2007) Regulatorymetabolic networks in drought stress responses. Curr Opin PlantBiol 10:296–302. doi:10.1016/j.pbi.2007.04.014

Shimaoka M, Takag J, Springer TA (2002) Conformational regulation ofintegrin structure and function. Annu Rev Biophys Biomol Struct31:485–516. doi:10.1146/annurev.biophys.31.101101.140922

Shinozaki K, Yamaguchi-Shinozaki K (1997) Gene expression andsignal transduction in water-stress response. Plant Physiol115:327–334. doi:10.1104/pp.115.2.327

Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K,Yamaguchi-Shinozaki K (2003) Two different novel cis-actingelements of erd1, a clpA homologous Arabidopsis gene functionin induction by dehydration stress and dark-induced senescence.Plant J 33:259–270. doi:10.1046/j.1365-313X. 2003.01624.x

Taji T, Seki M, Yamaguchi-Shinozaki K, Kamada H, Giraudat J,Shinozaki K (1999) Mapping of 25 drought-inducible genes, RDand ERD, in Arabidopsis thaliana. Plant Cell Physiol 40:119–123

Vinogradova O, Vaynberg J, Kong X (2004) Membrane-mediatedstructural transitions at the cytoplasmic face during integrinactivation. Proc Natl Acad Sci U S A 101:4094–4099. doi:10.1073/pnas.0400742101

Yamaguchi-shinozaki K (1998) Stress response of photosyntheticorganisms. Academic, New York, pp 13–163

548 Plant Mol Biol Rep (2009) 27:542–548