a multifunctional therapy approach for cancer: targeting raf1- … · a multifunctional therapy...

MOLECULAR CANCER THERAPEUTICS | SMALL MOLECULE THERAPEUTICS

A Multifunctional Therapy Approach for Cancer:Targeting Raf1- Mediated Inhibition of Cell Motility,Growth, and Interaction with the Microenvironment A CLimin Zhang1,2, Abhinandan Pattanayak1,Wenqi Li1, Hyun-Kyung Ko1, Graham Fowler1, Ryan Gordon1, andRaymond Bergan1

ABSTRACT◥

Prostate cancer cells move from their primary site of origin,interact with a distant microenvironment, grow, and therebycause death. It had heretofore not been possible to selectivelyinhibit cancer cell motility. Our group has recently shown thatinhibition of intracellular activation of Raf1 with the small-molecule therapeutic KBU2046 permits, for the first time, selec-tive inhibition of cell motility. We hypothesized that simulta-neous disruption of multiple distinct functions that drive pro-gression of prostate cancer to induce death would result inadvanced disease control. Using a murine orthotopic implanta-tion model of human prostate cancer metastasis, we demonstratethat combined treatment with KBU2046 and docetaxel retainsdocetaxel's antitumor action, but provides improved inhibition ofmetastasis, compared with monotherapy. KBU2046 does notinterfere with hormone therapy, inclusive of enzalutamide-

mediated inhibition of androgen receptor (AR) function andcell growth inhibition, and inclusive of the ability of castration toinhibit LNCaP-AR cell outgrowth in mice. Cell movement isnecessary for osteoclast-mediated bone degradation. KBU2046inhibits Raf1 and its downstream activation of MEK1/2 andERK1/2 in osteoclasts, inhibiting cytoskeleton rearrangement,resorptive cavity formation, and bone destruction in vitro, withimproved effects observed when the bone microenvironment ischemically modified by pretreatment with zoledronic acid. Usinga murine cardiac injection model of human prostate cancer bonedestruction quantified by CT, KBU2046 plus zoledronic exhibitimproved inhibitory efficacy, compared with monotherapy. Thecombined disruption of pathways that drive cell movement,interaction with bone, and growth constitutes a multifunctionaltargeting strategy that provides advanced disease control.

IntroductionThe abnormal movement of cancer cells throughout the body, their

ability to interact with distant organ sites, and to grow constituteseparate cellular functions whose integration results in end-organdestruction and ultimately death. The underlying biological processesthat drive these functions are collectively known as the hallmarks ofcancer (1). Hallmarks related to growth and survival are proximallyresponsible for the development and outgrowth of primary andmetastatic tumors, while the hallmark termed invasion and metastasisdrives the movement of cancer throughout the body and mediates itsinteraction with distant vital organs. Increased cell motility andresultant metastasis is the process by which the vast majority of solidorgan cancers cause death (2, 3). Considering all forms of cancer,metastasis is responsible for up to 90%ofmortality (4), and for prostatecancer it is responsible for essentially 100% (5, 6).

An approach that coordinately engages targets of pathways thatdrive distinct functions that act together to sustain cancer at the

systemic level represents a rational therapeutic strategy. Cell motilitydrives invasion and metastasis (7). Historically, there has been aninability to selectively target processes related to cell motility (8). Acentral aspect to this longstanding roadblock relates to the fact that awide array of gene products have been shown to regulate cell motility,but essentially all lack specificity (8). Recent advances by our grouphave identified a novel regulatory mechanism, demonstrating thatinhibition of Raf1 activation inhibits cell motility and resultantmetastasis across several comprehensive and complementaryin vitro and in vivo models (9). These advances by us were achievedby our designed synthesis of the small-molecule therapeutic,KBU2046, that operates through a heretofore unknown mechanismultimately inhibiting activation of Raf1, as previously described byus (9). In brief, it binds in a cleft formed when HSP90b interfaces withits co-chaperone CDC37. It thereby acts as a selective HSP90 activitymodulator (SHAM) agent, selectively modulating the activity of clientproteins that regulate cell motility, with inhibition of Raf1 activationbeing of central importance. Classical HSP90 inhibitors bind toHSP90, inhibit its chaperone cycle, inclusive of ATP hydrolysis, andbroadly disrupt client protein function resulting in protein degrada-tion. KBU2046 is distinctly different: it does not bind HSP90 inisolation, binds to a cleft formed at the interface of where HSP90binds to the co-chaperone CDC37, and thereby will only bind to theHSP90/CDC37 heterocomplex. This results in precision modulationof chaperone function, resulting in decreased binding of Raf1 to theHSP90/CDC37 heterocomplex, decreased phosphorylation of ser338on Raf10s activation motif, and decreased Raf1 kinase activity. Fur-thermore, Raf1was shown tomodulate cellmotility, and tomediate thepharmacologic action of KBU2046 on inhibition of cell motility. Theseadvances now permit selective inhibition of cell motility via a Raf1-targeting strategy.

1Division of Hematology/Oncology, Knight Cancer Institute, Oregon Health &Science University, Portland, Oregon. 2Department of Urology, Huashan Hos-pital, Fudan University, Shanghai, China.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

Corresponding Author: Raymond Bergan, Oregon Health & Science University,L586, 3181 SW Sam Jackson Park Road, Portland, OR 97239. Phone: 503-494-5325; Fax: 503-494-4285; E-mail: [email protected]

Mol Cancer Ther 2020;19:39–51

doi: 10.1158/1535-7163.MCT-19-0222

�2019 American Association for Cancer Research.

AACRJournals.org | 39

on June 24, 2021. © 2020 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst October 3, 2019; DOI: 10.1158/1535-7163.MCT-19-0222

http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-19-0222&domain=pdf&date_stamp=2019-12-16http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-19-0222&domain=pdf&date_stamp=2019-12-16http://mct.aacrjournals.org/

We have a long standing ability to target cancer cell growth andviability through a relatively diverse array of targeted strategies (10).Conversely, our ability to manipulate the interaction between cancerand distant organ sites, while feasible, has in general been less fruitful.Specifically, in the case of bone, bisphosphonates have been shown tophysically bind bone mineral (i.e., calcium–phosphate, in the form ofhydroxyapatite), to modify its structure and to inhibit its destructionby metastatic cancer (11). However, bisphosphonates are not consid-ered highly effective, and their use is not without toxicity. Considerprostate cancer, bone metastases are present in over 90% of those withmetastatic disease, and in the majority of cases, bone is the only site ofmetastasis (2). Bone metastases dominates the clinical management ofthese patients, causing pain, bone fracture, spinal cord and nerve rootcompression, bone marrow replacement, hypercalcemia, and theyserve as a major reservoir of tumor burden. Together these adverseclinical consequences of bonemetastasis constitutemajor contributorsto morbidity and mortality (12). Against this backdrop of bonedestruction, the bisphosphonate, zoledronic acid (ZA), has beenshown to decrease adverse events due to bone destruction in menwith metastatic prostate cancer, and its administration is consideredstandard practice (11). However, ZA only delays bone destruction,and the absolute difference in incidence compared with controls isonly 11%.

We hypothesized that simultaneous disruption of pathways drivingdistinct functions that sustain cancer systemically would result inadvanced disease control. In this study, we demonstrate that thisrepresents a viable approach that should be investigated further.Specifically, studies demonstrate the increased control of systemicdisease when Raf1 and microtubules are targeted, providing forcombined disruption of motility and growth regulatory pathways.Furthermore, they demonstrate increased control of systemic diseasewhen Raf1 and the bonemicroenvironment are targeted, providing forcombined disruption of pathways regulating motility and honing tobone.We also went on to demonstrate for the first time the therapeuticrelevance of inhibiting cellmotility in osteoclasts, through inhibition ofRaf1 activation, leading to disruption of actin reorganization andinhibition of bone-destructive resorptive cavity formation. Together,these findings support further investigations of a multi-functiontargeting paradigm and one involving inhibition of cell motility inparticular.

Materials and MethodsCell culture and reagents

The following prostate cancer cell lines, PC3, LNCaP, and VCaPwere obtained from ATCC, the constitutively active luciferase–expressing PC3-luc cell line was obtained from PerkinElmer, theoriginal characteristics of PC3-M cells have been previously describedby us (13). The constitutively active luciferase–expressing PC3-M-luccell line was established by transducing the parental cell line withpGL4.50 luciferase reporter (Promega), and culturing under hygro-mycin selection for stable integration. The LNCaP/AR-luc cell line waskindly provided byCharles Sawyers (Memorial SloanKetteringCancerCenter, New York, NY; ref. 14).

The osteoclast precursor mouse macrophage cell line, RAW 264.7,was obtained from ATCC. All cells were cultured as described pre-viously (9, 13, 15) and were maintained at 37�C in a humidifiedatmosphere of 5% carbon dioxide with biweekly media changes. Allcell lines were drawn from stored stock cells, and replenished on astandardized periodic basis and were routinely monitored for Myco-plasma (PlasmoTest, InvivoGen). Cells were authenticated as follows:

they were acquired from the originator of that line, grown underquarantine conditions, expanded and stored as primary stocks, and notused until following conditions were met: Mycoplasma negative;through morphologic examination; growth characteristics; hormoneresponsiveness; or lack thereof. KBU2046was synthesized as describedpreviously (9). Enzalutamide (#S1250), docetaxel (#S1148), and ZA(#S1314) were purchased from Selleckchem, and reconstituted per themanufacturer's recommendations.

Cytotoxicity assays and colony formation assaysTo assess the impact of cytotoxic chemotherapy on prostate cancer

growth kinetics 7-day soft agar colony formation assays and 3-dayMTT cell growth inhibition assays were performed as described byus (16).MTT assays were in replicates ofN¼ 3, and were repeated, softagar assays were in replicates of N ¼ 2 and are presented as meannumber of colonies expressed as percent of untreated controls.

Reverse transcription and qPCR analysisRNAwas isolated and reverse transcription quantitative PCR (qRT-

PCR) performed as previously described by us (17). Resultant datawere analyzed using the 2�DDCt method (18), normalized to GAPDH,for the following primer/probe sets (ABI) prostate-specific antigen(PSA) (Hs02576345_m1) and GAPDH (Hs99999905_m1). Assayswere performed in triplicate, and were repeated.

Enzalutamide-mediated cell growth inhibition assaysEnzalutamide-mediated growth inhibition was assessed using Sul-

forhodamine B (SRB) growth inhibition assays, were performed asdescribed previously (19). In brief, LNCaP and VCaP cells werepreincubated in charcoal-striped medium for 48 hours and thenseeded (1.9 � 104) in 96-well plates. Cells were stimulated with 1.0nmol/L R1881 and treated for 72 hours with 10 mmol/L KBU2046 orvehicle control in the presence or absence of 10 mmol/L enzalutamide,and subsequently SRB assays were performed. Assays were in repli-cates of N ¼ 6, and were repeated.

Subcellular localization of androgen receptorLNCaP and VCaP cells were preincubated in the charcoal-striped

medium containing 10 mmol/L KBU2046 or vehicle control for72 hours. Cells were then stimulated with 1.0 nmol/L R1881 andtreated for 24 hours with 10 mmol/L KBU2046 or vehicle control in thepresence or absence of 10 mmol/L enzalutamide. The nuclear andcytosolic subcellular fractions of the cells were prepared using the NE-PERNuclear and Cytoplasmic Extraction Kit (Pierce) according to themanufacturer's instructions. Protein was quantified by BCA Assay(Thermo Fisher Scientific), the per manufacturer's instructions.

Western blot analysisWestern blots were performed as described by us (9, 16). All

Western blots were repeated at least once. Antibodies recognizingandrogen receptor (AR, #5153S), Lamin B1 (#13435), and a-Tubulin(#3873) phospho-c-RAF (ser338) (#9427), c-Raf (#53745), MEK 1/2(#12671), phospho-MEK1/2 (#9121), ERK1/2 (#4695), phospho-ERK1/2 (#4370), GAPDH (#2118), antimouse IgG-HRP linked secondary(#7076), and anti-rabbit IgG-HRP linked secondary (#7074) antibo-dies were purchased from Cell Signaling Technology. Pierce ECLWestern blotting substrate (#32106) and SuperSignal West Femtomaximumsensitivity substrate (#34096)were purchased fromThermoFisher Scientific. All primary antibodies were used at a dilution of1:1,000 and corresponding secondary antibodies used at a dilution of1:5,000.

Zhang et al.

Mol Cancer Ther; 19(1) January 2020 MOLECULAR CANCER THERAPEUTICS40



http://mct.aacrjournals.org/

ImmunofluorescenceRaw 264.7 cells were grown in differentiation medium (described

below), with or without KBU2046, for 4 days on a Chamber Slide(Nunc Lab-Tek). Chambers were washed once with PBS, followed by10-minute fixation in cold 10% neutral-buffered formalin (VWR) anda post-fixation wash with PBS. Permeabilization was achieved withincubation in 0.1% Triton X-100 (Sigma) for 5 minutes, and thenblocked overnight at 4�C with 1% BSA (Sigma) containing 10% goatserum (Thermo Fisher Scientific), 0.3mol/L glycine (Sigma), and 0.1%PBS-Tween20. The cells were then incubated for 2 hours at 4�C inDylight Phallodin (Cell Signaling technology, #12935) antibody dilut-ed 1:40 in 1� PBS with 1% BSA and 0.3% Triton X-100. Subsequently,the slidewaswashed oncewith PBS, a coverslipmountedwith ProLongGoldAntifade Reagent withDAPI (Cell Signaling Technology, #8961),and imaged on a Confocal Microscope (Nikon/Yokogawa SpinningDisc).

Bone degradation assaysLow passage (p � 4) RAW 264.7 cells were suspended in

osteoclast differentiation media [MEM-alpha (Gibco) with 10% FBS,1% antibiotic-antimycotic, and 50 ng/mL RANKL (EMD Millipore,R0525)] and plated in 96-well Osteo Surface Assay plates (Corning)at 5,000 cells per well. For wells receiving ZA treatment, theosteosurface was precoated for 30 minutes at 25�C with the indicatedconcentration of ZA suspended in sterile water, followed by a gentlerinsing in sterile water to remove free compound prior to plating ofcells. Cells were treated with 10 mmol/L KBU2046 or control for6 days with the media and treatment refreshed on day 4. On day 6,the wells were washed with PBS, and cellular material removed by a5-minute incubation in a 10% bleach solution followed by a throughrinsing with ultrapure water. To visualize the resultant osteoclast-mediated bone degradation, the intact mineralized matrix wasstained following the manufacture's recommendations (Corning)utilizing a modified Von Kossa staining protocol. The resultantstained surfaces were imaged and subsequently evaluated using the“BoneJ” plugin of ImageJ. All treatments were performed in replicateof N ¼ 3, and were repeated.

ApoTox-Glo assayThe ApoTox-Glo Triplex Assay (Promega) was performed to assess

cell viability, cytotoxicity, and caspase-3/7 activation, per the manu-facturer's instructions. In brief, 5000 RAW 264.7 cells were plated in96-well assay plates and cultured in the osteoclast differentiationmedia for 4 days, at which point the media was replenished with orwithout KBU2046 and cell responses measured after 24, 48, and72 hours following the manufacture's protocol.

Animal models of systemic effects and metastasisAll animal studies adhered to theNIHGuide for the Care andUse of

LaboratoryAnimals, were treated under InstitutionalAnimal Care andUse Committee–approved protocols by Oregon Health and SciencesUniversity, complied with all federal, state, and local ethical regula-tions, and their design and implementation followed sanctionedguidelines (20). Animals were housed in barrier (for immunocom-promised mice) facilities, with a 12-hour light/dark cycle and givensoy-free food and water ad libitum.

Animal study sample size determinationSample sizes were determined using the sample size estimation

formula for differences in means with power set 80%, two-sided a ¼0.05, and a prespecified effect size of 30%.

Prostate cancer subcutaneous implantationA total of 2.5� 105 PC3-M cells in sterile PBS were implanted into

the right flank of 6- to 7-week-old male athymic nude mice (CharlesRiver Laboratories) and tumor growthmeasurements were performedtwice a week as previously described by us (21). Treatment via oralgavage 5 days per week with 80 mg/kg KBU2046 or vehicle control(sesame oil), as well as weekly intraperitoneal injections of docetaxel(0 and 20 mg/kg) began 18 days post implantation when tumorsreached our enrollment criteria of approximately 200–300 mm3.Experimental groups were randomly assigned to cages prior to theinitiation of the study. Tumor measurements were obtained in ablinded fashion, and tumor volumeswere calculatedwith the followingformula: length � (width)2 � 0.5.

Prostate cancer orthotopic implantationOrthotopic implantation of 2.5� 105 PC3M-luc into 7- to 8-week-

old male athymic mice was performed as previously described byus (9, 22). Daily oral gavage treatment with 150 mg/kg KBU2046 orwas initiated 3 days prior to implantation and continued throughoutthe duration of the study. Weekly intraperitoneal injections with7.5 mg/kg docetaxel or control were administered beginning 1 weekpost implantation. Primary tumor out growth was monitored viaweekly in vivo imaging system (IVIS imaging). At the completion ofthe study the primary tumor was resected and weighed and lungs wereresected and snap frozen. To determine the human prostate cancermetastatic burden in each mouse lung, the snap frozen tissue waspulverized, DNA isolated, andAlu-sequencing performed as describedpreviously (23). The following custom TaqMan primer probe set wasutilized: forward primer (101 F) GGTGAAACCCCGTCTCTACT,reverse primer (206 R) GGTTCAAGCGATTCT CCTGC, and hydro-lysis probe (144RH) CGCCCGGCTAATTTTTGTAT. The 144RHprobe was labeled with a 50 fluorescent reporter (6-FAM) and a 30

fluorescent quencher (Black Hole Quencher). The relative content ofhuman DNA was calculated by using the comparative CT method, CT(sample) –CT (negative control). All samples were run in triplicate andwere repeated.

Castration-resistant prostate cancer subcutaneous implantationSix- to 7-week-old male athymic mice received trans-scrotal bilat-

eral orchiectomy with a single incision in the midline of scrotumsunder general anesthesia and then allowed to recover for 10 days.Following the recovery period, mice received a subcutaneous implan-tation of 2.0 � 106 LNCaP/AR-luc into the right flank as previouslydescribed by us (21). Treatment with 80 mg/kg KBU2046 or controlwas administered via oral gavage 5 times weekly starting 4 weeks post-implantation, prior to the emergence of the castration-resistant phe-notype, and continued for 12 weeks. Experimental groups wererandomized prior to the initiation of treatment. Twice weekly tumormeasurements were performed and AR activity monitored biweeklythrough IVIS imaging.

Castration-resistant prostate cancer orthotopic implantationCastrations of athymic mice were performed as described above,

and following a 2-week recovery period, orthotopic implantations of5.0 � 105 LNCaP/AR-luc were performed as previously described byus (9, 22). Biweekly IVIS imaging was performed to assess AR activityand treatment with 80 mg/kg KBU2046 or control via oral gavage5 times weekly began 12 weeks post-implantation, as the castration-resistant phenotype began to emerge, and continued for duration of4weeks. Experimental groupswere randomly assigned to cages prior tothe initiation of the study.

Multifunctional Targeting Improves Systemic Cancer Control

AACRJournals.org Mol Cancer Ther; 19(1) January 2020 41




Prostate cancer intracardiac injectionIntracardiac injection of 4.0 � 105 PC3-luc cells into the left

ventricle of 7- to 8-week-old athymic mice under ultrasound guidancewas performed as previously described by us (9). Weekly intraperi-toneal injections of 100mg/kg ZA or vehicle control (PBS) began 7 daysprior to the intracardiac injection and continued throughout theduration of the study, whereas daily oral gavage treatment with150 mg/kg KBU2046 or control began 3 days prior to the intracardiacinjection. All treatments were randomly assigned to cages prior to theinitiation of the study. IVIS imaging was performed 30 minutes postintracardiac injection to confirm systemic distribution of cells andconducted weekly starting 7 days post injection, continuing for aperiod of 4 weeks. Animals were excluded from the analysis if 30-minute post-injection IVIS imaging revealed a focal signal only in thechest indicating a failed injection where cells were not distributed intocirculation. CT radiographic imaging of the entire cohort was per-formed with an Inveon X-ray mCT Scanner (Inveon, Siemens) at thecompletion of the study. Resultant images were analyzed in a blindedfashion using Inveon Research Workplace 4.2 visualization/analysissoftware and ImageJ. Specifically, to assess metastasis-associated bonedestruction, images were exported from the Inveon workplace in theDigital Imaging and Communications inMedicine format for analysisin ImageJ. Each imported imagewas adjusted to a commonbrightness/contrast threshold and the “Stack! Crop (3D)” and “volume viewer”plugins were utilized to performmultiplanar reconstruction (MPR) ofregions of interest (ROI, mandible and femurs). Utilizing the MPR ofthe bilateral femurs, a blinded operator obtained step-section serialimages of trabecular bone at both the proximal and distal ends of eachfemur. Subsequently, the “ROImanager” plugin was utilized to specifyfixed ROIs in each step-section images, and from which measurementbone density were obtained. Bone disruption of the mandible wasassessed in a blinded fashion utilizing the MPR of the mandible. Here,the loss of bone in the periodontal cavity was calculated by measuringthe distance between the edge ofmolar root and the wall of periodontalcavity at both coronal and transverse planes.

Statistical analysisFor all experiments unless otherwise stated, comparisons between

two groups were evaluated with the two-sided Student t test. Someexperiments, as denoted, used Fisher exact test using a significancethreshold of P� 0.05. In such instances, the mean value of the controlgroup was used as the threshold to assign the categorical nature (i.e., >/¼ versus < the mean value) of individual outcomes within differenttreatment groups.

Data availabilityThe data that support the findings of this study are available from

the corresponding author upon reasonable request.

ResultsRaf1 targeting does not interfere with inhibition of growthmediated by targeting microtubule function

Stabilization of microtubules, by the tubulin-binding agents doc-etaxel and cabazitaxel, are potent inhibitors of the growth of androgen-independent prostate cancer (24), and both have been shown toprolong life in the clinical setting (25, 26). Combined targeting ofRaf1, using KBU2046, and microtubules, using either docetaxel orcabazitaxel, did not affect the ability ofmicrotubule targeting to inhibitthe growth of androgen-independent PC3-Mcells in vitro (Fig. 1A andB). A similar lack of interference of growth inhibition was also

observed when KBU2046 was coadministered in the context of agentsthat act through different mechanisms and upon different targets, andwas demonstrated in both PC3-M human prostate cancer and MDA-MB-231 human breast cancer cells (Supplementary Fig. S1).

To evaluate whether Raf1 inhibition would inhibit the efficacy ofmicrotubule-targeting agents in vivo, mice were subcutaneouslyimplanted with PC3-M cells and treated with docetaxel � KBU2046(Fig. 1C). Compared with control mice, docetaxel significantly inhib-ited tumor growth (P < 0.01). However, KBU2046 did not significantlyaffect growth when added to control or docetaxel-treated mice (P ¼0.264 and 0.926, respectively). These findings demonstrate that Raf1inhibition, mediated by KBU2046, does not inhibit growth inhibition,mediated by targeting microtubules.

Combined targeting of Raf1 and microtubule function hasimproved efficacy in systemic models of disease

Unregulated cell growth and unregulated cell movement constitutetwo elemental processes of cancer. A therapeutic strategy wherein bothof these processes are targeted is rationally based. We sought toexamine whether combined Raf1 and microtubule targeting wouldallow for sustained inhibition of tumor growth kinetics achieved bytargeting microtubule function, while providing for improved anti-metastatic efficacy, as compared with either approach alone. The PC3-Morthotopic implantationmurinemodel allows for the quantificationof primary tumor growth, the assessment of distant metastasis to thelungs, and has previously been used to measure the effects of therapyand genetic alterations on metastasis (9, 16, 27).

To assess the efficacy of a spectrum of docetaxel concentrations,mice received orthotopic implants of PC3-M-luc cells, were treatedwith 0, 10, or 20 mg/kg docetaxel, and tumor growth monitored withweekly IVIS imaging (Supplementary Fig. S2). Docetaxel significantlyinhibited growth compared with controls in a dose-dependent man-ner. Subsequently, mice with orthotopic implants of PC3-M-luc cellswere treated with docetaxel, KBU2046, docetaxelþKBU2046, or vehi-cle, as denoted, and effects on primary tumor growth and lungmetastasis quantified (Fig. 2). Prior studies demonstrated that it ispossible to detect as few as 10 human cells per mouse organ, that is,kidney, using human Alu element–specific qPCR (23). We demon-strated that there is a linear relationship between the number of PC3-M-luc cells present in mouse lung and qPCR-based detection ofhuman Alu elements (Pearson R2 ¼ 0.96; Supplementary Fig. S3).Using human Alu element–specific qPCR to quantify PC3-M-lucmetastasis to lungs, we demonstrated that docetaxel, KBU2046, anddocetaxelþKBU2046 decreasedmetastasis by 27% (P< 0.05), 20% (P <0.05), and 48% (P < 0.001), respectively, as compared with controlmice. Of note, the combination of docetaxelþKBU2046 achieved asignificantly greater decrease in metastasis than that observed witheither docetaxel (P < 0.05) or KBU2046 (P < 0.01) alone (Fig. 2A).Based upon the effect of each treatment alone, the calculated combinedeffect of docetaxelþKBU2046 is 42% reduction, giving an experimen-tal/calculated ratio of 1.1, or additive-to-slightly-synergistic.

Evaluation of prostate tumor growth by weekly IVIS imagingdemonstrated exponential growth kinetics in cohorts not receivingdocetaxel, and slower growth in cohorts receiving docetaxel (Fig. 2B).Measurement of actual tumor weight demonstrated that docetaxel anddocetaxelþKBU2046 decreased tumor weight by 49% (Fisher exacttest, P < 0.05) and 37% (Fisher exact test, P < 0.05), respectively,compared with control (Fig. 2C). KBU2046 by itself or combined withdocetaxel had no significant effect, nor did it significantly impairdocetaxel efficacy. These findings demonstrate that combined Raf1and microtubule targeting allows for dual targeting of cell growth and

Zhang et al.





cellmovement, resulting in sustained control of primary tumor growthand enhanced control of metastatic disease progression.

Raf1 inhibition does not interfere with hormone therapyTargeted inhibition of the androgen axis effectively inhibits

prostate cancer cell growth, and constitutes the mainstay of thetreatment strategy for metastatic prostate cancer (28). It is thereforeimportant to ensure Raf1 inhibition does not interfere with it. Initialhormone treatment involves decreasing testicular androgen pro-duction, and is termed androgen deprivation therapy (ADT).Disease progression is inevitable, resulting in castrate-resistantprostate cancer, and is commonly treated with an AR antagonist,such as enzalutamide (29). To evaluate the effect Raf1 inhibitionupon these paradigm investigations began with the androgen-sensitive LNCaP and VCaP human prostate cancer cells, which

have been well-characterized for their response to hormonal-targeted therapies (14, 30).

Cells were cultured in media depleted of androgen and after awashout period of 72 hours were treated with the synthetic androgenR1881, KBU2046, enzalutamide, vehicle (control), and combinations,as denoted. The resultant effects upon induction of the androgen-responsive gene, PSAweremeasured (Fig. 3A andB). In both cell lines,R1881 significantly increased PSA expression and enzalutamidedecreased it. In LNCaP cells, KBU2046 had no significant effect. InVCaP cells, KBU2046 significantly decreased PSA expression inR1881-treated cells by 36% (P < 0.05). While it also significantlyincreased expression in control cells (P < 0.05), absolute baseline levelswere very low and the relative increasewas only 14%. Evaluating effectson cell growth, enzalutamide significantly inhibited it compared withcontrols (P < 0.05) in both LNCaP and VCaP cells, whereas the

A

0

20

40

60

80

100

120

140

Cell

viab

ility

, % c

ontr

ol

Docetaxel, nmol/L

CO

46

0

20

40

60

80

100

120

140

Cell

viab

ility

, % c

ontr

ol

Cabazitaxel, nmol/L

CO

46

0

500

1,000

1,500

2,000

2,500

3,000

1 3 6 8 10 14 15

Tum

or si

ze, m

m3

Days

CO

46

doc

doc+46

B

C

Figure 1.

Inhibition of Raf1 does not interfere with prostate cancer growthinhibition mediated by targeting microtubules. A and B, Effect onthe growth of androgen-independent PC3-M prostate cancer cellsin vitro. Data are the mean� SEM (N¼ 3 replicates) of cell viabilityin a 3-day growth assay in the presence of 10 mmol/L KBU2046 orvehicle (control) treated with docetaxel or cabazitaxel. C, Effect onthe growth of androgen-independent prostate cancer cells in vivo.Mice received subcutaneous implants of PC3-M cells, were mon-itored until tumors were detectable (250 mm3), and then treateddaily with oral 80 mg KBU2046/kg (46), intraperitoneal docetaxel20 mg/kg weekly (doc), the combination (docþ46), or with oraland intraperitoneal vehicle (CO), beginning onday 1, and tumor sizemeasured. Data are mean � SEM, with N ¼ 20 mice per cohort.






addition of KBU2046 to either control or enzalutamide-treated cellshad no significant effect (Fig. 3C and D).

Several considerations warranted a deeper examination of theeffect of Raf1 inhibition on AR function. In VCaP cells, KBU2046significantly inhibited R1881-mediated PSA gene expression, con-sistent with inhibition of AR function. In addition, AR is a clientprotein of HSP90, AR function requires HSP90-mediated chaper-one action, and direct inhibitors of HSP90 decrease client proteinexpression and inhibit AR function (31). KBU2046 is not a directinhibitor of HSP90, and as such does not globally decrease clientprotein expression. As a SHAM acting agent, it selectively mod-ulates client proteins that regulate cell motility. However, the effectof KBU2046 on AR expression and function had not been previ-ously explored. After ligand binding, functional AR translocatesfrom the cytoplasm to the nucleus, and nuclear localization there-fore provides a measure of functional AR. By treating LNCaP andVCaP cells with R1881, KBU2046, and/or enzalutamide, and mea-suring AR expression by Western blot in resultant nuclear andcytoplasmic cellular fractions, we demonstrated that KBU2046 didnot affect AR expression or nuclear localization in response toR1881, nor its inhibition by enzalutamide (Fig. 3E).

To complete our assessments of the androgen-related paradigm, theeffect of KBU2046 on resistance to hormone therapy was evaluated.The outgrowth of LNCaP/AR-luc cells in castrate mice evaluates thetransition to a castration-resistant phenotype (14). Tumor outgrowthis detectable approximately 8 weeks post implantation, and growthkinetics are typically monitored until 16 weeks post implantation.Here, two treatment approaches were investigated, the effects ofbeginning treatment early at 4 weeks, or late at 12 weeks, and wereperformed in mice receiving subcutaneous or orthotopic implants,respectively (Fig. 3F and G). KBU2046 did not alter tumor growth ineither model. Taken together, these findings support the notion thatRaf1 inhibition does not affect androgen signaling, nor does it inhibitthe efficacy of ADT or of AR antagonist therapy.

Combining Raf1 inhibition with modulation of the bonemicroenvironment has improved efficacy

Metastasis to the bone occurs in over 90% of people with metastaticprostate cancer (2). Upon arrival to bone, prostate cancer cells modifythe environment in a manner conducive to their outgrowth engagingwhat is known as the “vicious cycle” (32–34). Specifically, prostatecancer cells secrete IL11 and parathyroid hormone-related protein,

0

20

40

60

80

100

120

140

CO 46 doc doc+46

Lung

met

asta

sis, %

con

rol

*

*

*

*

*

0.00E+00

5.00E+08

1.00E+09

1.50E+09

2.00E+09

2.50E+09

3.00E+09

3.50E+09

4.00E+09

4.50E+09

5.00E+09

7 14 21 28

Tum

or v

olum

e, fl

ux (p

/s)

Days a�er implanta�on

CO

46

doc

doc+46

0.000

0.200

0.400

0.600

0.800

1.000

1.200

1.400

1.600

1.800

2.000

CO 46 doc doc+46

Tum

or w

eigh

t, gm

**

A

CB

Figure 2.

Combined Raf1 and microtubule targeting exhibits increased antimetastatic efficacy. Cohorts of N ¼ 10 mice bearing orthotopic implants of PC3-M-luc cellswere treated daily with 150 mg/kg KUB2046 (46), intraperitoneal docetaxel 7.5 mg/kg weekly (doc), the combination (docþ46), or with oral andintraperitoneal vehicle (CO). KBU2046 treatment began 3 days before implantation, and docetaxel began 1 week after. A, Lung metastasis measured by qPCRfor human Alu sequences, expressed as percent control. B, Weekly IVIS imaging of tumor. C, Tumor weight. � , P < 0.05 for differences between cohortsdenoted by bars. All data are mean � SEM.

Zhang et al.





Figure 3.

Raf1 inhibition does not affect androgen signaling or therapeutic targeting. LNCaP or VCaP cells cultured in hormone-free media were treated with vehicle control(CO), R1881 (R), KBU2046 (46), and/or enzalutamide (E).A andB,Effects onAR-responsivegene expression. PSAexpressionwasmeasuredbyqRT/PCR, normalizedto GAPDH, and expressed as a percent of control cells (N¼ 3 replicates); � , P < 0.05 for groups separated by bar. C and D, Effects on cell growth. Three-day growthassays were performed. Data are the number of viable cells, expressed as percent of control (N¼ 3 replicates); � , P < 0.05 compared with control. E, Effects on ARactivation. Western blots of nuclear (N) and cytoplasmic (C) preparations of cell extracts were probed for AR, laminin B1, or a-tubulin. F and G, Effects on tumoroutgrowth after ADT. LNCaP/AR-luc cells were implanted subcutaneously (N ¼ 6 mice/cohort) or orthotopic (N ¼ 15 mice/cohort were implanted; N ¼ 5 yieldedtumors) into castrate mice, treatment with KBU2046 began as noted, andweekly IVIS imaging performed. Data are tumor size, expressed as luminescence intensity.All data are expressed as mean � SEM.






stimulating osteoblasts to secrete receptor activator of nuclear factorkappa-B ligand (RANKL), RANKL induces osteoclasts to degradebone, the resultant degradation of bone matrix releases insulin growthfactor and TGFb, which act to sustain prostate cancer cell growth. Wepreviously demonstrated that KBU2046 inhibits cell motility byinhibiting activation of Raf1, specifically, by inhibiting phosphoryla-tion of its Ser338 activation motif (9). A central function of Raf1 relatesto regulating reorganization of the actin cytoskeleton, which in turnaffects how cells interact with and move through the microenviron-ment (35). Cytoskeleton reorganization is required for osteoclasts tosuccessively move across and to bind bone matrix, doing so byarranging their actin cytoskeleton to form a low pH resorptive cavityin which degradation of bonemineral occurs (36). These facts led us toconsider that osteoclast-mediated bone degradation was dependentupon cytoskeleton reorganization, and therefore might be inhibited byKBU2046.

To examine this paradigm, we first evaluated whether KBU2046would inhibit Raf1 phosphorylation in osteoclasts. After treatmentwith RANKL, RAW 267.4 cells differentiate into mature osteoclasts.Mature osteoclasts are multinucleated, express tartrate-resistant acidphosphatase (TRAP), and have the capacity to form actin rings thatcreate an occluded cavity in which bone is degraded. KBU2046 inhibitsphosphorylation of Raf10s activation motif in RANKL-treated RAW267.4 osteoclast cells, and does so in a time-dependent manner(Fig. 4A). In osteoclasts, Raf1 is known to phosphorylate MEK1/2,in turn phosphorylating ERK1/2 (37), with the latter acting to stim-ulate osteoclast differentiation and bone resorptive activity (38, 39).The functional relevance of KBU2046-mediated inhibition of Raf1phosphorylation is shownby demonstrating inhibition ofMEK1/2 andERK1/2 phosphorylation. Osteoclasts in Fig. 4A were not cultured onbone mineral, demonstrating that KBU2046-mediated inhibition ofRaf1 phosphorylation is not dependent upon the presence of bonemineral. We show in Supplementary Fig. S4 that similar effects areobserved when RAW 267.4 cells are grown in the presence of bonemineral.

Treatment of RAW 267.4 cells with KBU2046 induces severalstructural and functional changes. It reduces RANKL-mediated for-mation of multinucleated cells, and those that do form have lowernumbers of nuclei (see 40� panels, Fig. 4B). The characteristicprominent actin ring (white arrow) surrounding the resorptive cavity(yellow arrow) is readily apparent in control cells treated with RANKLligand, but is lacking in KBU2046-treated cells (100�, panels). Con-sistent with it inhibiting maturation of RAW 267.4 cells, TRAPstaining is decreased in KBU2046-treated cells (Fig. 4C). In theabsence of RANKL, undifferentiated RAW 267.4 cells exhibit aphenotype characterized by isolated cells with long thin cytoplasmicextensions (Fig. 4B). However, treatment with KBU2046 markedlyreduces cellular extensions, demonstrating that its ability to induceeffects on RAW 267.4 cells is not RANKL dependent.

To determine whether KBU2046 inhibits osteoclast-mediated bonedegradation, we used Corning Osteo Assay Surface plates, which arecoated with calcium-phosphate–based bone mineral. This platformsupports osteoclast growth, allowing for the quantitativemeasurementof bone degradation, and has previously been used to measure bispho-sphonate-mediated inhibition of bone degradation (40). RAW 267.4cells were grown on Osteo Assay plates in the presence of RANKL,treated with KBU2046 at 1 mmol/L, 10 mmol/L, or with vehicle(control), and effects on bone destruction quantified after 6 days. Inthis manner we demonstrated that when 10 mmol/L KBU2046 ispresent, it significantly increased bone surface area by 28% � 1.4%(mean� SEM) compared with control (P < 0.05; Fig. 4D). To further

substantiate the role of Raf1, we demonstrate in Supplementary Fig. S5that each of the Raf1-specific inhibitors, ZM336372, GW5074, andNVP-BHG712, inhibit osteoclast-mediated bone degradation, as wellas RANKL-induced osteoclast maturation. The latter is demonstratedby decreased TRAP staining, decreased formation of multinucleatedcells, and inhibition of resorptive cavity formation. Together, thesefindings demonstrate that we can inhibit degradation of bone matrixthrough an innovative strategy targeting Raf1.

Wenext examined targeting of the bonemicroenvironment coupledto targeting cell motility. Bisphosphonates modify the bone microen-vironment by chemically binding to calcium-phosphate bone mineral,are then taken up by osteoclasts after they digest the bound mineral,and once inside the cell, they inhibit osteoclast-mediated bone deg-radation (41). The bisphosphonate, ZA, is used clinically to decreasebone fractures in men with metastatic prostate cancer (11). ZA isadministered to humans by injection, whereupon it binds to bonemineral, while the remainder is rapidly cleared from the body, and thatbound to bone mineral is responsible for inhibition of osteoclastactivity and resultant decrease in bone fractures inmenwithmetastaticprostate cancer (42).We therefore focused our investigations uponZA.Furthermore, we emulated the pharmacologic situation in humans bypretreating Osteo Assay plates with ZA, washing nonbound ZA awayprior to adding RAW 267.4 cells, then treated, or not, with KBU2046,and measured resultant effects upon bone degradation. ZA wasevaluated at 2, 10, and 20 mmol/L, demonstrating a concentration-dependent increase in bone surface area, all significant compared withcontrol (P < 0.05; Fig. 5A and B). KBU2046 similarly significantlyincreased bone surface area (P < 0.05). Importantly, the combinationof ZAþKBU2046 yielded significantly improved efficacy comparedwith either agent alone (P < 0.05), did so with all ZA concentrationstested, and with the combination of 20 mmol/L ZAþKBU2046, bonesurface area increased to 193% � 1.6% of control (mean � SEM).Based upon the effect of each treatment alone, the calculated combinedeffects of ZAþKBU2046 are 170%, 190%, and 210% compared withuntreated controls for 2, 10, and 20 mmol/L ZA, respectively, givingexperimental/calculated ratios of 0.91, 1.0, and 0.92, respectively.These findings approach pure pharmacologic additivity.

We next examined the effect of ZA and KBU2046 on osteoclast cellviability, apoptosis, and cytotoxicity. RAW 267.4 cells were treatedwith RANKL for the duration of the experiment, at day 4 they werethen treated with ZA, KBU2046, the combination, or vehicle (forcontrols), and effect on cell viability, apoptosis, and cytotoxicitymeasured by Triplex assay at 24, 48, and 72 hours after treatment(Fig. 5C–E). During the 7-day time course of this experiment,RANKL-treated RAW 267.4 cells underwent maturation to terminallydifferentiated osteoclasts. Findings in control cells are consistent withthis process, demonstrating successive decreases in cell viability,accompanied by increases in cellular cytotoxicity and apoptosis withtime. Findings with KBU2046 are consistent with it delaying thematuration process, and include significant increases in cell viabilityand decreases in cytotoxicity at 72 hours, compared with control (P <0.05). There is a notable significant increase in apoptosis in KBU2046-treated cells at 72 hours compared with controls (P < 0.05), possiblyreflecting prior findings by other investigators linking suppression ofRaf1 signaling to an increase in apoptotic activity (43). The combi-nation of ZAþKBU2046 significantly increased apoptosis and cyto-toxicity at 48 hours, but there was little-to-no effect on viability at72 hours.

To evaluate the effectiveness of this strategy in vivo, we used thehumanPC3-luc prostate cancer intracardiac injectionmodel (9, 44). Inthismodel, mice develop widespreadmetastasis to the bone, with those

Zhang et al.





Figure 4.

KBU2046 (46) inhibits osteoclast function. A, Effects on Raf1 activation. RAW 267.4 cells were treated with RANKL for 4 days, treated with 10 mmol/L KBU2046 forthe indicated time periods, andWestern blot for the denoted proteins performed. B, Effects on cell morphology. RAW267.4 cells were treated with RANKL and withKBU2046 for 4 days, or not, as denoted, and stained for actin (green) and DAPI (blue); white arrow denotes an actin ring, yellow arrow a resorptive cavity.Representative immunofluorescence images are depicted. C, TRAP expression. Cells were treated as in B, stained for TRAP (denoted by presence of red), andrepresentative images from light microscopy depicted. D, Bone degradation. RAW 267.4 cells were plated onto Osteo Assay plates, treated with RANKL for 6 daysand with 1 or 10 mmol/L KBU2046 (or vehicle for controls, CO) as indicated, and bone surface area quantified. Data are the mean � SEM (N ¼ 3 replicates) of bonesurface area, expressed as the percentage of control cells; � , P < 0.05 compared with control.






to the mandible being the most prominent and symptomatic. Micewere treated with either ZA, KBU2046, ZAþKBU2046, or vehicle(control), and at the end of the experiment CT images of the boneswere obtained and metastasis to the mandible and femur quantified(Fig. 5F–H). Weekly IVIS imaging demonstrated progressive tumorgrowth over the 5 weeks of the experiment in themandible, femur, andwhole body, across all cohorts of mice (Supplementary Fig. S6).Representative CT images demonstrate the typically large destructivelesions in the mandible (Fig. 5F), and these were quantified by directmeasurement (Fig. 5G). Metastasis to the femur were smaller, led togeneralized loss of bone, with representative images demonstratingdecreased density of trabecular bone and thinning of cortical bone(Fig. 5F), andwere quantified bymeasurement of density (Fig. 5H). Inthe mandible, KBU2046 inhibited bone destruction by 33% � 4.2%(mean � SEM; P < 0.05) compared with control. While ZA also

decreased bone destruction, this effect was not significant. Important-ly, ZAdid not impair KBU2046 efficacy. In the femur, bone densitywassignificantly (P < 0.05) improved to 156%� 2.7% and 122%� 2.4% ofuntreated control mice by ZA and KBU2046, respectively. Further-more, the combination of ZAþKBU2046 significantly (P < 0.05)increased density to 176% � 3.7% as compared with either treatmentalone. Based upon the effect of each treatment alone, the calculatedcombined effect of ZAþKBU2046 on the femur is 192% of control,giving an experimental/calculated ratio of 0.92, which approachespharmacologic additivity for effects on the femur. Taken together,these findings demonstrate that combined targeting of cellmotility andthe bone microenvironment exert desirable therapeutic effects acrossdifferent anatomic sites that exceed the effects achieved with eitheragent alone, resulting in improved therapeutic efficacy, an effectobserved across both in vitro and in vivo model systems.

Figure 5.

Raf1 inhibition combined with modulation of thebone microenvironment has improved systemicefficacy. A, Bone degradation. Osteo assayswere performed as in Fig. 4D. Cells were treatedwith KBU2046 (46), ZA at 2, 10, or 20 mmol/L,with the indicated combinations, or vehicle(control; CO). Data are the mean � SEM (N ¼3 replicates); � , P < 0.05 compared with control,or between conditions denoted by bars. B, Rep-resentative photomicrographs of Osteo assaywells. Black color denotes presence of bonematrix; RL: RANKL. C–E, Cell viability, cytotox-icity, and apoptosis. RAW 267.4 cells were trea-tedwith RANKL, at day 4 theywere treated withKBU2046, ZA at 1 or 10 mmol/L (ZA1 or ZA10),the indicated combination, or vehicle (CO), andTriplex assayperformed 24, 48, or 72 hours later,per Materials and Methods. Data are themean�SEM (N ¼ 4 replicates); ¥, � , and # denotes P <0.05 compared with 24, 48, and 72 hour time-point controls, respectively. F–H, In vivo effica-cy. Four cohorts of mice, N ¼ 15/cohort, weregiven intracardiac injections of PC3-luc cells,yielding the following successful injections: N¼ 12 control, N¼ 12 ZA, N¼ 13 KBU2046, and N¼ 13 ZAþKBU2046. Treatment was oral 150 mgKBU2046/kg daily (starting 3 days before intra-cardiac injection), intraperitoneal ZA 100 mg/kgweekly (starting 1 week before intacardiac injec-tion), with oral and intraperitoneal vehicle con-trols given as indicated. F, Representative CTimages. Image types are side view and coronalsections of skull, and axil and sagittal sections ofthe femurs. Red arrows denote areas of bonedestruction. G and H, Quantification of bonelesions. The macroscopic lesions in the jawwerequantified by direct measurement from CTimages, and expressed as the mean � SEMpercent of control. Bone density of femurs wasmeasured fromCT images, and expressed as themean � SEM percent of control. � , P < 0.05comparedwith control, and for groups indicatedby bars.

Zhang et al.





DiscussionIncreased cancer cell motility is a characteristic of cancer, which

represents a clinically relevant driver ofmorbidity andmortality (2–6),and constitutes an important function that can now be effectively andselectively inhibited by targeting activation of Raf1 (9). As such, it iscentrally important to consider it as one of several abnormal functions.In this regard, two criteria become apparent. First, this new foundtherapeutic capability cannot mitigate the efficacy of agents that actupon targets with established clinical efficacy. Second, it underscoresthe strategic importance of treating cancer in a manner that targetsmultiple functions. Such an approach constitutes multifunctionaltherapy. This concept should not be confused with multi-modalitytherapy. The latter uses multiple therapies directed at different targetsand/or pathways, but which relate to a similar set of cellular functions,such as growth and or viability.

We herein demonstrate for the first time that antimotility therapy,through KBU2046-mediated inhibition of Raf1 activation, can bedeployed with agents that act upon several different pathways relevantto cancer progression at the systemic level, and that have establishedefficacy in humans. Specifically, we demonstrate sustained efficacy inconjunction with inhibition of cell growth, through taxane-mediatedinhibition of microtubule function, and do so in cell culture–basedstudies, as well as in two murine models, one utilizing subcutaneousand one utilizing orthotopic implantation. In the case of ZA, an agentthat modifies the bone microenvironment, we also demonstrate thatantimotility therapy does not interfere with its activity. In fact, wedemonstrate that it enhances it. Here too, experiments spanned cellculture- and human murine xenograft–based models of bone destruc-tion. In addition, we demonstrated that antimotility therapy does notinterfere with therapies that target the androgen axis. Here too, studiesinvolved cell culturemodels, as well asmurinemodels of subcutaneousand orthotopic implantation. Studies were performed in the context ofADT and androgen receptor antagonist therapy, examining the effectsupon cell and tumor growth, androgen-responsive gene activation, andAR activation.

After demonstrating that antimotility therapy did not inhibit theefficacy of established therapy, we went on to demonstrate its appli-cability in the context of multifunctional therapy.

Two notions support the rationale for pursuing a multi-functionaltreatment strategy. The first relates to the requirement for differentfunctions to sustain cancer progression at the systemic level. Thecurrent example fits this, where motility, interaction with a distantorgan microenvironment, and cell growth are all necessary functionsfor the development of clinically relevant metastasis. The secondnotion relates to evidence that therapeutic pressure can shift cancerdependence from one hallmark-related function to another, withantiangiogenic therapy fostering increased cell invasion serving as anexample (45, 46).

In this study, we specifically demonstrated that the combination ofdocetaxelþKBU2046 not only retained the growth inhibitory efficacyof docetaxel but also exhibited additive-to-slightly-synergistic efficacyat inhibiting metastasis. Such a strategic approach would be applicableto existing clinical scenarios where docetaxel is used to treat prostatecancer, especially in the newly diagnosed metastatic setting, where thecombination would serve to decrease formation of secondary metas-tasis. Because robust preclinical systemic models of the formation ofmetastasis as a function of targeting the androgen axis are lacking, wehave not demonstrated that KBU2046 would provide additive anti-metastatic efficacy when combined with hormone therapy. However,existing data supports that the use of KBU2046 along with hormonetherapy would further decrease the development of metastasis. Spe-

cifically, we have previously demonstrated that KBU2046 will inhibitthe motility of androgen-responsive prostate cancer cell lines (9).Furthermore, KBU2046 did not interfere with AR antagonist therapymediated by enzalutamide, a widely used agent shown to decreasemetastasis in humans (47).

We also demonstrated that antimotility therapy can enhance theefficacy of bone microenvironment targeting agents such as ZA.Osteoclasts modify the bone microenvironment in manner thatrequires them to interface with the bone mineral surface and toreorganize their actin cytoskeleton to form a chamber whose functionis to degrade bone. Given that Raf1 is a known regulator of thisprocess (37–39), we hypothesized that KBU2046 mediated inhibitionof Raf1 phosphorylation on its activation motif would inhibit actinreorganization and as a result inhibit bone degradation. We demon-strated that this was the case, and did so evaluating bone degradationin vitro and with animal models of bone destruction. These findingsrepresent a new mechanism and new strategic approach to inhibitingosteoclast function and bone destruction, and have wide spreadimplications.

Given that KBU2046 affects osteoclast motility and that ZA effectsthe bone microenvironment, that is, separate but complementarymechanisms, we hypothesized that together they would have at leastadditive therapeutic efficacy at inhibiting osteoclast-mediated bonedestruction. Our findings directly supported this concept. Specifi-cally, our in vitromodel system of osteoclast-mediated bone destruc-tion demonstrated additive effects of the two agents over a spectrumof ZA concentrations. A combined targeting approach was alsosupported by our findings with the murine model of human prostatecancer–mediated bone destruction, where we observed two forms ofimproved therapeutic efficacy. In the femur, the combination of bothagents gave additional efficacy when compared with either agentalone. The other form of improved efficacy relates to anatomic site.In the mandible, KBU2046 exhibited high efficacy, whereas ZAexhibited no significant efficacy. In the femur, ZA was highlyefficacious, and while KBU2046 was also efficacious, it was muchless than ZA. When ZA and KBU2046 are combined, they exertdesirable therapeutic effects across different anatomic sites thatexceed the effects achieved with either agent alone, resulting inimproved therapeutic efficacy. It will be important in future studiesto understand the mechanistic underpinnings of these anatomicdifferences in agent efficacy.

In summary, we demonstrated that inhibition of cancer cell motilitycan effectively be combined with other targeted functional therapiesfor cancer. Such an approach addresses the paradigm of cancer arisingfrom a relatively wide set of dysfunctions that together constitutecharacteristics of cancer. Such an approach is associated withimproved efficacy across several clinically relevantmodels, and togeth-er supports the translation of this approach into human studies.

Disclosure of Potential Conflicts of InterestR. Bergan has ownership interest (including patents) in Third Coast Therapeutics,

patents (US Patent 8,481,760, US Patent 8,742,141, US Patent 9,839,625, and USPatent 10,231,949). No potential conflicts of interest were disclosed by the otherauthors.

Authors’ ContributionsConception and design: L. Zhang, A. Pattanayak, R. Gordon, R. BerganDevelopment of methodology: L. Zhang, A. Pattanayak, W. Li, R. GordonAcquisition of data (provided animals, acquired and managed patients, providedfacilities, etc.): L. Zhang, A. Pattanayak, W. Li, R. GordonAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): L. Zhang, W. Li, R. Gordon, R. Bergan






Writing, review, and/or revision of the manuscript: L. Zhang, A. Pattanayak,H.-K. Ko, R. Gordon, R. BerganAdministrative, technical, or material support (i.e., reporting or organizing data,constructing databases): L. Zhang, W. Li, G. Fowler, R. GordonStudy supervision: R. Bergan

AcknowledgmentsThis study was supported with funding to R. Bergan by the United States Veterans

Administration (IBX002842A) and the United States Department of Defense

(W81XWH-15-1-0527). The authors would like to thank William Packwood for hisassistance in performing the high-resolution CT imaging.

The costs of publication of this article were defrayed in part by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received March 2, 2019; revised May 17, 2019; accepted September 26, 2019;published first October 3, 2019.

References1. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell 2011;

144:646–74.2. Minn AJ, Massague J. Invasion and metastasis. In:DeVita VT, Lawrence TS,

Rosenberg SA, editors. CANCER: principals and practice of oncology. NewYork, NY:Lippincott Wiliams and Wilkins;2008. p. 135–46.

3. Seyfried TN,Huysentruyt LC.On the origin of cancermetastasis. Crit RevOncog2013;18:43–73.

4. Gupta GP, Massague J. Cancer metastasis: building a framework. Cell 2006;127:679–95.

5. Norgaard M, Jensen AO, Jacobsen JB, Cetin K, Fryzek JP, Sorensen HT. Skeletalrelated events, bone metastasis and survival of prostate cancer: a populationbased cohort study in Denmark (1999 to 2007). J Urol 2010;184:162–7.

6. Pound CR, Partin AW, Eisenberger MA, Chan DW, Pearson JD, Walsh PC.Natural history of progression after PSA elevation following radical prostatec-tomy. JAMA 1999;281:1591–7.

7. Talmadge JE, Fidler IJ. AACR centennial series: the biology of cancer metastasis:historical perspective. Cancer Res 2010;70:5649–69.

8. Krishna SN, Bergan RC. Therapeutic modulation of prostate cancer metastasis.Future Med Chem 2014;6:223–39.

9. Xu L, Gordon R, Farmer R, PattanayakA, Binkowski A,HuangX, et al. Precisiontherapeutic targeting of human cancer cell motility. Nat Commun 2018;9:2454.

10. Masood I, Kiani MH, Ahmad M, Masood MI, Sadaquat H. Major contributionstowards finding a cure for cancer through chemotherapy: a historical review.Tumori 2016;102:6–17.

11. Saad F, Gleason DM, Murray R, Tchekmedyian S, Venner P, Lacombe L, et al.Long-term efficacy of zoledronic acid for the prevention of skeletal complica-tions in patients with metastatic hormone-refractory prostate cancer. J NatlCancer Inst 2004;96:879–82.

12. Costa L, Badia X, ChowE, LiptonA,Wardley A. Impact of skeletal complicationson patients' quality of life, mobility, and functional independence. Support CareCancer 2008;16:879–89.

13. Liu YQ,Kyle E, Patel S, Housseau F, Hakim F, LiebermanR, et al. Prostate cancerchemoprevention agents exhibit selective activity against early stage prostatecancer cells. Prost Cancer Prost Dis 2001;4:81–91.

14. Tran C, Ouk S, Clegg NJ, Chen Y, Watson PA, Arora V, et al. Development of asecond-generation antiandrogen for treatment of advanced prostate cancer.Science 2009;324:787–90.

15. Korenchuk S, Lehr JE, L MC, Lee YG, Whitney S, Vessella R, et al. VCaP, a cell-based model system of human prostate cancer. In Vivo 2001;15:163–8.

16. Pavese JM, Bergan RC. Circulating tumor cells exhibit a biologically aggressivecancer phenotype accompanied by selective resistance to chemotherapy.Cancer Lett 2014;352:179–86.

17. Ding Y, Xu L, Jovanovic BD, Helenowski IB, Kelly DL, Catalona WJ, et al. Themethodology used to measure differential gene expression affects the outcome.J Biomol Tech 2007;18:321–30.

18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402–8.

19. Vichai V, Kirtikara K. Sulforhodamine B colorimetric assay for cytotoxicityscreening. Nat Protoc 2006;1:1112–6.

20. HollingsheadMG. Antitumor efficacy testing in rodents. J Natl Cancer Inst 2008;100:1500–10.

21. Gordon RR, Wu M, Huang CY, Harris WP, Sim HG, Lucas JM, et al.Chemotherapy-induced monoamine oxidase expression in prostate carcinomafunctions as a cytoprotective resistance enzyme and associates with clinicaloutcomes. PLoS One 2014;9:e104271.

22. Pavese J, Ogden IM, Bergan RC. An orthotopic murinemodel of human prostatecancer metastasis. J Vis Exp 2013;79:e50873.

23. Funakoshi K, Bagheri M, Zhou M, Suzuki R, Abe H, Akashi H. Highly sensitiveand specific Alu-based quantification of human cells among rodent cells. Sci Rep2017;7:13202.

24. Lyseng-Williamson KA, Fenton C. Docetaxel: a review of its use in metastaticbreast cancer. Drugs 2005;65:2513–31.

25. Tannock IF, deWit R, BerryWR, Horti J, Pluzanska A, Chi KN, et al. Docetaxelplus prednisone or mitoxantrone plus prednisone for advanced prostate cancer.N Engl J Med 2004;351:1502–12.

26. de Bono JS, Oudard S, Ozguroglu M, Hansen S, Machiels JP, Kocak I, et al.Prednisone plus cabazitaxel or mitoxantrone for metastatic castration-resistantprostate cancer progressing after docetaxel treatment: a randomised open-labeltrial. Lancet 2010;376:1147–54.

27. LakshmanM,HuangX, AnanthanarayananV, Jovanovic B, Liu Y, Craft CS, et al.Endoglin suppresses human prostate cancer metastasis. Clin Exp Metastasis2011;28:39–53.

28. Gomella LG, Singh J, Costas L, Trabulsi EJ.Hormone therapy in themanagementof prostate cancer: evidence-based approaches. Ther Adv Urol 2010;2:171–81.

29. Beer TM, Armstrong AJ, Rathkopf DE, Loriot Y, Sternberg CN, Higano CS, et al.Enzalutamide in metastatic prostate cancer before chemotherapy. N Engl J Med2014;371:424–33.

30. Furr BJ. The development of Casodex (bicalutamide): preclinical studies.Eur Urol 1996;29:83–95.

31. Fang Y, Fliss AE, Robins DM, Caplan AJ. Hsp90 regulates androgen receptorhormone binding affinity in vivo. J Biol Chem 1996;271:28697–702.

32. Guise TA. The vicious cycle of bone metastases. J Musculoskelet NeuronalInteract 2002;2:570–2.

33. Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998;19:18–54.34. Logothetis C, Morris MJ, Den R, Coleman RE. Current perspectives on bone

metastases in castrate-resistant prostate cancer. Cancer Metastasis Rev 2018;37:189–96.

35. Yotova I, Quan P, Gaba A, Leditznig N, Pateisky P, Kurz C, et al. Raf-1 levelsdetermine the migration rate of primary endometrial stromal cells of patientswith endometriosis. J Cell Mol Med 2012;16:2127–39.

36. Florencio-Silva R, Sasso GR, Sasso-Cerri E, Simoes MJ, Cerri PS. Biology of bonetissue: structure, function, and factors that influence bone cells. Biomed Res Int2015;2015:421746.

37. Bradley EW, Ruan MM, Vrable A, Oursler MJ. Pathway crosstalk between Ras/Raf and PI3K in promotion of M-CSF-induced MEK/ERK-mediated osteoclastsurvival. J Cell Biochem 2008;104:1439–51.

38. He Y, Staser K, Rhodes SD, Liu Y, Wu X, Park SJ, et al. Erk1 positivelyregulates osteoclast differentiation and bone resorptive activity. PLoS One2011;6:e24780.

39. Nakamura H, Hirata A, Tsuji T, Yamamoto T. Role of osteoclast extracellularsignal-regulated kinase (ERK) in cell survival and maintenance of cell polarity.J Bone Miner Res 2003;18:1198–205.

40. Abe K, Yoshimura Y, Deyama Y, Kikuiri T, Hasegawa T, Tei K, et al. Effects ofbisphosphonates on osteoclastogenesis in RAW264.7 cells. Int J Mol Med2012;29:1007–15.

41. Polascik TJ,MouravievV. Zoledronic acid in themanagement ofmetastatic bonedisease. Ther Clin Risk Manag 2008;4:261–8.

42. Cremers S, Papapoulos S. Pharmacology of bisphosphonates. Bone 2011;49:42–9.43. Alejandro EU, Johnson JD. Inhibition of Raf-1 alters multiple downstream

pathways to induce pancreatic beta-cell apoptosis. J Biol Chem 2008;283:2407–17.

Zhang et al.





44. ChuK,ChengCJ, YeX, LeeYC, ZuritaAJ, ChenDT, et al. Cadherin-11 promotesthe metastasis of prostate cancer cells to bone. Mol Cancer Res 2008;6:1259–67.

45. Ebos JM, Lee CR, Kerbel RS. Tumor and host-mediated pathways of resistanceand disease progression in response to antiangiogenic therapy. Clin Cancer Res2009;15:5020–5.

46. Ellis LM, Reardon DA. Cancer: the nuances of therapy. Nature 2009;458:290–2.

47. Hussain M, Fizazi K, Saad F, Rathenborg P, Shore N, Ferreira U, et al.Enzalutamide in men with nonmetastatic, castration-resistant prostatecancer. N Engl J Med 2018;378:2465–74.






2020;19:39-51. Published OnlineFirst October 3, 2019.Mol Cancer Ther Limin Zhang, Abhinandan Pattanayak, Wenqi Li, et al. Microenvironment

theMediated Inhibition of Cell Motility, Growth, and Interaction with A Multifunctional Therapy Approach for Cancer: Targeting Raf1-

Updated version

10.1158/1535-7163.MCT-19-0222doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2019/10/03/1535-7163.MCT-19-0222.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/19/1/39.full#ref-list-1

This article cites 46 articles, 6 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/19/1/39To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-19-0222http://mct.aacrjournals.org/content/suppl/2019/10/03/1535-7163.MCT-19-0222.DC1http://mct.aacrjournals.org/content/19/1/39.full#ref-list-1http://mct.aacrjournals.org/cgi/alertsmailto:[email protected]://mct.aacrjournals.org/content/19/1/39http://mct.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

a multifunctional therapy approach for cancer: targeting raf1- … · a multifunctional therapy...

Documents