a novel approach to identify candidate imprinted genes in ......many imprinted genes are necessary...
TRANSCRIPT
A Novel Approach to Identify Candidate Imprinted Genes in Humans
by
Jonathan Samuel Shapiro
A thesis submitted in conformity with the requirements for the degree of Master of Science
Institute of Medical Science University of Toronto
© Copyright by Jonathan Samuel Shapiro 2012
ii
A Novel Approach to Identify Candidate Imprinted Genes in
Humans
Jonathan Samuel Shapiro
Master of Science
Institute of Medical Science University of Toronto
2012
Abstract
Many imprinted genes are necessary for normal human development. Approximately 70
imprinted genes have been identified in humans. I developed a novel approach to identify
candidate imprinted genes in humans using the premise that imprinted genes are often associated
with nearby parent-of-origin-specific DNA differentially methylated regions (DMRs). I
identified parent-of-origin-specific DMRs using sodium bisulfite-based DNA (CpG) methylation
profiling of uniparental tissues, mature cystic ovarian teratoma (MCT) and androgenetic
complete hydatidiform mole (AnCHM), and biparental tissues, blood and placenta. In support of
this approach, the CpG methylation profiling led to the identification of parent-of-origin-specific
differentially methylated CpG sites (DMCpGs) in known parent-of-origin-specific DMRs. I
found new DMRs for known imprinted genes NAP1L5 and ZNF597. Most importantly, I
discovered many new DMCpGs, which were associated with nearby genes, i.e., candidate
imprinted genes. Allelic expression analyses of one candidate imprinted gene, AXL, suggested
polymorphic imprinting of AXL in human blood.
iii
Acknowledgments
I would like to acknowledge my supervisor, Dr. Rosanna Weksberg, for her guidance,
encouragement, and patience. I would also like to acknowledge my program advisory committee
members Dr. Joseph Beyene, Dr. Andrew Paterson, and Dr. Sue Varmuza for their guidance and
support.
I would like to acknowledge the members of Dr. Rosanna Weksberg's laboratory. I would
particularly like to acknowledge Dr. Sanaa Choufani, Dr. Darci T. Butcher, Dr. Daria
Grafodatskaya, and Dr. Jose C. Ferreira for their guidance and support. I would also like to
acknowledge Chunhua Zhao, Youliang Lou, Sarah Goodman, Yi-An Chen, Kai-wei Chang, and
Khadine Wiltshire for their assistance.
I would like to acknowledge my collaborators Dr. Dalila Pinto and Dr. Stephen W. Scherer for
their assistance in my allelic expression analyses of AXL in humans and for producing the
idiogram showing the genomic regions of known and candidate parent-of-origin-specific
differentially methylated CpG sites (DMCpGs) in humans for our Genome Research journal
article.
I would also like to acknowledge Cold Spring Harbor Laboratory Press for publishing my work
in their journal Genome Research.
I would also like to acknowledge the Canadian Institutes of Health Research for the Frederick
Banting and Charles Best Canada Graduate Scholarships - Master's Award.
I would also like to acknowledge my family and friends for their support.
iv
Table of Contents
Acknowledgments ........................................................................................................................................................iii
Table of Contents .........................................................................................................................................................iv
List of Tables...............................................................................................................................................................vii
List of Figures ............................................................................................................................................................viii
List of Appendices........................................................................................................................................................ix
List of Abbreviations.....................................................................................................................................................x
Chapter 1 Introduction...................................................................................................................................................1
1 Introduction..............................................................................................................................................................1
1.1 Introduction to Imprinted Genes .....................................................................................................................1
1.1.1 Function and Expression Pattern of Imprinted Genes.......................................................................1
1.1.2 Discovery of Imprinted Genes ..........................................................................................................4
1.2 Uniparental Tissues - Androgenetic Complete Hydatidiform Mole (AnCHM) and Mature Cystic Ovarian Teratoma (MCT) .............................................................................................................................................8
1.3 Introduction to Epigenetics .............................................................................................................................9
1.3.1 DNA Methylation .............................................................................................................................9
1.3.2 Covalent Post-translational Modification of Histone Tails .............................................................18
1.3.3 Long Non-coding RNAs (ncRNAs)................................................................................................23
1.3.4 MicroRNAs (miRNAs)...................................................................................................................23
1.3.5 Crosstalk Between Epigenetic Mechanisms ...................................................................................23
1.4 Human Disorders Associated With Uniparental Origin Of Limited Genomic Regions................................25
1.4.1 Beckwith-Wiedemann syndrome (BWS)........................................................................................25
1.4.2 Russell-Silver syndrome (RSS) ......................................................................................................25
1.4.3 Prader-Willi syndrome (PWS) ........................................................................................................26
1.4.4 Angelman syndrome (AS) ..............................................................................................................26
1.5 Previous Methods Used to Find Candidate Imprinted Genes and Candidate Parent-of-Origin-Specific Differentially Methylated Regions (DMRs) in Humans ...............................................................................27
1.5.1 Searching for Candidate Parent-of-Origin-Specific DMRs Using Uniparental Tissues (AnCHMs and MCTs) ......................................................................................................................................27
v
1.5.2 Searching for Candidate Imprinted Genes Using DNA Sequence Features Around Known Imprinted Genes..............................................................................................................................28
1.5.3 Searching for Candidate Imprinted Genes by Searching for Genes with Differential Allelic Expression.......................................................................................................................................29
1.5.4 Searching for Candidate Imprinted Genes by Searching for RNA Polymerase Bound to Only One of Two Alleles ................................................................................................................................29
1.5.5 Searching for Candidate Parent-of-Origin-Specific DMRs Using Tissue with Cells Containing Maternal/Paternal Uniparental Disomies for Human Chromosome 15...........................................30
1.5.6 Searching for Candidate Parent-of-Origin-Specific DMRs Using Biparental Tissues and Tissues with Cells Containing Genome-Wide Maternal/Paternal Uniparental Disomies ............................30
1.5.7 Searching for Candidate Parent-of-Origin-Specific DMRs Using Biparental Diploid Placentas, Diandric Triploid Placentas, Digynic Triploid Placentas, and Androgenetic Complete Hydatidiform Moles (AnCHMs).....................................................................................................31
1.6 Hypothesis and Aims ....................................................................................................................................33
Chapter 2 Materials and Methods................................................................................................................................35
2 Materials and Methods...........................................................................................................................................35
2.1 Sample Collection .........................................................................................................................................35
2.2 Sodium Bisulfite Treatment of DNA ............................................................................................................35
2.3 Microarray Processing...................................................................................................................................38
2.4 CpG Methylated Proportion and Detection P-value For Each Targeted CpG Site........................................39
2.5 Statistical Analyses to Characterize CpG Methylation .................................................................................39
2.6 Compiled List of Microarray CpG Sites in Known Parent-of-Origin-Specific DMRs Associated With Known Imprinted Genes ...............................................................................................................................42
2.7 Selection Criteria for Candidate Maternally Methylated CpG Sites in Blood...............................................47
2.8 Selection Criteria for Candidate Maternally Methylated CpG Sites in Placenta...........................................48
2.9 Selection Criteria for Candidate Paternally Methylated CpG Sites in Blood................................................49
2.9.1 Adapted Selection Criteria for Candidate Paternally Methylated CpG Sites in Blood ...................50
2.10 Selection Criteria for Candidate Paternally Methylated CpG Sites in Placenta ............................................52
2.10.1 Adapted Selection Criteria for Candidate Paternally Methylated CpG Sites in Placenta ...............53
2.11 Targeted Quantitative Sodium Bisulfite Pyrosequencing..............................................................................56
2.12 Box-and-whisker Plots ..................................................................................................................................58
2.13 Sodium Bisulfite Cloning/Sequencing ..........................................................................................................58
vi
2.14 Allelic Expression Analyses of AXL in Humans...........................................................................................59
Chapter 3 Results.........................................................................................................................................................63
3 Results ...................................................................................................................................................................63
3.1 CpG Methylation in Known Parent-of-Origin-Specific DMRs Associated with Known Imprinted Genes..63
3.2 Candidate Parent-of-Origin-Specific Differentially Methylated CpG Sites (DMCpGs)...............................64
3.3 Allelic Expression of AXL in Humans...........................................................................................................67
Chapter 4 Discussion...................................................................................................................................................85
4 Discussion..............................................................................................................................................................85
4.1 More Complete Picture of CpG Methylation in Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes) ..............................................................................................................................85
4.2 Biparental Tissues (When Compared to Uniparental Tissues) Have Differential CpG Methylation in Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes) .............................................86
4.3 Variable CpG Methylation in Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes) ...........................................................................................................................................................87
4.4 Poor Microarray Coverage of Known Paternally Methylated DMRs ...........................................................88
4.5 Very Few Candidate Imprinted Loci Identified By More Than One Study ..................................................89
4.6 Boundaries of Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes) are Unknown.......................................................................................................................................................91
4.7 Candidate Maternally Methylated DMR in Promoter of Imprinted Gene NAP1L5 ......................................92
4.8 Candidate Paternally Methylated DMR in Promoter of Imprinted Gene ZNF597 ........................................92
4.9 Candidate Maternally Methylated DMR in Promoter of RIMS2...................................................................93
4.10 Candidate Paternally Methylated DMR in Promoter of AXL ........................................................................93
4.11 Polymorphic Imprinting of AXL....................................................................................................................93
4.12 General Discussion........................................................................................................................................94
4.13 Future Directions...........................................................................................................................................95
4.14 Conclusions ...................................................................................................................................................96
References ...................................................................................................................................................................98
Appendices ................................................................................................................................................................128
vii
List of Tables
Table 3-1: AXL SNP Quantification in DNA and RNA of Informative Individuals 83
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs 129
Table A-2: Description of Blood Samples 140
Table A-3: Description of Placenta Samples 141
Table A-4: Number of CpG Methylated Proportions Replaced with “N/A” 142
Table A-5: Array CpG Sites Located in DMRs Associated with Known Imprinted Genes 143
Table A-6: Candidate Maternally Methylated CpG Sites in Blood 144
Table A-7: Candidate Maternally Methylated CpG Sites in Placenta 147
Table A-8: Candidate Paternally Methylated CpG Sites in Blood 151
Table A-9: Candidate Paternally Methylated CpG Sites in Placenta 152
Table A-10: PCR Conditions for Bisulfite Pyrosequencing 153
Table A-11: PCR Cycling Conditions for Bisulfite Pyrosequencing 154
Table A-12: Primer Sequences for PCR for Bisulfite Pyrosequencing 155
Table A-13: Primer Sequences For Bisulfite Pyrosequencing Reactions 156
Table A-14: PCR Conditions for Sodium Bisulfite Sequencing 157
Table A-15: PCR Cycling Conditions for Sodium Bisulfite Sequencing 158
Table A-16: Primer Sequences for PCR for Sodium Bisulfite Sequencing 159
Table A-17: PCR Conditions for SNP (rs1051008) Pyrosequencing 160
Table A-18: PCR Cycling Conditions for SNP (rs1051008) Pyrosequencing 161
Table A-19: Primer Sequences for PCR for SNP (rs1051008) Pyrosequencing 162
Table A-20: Primer Sequence for SNP (rs1051008) Pyrosequencing Reactions 163
Table A-21: Overlapping Candidate Maternally Methylated CpG sites 164
Table A-22: Overlapping Candidate Paternally Methylated CpG sites 165
Table A-23: Candidate DMCpGs That May Represent Components of Known DMRs 166
viii
List of Figures
Figure 1-1: Locations of Known Imprinted Regions in the Human and Mouse Genomes 2
Figure 1-2: Imprinted Regions/Domains on Human Chromosome 11p15 16
Figure 1-3: Chromatin: DNA and its Associated Proteins 19
Figure 1-4: Location of Covalent Post-translational Histone Tail Modifications 21
Figure 2-1: Steps in the Sodium Bisulfite-Mediated Deamination of Cytosine 36
Figure 2-2: Distribution of Unadjusted and FDR-adjusted Mann-Whitney P-values 43
Figure 2-3: Expected CpG Methylation in Maternally/Paternally Methylated DMRs 45
Figure 3-1: CpG Methylation in DMRs Associated With Known Imprinted Genes 68
Figure 3-2: CpG Methylation within Four DMRs Associated with Imprinted Genes 70
Figure 3-3: CpG Methylation within the Candidate NAP1L5 DMR 73
Figure 3-4: CpG Methylation within the Candidate ZNF597 DMR 75
Figure 3-5: CpG Methylation within the Candidate RIMS2 DMR 77
Figure 3-6: CpG Methylation within the Candidate AXL DMR 79
Figure 3-7: Candidate AXL DMR Sodium Bisulfite Sequencing 81
ix
List of Appendices
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs 129
Table A-2: Description of Blood Samples 140
Table A-3: Description of Placenta Samples 141
Table A-4: Number of CpG Methylated Proportions Replaced with “N/A” 142
Table A-5: Array CpG Sites Located in DMRs Associated with Known Imprinted Genes 143
Table A-6: Candidate Maternally Methylated CpG Sites in Blood 144
Table A-7: Candidate Maternally Methylated CpG Sites in Placenta 147
Table A-8: Candidate Paternally Methylated CpG Sites in Blood 151
Table A-9: Candidate Paternally Methylated CpG Sites in Placenta 152
Table A-10: PCR Conditions for Bisulfite Pyrosequencing 153
Table A-11: PCR Cycling Conditions for Bisulfite Pyrosequencing 154
Table A-12: Primer Sequences for PCR for Bisulfite Pyrosequencing 155
Table A-13: Primer Sequences For Bisulfite Pyrosequencing Reactions 156
Table A-14: PCR Conditions for Sodium Bisulfite Sequencing 157
Table A-15: PCR Cycling Conditions for Sodium Bisulfite Sequencing 158
Table A-16: Primer Sequences for PCR for Sodium Bisulfite Sequencing 159
Table A-17: PCR Conditions for SNP (rs1051008) Pyrosequencing 160
Table A-18: PCR Cycling Conditions for SNP (rs1051008) Pyrosequencing 161
Table A-19: Primer Sequences for PCR for SNP (rs1051008) Pyrosequencing 162
Table A-20: Primer Sequence for SNP (rs1051008) Pyrosequencing Reactions 163
Table A-21: Overlapping Candidate Maternally Methylated CpG sites 164
Table A-22: Overlapping Candidate Paternally Methylated CpG sites 165
Table A-23: Candidate DMCpGs That May Represent Components of Known DMRs 166
x
List of Abbreviations
AnCHM androgenetic complete hydatidiform mole
AP-2 activating protein 2
AS Angelman syndrome
AXL anexelekto
BWS Beckwith-Wiedemann syndrome
cDNA copy deoxyribonucleic acid
CGIs CpG islands
CML chronic myeloid/myelogenous leukemia
CMLs chronic myeloid/myelogenous leukemias
CpG cytosine connected to a guanine through a phosphate group
CRC colorectal cancer
CRCs colorectal cancers
CTCF CCCTC-binding factor
DMCpG differentially methylated CpG site
DMCpGs differentially methylated CpG sites
DMR differentially methylated region
DMRs differentially methylated regions
DNA deoxyribonucleic acid
DNMT DNA methyltransferase
DNMTs DNA methyltransferases
dpc days post coitus
xi
EC esophageal cancer
ECs esophageal cancers
EMT epithelial to mesenchymal transition
FDR false discovery rate
GOM gain of methylation
H2 histone 2
H3 histone 3
H3K27 histone 3 lysine 27
H3K4 histone 3 lysine 4
H3K9 histone 3 lysine 9
H4 histone 4
H4K20 histone 4 lysine 20
HDAC histone deacetylase
hESC human embryonic stem cell
HP1 heterochromatin protein 1
IC1 imprinting centre 1
IC2 imprinting centre 2
ICC intraclass correlation coefficient
ID identifier
IQR interquartile range
KMMDMRs known maternally methylated DMRs associated with known imprinted genes
KPMDMRs known paternally methylated DMRs associated with known imprinted genes
LCL lymphoblastoid cell line
xii
LCLs lymphoblastoid cell lines
LOI loss of imprinting
LOM loss of methylation
MAT maternally inherited chromosome
MBD methyl-CpG binding domain
MCT mature cystic ovarian teratoma
MeCP methyl-cytosine binding protein
MeDIP methylated DNA immunoprecipitation
miRNA microRNA
mUPD maternal uniparental disomy
mUPD11 maternal uniparental disomy for chromosome 11
mUPD14 maternal uniparental disomy for chromosome 14
N number of values
N/A Not Applicable
ncRNA non-coding RNA
ncRNAs non-coding RNAs
PAT paternally inherited chromosome
PCR Polymerase Chain Reaction
PRC1 polycomb repressive complex 1
pUPD paternal uniparental disomy
pUPD11 paternal uniparental disomy for chromosome 11
pUPD11p15 paternal uniparental disomy for chromosome region 11p15
pUPD14 paternal uniparental disomy for chromosome 14
xiii
pUPD4 paternal uniparental disomy for chromosome 4
PWS Prader-Willi syndrome
RCC renal cell carcinoma
RCCs renal cell carcinomas
RNA ribonucleic acid
RNAs ribonucleic acids
ROI retention of imprinting
RSS Russell-Silver syndrome
snoRNA small nucleolar RNA
SNP single-nucleotide polymorphism
SP1 specificity protein 1
SP3 specificity protein 3
Std. Dev. standard deviation
TCAG The Centre for Applied Genomics
tDMR tissue-specific differentially methylated region
UPD uniparental disomy
UPDs uniparental disomies
UPD11p15 uniparental disomy for chromosome 11 region 11p15
UPD14 uniparental disomy for chromosome 14
UPD4 uniparental disomy for chromosome 4
WBC white blood cell
WGA whole genome amplification
YY1 Ying Yang 1
1
Chapter 1 Introduction
1 Introduction
1.1 Introduction to Imprinted Genes
Imprinted genes are expressed or silenced depending on their parent-of-origin, either the
maternal or paternal chromosome. This parent-of-origin-specific expression may be tissue-
specific and/or developmental-stage-specific1-3. There are approximately 70 known imprinted
genes in humans and 100 known imprinted genes in mice4. These known imprinted genes are
located in imprinted regions that map across the genome (Figure 1-1). Although there are many
different mechanisms that regulate the expression pattern of imprinted genes5-12, imprinted gene
expression patterns are usually associated with parent-of-origin-specific DNA differentially
methylated regions (DMRs)5,7,8,13-29 (discussed later in “DNA Methylation and Imprinted Genes”
section).
1.1.1 Function and Expression Pattern of Imprinted Genes
Imprinted genes have been implicated in many different biological processes30-67, including
development. Imprinted genes Igf2 and Ube3a have been implicated in development 46,47. In
murine conceptuses, reduced expression of functional Igf2 (achieved by knocking out the
preferentially expressed allele) leads to fetal and placental growth restriction46, whereas
overexpression of functional Igf2 (achieved by generating chimeric conceptuses by inserting
embryonic stem cells expressing functional transgenic Igf2 into conceptuses at the blastocyst
stage) leads to fetal overgrowth68. Reduced expression of functional Ube3a (achieved by
knocking out the maternal copy of Ube3a) leads to motor dysfunction in mice47.
Imprinted genes Igf2 and Ube3a demonstrate the complex regulation of imprinted genes. In
mice, Ube3a is usually paternally and maternally expressed in most tissues, while Ube3a is
usually paternally silent and maternally expressed in brain2. Igf2 is usually paternally expressed
and maternally silent in most mouse tissues, but expressed from both parental chromosomes in
mouse central nervous system neurons1.
2
Figure 1-1: Locations of Known Imprinted Regions in the Human and Mouse Genomes
Idiograms showing the genomic locations of known imprinted regions (i.e., regions with known imprinted genes) in
the human (A) and mouse (B) genomes. The red filled triangles point to genomic locations of known imprinted
regions. Some known imprinted regions contain only one known imprinted gene, whereas other known imprinted
regions contain 14+ known imprinted genes.
3
A
B
Figure 1-1: Locations of Known Imprinted Regions in the Human and Mouse Genomes
4
1.1.2 Discovery of Imprinted Genes
Extensive research on the reasons why parthenogenesis, “the process by which an egg can
develop into an embryo in the absence of sperm”69, does not occur in mammals when it does in
other classes of vertebrates, such as insects and reptiles, led to the discovery of imprinted genes.
Kaufman and Sachs (1975)70 described the death of parthenogenetic embryos in mice. The
reasons for the deaths of mouse parthenogenetic embryos was not immediately known. With the
combined work of Surani et al. (1984)71 and McGrath and Solter (1984)72, it was shown that both
sperm and oocyte pronuclei were required for normal development in mouse conceptuses.
Surani et al (1984)71 used nuclear transplantation to transplant a donor oocyte pronucleus into a
recipient oocyte to create a diploid parthenogenetic (2 maternal genomes) conceptus. They also
used nuclear transplantation to transplant a donor sperm pronucleus into a recipient oocyte to
create a diploid biparental (1 maternal and 1 paternal genome) conceptus. The diploid biparental
conceptuses developed to term. However, the diploid parthenogenetic conceptuses did not
develop to term as they died during gestation and were absorbed into the endometrium.
McGrath and Solter (1984)72 used nuclear transplantation of pronuclei between zygotes to
generate diploid androgenetic (2 paternal genomes) and diploid gynogenetic (2 maternal
genomes) conceptuses (gynogenesis “is a form of development in which eggs are activated by
sperm which does not contribute genetically to the resulting embryo”73). They also used nuclear
transplantation of pronuclei between zygotes to generate diploid biparental (1 maternal and 1
paternal genome) conceptuses to compare to their diploid androgenetic and gynogenetic
conceptuses. The diploid biparental conceptuses developed to term, whereas the diploid
androgenetic and gynogenetic conceptuses did not. Both the diploid androgenetic and
gynogenetic conceptuses died during gestation and were absorbed into the endometrium. Diploid
gynogenetic conceptuses developed embryonic tissues, but very little to no trophoblastic tissue in
comparison to diploid biparental conceptuses. Diploid androgenetic conceptuses developed
trophoblastic tissue, but very little embryonic tissues in comparison to diploid biparental
conceptuses. Barton et al. (1984)74 suggested sperm pronuclei are necessary for the development
of extraembryonic tissues such as trophoblast, whereas oocyte pronuclei are necessary for some
phases of embryogenesis.
5
The existence of imprinted genes was also suggested by studies of mice with paternal and
maternal uniparental disomies (UPDs)75. The term paternal uniparental disomy (pUPD) refers to
cells that have two homologous chromosomes from the father instead of one homologous
chromosome from each parent. The term maternal uniparental disomy (mUPD) refers to cells
that have two homologous chromosomes from the mother instead of one homologous
chromosome from each parent. Paternal and maternal uniparental disomies (UPDs) for the same
genomic region had opposite effects on development. Mice with a maternal uniparental disomy
for chromosome 11 (mUPD11) were small, whereas mice with a paternal uniparental disomy for
chromosome 11 (pUPD11) were large, when compared to mice with biparental inheritance of
chromosome 1175. Mice with a maternal uniparental disomy for distal chromosome 2 were
hypoactive, whereas mice with a paternal uniparental disomy for distal chromosome 2 were
hyperactive, in comparison to mice with a biparental inheritance for distal chromosome 275.
1.1.2.1 Studies that Led to the Discovery of Mouse Igf2r Imprinting
In 1962, in the Jackson Laboratory (Bar Harbor, Maine), a mouse from an AKR/J strain was
born with a hair-pin tail76. The mutation, a deletion, that caused the hairpin-tail phenotype was
identified and referred to as Thp. Johnson (1974)76 studied the phenotypic effect of the hairpin
mutation (Thp). He noted that if a mouse embryo inherited the Thp mutation maternally (i.e., via
the egg), the mouse embryo typically died late in gestation. He also noted that if a mouse embryo
inherited the Thp mutation paternally (i.e., via the sperm), the mouse embryo was viable.
McGrath and Solter (1984)77 carried out reciprocal nuclear transplantation experiments between
one-cell embryos generated using sperm from +/+ males and oocytes from Thp /+ and +/+
females. They observed that the maternally inherited lethal effect was preserved when Thp /+
pronuclei were transplanted into +/+ one-cell embryos (that had their +/+ pronuclei removed).
They also observed that the maternally inherited lethal effect was not preserved when +/+
pronuclei were transplanted into Thp /+ one-cell embryos (that had their Thp /+ pronuclei
removed). These results suggested that the lethal effect was inherited via the oocyte’s pronuclei,
not the oocyte’s cytoplasm.
6
Winking and Silver (1984)78 suggested that deletion of a locus, which they termed the Tme (T-
associated maternal effect) locus, was responsible for the maternally inherited lethal effect. They
noted that the Tme locus is located within the genomic region deleted in the Thp mutation. They
also noted that the Tme locus is deleted in other chromosomal variations that lead to the same
maternally inherited lethal effect.
Barlow et al. (1991)79 performed expression analyses for genes located within the Tme locus
using mouse embryos that inherited Tme locus deletions from either parent, as well as mouse
embryos that did not inherit a Tme locus deletion. They observed expression of Igf2r in mouse
embryos that inherited the Tme locus deletion paternally (i.e., via the sperm). They also observed
expression of Igf2r in mouse embryos that did not inherit a Tme locus deletion. However, they
did not observe expression of Igf2r in mouse embryos that inherited the Tme locus deletion
maternally (i.e., via the egg). These results suggested Igf2r has parent-of-origin-specific
expression, which is characteristic of an imprinted gene. The other three genes (Tcp1, Plg, and
Sod2) located within the Tme locus they assayed had expression in all mouse embryos,
suggesting that these three genes do not have parent-of-origin-specific expression in mouse
embryos.
1.1.2.2 Studies that Led to the Discovery of Mouse Igf2 Imprinting
Searle and Beechey (1990)80 using crosses of mice with translocations involving chromosome 7
showed that a maternal duplication (or a paternal deficiency) of distal chromosome 7 results in
late prenatal lethality. They also demonstrated that a paternal duplication (or a maternal
deficiency) of distal chromosome 7 results in early embryonic lethality.
DeChiara et al. (1990)48 generated chimeric mice with a targeted disruption in the gene encoding
insulin-like growth factor II (IGF-II). They noted that if a mouse inherited the deletion
maternally (i.e., via the egg), the mouse developed normally. They noted, however, that if a
mouse inherited the deletion paternally (i.e., via the sperm), the mouse became growth deficient.
They also noted that mice homozygous for the deletion were phenotypically indistinguishable
from the heterozygous mice that inherited the deletion paternally. They performed expression
analyses for Igf2 using mouse embryos that inherited the Igf2 deletion from their father, as well
7
as mouse embryos that did not inherit the Igf2 deletion. They observed expression of Igf2 in all
mouse embryos. However, the expression of Igf2 in mouse embryos that inherited the Igf2
deletion from their father was 10-fold less when compared to mouse embryos that did not inherit
the Igf2 deletion.
DeChiara et al. (1991)1 performed nuclease protection assays on RNA from mouse embryos that
inherited the Igf2 deletion from either parent, as well as mouse embryos that did not inherit the
Igf2 deletion. They observed expression of Igf2 in mouse embryos and placentas that inherited
the Igf2 deletion maternally. They also observed expression of Igf2 in mouse embryos and
placentas that did not inherit the Igf2 deletion. However, they did not observe expression of Igf2
in mouse embryos and placentas that inherited the Igf2 deletion paternally. These results
suggested Igf2 has parent-of-origin-specific expression, which is a characteristic of imprinted
genes.
1.1.2.3 Studies that Led to the Discovery of Human H19 Imprinting
Bartolomei et al. (1991)81 performed nuclease protection assays on RNA from hybrid offspring
of four subspecies of Mus. They observed that only the maternally derived (i.e., via the egg) H19
gene was expressed. These results suggested mouse H19 has parent-of-origin-specific
expression, which is a characteristic of imprinted genes.
Zhang and Tycko (1992)82 performed H19 expression analyses (using informative transcribed
polymorphisms, restriction enzymes, and sequencing of PCR products) on genomic DNA and
cDNA (derived from RNA) from human fetal organs (liver, kidney, lung, heart, adrenal gland,
spleen, thymus, brain, leptomeninges, and placenta). They observed monoallelic expression of
H19 in all tissues (except placenta). They suggested the biallelic expression of H19 in placenta
may be due to maternal decidua contamination in the collected placenta samples.
Rachmilewitz et al. (1992)83 performed H19 expression analyses in human first trimester
placentas, term placentas, and androgenetic complete hydatidiform moles (discussed later in
“Uniparental Tissues” section). The H19 expression observed in androgenetic complete
hydatidiform moles was less than 10% the H19 expression observed in first trimester and term
placentas.
8
1.2 Uniparental Tissues - Androgenetic Complete Hydatidiform Mole (AnCHM) and Mature Cystic Ovarian Teratoma (MCT)
An androgenetic complete hydatidiform mole (AnCHM) is a conceptus with excessive
proliferation of villi and absent embryonic development84,85. AnCHMs occur naturally (i.e.,
without human intervention) in humans and are similar to diploid androgenetic mouse
conceptuses (mentioned previously in “Discovery of Imprinted Genes” section) in that they both
contain two paternal (i.e., sperm-derived) genomes and consist mainly of trophoblastic tissue72,86-
89. Kajii and Ohama (1977)86 suggested AnCHMs may result from the fertilization of an empty
(i.e., no maternal genome) egg by a haploid sperm that has its genome duplicated after
fertilization. Kajii and Ohama (1977)86 also suggested AnCHMs may arise from the fertilization
of an empty (i.e., no maternal genome) egg by two haploid sperms or by a diploid sperm.
A mature cystic ovarian teratoma (MCT) is a dermoid cyst containing differentiated tissues that
arise from embyronal ectoderm, mesoderm, and endoderm90. MCTs occur naturally (i.e., without
human intervention) in humans and are similar to diploid gynogenetic mouse conceptuses
(mentioned previously in “Discovery of Imprinted Genes” section) in that they both contain two
maternal (i.e., oocyte-derived) genomes and consist of differentiated tissues from all three
embryonal germ cell layers (i.e., ectoderm, mesoderm, and endoderm)91,92. Linder et al. (1975)93
suggested MCTs may result from a single female germ cell after the first meiotic division and the
subsequent failure of meiosis II. Other studies have suggested MCTs may arise from any stage of
female oogenesis94-96.
9
1.3 Introduction to Epigenetics
Epigenetics refers to “the study of any potentially stable and, ideally, heritable change in gene
expression or cellular phenotype that occurs without changes in” DNA nucleotide sequence 97.
Epigenetic mechanisms influence gene expression without changing the primary DNA sequence.
Epigenetic mechanisms, such as DNA methylation, covalent post-translational modification of
histone tails, and long non-coding RNAs (ncRNAs), regulate the expression patterns of
imprinted genes5,7,10-12. Epigenetic mechanisms play important roles in maintaining transposable
elements in their inactive state, inactivating X chromosomes, differentially marking parental
alleles of imprinted regions, and maintaining genome stability and integrity6,98-106.
1.3.1 DNA Methylation
DNA methylation is the epigenetic modification that has been most widely studied in mammals
with respect to normal development and disease states.
1.3.1.1 DNA methyltransferases (DNMTs)
In vertebrates, DNA becomes methylated on the carbon-5 position of the cytosine ring by DNA
methyltransferase enzymes, DNMT1, DNMT3a, and DNMT3b107-109.
DNMT1 methylates hemi-methylated CpG sites and during DNA replication it is recruited to
replication foci to faithfully replicate the CpG methylation state in the daughter strand110,111.
Mouse embryos with homozygous Dnmt1 deletions die at approximately 10-11 days post coitus
(dpc), demonstrating Dnmt1 is necessary for normal embryonic development112.
DNMT3a and DNMT3b methylate unmethylated CpG sites113. When a DNA methyltransferase
methylates an unmethylated CpG site, the DNA methylation is considered de novo. Mice with
homozygous Dnmt3a deletions die shortly (4 weeks) after birth, indicating Dnmt3a is essential
for ordinary development114. Mouse embryos with homozygous Dnmt3b deletions die before
birth, showing Dnmt3b is required for typical fetal development114.
10
DNMT3l shares sequence identity with DNMT3a and DNMT3b, but DNMT3l lacks the catalytic
domain of DNMT3a and DNMT3b115. DNMT3l interacts with DNMT3a and DNMT3b to
facilitate the interaction with targets to be methylated116. Mice with homozygous Dnmt3l
deletions are sterile117. Germ cells in male mice with homozygous Dnmt3l deletions fail to
mature and undergo apoptosis118. Oogenesis appears to be normal in female mice with
homozygous Dnmt3l deletions117. However, the offspring of female mice with homozygous
Dnmt3l deletions mated with male wild-type mice die at approximately 9.5 days post coitus
(dpc)117. Bourc’his et al. (2001)117 suggested Dnmt3l may play a role in establishing imprinted
gene expression patterns as Dnmt3l is usually only expressed in germ cells when differential
DNA methylation imprints on the maternal and paternal chromosomes are established.
1.3.1.2 CpG Islands (CGIs)
The majority of cytosine methylation occurs in CpG dinucleotides, cytosines that are followed by
guanines on the same strand of DNA119. CpG dinucleotides are underrepresented in vertebrate
genomes; occurring at 20% of their expected frequency120,121. CpG islands are regions of the
genome rich in cytosine, guanine, and CpG dinucleotides122. Gardiner-Garden and Frommer
(1987)122 defined CpG islands as genomic regions with cytosine-guanine content of 50% or
more, length greater than 200 base pairs, and a ratio greater than 0.6 of the observed number of
CpG dinucleotides to the expected number of CpG dinucleotides in the given genomic region. In
a later study, Takai and Jones (2002)123 noted definitions of CpG islands are subjective and
defined CpG islands as genomic regions with cytosine-guanine content of 55% or more, length
greater than 500 base pairs, and a ratio greater than 0.65 of the observed number of CpG
dinucleotides to the expected number of CpG dinucleotides in the given genomic region. CpG
islands occur in approximately 40% of mammalian gene promoters124. The conservation of these
CpG islands, as well as the high number of transcription factor binding sites containing CpG
sites in their consensus sequences demonstrate the importance of these regions125,126.
11
1.3.1.3 Gene Silencing
Cytosine methylation within transcription factor binding sites can deter transcription factor
binding, thereby affecting gene expression127-130. For example, transcription factors such as
activating protein 2 (AP-2), specificity protein 1 (SP1), specificity protein 3 (SP3), and Ying
Yang 1 (YY1) cannot bind to methylated cytosines in their transcription factor binding sites128-
130. If these transcription factors cannot bind, the recruitment of transcriptional machinery will be
affected, leading to a reduction in gene expression. For example, methylation at the transcription
factor YY1 DNA binding site in the promoter region of imprinted gene Peg3 leads to decreased
Peg3 expression130.
Cytosine methylation can also influence transcription by inhibiting the binding of transcriptional
regulators to their DNA binding sites. For example, the transcriptional regulator CCCTC-binding
factor (CTCF) has reduced binding affinity depending on the density and location of methylated
cytosines in its DNA binding site5,131. Human CTCF has eleven zinc finger DNA binding
domains132. CTCF binds to DNA using different combinations of its zinc finger DNA binding
domains132-136. The human genome contains roughly 15,000 CTCF binding sites137,138. CTCF has
been implicated in the activation and repression of many genes5,132,134-136. For example, CTCF
binding in imprinting centre 1 (IC1) on maternal human chromosome 11p15.5 is associated with
increased expression of the maternally expressed imprinted gene H19 and decreased expression
of the paternally expressed imprinted gene IGF29.
Aberrant DNA methylation patterns have been observed in cancer. Whereas cancers generally
demonstrate genome-wide hypomethylation, hypermethylation at the promoters of specific genes
plays an important role in tumourigenesis139. DNA methylation silences tumour-suppressor and
DNA damage repair genes, leading to a predisposition to cancer139-154. DNA hypermethylation
has been observed in the promoter region of BRCA1, a tumour suppressor gene, in breast and
ovarian cancer when compared to non-cancerous breast and ovarian tissue140,155,156. DNA
methylation in the promoter region of BRCA1 silences BRCA1157-159. DNA hypermethylation
has also been observed in the promoter region of MLH1, a gene involved in DNA damage repair,
in sporadic colorectal cancer when compared to non-cancerous colon tissue160. DNA methylation
in the promoter region of MLH1 silences MLH1161.
12
1.3.1.4 DNA Methylation and Imprinted Genes
The parent-of-origin-specific expression pattern of imprinted genes has been demonstrated in
association with parent-of-origin-specific differentially methylated regions (DMRs). Many
studies have assessed cytosine methylation within these regions (Appendices Table A-
1)16,18,21,24,28,162-205. Aberrant cytosine methylation within some of these regions has been
associated with human disorders206-209 (discussed later in “Human Disorders Associated With
Uniparental Origin Of Limited Genomic Regions” section). Classic examples of parent-of-
origin-specific DMRs (associated with imprinted genes) are imprinting centre 1 (IC1) and
imprinting centre 2 (IC2) on human chromosome 11p15 (Figure 1-2)210.
1.3.1.4.1 Imprinting Centre 1 (IC1)
IC1, also known as H19DMR, is a primary parent-of-origin-specific DMR, a parent-of-origin-
specific DMR whose parent-of-origin-specific CpG methylation is inherited from the germline,
located between maternally expressed imprinted gene H19 and paternally expressed imprinted
gene IGF2. IC1 is usually methylated in sperm and unmethylated in ova173,211. The developing
embryo and placenta inherit these parental methylation patterns. Since IC1 is usually methylated
on the paternally inherited chromosome and unmethylated on the maternally inherited
chromosome, IC1 is referred to as a paternally methylated DMR. In contrast, an imprinting
centre (IC) that is usually unmethylated on the paternally inherited chromosome and methylated
on the maternally inherited chromosome is referred to as a maternally methylated DMR.
Usually the maternal unmethylated IC1 is bound by CTCF, a transcriptional regulator, resulting
in expression of H19 and silencing of Igf25,131,212. The CTCF bound to unmethylated IC1 causes
interference in the competition between H19 and Igf2 for a set of common downstream
enhancers (3’ of H19). When CTCF is bound to unmethylated IC1, Igf2 no longer has access to
the H19 downstream enhancers. As a result, H19 is expressed and Igf2 is silenced. In contrast,
CTCF does not bind to the paternal methylated IC1. Paternal Igf2 has access to the H19
downstream enhancers, resulting in expression of Igf2 and silencing of H19.
Loss of imprinting (LOI) of IGF2, i.e., expression of IGF2 from both maternal and paternal
chromosome 11, has been observed in some cancers that have retention of imprinting (ROI) of
13
IGF2, i.e., IGF2 paternally expressed and maternally silent, in adjacent non-cancerous tissue.
Loss of imprinting (LOI) of IGF2 has been noted in 100% of advanced chronic
myeloid/myelogenous leukemias (CMLs)213, 40-70% of Wilm’s tumours (nephroblastomas)214-
217, 30-65% of colorectal cancers (CRCs)201,218-220, ~50% of renal cell carcinomas (RCCs)221,222,
and 20-55% of esophageal cancers (ECs)223,224. The general population’s lifetime risk of
colorectal cancer (CRC) and renal cell carcinoma (RCC) is approximately 1 in 20225 and 1 in
74226, respectively. From the above values, it can be roughly estimated that the general
population’s lifetime risk of colorectal cancer (CRC) with loss of imprinting (LOI) of IGF2 is
between 3 in 200 and 13 in 400. It can also be roughly estimated that the general population’s
lifetime risk of renal cell carcinoma (RCC) with loss of imprinting (LOI) of IGF2 is 1 in 148.
The loss of imprinting (LOI) of IGF2 in Wilm’s tumours (nephroblastomas) and colorectal
cancers (CRCs) was observed in association with a gain of methylation (GOM) on the normally
unmethylated IC1201,203. The loss of imprinting (LOI) of IGF2 in colorectal cancers (CRCs) was
also observed in association with a loss of methylation (LOM) on the normally methylated
maternally inherited copy of IGF2 DMR0 (the paternally inherited copy of IGF2 DMR0 is
usually unmethylated)227. IGF2 DMR0 is an example of a secondary parent-of-origin-specific
DMR, which is a parent-of-origin-specific DMR whose parent-of-origin-specific CpG
methylation is established after fertilization.
In mice, a targeted deletion of murine IC1 on paternal chromosome 7 did not interfere with the
imprinted gene expression pattern of Igf2; paternally expressed imprinted gene Igf2 was
expressed on the paternal chromosome 7 with the targeted deletion of IC1228. A targeted deletion
of murine IC1 on maternal chromosome 7 caused the normally silent paternally expressed
imprinted gene Igf2 to be expressed on the maternal chromosome 7 with the targeted deletion of
IC1; loss of imprinting (LOI) of Igf2 occurred in mice with a targeted deletion of murine IC1 on
maternal chromosome 7 and a wild-type paternal chromosome 7228. The expression of Igf2 in
mice with a targeted deletion of murine IC1 on maternal chromosome 7 and a wild-type paternal
chromosome 7 was approximately twice the expression of Igf2 in wild-type littermates228. For
comparison, the expression of IGF2 in Wilm’s tumours (nephroblastomas) with loss of
imprinting (LOI) of IGF2 was approximately double the expression of IGF2 in adjacent non-
cancerous colonic tissue with retention of imprinting (ROI) of IGF2229. Mice with a targeted
deletion of murine IC1 on maternal chromosome 7 and a wild-type paternal chromosome 7 were
14
heavier at birth than their wild-type littermates228. Mice with a targeted deletion of murine IC1
on maternal chromosome 7 and a wild-type paternal chromosome 7 developed approximately
double the number of adenomas as wild-type littermates230.
1.3.1.4.2 Imprinting Centre 2 (IC2)
Another classic example of a primary parent-of-origin-specific DMR associated with parent-of-
origin-specific gene expression is imprinting centre 2 (IC2), which is also known as KvDMR1.
This DMR is located within intron 9 of imprinted gene KCNQ1. IC2, associated with paternally
expressed imprinted gene KCNQ1OT1 and maternally expressed imprinted genes KCNQ1,
KCNQ1DN, CDKN1C, SLC22A18, and PHLDA28,9, is usually unmethylated in sperm and
methylated in ova169. CpG methylation at IC2 silences the expression of KCNQ1OT1, a long
non-coding RNA that starts in intron 9 of the KCNQ1 gene and is read as an antisense
transcript10. Kcnq1ot1 associates with the chromosomal region it was transcribed from12, leading
to in cis silencing of the maternally expressed imprinted genes Kcnq1, Cdkn1c, Slc22a18, and
Phlda211,12.
1.3.1.4.3 Intergenic Germline Differentially Methylated Region (IG-DMR)
IG-DMR is a primary parent-of-origin-specific DMR associated with parent-of-origin-specific
gene expression. IG-DMR is located between the paternally expressed imprinted gene DLK1 and
maternally expressed imprinted gene MEG3 (Meg3 in mice is called Gtl2). IG-DMR is usually
methylated in sperm and unmethylated in ova175. The developing embryo and placenta inherit
these parental methylation patterns.
In mice, a targeted deletion of murine IG-DMR on paternal chromosome 12 did not interfere
with the imprinted gene expression pattern of Dlk1, Gtl2, miR-127, miR-136, Rtl1, and Dio3;
paternally expressed imprinted genes Dlk1, Rtl1, and Dio3 were expressed and maternally
expressed imprinted genes Gtl2, miR-127, and miR-136 were silent on the paternal chromosome
12 with the targeted deletion of IG-DMR231. Mice with a targeted deletion of murine IG-DMR on
15
paternal chromosome 12 and a wild-type maternal chromosome 12 developed normally231. A
targeted deletion of murine IG-DMR on maternal chromosome 12 caused the normally silent
paternally expressed imprinted genes Dlk1, Rtl1, and Dio3 to be expressed and the normally
expressed maternally expressed imprinted genes Gtl2, miR-127, and miR-136 to be silenced on
the maternal chromosome 12 with the targeted deletion of IG-DMR231. Mice with a targeted
deletion of murine IG-DMR on maternal chromosome 12 and a wild-type paternal chromosome
12 did not survive more than a few hours after birth231.
1.3.1.4.4 DIRAS3 DMR
DIRAS3 DMR is another parent-of-origin-specific DMR associated with parent-of-origin-
specific gene expression. DIRAS3 DMR overlaps the promoter region and gene body of the
paternally expressed imprinted gene DIRAS37,232. Changes in covalent post-translational histone
tail modifications (discussed later in “Covalent Post-translational Modification of Histone Tails”
section) and DNA methylation in the promoter region of DIRAS3 can decrease or increase the
expression of DIRAS37.
DIRAS3 is paternally expressed and maternally silenced in breast tissue232. Silencing of DIRAS3
has been noted in 25-55% of breast tumours233,234. The general female population’s lifetime risk
of breast cancer is 1 in 8235,236. From the above values, it can be roughly estimated that the
general female population’s lifetime risk of breast cancer with silencing of DIRAS3 is between 1
in 32 and 11 in 160. The silencing of DIRAS3 in breast tumours has been observed in association
with a deletion of the paternal DIRAS3232.
In mice, expression of functional human DIRAS3 (achieved by generating chimeric conceptuses
by inserting embryonic stem cells expressing functional human DIRAS3 into conceptuses at the
blastocyst stage) interferes with normal growth, development of the thymus, development of the
cerebellar cortex, ovarian folliculogenesis, and mammary gland development and lactation237.
16
Figure 1-2: Imprinted Regions/Domains on Human Chromosome 11p15
A simple representation of imprinted regions/domains on human chromosome 11p15 on maternally (MAT) and
paternally (PAT) inherited human chromosomes. Maternal and paternal chromosomes are usually inherited from ova
and sperm respectively. Maternally expressed imprinted genes are shown as red arrows and paternally expressed
imprinted genes are shown as blue arrows. Light red and light blue bars show corresponding silent imprinted genes.
IC1 (H19DMR) and IC2 (KvDMR1) are the imprinting centres for the imprinted regions/domains on human
chromosome 11p15. Black-filled squares represent DNA methylated regions and white-filled squares represent
unmethylated DNA regions. From the figure, it can be observed that IC1 is paternally methylated and IC2 is
maternally methylated. Drawing is not to scale. Adapted from Developmental Biology, Vol. 320, Guo et al., Altered
gene expression and methylation of the human chromosome 11 imprinted region in small for gestational age (SGA)
placentae, 79-91, Copyright (2008), with permission from Elsevier.
17
Figure 1-2: Imprinted Regions/Domains on Human Chromosome 11p15
18
1.3.2 Covalent Post-translational Modification of Histone Tails
Chromatin is composed of DNA wrapped around histone nucleosome cores (Figure 1-3)238,239.
Approximately 147 base pairs of DNA wrap around a single nucleosome core240. The
nucleosome octamer core is composed of two H2A-H2B dimers and one H3-H4 tetramer239.
Histone H2A, H2B, H3, and H4 have long amino acid tails, which extend out from the globular
core, that can be covalently post-translationally modified241. These covalent post-translational
histone tail modifications, that include phosphorylation, acetylation, and methylation (Figure 1-
4)242,243, may work separately or together to cause downstream effects, such as signal activation
and/or enhancing/repressing gene expression of the local genomic region241.
Some proteins can bind to specific covalent post-translational histone tail modifications. These
proteins may affect RNA polymerase recruitment, which in turn may lead to changes in gene
expression. For example, transcriptional repressor Polycomb (PcG) complex PRC1 can bind to
trimethylated histone 3 lysine 27 (H3K27)244,245. It has been suggested PRC1 may inhibit
transcription by blocking the binding of key transcription factors in promoter/enhancer genomic
regions, RNA polymerase binding to gene promoters, transcription initiation, and/or transcription
elongation246.
Examples of covalent post-translational histone tail modifications that repress transcription are
histone 3 lysine 9 (H3K9) deacetylation, histone 3 lysine 4 (H3K4) demethylation, histone 3
lysine 27 (H3K27) methylation, H3K9 methylation, and histone 4 lysine 20 (H4K20)
methylation247-250. Reversing the covalent post-translational histone tail modifications mentioned
above enhances transcription.
19
Figure 1-3: Chromatin: DNA and its Associated Proteins
A simple representation of DNA, which contains methylated and unmethylated bases, wrapped around histones.
Histones have long amino acid tails, which extend out from the globular core. “Me” indicates a methylated base.
Adapted by permission from Nature Publishing Group: Nature (Qiu, J. (2006). "Epigenetics: unfinished symphony."
Nature 441(7090): 143-145), copyright (2006).
20
Figure 1-3: Chromatin: DNA and its Associated Proteins
21
Figure 1-4: Location of Covalent Post-translational Histone Tail Modifications
Some amino acids of histone tails are subject to covalent modifications. Some of these covalent modifications
include acetylation, methylation, phosphorylation, and ubiquitylation. Adapted by permission from Nature
Publishing Group: Nature (Spivakov, M. and A. G. Fisher (2007). "Epigenetic signatures of stem-cell identity." Nat
Rev Genet 8(4): 263-271), copyright (2007).
22
Figure 1-4: Location of Covalent Post-translational Histone Tail Modifications
23
1.3.3 Long Non-coding RNAs (ncRNAs)
Long non-coding RNAs (ncRNAs) are usually functional transcripts greater than 200 nucleotides
in length251. Approximately 35,000 long non-coding RNAs (ncRNAs) have been identified in the
mouse genome252. Long non-coding RNAs (ncRNAs) can have roles in regulating the expression
pattern of imprinted genes, regulating the activation of transcription factors, interfering with
transcription factor binding, regulating splicing during transcription, interfering with translation,
and X-inactivation253-259. Examples of long non-coding RNAs include XIST and KCNQ1OT1.
XIST is expressed from X chromosomes that are going to become inactive260. XIST coats the
chromosome it is expressed from; thereby leading to that chromosome’s silencing260. While an X
chromosome is being coated by XIST, its histone tails undergo specific covalent post-
translational modifications to strengthen the association of histones to the DNA to repress gene
expression260. KCNQ1OT1 is paternally expressed from human chromosome 11p15 and in cis
associates with it (i.e., paternal human chromosome 11p15), thereby leading to the silencing of
maternally expressed imprinted genes KCNQ1, KCNQ1DN, CDKN1C, SLC22A18, and PHLDA2
on paternal human chromosome 11p1511,12,261,262.
1.3.4 MicroRNAs (miRNAs)
MicroRNAs (miRNAs) are involved in some aspects of epigenetic regulation. MicroRNAs
(miRNAs) are 20 to 25 nucleotides in length and interact with protein complexes to degrade and
inhibit translation of complementary RNA targets263,264. MicroRNAs (miRNAs) are predicted to
regulate 60% of the genes in the human genome265. Some microRNAs are involved in cell
growth, proliferation, and differentiation266-268. For example, miR-124a may hinder the
differentiation of human embryonic stem cells (hESCs)269.
1.3.5 Crosstalk Between Epigenetic Mechanisms
Different epigenetic mechanisms can interact with each other to refine epigenetic control of gene
expression. For example, DNA methylation and repressive covalent post-translational histone tail
24
modifications silence the miR200 family of miRNAs, which impede epithelial to mesenchymal
transition (EMT) and tumour invasion270-275.
Methylated cytosines can be recognized by methyl-cytosine binding proteins MeCP2, MBD1,
and MBD2276. These methyl-CpG binding proteins can interact with complexes of proteins, such
as HDAC1 and Sin3A, to covalently modify histone tails to loosen or tighten chromatin to affect
gene expression277-280. MeCP2 may interact with a methyltransferase for H3K9 (SUV39H1),
histone tail deacetylases HDAC1 and HDAC2 to tighten chromatin and inhibit gene
expression281-287. H3K9 methylation is recognized by heterochromatin protein 1 (HP1), which
can interact with DNA methyltransferase DNMT3a, which can methylate the DNA in the
region288-290. As can be seen with the examples above, different epigenetic mechanisms can
regulate each other. Some may even form feedback loops to enable the refinement of epigenetic
regulation.
25
1.4 Human Disorders Associated With Uniparental Origin Of Limited Genomic Regions
Beckwith-Wiedemann syndrome (BWS), Russell-Silver syndrome (RSS), Prader-Will syndrome
(PWS), and Angelman syndrome (AS) are examples of human genetic/genomic disorders
associated with imprinted regions that may exhibit localized genomic areas (i.e., all or part of
one chromosome) of uniparental origin.
1.4.1 Beckwith-Wiedemann syndrome (BWS)
Beckwith-Wiedemann syndrome (BWS) is a complex genetic/genomic overgrowth disorder.
Features of BWS include macroglossia, exomphalos, gigantism, hemihyperplasia, facial nevus
flammeus, prominent eyes with infra-orbital creases, midfacial hypoplasia, anterior earlobe
creases and posterior helical pits206,291-294. Visceromegaly, abdominal wall defects, and cardiac
malformations may also occur206,291,293,295,296. Individuals with BWS are at a higher risk for
embryonal cancers206,297,298. The incidence of BWS has been estimated to be one in 13,700
individuals206. In ~20% of cases, BWS is caused by a paternal uniparental disomy for human
chromosome 11p15 (pUPD11p15)206,299. Other molecular causes of BWS involving human
chromosome 11p15 include: a loss of DNA methylation at IC2 (~50% of cases), a mutation in
the maternal copy of the maternally expressed imprinted gene CDKN1C (~10% of cases), a gain
of DNA methylation at IC1 (~2%-7% of cases), a duplication of the chromosome 11p15 region
(~1% of cases), and/or a translocation/inversion involving chromosome 11p15 (~1% of
cases)206,299-302. The mechanism of BWS for approximately 14% of cases is unknown206,299.
1.4.2 Russell-Silver syndrome (RSS)
Russell-Silver syndrome (RSS) is a complex genetic/genomic undergrowth disorder. Features of
RSS include prenatal and postnatal growth retardation, hemihyperplasia, and fifth finger
clinodactyly303,304. The incidence of RSS has been estimated to be one in 3,000 - 100,000
individuals305,306. In ~30% of cases, RSS is caused by a loss of DNA methylation at IC1 on
human chromosome 11p15207,307-316. In ~10% of cases, RSS is caused by a maternal uniparental
26
disomy for human chromosome 7 (mUPD7) (~10% of cases)207,307-316. The mechanism of RSS
for approximately 60% of cases is unknown207.
1.4.3 Prader-Willi syndrome (PWS)
Prader-Willi syndrome (PWS) is a complex genetic/genomic disorder with mental and physical
abnormalities. The physical abnormalities of PWS include infantile hypotonia, early childhood
obesity, small hands and feet, hypogenitalism/hypogonadism, growth hormone deficiency, short
stature, sticky saliva, enamel hypoplasia, and a typical PWS face317-319. The typical PWS face has
an upturned-short nose, narrow bifrontal diameter, almond-shaped eyes, and a triangular
mouth317-319. PWS symptoms may include temper tantrums and skin picking317-319. The incidence
of PWS has been estimated to be one in 10,000 - 20,000 individuals, with a higher rate in
Caucasians317. In ~20% to ~25% of cases, PWS is caused by a maternal uniparental disomy for
human chromosome 15q11-q13 (mUPD15q11-q13)208. Other molecular causes of PWS on
human chromosome 15q11-q13 include: a deletion (~70% of cases), a defect in an imprinting
centre (2%-5% of cases), and/or a chromosomal translocation involving chromosome 15q11-q13
(<1% of cases)208,320-322.
1.4.4 Angelman syndrome (AS)
Angelman syndrome (AS) is a complex genetic/genomic disorder with neurodevelopmental
deficits. The phenotype of AS may include limb tremors, gait ataxia, severe developmental
delay, speech impairment, and frequent laughing and smiling, as well as excitability323-325. The
incidence of AS has been estimated to be one in 12,000 - 20,000 individuals326-328. In ~5% of
cases, AS is caused by a paternal uniparental disomy for human chromosome 15q11-q13
(pUPD15q11-q13)209; the reciprocal uniparental disomy, mUPD15q11-q13, causes Prader-Willi
syndrome (PWS)208. Other molecular etiologies for AS on human chromosome 15q11-q13
include: a deletion (~70% of cases), a defect in an imprinting centre (~2% of cases), a mutation
in the maternal copy of the maternally expressed imprinted gene UBE3A (~20% of cases), and/or
a chromosomal translocation involving chromosome 15q11-q13 (<1% of cases)209,329-334.
27
1.5 Previous Methods Used to Find Candidate Imprinted Genes and Candidate Parent-of-Origin-Specific Differentially Methylated Regions (DMRs) in Humans
Many approaches have been taken to identify candidate imprinted genes and candidate parent-of-
origin-specific differentially methylated regions (DMRs) in humans335-341. Candidate imprinted
genes have been identified by searching the genome for genes with DNA sequence features
around known imprinted genes. Candidate imprinted genes have also been identified by
searching the genome for genes with differential allelic expression. Candidate parent-of-origin-
specific DMRs have been identified by comparing CpG methylation among tissues of
uniparental origin, tissues with cells containing maternal/paternal uniparental disomies, and
diandric & digynic triploid placentas. These approaches are described in further detail below.
1.5.1 Searching for Candidate Parent-of-Origin-Specific DMRs Using Uniparental Tissues (AnCHMs and MCTs)
A previous study searched for candidate parent-of-origin-specific DMRs using CpG methylation
sensitive and CpG methylation insensitive restriction enzymes on genomic DNA from two
uniparental tissues (AnCHM (androgenetic complete hydatidiform mole) and MCT (mature
cystic ovarian teratoma)), followed by cloning and sequencing335. The study identified 12 DMRs,
of which only one was a known parent-of-origin-specific DMR. This DMR in particular is
maternally methylated and associated with known paternally expressed imprinted genes PLAGL1
and HYMAI34,162,184,188. Their method could not detect 18 other known parent-of-origin-specific
DMRs (13 maternally methylated, 5 paternally methylated) in the human genome that associate
with known imprinted genes18,21,23,24,26,28,163,181,182,205,335,339,342-346. Perhaps their method could not
detect the other known parent-of-origin-specific DMRs (associated with known imprinted genes)
because they were using site-specific CpG methylation sensitive and CpG methylation
insensitive restriction enzymes. The CpG methylation sensitive and CpG methylation insensitive
restriction enzymes they were using recognized the DNA sequence CCGG, which comprises a
very small proportion of the human genome. Another possible reason for their method being
unable to detect the other known parent-of-origin-specific DMRs (associated with known
imprinted genes) is aberrant CpG methylation (perhaps some known maternally methylated
28
DMRs are not completely methylated in MCTs, maybe some known paternally methylated
DMRs are not completely methylated in AnCHMs, possibly some known maternally methylated
DMRs are not completely unmethylated in AnCHMs, perchance some known paternally
methylated DMRs are not completely unmethylated in MCTs).
One of the newly identified candidate maternally methylated DMRs was in the promoter region
of TCEB3C. They utilized four fetuses with an informative transcribed polymorphism for
TCEB3C for allelic expression analyses. They observed preferential expression of TCEB3C from
the maternal chromosome in fetal lung, brain, placenta, and spinal cord. They did not observe
preferential maternal/paternal expression of TCEB3C in fetal liver or intestine. These results
suggested TCEB3C is an imprinted gene.
1.5.2 Searching for Candidate Imprinted Genes Using DNA Sequence Features Around Known Imprinted Genes
In another previous study, candidate imprinted genes were searched for using computer
algorithms to search the genome for genes with DNA sequence features around known imprinted
genes336. Their method could detect all 40 known imprinted genes that they used to optimize
their computer algorithm. Their method could not detect 27 other known imprinted genes not
included in their training set. These results may have been due to overfitting the model to the
data. Perhaps some unidentified imprinted genes do not have many, if any at all, DNA sequence
features common to known imprinted genes. They identified 156 candidate imprinted genes,
including DLGAP2 and KCNK9. They used eight fetuses with an informative transcribed
polymorphism for DLGAP2 and nine fetuses with an informative transcribed polymorphism for
KCNK9 for allelic expression analyses. They observed preferential expression of DLGAP2 from
the paternal chromosome in fetal testis and preferential expression of KCNK9 from the maternal
chromosome in fetal brain. These results suggested DLGAP2 and KCNK9 are imprinted genes.
Notably, a similar approach was used to identify candidate imprinted genes in mice347.
29
1.5.3 Searching for Candidate Imprinted Genes by Searching for Genes with Differential Allelic Expression
Another study searched for candidate imprinted genes using SNP microarrays to search for genes
with differential allelic expression in peripheral blood leukocytes (PBLs)337. They found PEG10
and ATP10A as the only known imprinted genes to have differential allelic expression in their
analyses using PBLs. They found imprinted gene PLAGL1 to not exhibit differential allelic
expression in PBLs, which was expected as Kamiya et al. (2000)188 observed expression of
imprinted gene PLAGL1 from both the maternal and paternal chromosome in peripheral blood
leukocytes (PBLs). They could not assess differential allelic expression for 64 other known
imprinted genes. This may have been due to the rarity of informative transcribed SNPs and
excluding genes with differential allelic expression that had an association with the informative
transcribed SNP. They identified 61 candidate imprinted genes, including TBC1D4 and ZNF331.
They utilized seven siblings with an informative transcribed polymorphism for TBC1D4 and six
siblings with an informative transcribed polymorphism for ZNF331 for allelic expression
analyses. They observed preferential expression of TBC1D4 from the maternal chromosome and
preferential expression of ZNF331 from the paternal chromosome in lymphoblastoid cell lines
(LCLs). They proposed TBC1D4 and ZNF331 are imprinted genes. Interestingly, other studies
have focused on differential allelic expression in humans348-353. Notably, similar approaches have
been used to identify candidate imprinted genes in mice4,354.
1.5.4 Searching for Candidate Imprinted Genes by Searching for RNA Polymerase Bound to Only One of Two Alleles
In another study, candidate imprinted genes were searched for by searching for genes with RNA
polymerase bound to only one of their two alleles (one allele on each homologous chromosome)
in a human lung fibroblast cell line (IMR90)338. They identified RNA polymerase bound to only
one of two alleles for known imprinted genes KCNQ1, PLAGL1, SNRPN, ZNF331, and ZNF597.
They could not identify RNA polymerase bound to only one of two alleles for 64 other known
imprinted genes. This may have been due to the rarity of informative transcribed SNPs. They
identified RNA polymerase bound to only one of two alleles for (excluding known imprinted
30
genes) 234 RefSeq genes, 16 microRNAs (miRNAs), and two small nucleolar RNAs
(snoRNAs). These RefSeq genes, microRNAs, and snoRNAs are candidate imprinted genes.
1.5.5 Searching for Candidate Parent-of-Origin-Specific DMRs Using Tissue with Cells Containing Maternal/Paternal Uniparental Disomies for Human Chromosome 15
A recent study searched for candidate parent-of-origin-specific DMRs on human chromosome 15
using DNA methylation profiling (using MeDIP-chip) of blood tissues with cells containing
maternal/paternal uniparental disomies for human chromosome 15339. The study identified 25
candidate parent-of-origin-specific DMRs and 4 known maternally methylated DMRs associated
with known imprinted gene SNRPN183,355,356. Notably, of the 25 candidate parent-of-origin-
specific DMRs, only 8 were confirmed using sodium bisulfite cloning/sequencing. Remarkably,
of the 8 new DMRs (all candidate maternally methylated DMRs), two DMRs are associated with
known imprinted gene MAGEL2, two DMRs are associated with known imprinted gene NDN,
two DMRs are associated with known imprinted gene SNRPN, one DMR is associated with
GABRG3, and one DMR is associated with IGF1R. Interestingly, the DMRs associated with
GABRG3 and IGF1R are almost completely methylated on the maternal chromosome and almost
completely unmethylated on the paternal chromosome. Allelic expression analyses of IGF1R in
cord blood and term placenta did not reveal any instances of preferential allelic expression.
These results suggested IGF1R is not imprinted in cord blood or term placenta.
1.5.6 Searching for Candidate Parent-of-Origin-Specific DMRs Using Biparental Tissues and Tissues with Cells Containing Genome-Wide Maternal/Paternal Uniparental Disomies
In another recent study, candidate parent-of-origin-specific DMRs were searched for using CpG
methylation profiling (using the Illumina Infinium Human Methylation27 promoter microarray)
of biparental tissues (blood, placenta, brain, muscle, fat, and buccal cells) and blood tissues with
cells containing genome-wide maternal/paternal uniparental disomies340. The study identified 2
candidate paternally methylated CpG sites (in blood, placenta, brain, muscle, fat, and buccal
cells) and 12 candidate maternally methylated CpG sites (in blood, placenta, brain, muscle, fat,
31
and buccal cells). Notably, of the 14 candidate parent-of-origin-specific differentially methylated
CpG sites (DMCpGs), only 2 candidate paternally methylated CpG sites and 7 candidate
maternally methylated CpG sites were confirmed using sodium bisulfite cloning/sequencing.
Interestingly, the 2 candidate paternally methylated CpG sites are associated with known
maternally expressed imprinted gene ZNF597, 5 candidate maternally methylated CpG sites are
associated with known imprinted gene RB1, and 2 candidate maternally methylated CpG sites are
associated with FAM50B. Allelic expression analysis of FAM50B in one placenta sample
revealed preferential allelic expression. This result suggested FAM50B may be an imprinted
gene. Interestingly, Zhang et al. (2011)357 observed preferential paternal expression of FAM50B
in four fetal conceptuses.
1.5.7 Searching for Candidate Parent-of-Origin-Specific DMRs Using Biparental Diploid Placentas, Diandric Triploid Placentas, Digynic Triploid Placentas, and Androgenetic Complete Hydatidiform Moles (AnCHMs)
A relatively new study searched for candidate parent-of-origin-specific DMRs using CpG
methylation profiling (using the Illumina Infinium Human Methylation27 promoter microarray)
of biparental diploid (one maternal genome and one paternal genome) placentas, diandric triploid
(two paternal genomes and one maternal genome) placentas, digynic triploid (2 maternal
genomes and 1 paternal genome) placentas, and androgenetic complete hydatidiform moles
(AnCHMs)341. The study identified 40 paternally methylated CpG sites (known and candidate)
and 68 maternally methylated CpG sites (known and candidate) that are associated with 26 and
37 genes respectively. Notably, 4 candidate maternally methylated CpG sites were located in the
promoter region of known paternally expressed imprinted gene L3MBTL1, one candidate
maternally methylated CpG site was located in the promoter region of known paternally
expressed imprinted gene NAP1L5, one candidate paternally methylated CpG site was located in
the promoter region of known maternally expressed imprinted gene ZNF597, one candidate
paternally methylated CpG site was located in the promoter region of known maternally
expressed imprinted gene CDKN1C, and one candidate maternally methylated CpG site was
located in the promoter region of candidate imprinted gene FAM50B. Monoallelic CpG
methylation patterns were observed in the candidate maternally methylated DMR associated with
32
candidate imprinted gene FAM50B. Allelic expression analyses of FAM50B in five different
placenta samples revealed preferential paternal expression of FAM50B.
33
1.6 Hypothesis and Aims
I hypothesize that candidate parent-of-origin-specific differentially methylated CpG sites
(DMCpGs), some of which may reside in parent-of-origin-specific DMRs associated with nearby
known and/or novel imprinted genes in humans, can be identified by comparing the CpG
methylation of individual CpG sites in human uniparental and biparental tissues. These unique
human uniparental tissues are androgenetic complete hydatidiform mole (AnCHM) and mature
cystic ovarian teratoma (MCT). To test my hypothesis, the following aims were developed:
1) To analyze CpG methylation using sodium bisulfite-treated DNA from human
uniparental and biparental tissues on Illumina Infinium Human Methylation27 promoter
microarrays. The CpG methylation in known paternally and maternally methylated
DMRs (associated with known imprinted genes) will be characterized using statistical
values. These statistical values will be used to set thresholds/criteria to identify candidate
parent-of-origin-specific DMCpGs. Some of these candidate parent-of-origin-specific
DMCpGs may reside in parent-of-origin-specific DMRs associated with nearby known
and/or novel imprinted genes
2) To use targeted quantitative sodium bisulfite pyrosequencing to assess the CpG
methylation around selected candidate parent-of-origin-specific DMCpGs identified by
comparing CpG methylation using sodium bisulfite-treated DNA from human uniparental
and biparental tissues on Illumina Infinium Human Methylation27 promoter microarrays
3) To determine the allelic expression pattern of a candidate novel imprinted gene in
humans, AXL, which has a candidate parent-of-origin-specific DMCpG in its promoter
region identified by comparing CpG methylation using sodium bisulfite-treated DNA
from human uniparental and biparental tissues on Illumina Infinium Human
Methylation27 promoter microarrays
34
35
Chapter 2 Materials and Methods
2 Materials and Methods
2.1 Sample Collection
Blood samples were collected from individuals undergoing routine blood tests after informed
consent. DNA was extracted from these samples using a standard phenol/chloroform extraction
process210,358,359. Blood samples were collected mostly from children (Appendices Table A-2).
The placenta samples were provided by the Biobank at Mount Sinai Hospital. DNA was
extracted from these samples (as described previously)210,358. Placenta samples were collected
from conceptuses older than 24 weeks gestation (Appendices Table A-3).
One androgenetic complete hydatidiform mole (AnCHM) sample was obtained from Mount
Sinai Hospital. Two other AnCHM samples were obtained from Montreal Children’s Hospital.
One mature cystic ovarian teratoma (MCT) sample was obtained from the Biopathology Center,
CHTN Pediatric Division, Nationwide Children’s Hospital, Columbus, Ohio. DNA was extracted
from these samples (as described previously)166,210,358.
DNA was obtained from the following: 1 lymphoblastoid cell line (LCL) derived from a patient
with paternal UPD11p15 (pUPD11p15), 1 blood sample from a patient with maternal UPD14
(mUPD14), 1 blood sample from a patient with paternal UPD14 (pUPD14), and 1
lymphoblastoid cell line (LCL) derived from a patient with paternal UPD4 (pUPD4).
DNA samples were stored at 4°C.
2.2 Sodium Bisulfite Treatment of DNA
All DNA samples were sodium bisulfite-treated using the EpiTect Bisulfite kit (Qiagen). Sodium
bisulfite treatment enables the quantification of cytosine methylation for individual cytosines in
DNA. The individual steps in the deamination of cytosine using sodium bisulfite treatment are
shown in Figure 2-1360.
36
Figure 2-1: Steps in the Sodium Bisulfite-Mediated Deamination of Cytosine
Cytosine undergoes a sulphonation reaction to produce cytosine sulphonate361,362. Cytosine sulphonate undergoes a
hydrolytic deamination reaction to produce uracil sulphonate361,362. Uracil sulphonate undergoes an alkali
desulphonation reaction to produce uracil361,362. Adapted by permission from Nature Publishing Group: Nature
Protocols (Clark, S. J., A. Statham, et al. (2006). "DNA methylation: bisulphite modification and analysis." Nat
Protoc 1(5): 2353-2364), copyright (2006).
37
Figure 2-1: Steps in the Sodium Bisulfite-Mediated Deamination of Cytosine
38
2.3 Microarray Processing
The sodium bisulfite-treated DNA for 16 blood samples, 5 placenta samples, 3 AnCHM samples,
1 MCT sample, and 1 paternal UPD4 lymphoblastoid cell line (LCL) sample were sent to The
Centre for Applied Genomics (TCAG) to be prepared for Illumina Infinium Human
Methylation27 promoter microarrays. For each sample, the Illumina microarray assesses the
proportion of CpG methylation at 27,578 individual CpG sites. More than 14,000 RefSeq gene
promoters are covered by these 27,578 individual CpG sites, with an average of 2 CpG sites per
gene promoter. Cancer-related and imprinted genes have more extensive coverage (three to
twenty CpG sites per gene).
The Illumina microarray uses two site-specific probes (both 50 base pairs long) for each targeted
individual CpG site. One site-specific probe targets the unmethylated CpG site. The other site-
specific probe targets the methylated CpG site. The targeted CpG site is situated to the end of
the 50 base pair oligonucleotide (not the end with the bead) to enable quantification of cytosine
methylation by incorporating a fluorescently labeled ddNTP onto the 50 base pair
oligonucleotide.
The single measure (one-way random) intraclass correlation coefficient (ICC) for a technical
replicate (same sodium bisulfite treatment for a sample) run on the microarray was .98
(calculated using computer application SPSS Statistics 17.0 and all 27,578 Illumina microarray
CpG sites). It was important for the technical replicate to be from the same sodium bisulfite
treatment because using a different sodium bisulfite treatment may have introduced variability.
The single measure (one-way random) intraclass correlation coefficient (ICC) was chosen
because the same sample was run twice on the same type of microarray.
Within the TCAG facility, the sodium bisulfite-treated DNAs underwent whole-genome
amplification (WGA), enzymatic fragmentation, and hybridization to the Illumina Infinium
Human Methylation27 promoter microarray. Probes underwent single-base extension using
fluorescently labeled ddNTPs. A probe was only extended with a fluorescently labeled ddNTP
when its end (not the end attached to the bead) was bound to the sodium bisulfite-treated DNA.
The microarray was washed, stained, and scanned. The scanned image underwent feature
extraction. I received the feature extracted data from TCAG as “.idat” files.
39
2.4 CpG Methylated Proportion and Detection P-value For Each Targeted CpG Site
The feature extracted data was loaded into Illumina’s Beadstudio 3 computer application. In
Beadstudio 3, samples were organized into groups (3 AnCHMs in one group, 16 bloods in one
group, 1 MCT in one group, 5 placentas in one group, 1 pUPD4 in one group). The average
normalization (across chips) setting was chosen in BeadStudio 3 because it allowed for the
comparison of samples run on different microarray chips. Using these steps, BeadStudio 3
calculated the CpG methylated proportion and detection p-value for each individual microarray
CpG site in each sample. The detection p-value showed how significantly different the signal for
the CpG site was when compared to the background signal. This data was uploaded to NCBI’s
(The National Center for Biotechnology Information’s) GEO (Gene Expression Omnibus) and
was given the accession number GSE22091.
CpG methylated proportions were replaced with a “N/A” if their CpG site detection p-values
were greater than .05 (i.e., the signal intensity for the CpG site was not significantly different
from the background). This was done because if the signal intensity for the CpG site is not
significantly different from the background, the CpG site’s calculated CpG methylated
proportion is unreliable. The number of CpG methylated proportions replaced with “N/A” varied
between samples (Appendices Table A-4).
To convert a CpG methylated proportion value into a percent CpG methylation value; multiply
the CpG methylated proportion value by 100 to get the percent CpG methylation value.
2.5 Statistical Analyses to Characterize CpG Methylation
In Illumina Beadstudio 3, a Mann-Whitney statistical test comparing CpG methylation between
AnCHM samples and blood samples was performed for each individual microarray CpG site. I
chose the AnCHMs instead of the MCT to be the uniparental group for comparison because I had
more AnCHMs than MCTs (3 AnCHMs, 1 MCT). I chose the bloods instead of the placentas to
be the biparental group because I had more bloods than placentas (16 bloods, 5 placentas). Since,
to my knowledge at the time, no one had noted that the CpG methylation data in known parent-
of-origin-specific DMRs (associated with known imprinted genes) is normally distributed, I
40
chose to utilize the Mann-Whitney statistical test because it can “detect differences in shape and
spread as well as just differences in medians”363 and does not require the underlying data to be
normally distributed.
The maximum p-value (not adjusted using the false discovery rate (FDR)) on the list less than
.05 has an associated q-value (“the minimum FDR that can be attained when calling that feature
significant”364) less than .06. These results may suggest that adjusting p-values using the FDR
may not have been necessary when using a p-value cutoff of .05. As a side note, the maximum p-
value (not adjusted using the false discovery rate (FDR)) on the list less than .01 has an
associated q-value of approximately .013. I decided that it would be better to adjust the p-values
using the FDR to be on the safe side. Also as a side note, the maximum p-value (adjusted using
the FDR) on the list less than .05 has an associated q-value of approximately .022 (this q-value
was determined based on the unadjusted p-value distribution). Also, the maximum p-value
(adjusted using the FDR) on the list less than .01 has an associated q-value of approximately .004
(this q-value was also determined based on the unadjusted p-value distribution). Notably, there
are more than expected unadjusted and FDR-adjusted p-values less than .05 (Figure 2-2).
All the data (e.g., p-value for the Mann-Whitney test mentioned above (comparing AnCHMs to
bloods), CpG methylated proportion per targeted CpG site per sample, detection p-value, each
targeted CpG site’s TargetID, the location of the CpG site in the human genome (NCBI Build
36), the gene promoter the CpG site is in, if the CpG site is in a CpG island) from BeadStudio 3
was exported to Microsoft Excel 2007 in “.csv” format. The data pertaining to the sex
chromosomes (1092 of 27578 Illumina microarray CpG sites) were deleted from the “.csv” file.
This was done because I decided to focus on autosomal loci. To focus on X chromosome loci, an
alternative method would have been required. This would have been necessary because males
usually have one X chromosome and females usually have two X chromosomes. Also, the X
chromosome in males would usually be inherited from the mother, whereas in females, one X
chromosome would usually be inherited from each parent. Also, X chromosome cytosine
methylation could be altered by X inactivation in females.
In Microsoft Excel 2007, I calculated values that would be used to characterize CpG methylation
in known parent-of-origin-specific DMRs (associated with known imprinted genes). These
values would later be used to set thresholds/criteria to find candidate parent-of-origin-specific
41
differentially methylated CpG sites (DMCpGs), some of which may reside in parent-of-origin-
specific DMRs associated with nearby known and/or novel imprinted genes. The median CpG
methylated proportions for each CpG site for the AnCHMs, bloods, and placentas was
calculated. The median instead of the mean was calculated because a normal distribution could
not be assumed. The CpG methylated interquartile ranges (IQRs) for each CpG site for the
AnCHMs, bloods, and placentas was calculated. IQRs were calculated because IQRs measure
variability and they are usually associated with medians. The CpG methylated proportion
difference between the (blood median and AnCHM median) and the (placenta median and
AnCHM median) for each CpG site was computed. The CpG methylated proportion differences
for each CpG site when comparing one of the AnCHM to the MCT was also computed. It is
expected that AnCHMs and MCTs have opposite CpG methylation values in parent-of-origin-
specific DMRs associated with imprinted genes. It was decided that the AnCHM with the highest
CpG methylation difference when compared to the MCT in known parent-of-origin-specific
DMRs (associated with known imprinted genes) would be the one considered to be the best
AnCHM to use for comparisons. This difference was inferred using the intraclass correlation
coefficient (ICC). Intraclass correlation coefficients (ICCs) measure the amount of agreement
between sets of paired data. The ICCs were calculated using the computer application SPSS
Statistics 17.0. The absolute CpG methylated proportion difference between the (blood median -
AnCHM median) column and the (MCT – AnCHM (best)) column for each CpG site was
computed. The difference between the MCT and the best AnCHM was expected to be greater
than the difference between the blood median and AnCHM median. The absolute CpG
methylated proportion difference between the (placenta median - AnCHM median) column and
the (MCT – AnCHM (best)) column for each CpG site was also computed. The difference
between the MCT and the best AnCHM was expected to be greater than the difference between
the placenta median and AnCHM median.
For CpG sites located in parent-of-origin-specific DMRs (associated with imprinted genes), it is
expected the blood and placenta (both have one sperm-derived genome and one oocyte-derived
genome) will have median CpG methylation values in between the AnCHMs (two sperm-derived
genomes) and MCT (two oocyte-derived genomes). In paternally methylated DMRs associated
with imprinted genes, it is expected AnCHMs have 100% CpG methylation, MCTs have 0%
CpG methylation, bloods and placentas have 50% CpG methylation (Figure 2-3). In maternally
42
methylated DMRs associated with imprinted genes, it is expected AnCHMs have 0% CpG
methylation, MCTs have 100% CpG methylation, bloods and placentas have 50% CpG
methylation (Figure 2-3). In my experiment, in the known paternally methylated DMR
(associated with known imprinted gene GNAS), GNAS NESP55 DMR, I can observe AnCHMs
with ~87% CpG methylation, the MCT with ~11% CpG methylation, bloods with ~42% CpG
methylation, and placentas with ~55% CpG methylation.
2.6 Compiled List of Microarray CpG Sites in Known Parent-of-Origin-Specific DMRs Associated With Known Imprinted Genes
A list of Illumina Infinium Human Methylation27 promoter microarray CpG sites located in
known parent-of-origin-specific DMRs (associated with known imprinted genes) was compiled
(these CpG sites are listed in Appendices Table A-5) using the following journal articles: Yuan
et al. (2003)18, Riemenschneider et al. (2008)19, Valleley et al. (2010)342, Arima et al. (2006)179,
Kamiya et al. (2000)188, Bliek et al. (2009)365, Arnaud et al. (2003)21, Kainz et al. (2007)22, Monk
et al. (2008)23, Riesewijk et al. (1997)24, Li et al. (2002)343, Frevel et al. (1999)172, Beatty et al.
(2006)205, Zeschnigk et al. (1997)26, Dasoula et al. (2007)366, Murphy et al. (2001)27, Liu et al.
(2000)28, and Bastepe et al. (2001)189. Only one (out of the 46) Illumina Infinium Human
Methylation27 promoter microarray CpG sites located in known parent-of-origin-specific DMRs
(associated with known imprinted genes) was excluded from the list. This particular CpG site
(cg06191076) did not have blood and placenta median CpG methylation values in between the
AnCHMs and MCT (the blood and placenta were more heavily methylated than the AnCHMs
and MCT).
43
Figure 2-2: Distribution of Unadjusted and FDR-adjusted Mann-Whitney P-values
Histograms showing the distributions of unadjusted (A) and FDR-adjusted (B) Mann-Whitney p-values. The
unadjusted p-values came from Mann-Whitney statistical tests performed for each individual microarray CpG site
comparing CpG methylation between AnCHM samples and blood samples. The unadjusted p-values were converted
into FDR-adjusted p-values using the false discovery rate (FDR).
44
A
B
Figure 2-2: Distribution of Unadjusted and FDR-adjusted Mann-Whitney P-values
45
Figure 2-3: Expected CpG Methylation in Maternally/Paternally Methylated DMRs
Androgenetic complete hydatidiform moles (AnCHMs) and mature cystic ovarian teratomas (MCTs) are uniparental
tissues. Unlike somatic tissues with a genomic contribution from each parent, AnCHMs have two paternal (i.e.,
sperm-derived) copies of each chromosome and MCTs have two maternal (i.e., oocyte-derived) copies of each
chromosome. Placenta and AnCHM arise from trophoblastic tissue. Fibroblasts compose a large proportion of
MCTs. WBC stands for white blood cell.
46
Figure 2-3: Expected CpG Methylation in Maternally/Paternally Methylated DMRs
47
2.7 Selection Criteria for Candidate Maternally Methylated CpG Sites in Blood
Minimum and maximum values were calculated for the median CpG methylated proportions for
each CpG site in KMMDMRs (known maternally methylated DMRs associated with known
imprinted genes) for the bloods; the minimum and maximum values were ~0.345 and ~0.805
respectively. A maximum value was calculated for the median CpG methylated proportions for
each CpG site in KMMDMRs (known maternally methylated DMRs associated with known
imprinted genes) for the AnCHMs; the maximum value was ~0.446. Maximum values were
calculated for the CpG methylated proportion interquartile ranges (IQRs) for each CpG site in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes) for
the AnCHMs and bloods; the maximum values for the AnCHMs and bloods were ~0.203 and
~0.102 respectively. A minimum value was calculated for the CpG methylated proportion
difference between the (blood median and AnCHM median) for each CpG site in KMMDMRs
(known maternally methylated DMRs associated with known imprinted genes); the minimum
value was ~0.216. A minimum value was calculated for the CpG methylated proportion
difference between the (best AnCHM and MCT) for each CpG site in KMMDMRs (known
maternally methylated DMRs associated with known imprinted genes); the minimum value was
~0.299. A minimum value was calculated for the CpG methylated proportions for CpG sites
within KMMDMRs (known maternally methylated DMRs associated with known imprinted
genes) for the MCT; the minimum value was ~0.446. All of these maximum and minimum
values were used to form the criteria for candidate maternally methylated CpG sites in blood.
The criteria also required that candidate maternally methylated CpG sites in blood have
significant (i.e., p-value < .05) Mann-Whitney statistical tests (with p-values adjusted using the
FDR) comparing the AnCHMs to bloods. In addition, the criteria also required that the difference
between the MCT and the best AnCHM be greater than the difference between the blood median
and AnCHM median for a given candidate maternally methylated CpG site in blood. With these
criteria, I identified all 43 maternally methylated CpG sites on the list of Illumina Infinium
Human Methylation27 promoter microarray CpG sites located in known parent-of-origin-
specific DMRs (associated with known imprinted genes). I also identified 365 candidate
maternally methylated CpG sites in blood (Appendices Table A-6).
48
2.8 Selection Criteria for Candidate Maternally Methylated CpG Sites in Placenta
Minimum and maximum values were calculated for the median CpG methylated proportions for
each CpG site in KMMDMRs (known maternally methylated DMRs associated with known
imprinted genes) for the placentas; the minimum and maximum values were ~0.241 and ~0.801
respectively. A maximum value was calculated for the median CpG methylated proportions for
each CpG site in KMMDMRs (known maternally methylated DMRs associated with known
imprinted genes) for the AnCHMs; the maximum value was ~0.446. Maximum values were
calculated for the CpG methylated proportion interquartile ranges (IQRs) for each CpG site in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes) for
the AnCHMs and placentas; the maximum values for the AnCHMs and placentas were ~0.203
and ~0.216 respectively. A minimum value was calculated for the CpG methylated proportion
difference between the (placenta median and AnCHM median) for each CpG site in KMMDMRs
(known maternally methylated DMRs associated with known imprinted genes); the minimum
value was ~0.151. A minimum value was calculated for the CpG methylated proportion
difference between the (best AnCHM and MCT) for each CpG site in KMMDMRs (known
maternally methylated DMRs associated with known imprinted genes); the minimum value was
~0.299. A minimum value was calculated for the CpG methylated proportions for CpG sites
within KMMDMRs (known maternally methylated DMRs associated with known imprinted
genes) for the MCT; the minimum value was ~0.446. All of these maximum and minimum
values were used to form the criteria for candidate maternally methylated CpG sites in placenta.
In addition, the criteria also required that the difference between the MCT and the best AnCHM
be greater than the difference between the placenta median and AnCHM median for a given
candidate maternally methylated CpG site in placenta. With these criteria, I identified all 43
maternally methylated CpG sites on the list of Illumina Infinium Human Methylation27
promoter microarray CpG sites located in known parent-of-origin-specific DMRs (associated
with known imprinted genes). I also identified 491 candidate maternally methylated CpG sites in
placenta (Appendices Table A-7).
49
2.9 Selection Criteria for Candidate Paternally Methylated CpG Sites in Blood
Minimum and maximum values were calculated for the median CpG methylated proportions for
each CpG site in KPMDMRs (known paternally methylated DMRs associated with known
imprinted genes) for the bloods; the minimum and maximum values were ~0.418 and ~0.461
respectively. A minimum value was calculated for the median CpG methylated proportions for
each CpG site in KPMDMRs (known paternally methylated DMRs associated with known
imprinted genes) for the AnCHMs; the minimum value was ~0.874. Maximum values were
calculated for the CpG methylated proportion interquartile ranges (IQRs) for each CpG site in
KPMDMRs (known paternally methylated DMRs associated with known imprinted genes) for
the AnCHMs and bloods; the maximum values for the AnCHMs and bloods were ~0.033 and
~0.057 respectively. A maximum value was calculated for the CpG methylated proportion
difference between the (blood median and AnCHM median) for each CpG site in KPMDMRs
(known paternally methylated DMRs associated with known imprinted genes); the maximum
value was ~-.427. A maximum value was calculated for the CpG methylated proportion
difference between the (best AnCHM and MCT) for each CpG site in KPMDMRs (known
paternally methylated DMRs associated with known imprinted genes); the maximum value was
~-.787. A maximum value was calculated for the CpG methylated proportions for CpG sites
within KPMDMRs (known paternally methylated DMRs associated with known imprinted
genes) for the MCT; the maximum value was ~0.104. All of these maximum and minimum
values were used to form the criteria for candidate paternally methylated CpG sites in blood. The
criteria also required that candidate paternally methylated CpG sites in blood have significant
(i.e., p-value < .05) Mann-Whitney statistical tests (with p-values adjusted using the false
discovery rate (FDR)) comparing the AnCHMs to bloods. In addition, the criteria also required
that the difference between the MCT and the best AnCHM be greater than the difference
between the blood median and AnCHM median for a given candidate differentially methylated
CpG site. With these criteria, I identified only the 2 paternally methylated CpG sites on the list of
Illumina Infinium Human Methylation27 promoter microarray CpG sites located in known
parent-of-origin-specific DMRs (associated with known imprinted genes). In other words, with
these criteria I did not identify any candidate paternally methylated CpG sites in blood. The
criteria for candidate paternally methylated CpG sites in blood were too strict (allowed less
variation) in comparison to the criteria for candidate maternally methylated CpG sites in blood
50
and the criteria for candidate maternally methylated CpG sites in placenta. This may have been
due to the scarcity of microarray CpG sites in KPMDMRs (known paternally methylated DMRs
associated with known imprinted genes). With more microarray CpG sites in KPMDMRs
(known paternally methylated DMRs associated with known imprinted genes), more variation
may have been introduced.
2.9.1 Adapted Selection Criteria for Candidate Paternally Methylated CpG Sites in Blood
Extra variation was introduced into the criteria for candidate paternally methylated CpG sites in
blood by adapting the criteria for candidate maternally methylated CpG sites in blood. The
adaptations are detailed in the paragraphs below.
If the maximum AnCHM median percent CpG methylation value calculated for CpG sites in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes) was
further from its expected value (0%) when compared to how far the minimum AnCHM median
percent CpG methylation value calculated for CpG sites in KPMDMRs (known paternally
methylated DMRs associated with known imprinted genes) was from its expected value (100%),
the candidate paternally methylated CpG site in blood criteria would use the maximum AnCHM
median percent CpG methylation calculated for CpG sites in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) subtracted from 100% to be the
minimum AnCHM median percent CpG methylation value. This was done because I would
expect opposite AnCHM percent CpG methylation in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) and KPMDMRs (known paternally
methylated DMRs associated with known imprinted genes).
If the minimum MCT percent CpG methylation value in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) was further from its expected value
(100%) when compared to how far the maximum MCT percent CpG methylation value in
KPMDMRs (known paternally methylated DMRs associated with known imprinted genes) was
from its expected value (0%), the candidate paternally methylated CpG site in blood criteria
would use the minimum MCT percent CpG methylation value in KMMDMRs (known
51
maternally methylated DMRs associated with known imprinted genes) subtracted from 100% to
be the maximum MCT percent CpG methylation value. This was done because I would expect
opposite MCT percent CpG methylation in KMMDMRs (known maternally methylated DMRs
associated with known imprinted genes) and KPMDMRs (known paternally methylated DMRs
associated with known imprinted genes).
If the maximum or minimum blood median percent CpG methylation value calculated for CpG
sites in KMMDMRs (known maternally methylated DMRs associated with known imprinted
genes) was further from its expected value (50%) when compared to how far the maximum or
minimum blood median percent CpG methylation value calculated for CpG sites in KPMDMRs
(known paternally methylated DMRs associated with known imprinted genes) was from its
expected value (50%), the candidate paternally methylated CpG site in blood criteria would use
the difference between the maximum or minimum blood median percent CpG methylation value
(whichever is furthest from the expected 50%) calculated for CpG sites in KMMDMRs (known
maternally methylated DMRs associated with known imprinted genes) to the expected (50%) as
the allowable distance around the expected 50%.
If the maximum AnCHM IQR value calculated for CpG sites in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) was greater than the maximum
AnCHM IQR value calculated for CpG sites in KPMDMRs (known paternally methylated
DMRs associated with known imprinted genes), the maximum allowable AnCHM IQR value for
candidate paternally methylated CpG sites in blood became the maximum AnCHM IQR value
calculated for CpG sites in KMMDMRs (known maternally methylated DMRs associated with
known imprinted genes).
If the maximum blood IQR value calculated for CpG sites in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) was greater than the maximum blood
IQR value calculated for CpG sites in KPMDMRs (known paternally methylated DMRs
associated with known imprinted genes), the maximum allowable blood IQR value for candidate
paternally methylated CpG sites in blood became the maximum blood IQR value calculated for
CpG sites in KMMDMRs (known maternally methylated DMRs associated with known
imprinted genes).
52
If the minimum difference between the calculated (blood.median-AnCHM.median) for CpG sites
in KMMDMRs (known maternally methylated DMRs associated with known imprinted genes)
was smaller than the minimum difference between the calculated (AnCHM.median-
blood.median) for CpG sites in KPMDMRs (known paternally methylated DMRs associated
with known imprinted genes), the minimum difference between the calculated (AnCHM.median-
blood.median) for candidate paternally methylated CpG sites in blood became the minimum
difference between the calculated (blood.median-AnCHM.median) for CpG sites in KMMDMRs
(known maternally methylated DMRs associated with known imprinted genes).
If the minimum difference between the calculated (MCT – best AnCHM) for CpG sites in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes) was
smaller than the minimum difference between the calculated (best AnCHM - MCT) for CpG
sites in KPMDMRs (known paternally methylated DMRs associated with known imprinted
genes), the minimum difference between the calculated (best AnCHM – MCT) for candidate
paternally methylated CpG sites in blood became the minimum difference between the calculated
(MCT – best AnCHM) for CpG sites in KMMDMRs (known maternally methylated DMRs
associated with known imprinted genes).
With the adapted criteria for candidate paternally methylated CpG sites in blood, I identified 77
candidate paternally methylated CpG sites in blood (Appendices Table A-8).
2.10 Selection Criteria for Candidate Paternally Methylated CpG Sites in Placenta
Minimum and maximum values were calculated for the median CpG methylated proportions for
each CpG site in KPMDMRs (known paternally methylated DMRs associated with known
imprinted genes) for the placentas; the minimum and maximum values were ~0.557 and ~0.678
respectively. A minimum value was calculated for the median CpG methylated proportions for
each CpG site in KPMDMRs (known paternally methylated DMRs associated with known
imprinted genes) for the AnCHMs; the minimum value was ~0.874. Maximum values were
calculated for the CpG methylated proportion interquartile ranges (IQRs) for each CpG site in
KPMDMRs (known paternally methylated DMRs associated with known imprinted genes) for
53
the AnCHMs and placentas; the maximum values for AnCHMs and placentas were ~0.033 and
~0.053 respectively. A maximum value was calculated for the CpG methylated proportion
difference between the (placenta median and AnCHM median) for each CpG site in KPMDMRs
(known paternally methylated DMRs associated with known imprinted genes); the maximum
value was ~-.211. A maximum value was calculated for the CpG methylated proportion
difference between the (best AnCHM and MCT) for each CpG site in KPMDMRs (known
paternally methylated DMRs associated with known imprinted genes); the maximum value was
~-.787. A maximum value was calculated for the CpG methylated proportions for CpG sites
within KPMDMRs (known paternally methylated DMRs associated with known imprinted
genes) for the MCT; the maximum value was ~0.104. All of these maximum and minimum
values were used to form the criteria for candidate paternally methylated CpG sites in placenta.
In addition, the criteria also required that the difference between the MCT and the best AnCHM
be greater than the difference between the placenta median and AnCHM median for a given
candidate differentially methylated CpG site. With these criteria, I identified only the 2
paternally methylated CpG sites on the list of Illumina Infinium Human Methylation27 promoter
microarray CpG sites located in known parent-of-origin-specific DMRs (associated with known
imprinted genes). In other words, with these criteria I did not identify any candidate paternally
methylated CpG sites in placenta. The criteria for candidate paternally methylated CpG sites in
placenta were too strict (allowed less variation) in comparison to the criteria for candidate
maternally methylated CpG sites in blood and the criteria for candidate maternally methylated
CpG sites in placenta. This may have been due to the scarcity of microarray CpG sites in
KPMDMRs (known paternally methylated DMRs associated with known imprinted genes). With
more microarray CpG sites in KPMDMRs (known paternally methylated DMRs associated with
known imprinted genes), more variation may have been introduced.
2.10.1 Adapted Selection Criteria for Candidate Paternally Methylated CpG Sites in Placenta
Extra variation was introduced into the criteria for candidate paternally methylated CpG sites in
placenta by adapting the criteria for candidate maternally methylated CpG sites in placenta. The
adaptations are detailed in the paragraphs below.
54
If the maximum AnCHM median percent CpG methylation value calculated for CpG sites in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes) was
further from its expected value (0%) when compared to how far the minimum AnCHM median
percent CpG methylation value calculated for CpG sites in KPMDMRs (known paternally
methylated DMRs associated with known imprinted genes) was from its expected value (100%),
the candidate paternally methylated CpG site in placenta criteria would use the maximum
AnCHM median percent CpG methylation calculated for CpG sites in KMMDMRs (known
maternally methylated DMRs associated with known imprinted genes) subtracted from 100% to
be the minimum AnCHM median percent CpG methylation value. This was done because I
would expect opposite AnCHM percent CpG methylation in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) and KPMDMRs (known paternally
methylated DMRs associated with known imprinted genes).
If the minimum MCT percent CpG methylation value in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) was further from its expected value
(100%) when compared to how far the maximum MCT percent CpG methylation value in
KPMDMRs (known paternally methylated DMRs associated with known imprinted genes) was
from its expected value (0%), the candidate paternally methylated CpG site in placenta criteria
would use the minimum MCT percent CpG methylation value in KMMDMRs (known
maternally methylated DMRs associated with known imprinted genes) subtracted from 100% to
be the maximum MCT percent CpG methylation value. This was done because I would expect
opposite MCT percent CpG methylation in KMMDMRs (known maternally methylated DMRs
associated with known imprinted genes) and KPMDMRs (known paternally methylated DMRs
associated with known imprinted genes).
If the maximum or minimum placenta median percent CpG methylation value calculated for
CpG sites in KMMDMRs (known maternally methylated DMRs associated with known
imprinted genes) was further from its expected value (50%) when compared to how far the
maximum or minimum placenta median percent CpG methylation value calculated for CpG sites
in KPMDMRs (known paternally methylated DMRs associated with known imprinted genes)
was from its expected value (50%), the candidate paternally methylated CpG site in placenta
criteria would use the difference between the maximum or minimum placenta median percent
CpG methylation value (whichever is furthest from the expected 50%) calculated for CpG sites
55
in KMMDMRs (known maternally methylated DMRs associated with known imprinted genes)
to the expected (50%) as the allowable distance around the expected 50%.
If the maximum AnCHM IQR value calculated for CpG sites in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) was greater than the maximum
AnCHM IQR value calculated for CpG sites in KPMDMRs (known paternally methylated
DMRs associated with known imprinted genes), the maximum allowable AnCHM IQR value for
candidate paternally methylated CpG sites in placenta became the maximum AnCHM IQR value
calculated for CpG sites in KMMDMRs (known maternally methylated DMRs associated with
known imprinted genes).
If the maximum placenta IQR value calculated for CpG sites in KMMDMRs (known maternally
methylated DMRs associated with known imprinted genes) was greater than the maximum
placenta IQR value calculated for CpG sites in KPMDMRs (known paternally methylated DMRs
associated with known imprinted genes), the maximum allowable placenta IQR value for
candidate paternally methylated CpG sites in placenta became the maximum placenta IQR value
calculated for CpG sites in KMMDMRs (known maternally methylated DMRs associated with
known imprinted genes).
If the minimum difference between the calculated (placenta.median-AnCHM.median) for CpG
sites in KMMDMRs (known maternally methylated DMRs associated with known imprinted
genes) was smaller than the minimum difference between the calculated (AnCHM.median-
placenta.median) for CpG sites in KPMDMRs (known paternally methylated DMRs associated
with known imprinted genes), the minimum difference between the calculated (AnCHM.median-
placenta.median) for candidate paternally methylated CpG sites in placenta became the minimum
difference between the calculated (placenta.median-AnCHM.median) for CpG sites in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes).
If the minimum difference between the calculated (MCT – best AnCHM) for CpG sites in
KMMDMRs (known maternally methylated DMRs associated with known imprinted genes) was
smaller than the minimum difference between the calculated (best AnCHM - MCT) for CpG
sites in KPMDMRs (known paternally methylated DMRs associated with known imprinted
genes), the minimum difference between the calculated (best AnCHM – MCT) for candidate
paternally methylated CpG sites in placenta became the minimum difference between the
56
calculated (MCT – best AnCHM) for CpG sites in KMMDMRs (known maternally methylated
DMRs associated with known imprinted genes).
With the adapted criteria for candidate paternally methylated CpG sites in placenta, I identified
116 candidate paternally methylated CpG sites in placenta (Appendices Table A-9).
2.11 Targeted Quantitative Sodium Bisulfite Pyrosequencing
Targeted quantitative sodium bisulfite pyrosequencing using the PyroMark Q24 was used to
assess the percent CpG methylation of four known parent-of-origin-specific DMRs (associated
with known imprinted genes) in blood, placenta, AnCHM, and MCT. These four known parent-
of-origin-specific DMRs (associated with known imprinted genes) consisted of two paternally
methylated DMRs, IC1 and IG-DMR, and two maternally methylated DMRs, IC2 and DIRAS3. I
chose to bisulfite pyrosequencing targeting regions within known intergenic parent-of-origin-
specific DMRs (associated with known imprinted genes), IC1 (also known as H19DMR) and IG-
DMR, since the Illumina Infinium Human Methylation27 promoter microarray does not target
any CpG sites within known intergenic parent-of-origin-specific DMRs (associated with known
imprinted genes). For a comparison to the known intergenic parent-of-origin-specific DMRs
(associated with known imprinted genes), I decided to do bisulfite pyrosequencing targeting
regions within known maternally methylated DMRs IC2 and DIRAS3 DMR. I specifically chose
IC2 and DIRAS3 DMR because the lab had optimized assays available for them, i.e., IC2 and
DIRAS3 DMR.
Targeted quantitative sodium bisulfite pyrosequencing using the PyroMark Q24 was performed
in an effort to assess the extent of the candidate parent-of-origin-specific DMRs in the promoter
regions of NAP1L5, ZNF597, AXL, and RIMS2. I chose to perform bisulfite pyrosequencing
targeting the promoter regions of NAP1L5 and ZNF597 because NAP1L5 and ZNF597 were the
only known imprinted genes (without known associated parent-of-origin-specific DMRs at the
time) with candidate parent-of-origin-specific differentially methylated CpG sites (DMCpGs) in
their promoter regions. I decided to carry out bisulfite pyrosequencing targeting the promoter
region of RIMS2 since one candidate maternally methylated CpG site was detected in the
promoter region of RIMS2 and this candidate maternally methylated CpG site had differential
57
CpG methylation (~50% CpG methylation) in blood and placenta, which was rare to observe for
candidate parent-of-origin-specific differentially methylated CpG sites (DMCpGs). I chose to
perform bisulfite pyrosequencing targeting the promoter region of AXL as one candidate
paternally methylated CpG site was identified in the promoter region of AXL and this candidate
paternally methylated CpG site had one of the highest CpG methylation differences between the
best androgenetic complete hydatidiform mole (AnCHM) and mature cystic ovarian teratoma
(MCT). Also, AXL overexpression had been observed in some cancers367-371.
Targeted quantitative sodium bisulfite pyrosequencing enables the quantification of cytosine
methylation at a chosen CpG site372. The first step in targeted quantitative sodium bisulfite
pyrosequencing is to treat the genomic DNA with sodium bisulfite (under specific conditions)
and then purify the resulting DNA fragments. The second step is to amplify your sodium
bisulfite-treated region of interest using Polymerase Chain Reaction (PCR) amplification. Biotin
was not directly attached to the primers; instead an M13 sequence was attached to the 5’ end of
the primers, which annealed to a Biotin-M13 Universal Primer complex. The PCR amplification
reaction incorporates thymines instead of uracils into the daughter strands. The third step is to
sequence you PCR products using pyrosequencing reactions. The pyrosequencing reaction adds
nucleotides one at a time in a designated order and the pyrosequencer measures the proportion of
nucleotides incorporated into the PCR products. A comparison of the proportion of nucleotides
incorporated provides the percent CpG methylation. The CpG methylated proportion is
determined (at a given CpG locus) by dividing the intensity of cytosine (methylated cytosine in
the genomic DNA) by the total intensity (add the intensity of cytosine (methylated cytosine in
the genomic DNA) to the intensity of thymine (unmethylated cytosine in the genomic DNA) to
get total intensity) at the given CpG locus. The percent CpG methylation is determined by
multiplying the CpG methylated proportion by 100%.
The reagents used for the PCR amplification reactions included distilled water (Hospira
Healthcare Corporation), 10*BF (Qiagen), magnesium chloride (Qiagen), dNTPs (BioBasic),
M13-Biotin Universal Primer (Integrated DNA Technologies), oligonucleotides (Integrated
DNA Technologies), HotStar Taq (Qiagen), and sodium bisulfite-treated DNA. The amounts and
concentrations of each of these reagents for the PCR amplification reactions are shown in
Appendices Table A-10. The thermal cycler programs for the PCR amplification reactions are
shown in Appendices Table A-11. The primers used for PCR amplification reactions are listed in
58
Appendices Table A-12. The primers used for pyrosequencing reactions are listed in Appendices
Table A-13.
The primers for these reactions (PCR amplification and pyrosequencing) were designed (using
the program PSQ Assay Design 1.0.6) to only amplify sodium bisulfite-converted DNA. Also,
sodium bisulfite conversion controls were included in pyrosequencing assays. These sodium
bisulfite conversion controls were cytosines not followed by guanines in the genomic DNA.
These sodium bisulfite conversion controls are expected to appear as thymines, instead of
cytosines, in the pyrosequencing reactions.
2.12 Box-and-whisker Plots
I used the computer application SPSS Statistics 18.0 to generate box-and-whisker plots. The
horizontal line inside the box-and-whisker plot is the median of the group. The top of the box is
the 75th percentile and the bottom of the box is the 25th percentile. The bottom whisker goes to
the data point above or at (25th percentile – 1.5 * interquartile range). The upper whisker goes to
the data point below or at (75th percentile + 1.5 * interquartile range). The dots outside of the
box and whiskers represent outliers and the stars represent extreme outliers (more than (3 *
interquartile range) from the box).
2.13 Sodium Bisulfite Cloning/Sequencing
Sodium bisulfite cloning/sequencing was used to assess the CpG methylation of 14 CpG sites in
a 355 base-pair fragment from the AXL promoter region in one placenta (Placenta2), one
AnCHM (AnCHM1), and the MCT sample. I chose to perform bisulfite sequencing targeting the
identified candidate paternally methylated CpG sites (within the promoter region of AXL) in an
effort to support and determine the boundaries of the candidate paternally methylated DMR
(within the promoter region of AXL). I chose to perform bisulfite sequencing targeting the
identified candidate paternally methylated CpG sites (within the promoter region of AXL)
because CpG methylation in the promoter region of AXL may silence AXL and AXL
overexpression had been observed in some cancers367-371.
59
Sodium bisulfite cloning/sequencing enables the quantification of cytosine methylation at several
consecutive CpG sites373,374. The first step in sodium bisulfite cloning/sequencing is to treat the
genomic DNA with sodium bisulfite (under specific conditions) and then purify the resulting
DNA fragments. The second step is to amplify your sodium bisulfite-treated region of interest
using Polymerase Chain Reaction (PCR) amplification. The PCR amplification reaction
incorporates thymines instead of uracils into the daughter strands (recall how unmethylated
cytosines are converted by the sodium bisulfite treatment into uracils, sodium bisulfite treatment
does not alter methylated cytosines). The third step is to clone your PCR products into vectors.
The fourth step is to transform the E coli cells with the vector. The fifth step is to select E coli
colonies. The sixth step is to isolate and purify the plasmid DNA from the selected E coli
colonies. The seventh step is to sequence the plasmid DNA from the selected E coli colonies.
The reagents used for the PCR amplification reactions included distilled water (Hospira
Healthcare Corporation), 10*BF (Qiagen), dNTPs (BioBasic), oligonucleotides (Integrated DNA
Technologies), HotStar Taq (Qiagen), and sodium bisulfite-treated DNA. The amounts and
concentrations of each of these reagents for the PCR amplification reactions are shown in
Appendices Table A-14. The thermal cycler programs for the PCR amplification reactions are
shown in Appendices Table A-15. The primers used for PCR amplification reactions are listed in
Appendices Table A-16.
The TOPO TA Cloning Kit manufactured by Invitrogen was used for PCR product cloning. The
GenElute Plasmid Miniprep Kit manufactured by Sigma was used to isolate and purify the
plasmid DNA.
2.14 Allelic Expression Analyses of AXL in Humans
I chose to carry out allelic expression analyses of AXL in humans since several candidate
paternally methylated CpG sites were identified in the promoter region of AXL, CpG methylation
in the promoter region of AXL may silence AXL, and AXL overexpression had been observed in
some cancers367-371.
60
Dr. Dalila Pinto from the Scherer laboratory located in the Genetics and Genome Biology
program at the Hospital for Sick Children collaborated on the project to provide genotype data
regarding AXL. These data were produced by the Illumina 1M-Duo v3.0 microarray for 90
persons from the Yoruba of Ibadan (YRI) and 90 persons of Northern and Western European
ancestry (CEU)375. Only one CEU individual had an AXL heterozygous transcribed SNP
(rs1051008). Thirty-three YRI individuals from 20 different pedigrees had the same AXL
heterozygous transcribed SNP (rs1051008). No other AXL heterozygous transcribed SNPs were
identified in either population. The Scherer laboratory provided me with DNA and RNA sets
from lymphoblastoid cell lines (LCLs) derived from blood of 4 informative heterozygous
individuals (these individuals were informative because it could be determined which parent
contributed which allele). cDNA was synthesized using SuperScript III reverse transcriptase
(Invitrogen) following the manufacturer’s instructions.
The genotypes for the 4 heterozygous individuals were validated using targeted pyrosequencing
(allelic quantification) by the PyroMark Q24 according to the manufacturer’s protocol. The
genomic region of interest (with SNP rs1051008) was amplified using PCR (polymerase chain
reaction). Biotin was not directly attached to the primers; instead an M13 sequence was attached
to the 5’ end of the primers, which annealed to a Biotin-M13 Universal Primer complex. The
PCR products were sequenced using pyrosequencing reactions. The pyrosequencing reaction
adds nucleotides one at a time in a designated order and the pyrosequencer measures the
proportion of nucleotides incorporated into the PCR products. A comparison of the proportion of
nucleotides incorporated provides the relative amount of each nucleotide in the DNA (we would
expect a 1:1 ratio for a heterozygous SNP).
The reagents used for the PCR amplification reactions included distilled water (Hospira
Healthcare Corporation), 10*BF (Qiagen), magnesium chloride (Qiagen), dNTPs (BioBasic),
M13-Biotin Universal Primer (Integrated DNA Technologies), oligonucleotides (Integrated
DNA Technologies), HotStar Taq (Qiagen), and DNA. The amounts and concentrations of each
of these reagents for the PCR amplification reactions are shown in Appendices Table A-17. The
thermal cycler program for the PCR amplification reactions is shown in Appendices Table A-18.
The primers used for PCR amplification reactions are listed in Appendices Table A-19. The
primer used for pyrosequencing reactions is listed in Appendices Table A-20.
61
The double stranded cDNA was pyrosequenced (almost exactly like the procedure mentioned
above, except that double stranded cDNA is substituted for DNA) to determine relative allelic
expression (using the rs1051008 SNP). Only one out of the 4 informative heterozygous
individuals had preferential allelic expression of AXL. This individual’s parents’ genotypes were
retrieved from the genotype data of Dr. Dalila Pinto.
62
63
Chapter 3 Results
3 Results
I hypothesized that candidate parent-of-origin-specific differentially methylated CpG sites
(DMCpGs), some of which may reside in parent-of-origin-specific DMRs associated with nearby
known and/or novel imprinted genes in humans, could be identified by comparing the CpG
methylation of individual CpG sites in human uniparental and biparental tissues. To test this
hypothesis, sodium bisulfite-treated DNA from human uniparental tissues, androgenetic
complete hydatidiform mole (AnCHM) and mature cystic ovarian teratoma (MCT), and human
biparental tissues, blood and placenta, was hybridized to Illumina Infinium Human
Methylation27 promoter microarrays, which assess the proportion of CpG methylation at 27,578
individual CpG sites. The CpG methylation data for the 1092 sex chromosome CpG sites
represented on the Illumina Infinium Human Methylation27 promoter microarray was excluded.
Statistical values (used to characterize CpG methylation) were calculated for the remaining
26,486 autosomal CpG sites represented on the Illumina Infinium Human Methylation27
promoter microarray. Some of the statistical values (used to characterize CpG methylation)
specific to CpG sites located in known parent-of-origin-specific DMRs (associated with known
imprinted genes) were used to set thresholds/criteria to identify candidate parent-of-origin-
specific differentially methylated CpG sites (DMCpGs), some of which may reside in parent-of-
origin-specific DMRs associated with nearby known and/or novel imprinted genes in humans.
3.1 CpG Methylation in Known Parent-of-Origin-Specific DMRs Associated with Known Imprinted Genes
CpG sites represented on the Illumina Infinium Human Methylation27 promoter microarray
located in known parent-of-origin-specific DMRs (associated with known imprinted genes)
displayed differential CpG methylation in biparental tissues, blood and placenta, when compared
to uniparental tissues, AnCHM and MCT (Figure 3-1)359. This was expected as several studies
have noted differential CpG methylation in biparental tissues when compared to uniparental
64
tissues for CpG sites located in several known parent-of-origin-specific DMRs associated with
known imprinted genes163,164,166,176,376,377.
Since the Illumina Infinium Human Methylation27 promoter microarray does not target any CpG
sites within known intergenic parent-of-origin-specific DMRs (associated with known imprinted
genes), IC1 (also known as H19DMR) and IG-DMR, targeted quantitative sodium bisulfite
pyrosequencing was used to assess percent CpG methylation in blood, placenta, AnCHM, and
MCT. IC1 (H19DMR) displayed differential CpG methylation in blood and placenta, a gain of
CpG methylation in the paternal UPD11p15 lymphoblastoid cell line and AnCHMs, and a loss of
CpG methylation in the MCT (Figure 3-2A). IG-DMR presented differential CpG methylation in
blood and placenta, a gain of CpG methylation in the paternal UPD14 blood and AnCHMs, and a
loss of CpG methylation in the maternal UPD14 blood and MCT (Figure 3-2B).
For comparisons to the known paternally methylated intergenic DMRs (associated with known
imprinted genes), IC1 (H19DMR) and IG-DMR, targeted quantitative sodium bisulfite
pyrosequencing was used to assess percent CpG methylation in known maternally methylated
DMRs (associated with known imprinted genes) DIRAS3 DMR and IC2 (KvDMR1) in blood,
placenta, AnCHM, and MCT. The DIRAS3 DMR displayed differential CpG methylation in
blood and placenta, a loss of CpG methylation in the AnCHMs, and a gain of CpG methylation
in the MCT (Figure 3-2C). IC2 (KvDMR1) presented differential CpG methylation in blood and
placenta, a loss of CpG methylation in the paternal UPD11p15 lymphoblastoid cell line and
AnCHMs, and a gain of CpG methylation in the MCT (Figure 3-2D).
3.2 Candidate Parent-of-Origin-Specific Differentially Methylated CpG Sites (DMCpGs)
The criteria I used for candidate maternally methylated CpG sites in blood produced 365
candidates (Appendices Table A-6). The criteria I utilized for candidate maternally methylated
CpG sites in placenta produced 491 candidates (Appendices Table A-7). The original criteria for
candidate paternally methylated CpG sites in blood generated 0 candidates. The original criteria
for candidate paternally methylated CpG sites in placenta also produced produced 0 candidates.
Since both the original criteria for candidate paternally methylated CpG sites in blood and the
65
original criteria for candidate paternally methylated CpG sites in placenta were too strict
(allowed less variation) in comparison to the criteria for candidate maternally methylated CpG
sites in blood and the criteria for candidate maternally methylated CpG sites in placenta, the
criteria for candidate paternally methylated CpG sites in blood was loosened by adapting the
criteria for candidate maternally methylated CpG sites in blood and the criteria for candidate
paternally methylated CpG sites in placenta was loosened by adapting the criteria for candidate
maternally methylated CpG sites in placenta. The adapted criteria for candidate paternally
methylated CpG sites in blood generated 77 candidates (Appendices Table A-8). The adapted
criteria for candidate paternally methylated CpG sites in placenta produced 116 candidates
(Appendices Table A-9). There are 101 overlapping (i.e., present in both blood and placenta
lists) candidate maternally methylated CpG sites (Appendices Table A-21). There are 26
overlapping (i.e., present in both blood and placenta lists) candidate paternally methylated CpG
sites (Appendices Table A-22).
Interestingly, some overlapping (i.e., present in both blood and placenta lists) candidate parent-
of-origin-specific differentially methylated CpG sites (DMCpGs) had the same CpG methylation
pattern as known parent-of-origin-specific DMRs (associated with known imprinted genes) less
than a kilobase away (Appendices Table A-23). I postulated that these candidate parent-of-
origin-specific differentially methylated CpG sites (DMCpGs) represent components of these
known parent-of-origin-specific DMRs (associated with known imprinted genes).
Two candidate maternally methylated CpG sites were identified in the promoter region of the
known paternally expressed imprinted gene NAP1L5378, which at the time had no known
associated parent-of-origin-specific DMR. In an effort to determine if the genomic region in
between these two candidate maternally methylated CpG sites is maternally methylated, I carried
out quantitative sodium bisulfite pyrosequencing targeting a portion of the genomic region in
between these two candidate maternally methylated CpG sites in blood, placenta, AnCHM, and
MCT. The assessed CpG sites displayed differential CpG methylation in blood and placenta, a
loss of CpG methylation in the paternal UPD4 lymphoblastoid cell line and AnCHMs, and a gain
of CpG methylation in the MCT (Figure 3-3). These results suggest that the region may be
maternally methylated. Perhaps this region participates in regulating the imprinted gene
expression pattern of NAP1L5.
66
One candidate paternally methylated CpG site was identified in the promoter region of the
known maternally expressed imprinted gene ZNF597379, which at the time had no recognized
associated parent-of-origin-specific DMR. In an attempt to find out if the genomic region
upstream of the candidate paternally methylated CpG site is paternally methylated, quantitative
sodium bisulfite pyrosequencing targeting a segment of the genomic region upstream of the
candidate paternally methylated CpG site was performed in blood, placenta, AnCHM, and MCT.
The evaluated CpG sites displayed differential CpG methylation in blood and placenta, a gain of
CpG methylation in the AnCHMs, and a loss of CpG methylation in the MCT (Figure 3-4).
These results suggest that the genomic region upstream of the candidate paternally methylated
CpG site may be paternally methylated. Maybe this entire region is paternally methylated and
participates in regulating the imprinted gene expression pattern of ZNF597.
One candidate maternally methylated CpG site was detected in the promoter region of RIMS2.
This candidate maternally methylated CpG site had differential CpG methylation (~50% CpG
methylation) in blood and placenta (Figure 3-5A). In an endeavour to determine if the genomic
region upstream of the candidate maternally methylated CpG site is maternally methylated,
quantitative sodium bisulfite pyrosequencing targeting a section of the genomic region upstream
of the candidate paternally methylated CpG site was carried out in blood, placenta, AnCHM, and
MCT. Unexpectedly, the assessed CpG sites upstream of the candidate maternally methylated
CpG site displayed differential CpG methylation in the placenta and MCT, a gain of CpG
methylation in the blood, and a loss of CpG methylation in the AnCHMs (Figure 3-5B). These
results suggest that the genomic region upstream of the candidate maternally methylated CpG
site is not maternally methylated. The candidate maternally methylated CpG site may be a part of
a maternally methylated DMR that does not extend upstream. This maternally methylated DMR
might regulate the expression of RIMS2.
One candidate paternally methylated CpG site was detected in the promoter region of AXL; AXL
overexpression has been observed in some cancers, such as skin, lung, prostate, breast, and
gastric cancer367-371. This candidate paternally methylated CpG site had one of the highest CpG
methylation differences between the best AnCHM and MCT. In an effort to find out if the
genomic region surrounding the candidate paternally methylated CpG site is paternally
methylated, I performed quantitative sodium bisulfite pyrosequencing targeting the genomic
region surrounding the candidate paternally methylated CpG site in blood, placenta, AnCHM,
67
and MCT. The evaluated CpG sites displayed differential CpG methylation in blood and
placenta, a gain of CpG methylation in the AnCHMs, and a loss of CpG methylation in the MCT
(Figure 3-6). These results suggested that the genomic region surrounding the candidate
paternally methylated CpG site is paternally methylated. In an attempt to support and determine
the boundaries of the paternally methylated DMR (within the promoter region of AXL), sodium
bisulfite cloning/sequencing targeting the promoter region of AXL was performed in the MCT,
one AnCHM, and one placenta. Using targeted sodium bisulfite cloning/sequencing, the
boundaries of the paternally methylated DMR and one other candidate paternally methylated
CpG site were identified (Figure 3-7). Perhaps these candidate paternally methylated CpG sites
are part of a paternally methylated DMR that regulates the expression of AXL.
3.3 Allelic Expression of AXL in Humans Since several candidate paternally methylated CpG sites were identified in the promoter region
of AXL, CpG methylation in the promoter region of AXL may silence AXL, and AXL
overexpression had been observed in some cancers367-371, allelic expression analyses of AXL (in
humans) were performed. The genotypes of four informative individuals heterozygous for AXL
(SNP rs1051008) were validated using targeted pyrosequencing (allelic quantification) using
their lymphoblastoid cell line (LCL) DNA (Table 3-1). Relative allelic expression was estimated
in these individuals using targeted pyrosequencing (allelic quantification) on cDNA generated
from their lymphoblastoid cell line (LCL) RNA (Table 3-1). Although AXL was preferentially
expressed from the maternal chromosome in one informative heterozygous individual, AXL was
not expressed preferentially from any parental chromosome in the other three informative
heterozygous individuals (Table 3-1). These results suggest AXL may have polymorphic
imprinting in human blood.
68
Figure 3-1: CpG Methylation in DMRs Associated With Known Imprinted Genes
Heatmap displaying the CpG methylated proportions of Illumina Infinium Human Methylation27 promoter
microarray CpG sites located in known parent-of-origin-specific DMRs associated with known imprinted genes.
Each column represents one sample run on the Illumina Infinium Human Methylation27 promoter microarray. Each
row represents one unique CpG site (labeled with its unique Illumina ID and the gene promoter it is located in)
targeted on the Illumina Infinium Human Methylation27 promoter microarray that is located within a known parent-
of-origin-specific DMR associated with a known imprinted gene. The two CpG sites at the bottom are paternally
methylated (these two CpG sites are located in the known paternally methylated GNAS NESP55 DMR associated
with known imprinted gene GNAS); the other CpG sites are maternally methylated. The number of microarray CpG
sites within each known parent-of-origin-specific DMR (associated with known imprinted genes) varies. The
samples are labeled WBC (white blood cell), placenta, AnCHM (androgenetic complete hydatidiform mole), and
MCT (mature cystic ovarian teratoma). Illumina Infinium Human Methylation27 promoter microarray CpG sites on
the list of CpG sites located in known parent-of-origin-specific DMRs (associated with known imprinted genes)
displayed differential CpG methylation in biparental tissues, blood and placenta, when compared to uniparental
tissues, AnCHM and MCT. Adapted from Genome Research, Vol. 21 (Issue 3), Choufani et al., A novel approach
identifies new differentially methylated regions (DMRs) associated with imprinted genes, 465-476, Copyright
(2011), with permission from Cold Spring Harbor Laboratory Press.
69
Figure 3-1: CpG Methylation in DMRs Associated With Known Imprinted Genes
70
Figure 3-2: CpG Methylation within Four DMRs Associated with Imprinted Genes
Box-and-whisker plot showing the distribution of sodium bisulfite pyrosequencing percent CpG methylation for: A)
3 consecutive CpG sites within the paternally methylated IC1 (H19DMR) on human chromosome 11 for each tissue.
The data came form 15 blood, 10 placenta, 3 AnCHM, 1 paternal UPD11p15 lymphoblastoid cell line, and 1 MCT
sample; B) 5 consecutive CpG sites within the paternally methylated IG-DMR on human chromosome 14 for each
tissue. The data came from 17 blood, 9 placenta, 3 AnCHM, 1 paternal UPD14 blood, 1 MCT, and 1 maternal
UPD14 blood sample; C) 3 consecutive CpG sites within the maternally methylated DIRAS3 DMR on human
chromosome 1 for each tissue. The data came from 16 blood, 5 placenta, 3 AnCHM, and 1 MCT sample; D) 5
consecutive CpG sites within the maternally methylated KvDMR1 on human chromosome 11 for each tissue. The
data came from 15 blood, 10 placenta, 3 AnCHM, 1 paternal UPD11p15 lymphoblastoid cell line, and 1 MCT
sample. These results suggest known parent-of-origin-specific DMRs (associated with known imprinted genes) are
differentially methylated in biparental tissues, blood and placenta, when compared to uniparental tissues, AnCHM
and MCT.
71
A
B
Figure 3-2: CpG Methylation within Four DMRs Associated with Imprinted Genes
72
C
D
Figure 3-2: CpG Methylation within Four DMRs Associated with Imprinted Genes
(Continued)
73
Figure 3-3: CpG Methylation within the Candidate NAP1L5 DMR
Box-and-whisker plot showing the distribution of: A) Illumina Infinium Human Methylation27 promoter microarray
percent CpG methylation for NAP1L5 CpG sites cg01026744 and cg12759554 for each tissue. The data came from
16 blood, 5 placenta, 3 AnCHM, 1 paternal UPD4 lymphoblastoid cell line, and 1 MCT sample; B) Sodium bisulfite
pyrosequencing percent CpG methylation for 6 consecutive CpG sites within the candidate maternally methylated
NAP1L5 DMR for each tissue. The data came from 15 blood, 10 placenta, 3 AnCHM, 1 paternal UPD4
lymphoblastoid cell line, and 1 MCT sample. Genomic regions within the candidate maternally methylated DMR for
known paternally expressed imprinted gene NAP1L5 display differential CpG methylation in blood and placenta, a
loss of CpG methylation in the paternal UPD4 lymphoblastoid cell line and AnCHMs, and a gain of CpG
methylation in the MCT.
74
A
B
Figure 3-3: CpG Methylation within the Candidate NAP1L5 DMR
75
Figure 3-4: CpG Methylation within the Candidate ZNF597 DMR
Box-and-whisker plot showing the distribution of: A) Illumina Infinium Human Methylation27 promoter microarray
percent CpG methylation for ZNF597 CpG site cg14654875 for each tissue. The data came from 16 blood, 5
placenta, 3 AnCHM, and 1 MCT sample. Adapted from Genome Research, Vol. 21 (Issue 3), Choufani et al., A
novel approach identifies new differentially methylated regions (DMRs) associated with imprinted genes, 465-476,
Copyright (2011), with permission from Cold Spring Harbor Laboratory Press; B) Sodium bisulfite pyrosequencing
percent CpG methylation for 4 consecutive CpG sites within the candidate paternally methylated ZNF597 DMR for
each tissue. The data came from 14 blood, 4 placenta, 1 AnCHM, and 1 MCT sample. Genomic regions within the
candidate paternally methylated DMR for known maternally expressed imprinted gene ZNF597 display differential
CpG methylation in blood and placenta, a gain of CpG methylation in the AnCHMs, and a loss of CpG methylation
in the MCT.
76
A
B
Figure 3-4: CpG Methylation within the Candidate ZNF597 DMR
77
Figure 3-5: CpG Methylation within the Candidate RIMS2 DMR
Box-and-whisker plot showing the distribution of: A) Illumina Infinium Human Methylation27 promoter microarray
percent CpG methylation for RIMS2 CpG site cg05341878 for each tissue. The data came from 16 blood, 5 placenta,
3 AnCHM, and 1 MCT sample; B) Sodium bisulfite pyrosequencing percent CpG methylation for 2 consecutive
CpG sites approximately 100 bases upstream of the candidate maternally methylated RIMS2 CpG site for each
tissue. The data came from 17 blood, 12 placenta, 3 AnCHM, and 1 MCT sample. The RIMS2 CpG site cg05341878
displays differential CpG methylation in blood and placenta, a loss of CpG methylation in the AnCHMs, and
differential CpG methylation in the MCT. A genomic region approximately 100 bases upstream of the RIMS2 CpG
site cg05341878 displays differential CpG methylation in the placenta and MCT, a gain of CpG methylation in the
blood, and a loss of CpG methylation in the AnCHMs.
78
A
B
Figure 3-5: CpG Methylation within the Candidate RIMS2 DMR
79
Figure 3-6: CpG Methylation within the Candidate AXL DMR
Box-and-whisker plot showing the distribution of: A) Illumina Infinium Human Methylation27 promoter microarray
percent CpG methylation for AXL CpG site cg14892768 for each tissue. The data came from 16 blood, 5 placenta, 3
AnCHM, and 1 MCT sample; B) Sodium bisulfite pyrosequencing percent CpG methylation for 4 consecutive CpG
sites within the candidate paternally methylated AXL DMR for each tissue. The first CpG site analyzed is AXL CpG
site cg14892768 on the Illumina Infinuium Human Methylation27 promoter microarray. The data came from 15
blood, 10 placenta, 3 AnCHM, and 1 MCT sample. Adapted from Genome Research, Vol. 21 (Issue 3), Choufani et
al., A novel approach identifies new differentially methylated regions (DMRs) associated with imprinted genes, 465-
476, Copyright (2011), with permission from Cold Spring Harbor Laboratory Press. A genomic region within the
candidate paternally methylated DMR for candidate imprinted gene AXL displays differential CpG methylation in
blood and placenta, a gain of CpG methylation in the AnCHMs, and a loss of CpG methylation in the MCT.
80
A
B
Figure 3-6: CpG Methylation within the Candidate AXL DMR
81
Figure 3-7: Candidate AXL DMR Sodium Bisulfite Sequencing
CpG methylation of the candidate paternally methylated AXL DMR. A) Genomic location of the human AXL
promoter with the 355 base-pair region analyzed for CpG methylation (using sodium bisulfite cloning/sequencing)
indicated by a red filled rectangle. The Illumina Infinium Human Methylation27 promoter microarray AXL CpG site
cg14892768 is located within this red rectangle. Rakyan et al. (2008)380 performed CpG methylation analyses using
MeDIP on sperm and placenta and their CpG methylation data for the AXL promoter region has been integrated into
the Ensembl Genome Browser screenshot (shown in the MeDIP-chip Placenta and MeDIP-chip Sperm rows, chip in
this case refers to microarrays). The green region within the MeDIP-chip Placenta row is intermediately methylated
(~50% CpG methylation). The blue region within the MeDIP-chip Sperm row is methylated (~100% CpG
methylation); B) DNA sequence of the 355 base-pair genomic region that had its CpG methylation analyzed using
sodium bisulfite cloning/sequencing. The CpG dinucleotides are in bold. The underlined (and #ed) CpG site is the
Illumina Infinium Human Methylation27 promoter microarray AXL CpG site cg14892768. The # CpG sites had their
CpG methylation analyzed using targeted quantitative sodium bisulfite pyrosequencing (Figure 3-6B); C) Sodium
bisulfite cloning/sequencing results for the 14 CpG sites within the 355 base-pair fragment from the AXL promoter
region in the MCT (on the right), one AnCHM (on the left), and one placenta sample (in the middle). Each row
corresponds to a specific clone. Each column corresponds to a specific CpG site (the CpG sites are ordered by their
genomic location (p-arm to q-arm, left to right)). A black filled circle represents a methylated CpG site. A white
filled circle represents an unmethylated CpG site. The Illumina Infinium Human Methylation27 promoter
microarray AXL CpG site cg14892768 is indicated by the black arrows at the bottom. Beneath each set of results is
the tissue type (e.g., MCT). A genomic region within the candidate paternally methylated DMR for candidate
imprinted gene AXL displays differential CpG methylation in one placenta, a gain of CpG methylation in one
AnCHM, and a loss of CpG methylation in the MCT. Not even one genomic single nucleotide variant was observed
in the sodium bisulfite-treated DNA. Adapted from Genome Research, Vol. 21 (Issue 3), Choufani et al., A novel
approach identifies new differentially methylated regions (DMRs) associated with imprinted genes, 465-476,
Copyright (2011), with permission from Cold Spring Harbor Laboratory Press.
82
A
B AGGCAGGGGTGCTGAGAAGGCGGCTGCTGGGCAGAGCCGGTGGCAAGGGCCTCCCCTGCCGCTGTGCCAGGCAG
GCAGTGCCAAATCCGGGGAGCCTGGAGCTGGGGGGAGGGCCGGGGACAGCCCGGCCCTGCCCCCTCCCCCGCTG
GGAGCCCAACAACTTCTGAGGAAAGTTTGGCACCCATGGCGTGGCGGTGCCCCAGGATGGGCAGGGTCCCG#CTG
GCCTGGTGCTTGGCG#CTGTGCG#GCTGGGCG#TGCATGGCCCCCAGGGGTGAGTGATGGGGGCTCCTTGGGGCAG
GGATCCCCTCGGAGGGGCTGGGGCAGGGGTAGGAGGTGGGGGATGATGGCAGGTGTGGGG
C
Figure 3-7: Candidate AXL DMR Sodium Bisulfite Sequencing
83
Table 3-1: AXL SNP Quantification in DNA and RNA of Informative Individuals
The AXL SNP is rs1051008. The SNP quantification was performed using targeted pyrosequencing (allelic
quantification). The DNA and RNA were extracted from lymphoblastoid cell lines (LCLs). The informative
individuals mentioned in the title are informative because they are heterozygous for the AXL SNP rs1051008 and in
these individuals it can be determined which of their parents contributed each allele present. The genotype of the
father of individual 35326 is GG at the AXL SNP rs1051008 (determined from the Hapmap data generated on the
Illumina 1M-Duo v3). The genotype of the mother of individual 35326 is AA at the AXL SNP rs1051008
(determined from the Hapmap data generated on the Illumina 1M-Duo v3). In one informative heterozygous
individual (shaded in light blue), AXL was preferentially expressed from the maternal chromosome. In the other
three heterozygous individuals, AXL was not expressed preferentially from any parental chromosome. Adapted from
Genome Research, Vol. 21 (Issue 3), Choufani et al., A novel approach identifies new differentially methylated
regions (DMRs) associated with imprinted genes, 465-476, Copyright (2011), with permission from Cold Spring
Harbor Laboratory Press.
Individual ID DNA RNA
34969 A: 55%; G: 45% A: 59%; G:41%
35158 A: 57%; G: 43% A: 53%; G: 47%
35167 A: 58%; G: 42% A: 56%; G: 44%
35326 A: 57%; G: 43% A: 82%; G: 18%
84
85
Chapter 4 Discussion
4 Discussion
Various approaches have been utilized to identify novel imprinted genes and their associated
parent-of-origin-specific differentially methylated regions (DMRs) in humans335-341. I developed
a new approach to identify candidate parent-of-origin-specific differentially methylated regions
(DMRs), some of which may be associated with nearby known and/or novel imprinted genes in
humans. Sodium bisulfite-treated DNA from human uniparental tissues, androgenetic complete
hydatidiform mole (AnCHM) and mature cystic ovarian teratoma (MCT), and human biparental
tissues, blood and placenta, was hybridized to CpG methylation microarrays to identify candidate
parent-of-origin-specific differentially methylated CpG sites (DMCpGs), some of which may
reside in parent-of-origin-specific differentially methylated regions (DMRs) associated with
nearby known and/or novel imprinted genes.
4.1 More Complete Picture of CpG Methylation in Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes)
I assayed CpG methylation within fourteen known parent-of-origin-specific DMRs (associated
with known imprinted genes) in blood, placenta, AnCHM, and MCT (Figure 3-1; Figure 3-2).
Many studies have assessed the CpG methylation state of known parent-of-origin-specific DMRs
(associated with known imprinted genes) in biparental tissues. However, very few studies have
examined the CpG methylation state of known parent-of-origin-specific DMRs (associated with
known imprinted genes) in uniparental tissues, AnCHM and MCT (Appendices Table A-1).
Notably, many known parent-of-origin-specific DMRs (associated with known imprinted genes)
have not had their CpG methylation investigated in AnCHMs and/or MCTs in previous studies
(Appendices Table A-1). In biparental and uniparental tissues, I have examined the CpG
methylation within many of these known parent-of-origin-specific DMRs associated with known
imprinted genes (Figure 3-1; Figure 3-2).
86
By using the Illumina Infinium Human Methylation27 promoter microarray to assess the CpG
methylation of CpG sites located in additional known parent-of-origin-specific DMRs
(associated with known imprinted genes) in uniparental and biparental tissues, a more complete
picture of CpG methylation within known parent-of-origin-specific DMRs (associated with
known imprinted genes) was produced. The extra data increased the number of known and
candidate parent-of-origin-specific differentially methylated CpG sites (DMCpGs) identified by
my method. Some of the additional candidate parent-of-origin-specific DMCpGs may reside
within parent-of-origin-specific DMRs associated with nearby known and/or novel imprinted
genes.
4.2 Biparental Tissues (When Compared to Uniparental Tissues) Have Differential CpG Methylation in Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes)
As expected, known parent-of-origin-specific DMRs (associated with known imprinted genes)
were differentially methylated in biparental tissues, blood and placenta, when compared to
uniparental tissues, AnCHM and MCT (Figure 3-1; Figure 3-2). A few previous studies have
contrasted the percent CpG methylation of some known parent-of-origin-specific DMRs
(associated with known imprinted genes) in biparental and uniparental tissues163,166,176. In the
known paternally methylated IC1 (H19DMR), Miura et al. (1999)176 reported hypomethylation
in MCTs (when compared to blood) and El-Maarri et al. (2003)166 reported hypermethylation in
AnCHMs (when compared to blood). In the known maternally methylated SNRPN DMR, Miura
et al. (1999)176 noted hypermethylation in MCTs (when compared to blood) and El-Maarri et al.
(2003)166 noted hypomethylation in AnCHMs (when compared to blood).
Due to the differences in CpG methylation in known parent-of-origin-specific DMRs (associated
with known imprinted genes) between androgenetic complete hydatidiform moles (AnCHMs),
mature cystic ovarian teratoma (MCT), and biparental tissues, I was able to identify candidate
parent-of-origin-specific differentially methylated CpG sites (DMCpGs) using my approach.
87
4.3 Variable CpG Methylation in Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes)
Interestingly, the variability in the CpG methylation of some known parent-of-origin-specific
DMRs (associated with known imprinted genes) varied between tissues (Figure 3-1; Figure 3-2).
Results from several previous studies have also suggested that the variability in the CpG
methylation of some known parent-of-origin-specific DMRs (associated with known imprinted
genes) varies between tissues166,175,381. Perhaps these known parent-of-origin-specific DMRs
(associated with known imprinted genes) have different CpG methylation natural histories in
different cell types (DNA in blood generally comes from neutrophils, lymphocytes, monocytes,
and eosinophils382; DNA in placenta generally comes from cytotrophoblasts,
syncytiotrophoblasts, and fibroblasts383,384). Such differences in CpG methylation could be due to
differences in CpG methylation maintenance385-389, de novo CpG methylation385,390,391, and/or
other epigenetic processes392-395.
Differences in cell type composition of the individual tissue samples may also factor into the
difference in variability in the CpG methylation of some known parent-of-origin-specific DMRs
(associated with known imprinted genes) in different tissues381. Some biparental cell types may
not contain parent-of-origin-specific CpG methylation at some parent-of-origin-specific
DMRs396. The absence of parent-of-origin-specific CpG methylation at some parent-of-origin-
specific DMRs in some biparental cell types may be more common at secondary parent-of-
origin-specific DMRs when compared to primary parent-of-origin-specific DMRs. The
epigenetic processes required to establish parent-of-origin-specific CpG methylation at some
secondary parent-of-origin-specific DMRs in some biparental cell types may be perturbed.
Notably, some uniparental cell types (in AnCHM or MCT) may not contain completely
methylated/unmethylated genomic regions within some parent-of-origin-specific DMRs. This
circumstance may be more common at secondary parent-of-origin-specific DMRs (when
compared to primary parent-of-origin-specific DMRs). The epigenetic processes required to
methylate/unmethylate the secondary parent-of-origin-specific DMR in some uniparental cell
types may be disrupted.
Since some biparental cell types, such as neutrophils in blood or cytotrophoblasts in placenta,
may not contain parent-of-origin-specific CpG methylation at some parent-of-origin-specific
88
DMRs, candidate maternally methylated CpG sites and candidate paternally methylated CpG
sites were determined for blood and placenta separately.
4.4 Poor Microarray Coverage of Known Paternally Methylated DMRs
It was not surprising that the Illumina Infinium Human Methylation27 promoter microarray had
very poor coverage of known paternally methylated DMRs (when compared to the coverage of
known maternally methylated DMRs) (Appendices Table A-5). There are 5 known paternally
methylated DMRs in the human genome16,167,172,175,181,190,198,397,398. Of the five known paternally
methylated DMRs, two are located within intergenic regions, two are located within gene
promoters, and one is located in the gene body of IGF2. For comparison, there are 14 known
maternally methylated DMRs in the human genome10,18,19,24,26,28,163,164,170,177,180,188,196,227,346,399-403.
Of the 14 known maternally methylated DMRs, 12 are located within gene promoters, one is
located in the gene body of GRB10, and the last one is located in the gene body of IGF2R.
The poor microarray coverage of known paternally methylated DMRs may have caused the
original criteria for candidate paternally methylated CpG sites in blood and candidate paternally
methylated CpG sites in placenta to be more strengthened than the criteria for candidate
maternally methylated CpG sites in blood and candidate maternally methylated CpG sites in
placenta. Therefore, the criteria for candidate paternally methylated CpG sites in blood were
loosened by adapting the criteria for candidate maternally methylated CpG sites in blood. The
criteria for candidate paternally methylated CpG sites in placenta were loosened by adapting the
criteria for candidate maternally methylated CpG sites in placenta. This decreased the bias
against paternally methylated CpG sites.
Considering the distribution of known paternally methylated DMRs (associated with known
imprinted genes) and known maternally methylated DMRs (associated with known imprinted
genes) in the human genome, it was expected that there would be more candidate maternally
methylated CpG sites than candidate paternally methylated CpG sites (Table A-6; Table A-7;
Table A-8; Table A-9).
89
4.5 Very Few Candidate Imprinted Loci Identified By More Than One Study
My method identified 365 candidate maternally methylated CpG sites in blood (Table A-6), 491
candidate maternally methylated CpG sites in placenta (Table A-7), 77 candidate paternally
methylated CpG sites in blood (Table A-8), and 116 candidate paternally methylated CpG sites
in placenta (Table A-9). Three hundred sixty four candidate maternally methylated CpG sites in
blood, 488 candidate maternally methylated CpG sites in placenta, 77 candidate paternally
methylated CpG sites in blood, and 116 candidate paternally methylated CpG sites in placenta
are associated with approximately 340, 440, 70, and 100 genes respectively. One hundred
overlapping (i.e., present in both blood and placenta lists) candidate maternally methylated CpG
sites are associated with ~90 genes. Twenty six overlapping (i.e., present in both blood and
placenta lists) candidate paternally methylated CpG sites are associated with ~20 genes.
One candidate maternally methylated CpG site in blood is associated with candidate imprinted
gene TCEB3C, which was identified by Strichman-Almashanu et al. (2002)335 using CpG
methylation sensitive and CpG methylation insensitive restriction enzymes on genomic DNA
from two uniparental tissues (AnCHM (androgenetic complete hydatidiform mole) and MCT
(mature cystic ovarian teratoma)), followed by cloning and sequencing.
One candidate maternally methylated CpG site in blood is associated with candidate imprinted
gene CDH18. One candidate maternally methylated CpG site in placenta is associated with
candidate imprinted gene FAM50B. One candidate paternally methylated CpG site in placenta is
associated with candidate imprinted gene PAOX. Five candidate paternally methylated CpG sites
in placenta are associated with candidate imprinted gene RBP5. One candidate paternally
methylated CpG site in placenta is associated with candidate imprinted gene HOXC4. One
candidate maternally methylated CpG site in blood is associated with candidate imprinted gene
PPAP2C. Candidate imprinted genes CDH18, FAM50B, PAOX, RBP5, HOXC4, and PPAP2C
were identified by Luedi et al. (2007)336 using computer algorithms to search the genome for
genes with DNA sequence features around known imprinted genes.
One candidate maternally methylated CpG site in placenta is associated with candidate imprinted
gene ATF5. One candidate maternally methylated CpG site in blood is associated with candidate
imprinted gene SLC7A7. One candidate maternally methylated CpG site in blood is associated
90
with candidate imprinted gene BCL2L14. One candidate maternally methylated CpG site in
placenta is associated with candidate imprinted gene TSPAN4. One candidate paternally
methylated CpG site in blood is associated with candidate imprinted gene BTN3A2. Candidate
imprinted genes ATF5, SLC7A7, BCL2L14, TSPAN4, and BTN3A2 were identified by Pollard et
al. (2008)337 using SNP microarrays to search for genes with differential allelic expression in
peripheral blood leukocytes (PBLs).
One candidate maternally methylated CpG site in placenta is associated with candidate imprinted
gene CUBN. One overlapping (i.e., present in both blood and placenta lists) candidate maternally
methylated CpG site is associated with candidate imprinted gene GRIN2B. One candidate
maternally methylated CpG site in blood is associated with candidate imprinted gene LIFR. One
candidate maternally methylated CpG site in placenta is associated with candidate imprinted
gene SLC10A2. One candidate maternally methylated CpG site in blood is associated with
candidate imprinted gene SLC4A4. One overlapping (i.e., present in both blood and placenta
lists) candidate paternally methylated CpG site is associated with known imprinted gene
ZNF597. Known imprinted gene ZNF597 and candidate imprinted genes CUBN, GRIN2B, LIFR,
SLC10A2, and SLC4A4, were identified by Maynard et al. (2008)338 by searching for genes with
RNA polymerase bound to only one of their two alleles.
The candidate maternally methylated CpG sites in placenta associated with candidate imprinted
genes TRPC3 and FAM50B were identified as candidate maternally methylated CpG sites by
Nakabayashi et al. (2011)340 using CpG methylation profiling of biparental tissues and blood
tissues with cells containing genome-wide maternal/paternal uniparental disomies. The candidate
maternally methylated CpG site in blood associated with candidate imprinted gene ZBTB16 was
identified as a candidate maternally methylated CpG site by Nakabayashi et al. (2011)340. The
overlapping (i.e., present in both blood and placenta lists) candidate paternally methylated CpG
site associated with known imprinted gene ZNF597 was identified as a candidate paternally
methylated CpG site by Nakabayashi et al. (2011)340.
The candidate paternally methylated CpG sites in placenta associated with candidate imprinted
genes AKAP10, PARP12, ACPL2, and PEX5 were identified as candidate paternally methylated
CpG sites by Yuen et al. (2011)341 using CpG methylation profiling of biparental diploid (one
maternal genome and one paternal genome) placentas, diandric triploid (two paternal genomes
91
and one maternal genome) placentas, digynic triploid (2 maternal genomes and 1 paternal
genome) placentas, and androgenetic complete hydatidiform moles (AnCHMs). The candidate
maternally methylated CpG site in placenta associated with candidate imprinted gene FAM50B
was identified as a candidate maternally methylated CpG site by Yuen et al. (2011)341. The
overlapping (i.e., present in both blood and placenta lists) candidate paternally methylated CpG
site associated with candidate imprinted gene LEP was identified as a candidate paternally
methylated CpG site by Yuen et al. (2011)341.
Interestingly, candidate imprinted gene FAM50B was identified by Luedi et al. (2007)336,
Nakabayashi et al. (2011)340, Yuen et al. (2011)341, and I. Nakabayashi et al. (2011)340 and I have
identified the candidate paternally methylated CpG site associated with known imprinted gene
ZNF597.
4.6 Boundaries of Known Parent-of-Origin-Specific DMRs (Associated with Known Imprinted Genes) are Unknown
Candidate parent-of-origin-specific DMCpGs with the same methylation pattern as known
parent-of-origin-specific DMRs (associated with known imprinted genes) less than a kilobase
away were identified (Appendices Table A-23). Perhaps these candidate parent-of-origin-specific
DMCpGs are components of these known parent-of-origin-specific DMRs (associated with
known imprinted genes).
Although many studies have added to what is known about the CpG methylation state within
known parent-of-origin-specific DMRs (associated with known imprinted genes) in different
tissues, the boundaries of known parent-of-origin-specific DMRs (associated with known
imprinted genes) are still unknown. Notably, there are studies that have crudely estimated the
boundaries of known parent-of-origin-specific DMRs (associated with known imprinted
genes)172,205.
92
4.7 Candidate Maternally Methylated DMR in Promoter of Imprinted Gene NAP1L5
In the promoter region of known paternally expressed imprinted gene NAP1L5378, eight
candidate maternally methylated CpG sites were identified. Two of these eight candidate
maternally methylated CpG sites were identified using the Illumina Infinium Human
Methylation27 promoter microarray. The six other candidate maternally methylated CpG sites
were identified using sodium bisulfite pyrosequencing (Figure 3-3B). The eight candidate
maternally methylated CpG sites may be located within a maternally methylated DMR that
participates in regulating the imprinted gene expression pattern of NAP1L5. In mice, a
maternally methylated DMR associated with the known paternally expressed imprinted gene
Nap1l5 has been discovered in the promoter region of Nap1l5404. Perhaps maternal DNA
methylation in the promoter region of NAP1L5 silences the maternal NAP1L5 in tissue(s) where
NAP1L5 is imprinted.
4.8 Candidate Paternally Methylated DMR in Promoter of Imprinted Gene ZNF597
In the promoter region of known maternally expressed imprinted gene ZNF597379, five candidate
paternally methylated CpG sites were identified. One of these five candidate paternally
methylated CpG sites was identified using the Illumina Infinium Human Methylation27
promoter microarray (Figure 3-4A). The four other candidate paternally methylated CpG sites
were identified using sodium bisulfite pyrosequencing (Figure 3-4B). The five candidate
paternally methylated CpG sites may be located within a paternally methylated DMR that
participates in regulating the imprinted gene expression pattern of ZNF597. Maybe paternal
DNA methylation in the promoter region of ZNF597 silences the paternal ZNF597 in tissue(s)
where ZNF597 is imprinted.
93
4.9 Candidate Maternally Methylated DMR in Promoter of RIMS2
In the promoter region of candidate imprinted gene RIMS2, one candidate maternally methylated
CpG site was identified using the Illumina Infinium Human Methylation27 promoter microarray
(Figure 3-5A). This candidate maternally methylated CpG site may be located within a
maternally methylated DMR that regulates the expression of RIMS2. Two CpG sites upstream of
the aforementioned candidate maternally methylated CpG site did not appear to be differentially
methylated depending on their parent-of-origin (Figure 3-5B). Perhaps the candidate maternally
methylated DMR does not extend to these two upstream CpG sites. Maybe maternal DNA
methylation in the region of the candidate maternally methylated CpG site silences the maternal
RIMS2 in some tissues.
4.10 Candidate Paternally Methylated DMR in Promoter of AXL
In the promoter region of candidate imprinted gene AXL, five candidate paternally methylated
CpG sites were identified. One candidate paternally methylated CpG site was identified using the
Illumina Infinium Human Methylation27 promoter microarray (Figure 3-6A). Three other
candidate paternally methylated CpG sites were identified using sodium bisulfite pyrosequencing
(Figure 3-6B). The last candidate paternally methylated CpG sites was identified using sodium
bisulfite cloning/sequencing (Figure 3-7). The five candidate paternally methylated CpG sites
may be located within a paternally methylated DMR that regulates the expression of AXL.
Plausibly, paternal DNA methylation in the promoter region of AXL silences the paternal AXL in
some tissues.
4.11 Polymorphic Imprinting of AXL
AXL was observed to have preferential parental expression in only one lymphoblastoid cell line
(one lymphoblastoid cell line (LCL) was established from each informative heterozygous
individual) (Table 3-1). Perhaps AXL, like paternally expressed imprinted gene IGF2405, has
polymorphic imprinting in human blood. AXL may have (polymorphic) imprinting in other
94
tissues or cell types and maybe at different developmental stages. Maybe the informative
heterozygous individual with preferential maternal expression of AXL in his/her lymphoblastoid
cell line (LCL) has preferential maternal expression of AXL in some of his/her other tissues
(possibly at different developmental stages). Other genes with polymorphic imprinting in
humans include IGF2R and SLC22A2406.
Interestingly, Axl is expressed preferentially from the maternal chromosome in the early mouse
conceptus359. Although the mouse conceptus usually loses its preferential parental expression of
Axl in later stages of development, sometimes preferential maternal expression of Axl is retained,
which is intriguing because polymorphic imprinting has not been described in mice. Perhaps
AXL is expressed preferentially from the maternal chromosome in the early human conceptus.
Maybe the human conceptus usually loses its preferential parental expression of AXL in later
stages of development, but sometimes retains preferential maternal expression of AXL, resulting
in polymorphic imprinting.
4.12 General Discussion
My hypothesis was that candidate parent-of-origin-specific DMCpGs, some of which may reside
in parent-of-origin-specific DMRs associated with nearby known and/or novel imprinted genes
in humans, can be identified by comparing the CpG methylation of individual CpG sites in
human uniparental and biparental tissues. Interestingly, some candidate parent-of-origin-specific
DMCpGs I identified were associated with known imprinted genes (NAP1L5 and ZNF597)
without known parent-of-origin-specific DMRs at the time; perhaps these candidate parent-of-
origin-specific DMCpGs are a part of the parent-of-origin-specific DMRs that regulate the
imprinting of these known imprinted genes. I also identified candidate parent-of-origin-specific
DMCpGs in the promoter region of AXL and allelic expression analyses of AXL in human
lymphoblastoid cell lines (LCLs) were performed. I discovered one lymphoblastoid cell line
(LCL) with preferential parental expression of AXL, which suggests AXL may have polymorphic
imprinting in human blood.
My approach to identify candidate imprinted genes was limited in that it identifies candidate
parent-of-origin-specific DMCpGs, not candidate imprinted genes. The genes around my
95
candidate parent-of-origin-specific DMCpGs may be imprinted. My approach was also limited in
that it could not be used to identify candidate parent-of-origin-specific DMCpGs genome-wide
because it utilized the Illumina Infinium Human Methylation27 microarray, which is a promoter
microarray that interrogates on average only two CpG sites in every gene promoter.
Unfortunately, the Illumina Infinium Human Methylation27 promoter microarray could not be
used to define the boundaries of DMRs. To define the boundary of a DMR, the CpG methylation
of the entire DMR, plus the surrounding of the DMR, would need to be defined.
4.13 Future Directions
I have identified candidate parent-of-origin-specific DMCpGs, which reside in candidate parent-
of-origin-specific DMRs, some of which may be associated with nearby novel imprinted genes in
humans. A future study could attempt to determine if genes nearby my candidate parent-of-
origin-specific DMCpGs are imprinted in humans using allelic expression analyses in different
tissues at different developmental stages. If any novel imprinted genes in humans are identified,
their homologues in other mammals, such as mice, could be checked for imprinting.
My approach could not be used to identify candidate DMCpGs genome-wide because it utilized
the Illumina Infinium Human Methylation27 promoter microarray, which interrogates on
average only two CpG sites in every gene promoter. A future study could replicate my study, but
instead of using the Illumina Infinium Human Methylation27 promoter microarray, use the 450K
Illumina Methylation BeadChip microarray. The 450K Illumina Methylation BeadChip
microarray would interrogate the methylation status of greater than 450,000 cytosine sites
covering CpG islands, CpG island shores, non-CpG methylated cytosines identified in human
stem cells, and miRNA promoter regions. Also, another future study could expand the scope of
my study by using next generation sodium bisulfite sequencing instead of microarray
technology. The next generation sodium bisulfite sequencing approach would allow one to assess
the methylation of significantly more cytosines in the human genome.
The boundaries for known parent-of-origin-specific DMRs (associated with known imprinted
genes) have yet to be determined in humans. Also, boundaries for my candidate parent-of-origin-
specific DMRs that may be associated with known human imprinted genes, NAP1L5 and
96
ZNF597, are unknown. A future study could determine the boundaries for these human DMRs,
perhaps using next generation sodium bisulfite sequencing.
4.14 Conclusions
Several approaches have been utilized to identify novel imprinted genes in humans. I developed
a new method to identify candidate imprinted genes in humans using the fact that imprinted
genes are often associated with nearby parent-of-origin-specific DMRs. I utilized sodium
bisulfite-based CpG methylation profiling of uniparental tissues, AnCHM and MCT, and
biparental tissues, blood and placenta, to identify candidate parent-of-origin-specific DMRs. I
identified candidate parent-of-origin-specific DMRs in the promoter regions of the known
imprinted genes NAP1L5 and ZNF597, which did not have known associated parent-of-origin-
specific DMRs at the time. I also identified a candidate paternally methylated DMR in the
promoter region of AXL and allelic expression analyses of AXL in human lymphoblastoid cell
lines (LCLs) were performed. In only one lymphoblastoid cell line (LCL), I discovered
preferential parental expression of AXL, which suggests AXL may have polymorphic imprinting
in human blood. Perhaps other candidate parent-of-origin-specific DMRs I identified are
associated with nearby novel imprinted genes not yet discovered. Maybe some of these novel
imprinted genes could help explain some unexplained cases of deregulated development.
97
98
References
1 DeChiara, T. M., Robertson, E. J. & Efstratiadis, A. Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64, 849-859, (1991).
2 Albrecht, U. et al. Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet 17, 75-78, (1997).
3 Hikichi, T., Kohda, T., Kaneko-Ishino, T. & Ishino, F. Imprinting regulation of the murine Meg1/Grb10 and human GRB10 genes; roles of brain-specific promoters and mouse-specific CTCF-binding sites. Nucleic Acids Res 31, 1398-1406, (2003).
4 Wang, X. et al. Transcriptome-wide identification of novel imprinted genes in neonatal mouse brain. PLoS One 3, e3839, (2008).
5 Hark, A. T. et al. CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405, 486-489, (2000).
6 Li, E. Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3, 662-673, (2002).
7 Yu, Y. et al. Epigenetic regulation of ARHI in breast and ovarian cancer cells. Ann N Y Acad Sci 983, 268-277, (2003).
8 Caspary, T., Cleary, M. A., Baker, C. C., Guan, X. J. & Tilghman, S. M. Multiple mechanisms regulate imprinting of the mouse distal chromosome 7 gene cluster. Mol Cell Biol 18, 3466-3474, (1998).
9 Weksberg, R., Smith, A. C., Squire, J. & Sadowski, P. Beckwith-Wiedemann syndrome demonstrates a role for epigenetic control of normal development. Hum Mol Genet 12 Spec No 1, R61-68, (2003).
10 Smilinich, N. J. et al. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann syndrome. Proc Natl Acad Sci U S A 96, 8064-8069, (1999).
11 Umlauf, D. et al. Imprinting along the Kcnq1 domain on mouse chromosome 7 involves repressive histone methylation and recruitment of Polycomb group complexes. Nat Genet 36, 1296-1300, (2004).
12 Redrup, L. et al. The long noncoding RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene silencing. Development 136, 525-530, (2009).
13 Mancini-DiNardo, D., Steele, S. J., Ingram, R. S. & Tilghman, S. M. A differentially methylated region within the gene Kcnq1 functions as an imprinted promoter and silencer. Hum Mol Genet 12, 283-294, (2003).
99
14 Murrell, A., Heeson, S. & Reik, W. Interaction between differentially methylated regions partitions the imprinted genes Igf2 and H19 into parent-specific chromatin loops. Nat Genet 36, 889-893, (2004).
15 Okamura, K., Wintle, R. F. & Scherer, S. W. Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting. Genome Biol 9, R160, (2008).
16 Kagami, M. et al. The IG-DMR and the MEG3-DMR at human chromosome 14q32.2: hierarchical interaction and distinct functional properties as imprinting control centers. PLoS Genet 6, e1000992, (2010).
17 Yun, J., Park, C. W., Lee, Y. J. & Chung, J. H. Allele-specific methylation at the promoter-associated CpG island of mouse Copg2. Mamm Genome 14, 376-382, (2003).
18 Yuan, J. et al. Aberrant methylation and silencing of ARHI, an imprinted tumor suppressor gene in which the function is lost in breast cancers. Cancer Res 63, 4174-4180, (2003).
19 Riemenschneider, M. J., Reifenberger, J. & Reifenberger, G. Frequent biallelic inactivation and transcriptional silencing of the DIRAS3 gene at 1p31 in oligodendroglial tumors with 1p loss. Int J Cancer 122, 2503-2510, (2008).
20 Arima, T. et al. The human HYMAI/PLAGL1 differentially methylated region acts as an imprint control region in mice. Genomics 88, 650-658, (2006).
21 Arnaud, P. et al. Conserved methylation imprints in the human and mouse GRB10 genes with divergent allelic expression suggests differential reading of the same mark. Hum Mol Genet 12, 1005-1019, (2003).
22 Kainz, B. et al. Overexpression of the paternally expressed gene 10 (PEG10) from the imprinted locus on chromosome 7q21 in high-risk B-cell chronic lymphocytic leukemia. Int J Cancer 121, 1984-1993, (2007).
23 Monk, D. et al. Comparative analysis of human chromosome 7q21 and mouse proximal chromosome 6 reveals a placental-specific imprinted gene, TFPI2/Tfpi2, which requires EHMT2 and EED for allelic-silencing. Genome Res 18, 1270-1281, (2008).
24 Riesewijk, A. M. et al. Monoallelic expression of human PEG1/MEST is paralleled by parent-specific methylation in fetuses. Genomics 42, 236-244, (1997).
25 Astuti, D. et al. Epigenetic alteration at the DLK1-GTL2 imprinted domain in human neoplasia: analysis of neuroblastoma, phaeochromocytoma and Wilms' tumour. Br J Cancer 92, 1574-1580, (2005).
26 Zeschnigk, M. et al. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet 6, 387-395, (1997).
100
27 Murphy, S. K., Wylie, A. A. & Jirtle, R. L. Imprinting of PEG3, the human homologue of a mouse gene involved in nurturing behavior. Genomics 71, 110-117, (2001).
28 Liu, J. et al. A GNAS1 imprinting defect in pseudohypoparathyroidism type IB. J Clin Invest 106, 1167-1174, (2000).
29 Onyango, P. et al. Monoallelic expression and methylation of imprinted genes in human and mouse embryonic germ cell lineages. Proc Natl Acad Sci U S A 99, 10599-10604, (2002).
30 Bao, J. J. et al. Reexpression of the tumor suppressor gene ARHI induces apoptosis in ovarian and breast cancer cells through a caspase-independent calpain-dependent pathway. Cancer Res 62, 7264-7272, (2002).
31 Huang, S. et al. ARHI (DIRAS3), an imprinted tumour suppressor gene, binds to importins and blocks nuclear import of cargo proteins. Biosci Rep 30, 159-168, (2010).
32 Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A. & Craig, A. M. LRRTMs and neuroligins bind neurexins with a differential code to cooperate in glutamate synapse development. J Neurosci 30, 7495-7506, (2010).
33 Spengler, D. et al. Regulation of apoptosis and cell cycle arrest by Zac1, a novel zinc finger protein expressed in the pituitary gland and the brain. EMBO J 16, 2814-2825, (1997).
34 Mackay, D. J. et al. Relaxation of imprinted expression of ZAC and HYMAI in a patient with transient neonatal diabetes mellitus. Hum Genet 110, 139-144, (2002).
35 Kamikihara, T. et al. Epigenetic silencing of the imprinted gene ZAC by DNA methylation is an early event in the progression of human ovarian cancer. Int J Cancer 115, 690-700, (2005).
36 Ma, L. et al. Zac1 functions through TGFbetaII to negatively regulate cell number in the developing retina. Neural Dev 2, 11, (2007).
37 Chung, S. H. et al. Zac1 plays a key role in the development of specific neuronal subsets in the mouse cerebellum. Neural Dev 6, 25, (2011).
38 Declercq, J. et al. Pdx1- and Ngn3-Cre-mediated PLAG1 expression in the pancreas leads to endocrine hormone imbalances that affect glucose metabolism. Cell Transplant, (2011).
39 Morrione, A. et al. Grb10: A new substrate of the insulin-like growth factor I receptor. Cancer Res 56, 3165-3167, (1996).
40 Murdaca, J. et al. Grb10 prevents Nedd4-mediated vascular endothelial growth factor receptor-2 degradation. J Biol Chem 279, 26754-26761, (2004).
101
41 Tezuka, N., Brown, A. M. & Yanagawa, S. GRB10 binds to LRP6, the Wnt co-receptor and inhibits canonical Wnt signaling pathway. Biochem Biophys Res Commun 356, 648-654, (2007).
42 Smith, F. M. et al. Mice with a disruption of the imprinted Grb10 gene exhibit altered body composition, glucose homeostasis, and insulin signaling during postnatal life. Mol Cell Biol 27, 5871-5886, (2007).
43 Kanayama, N. et al. Deficiency in p57Kip2 expression induces preeclampsia-like symptoms in mice. Mol Hum Reprod 8, 1129-1135, (2002).
44 Takahashi, K., Kobayashi, T. & Kanayama, N. p57(Kip2) regulates the proper development of labyrinthine and spongiotrophoblasts. Mol Hum Reprod 6, 1019-1025, (2000).
45 Moon, Y. S. et al. Mice lacking paternally expressed Pref-1/Dlk1 display growth retardation and accelerated adiposity. Mol Cell Biol 22, 5585-5592, (2002).
46 Constancia, M. et al. Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 417, 945-948, (2002).
47 Jiang, Y. H. et al. Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron 21, 799-811, (1998).
48 DeChiara, T. M., Efstratiadis, A. & Robertson, E. J. A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 345, 78-80, (1990).
49 Wang, Z. Q., Fung, M. R., Barlow, D. P. & Wagner, E. F. Regulation of embryonic growth and lysosomal targeting by the imprinted Igf2/Mpr gene. Nature 372, 464-467, (1994).
50 Shin, J. Y., Fitzpatrick, G. V. & Higgins, M. J. Two distinct mechanisms of silencing by the KvDMR1 imprinting control region. EMBO J 27, 168-178, (2008).
51 Kozlov, S. V. et al. The imprinted gene Magel2 regulates normal circadian output. Nat Genet 39, 1266-1272, (2007).
52 Yokoi, F., Dang, M. T., Li, J. & Li, Y. Myoclonus, motor deficits, alterations in emotional responses and monoamine metabolism in epsilon-sarcoglycan deficient mice. J Biochem 140, 141-146, (2006).
53 Ono, R. et al. Deletion of Peg10, an imprinted gene acquired from a retrotransposon, causes early embryonic lethality. Nat Genet 38, 101-106, (2006).
54 Curley, J. P., Barton, S., Surani, A. & Keverne, E. B. Coadaptation in mother and infant regulated by a paternally expressed imprinted gene. Proc Biol Sci 271, 1303-1309, (2004).
102
55 Lefebvre, L. et al. Abnormal maternal behaviour and growth retardation associated with loss of the imprinted gene Mest. Nat Genet 20, 163-169, (1998).
56 Miri, K. & Varmuza, S. Imprinting and extraembryonic tissues-mom takes control. Int Rev Cell Mol Biol 276, 215-262, (2009).
57 Varmuza, S., Mann, M. & Rogers, I. Site of action of imprinted genes revealed by phenotypic analysis of parthenogenetic embryos. Dev Genet 14, 239-248, (1993).
58 Rogers, I., Okano, K. & Varmuza, S. Paternal transmission of the mouse Thp mutation is lethal in some genetic backgrounds. Dev Genet 20, 23-28, (1997).
59 Kuzmin, A. et al. The PcG gene Sfmbt2 is paternally expressed in extraembryonic tissues. Gene Expr Patterns 8, 107-116, (2008).
60 Nakanishi, H. et al. Neurabin: a novel neural tissue-specific actin filament-binding protein involved in neurite formation. J Cell Biol 139, 951-961, (1997).
61 Mu, D. et al. Genomic amplification and oncogenic properties of the KCNK9 potassium channel gene. Cancer Cell 3, 297-302, (2003).
62 Casimiro, M. C. et al. Targeted point mutagenesis of mouse Kcnq1: phenotypic analysis of mice with point mutations that cause Romano-Ward syndrome in humans. Genomics 84, 555-564, (2004).
63 Vallon, V. et al. KCNQ1-dependent transport in renal and gastrointestinal epithelia. Proc Natl Acad Sci U S A 102, 17864-17869, (2005).
64 Reece, M. et al. Functional characterization of ORCTL2--an organic cation transporter expressed in the renal proximal tubules. FEBS Lett 433, 245-250, (1998).
65 Frank, D. et al. Placental overgrowth in mice lacking the imprinted gene Ipl. Proc Natl Acad Sci U S A 99, 7490-7495, (2002).
66 Muscatelli, F. et al. Disruption of the mouse Necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum Mol Genet 9, 3101-3110, (2000).
67 Lee, S. et al. Essential role for the Prader-Willi syndrome protein necdin in axonal outgrowth. Hum Mol Genet 14, 627-637, (2005).
68 Sun, F. L., Dean, W. L., Kelsey, G., Allen, N. D. & Reik, W. Transactivation of Igf2 in a mouse model of Beckwith-Wiedemann syndrome. Nature 389, 809-815, (1997).
69 Cibelli, J. B. et al. Parthenogenetic stem cells in nonhuman primates. Science 295, 819, (2002).
70 Kaufman, M. H. & Sachs, L. The early development of haploid and aneuploid parthenogenetic embryos. J Embryol Exp Morphol 34, 645-655, (1975).
103
71 Surani, M. A., Barton, S. C. & Norris, M. L. Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308, 548-550, (1984).
72 McGrath, J. & Solter, D. Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37, 179-183, (1984).
73 Fairbrother, J. E. Viable gynogenetic diploid Mytilus edulis (L.) larvae produced by ultraviolet light irradiation and cytochalasin B shock. Aquaculture 126, 25-34, (1994).
74 Barton, S. C., Surani, M. A. & Norris, M. L. Role of paternal and maternal genomes in mouse development. Nature 311, 374-376, (1984).
75 Cattanach, B. M. & Kirk, M. Differential activity of maternally and paternally derived chromosome regions in mice. Nature 315, 496-498, (1985).
76 Johnson, D. R. Hairpin-tail: a case of post-reductional gene action in the mouse egg. Genetics 76, 795-805, (1974).
77 McGrath, J. & Solter, D. Maternal Thp lethality in the mouse is a nuclear, not cytoplasmic, defect. Nature 308, 550-551, (1984).
78 Winking, H. & Silver, L. M. Characterization of a recombinant mouse T haplotype that expresses a dominant lethal maternal effect. Genetics 108, 1013-1020, (1984).
79 Barlow, D. P., Stoger, R., Herrmann, B. G., Saito, K. & Schweifer, N. The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the Tme locus. Nature 349, 84-87, (1991).
80 Searle, A. G. & Beechey, C. V. Genome imprinting phenomena on mouse chromosome 7. Genet Res 56, 237-244, (1990).
81 Bartolomei, M. S., Zemel, S. & Tilghman, S. M. Parental imprinting of the mouse H19 gene. Nature 351, 153-155, (1991).
82 Zhang, Y. & Tycko, B. Monoallelic expression of the human H19 gene. Nat Genet 1, 40-44, (1992).
83 Rachmilewitz, J. et al. Parental imprinting of the human H19 gene. FEBS Lett 309, 25-28, (1992).
84 Dodson, M. G. New concepts and questions in gestational trophoblastic disease. J Reprod Med 28, 741-749, (1983).
85 Bestor, T. H. & Bourc'his, D. Genetics and epigenetics of hydatidiform moles. Nat Genet 38, 274-276, (2006).
86 Kajii, T. & Ohama, K. Androgenetic origin of hydatidiform mole. Nature 268, 633-634, (1977).
104
87 Szulman, A. E. & Surti, U. The syndromes of hydatidiform mole. I. Cytogenetic and morphologic correlations. Am J Obstet Gynecol 131, 665-671, (1978).
88 Vassilakos, P., Riotton, G. & Kajii, T. Hydatidiform mole: two entities. A morphologic and cytogenetic study with some clinical consideration. Am J Obstet Gynecol 127, 167-170, (1977).
89 Wake, N., Takagi, N. & Sasaki, M. Androgenesis as a cause of hydatidiform mole. J Natl Cancer Inst 60, 51-57, (1978).
90 Erian, M. M. Unusual contents of a dermoid cyst of the ovary removed by laparoscopy. Aust N Z J Obstet Gynaecol 34, 195-196, (1994).
91 Rashad, M. N., Fathalla, M. F. & Kerr, M. G. Sex chromatin and chromosome analysis in ovarian teratomas. Am J Obstet Gynecol 96, 461-465, (1966).
92 Thomson, J. A. & Solter, D. The developmental fate of androgenetic, parthenogenetic, and gynogenetic cells in chimeric gastrulating mouse embryos. Genes Dev 2, 1344-1351, (1988).
93 Linder, D., McCaw, B. K. & Hecht, F. Parthenogenic origin of benign ovarian teratomas. N Engl J Med 292, 63-66, (1975).
94 Dahl, N., Gustavson, K. H., Rune, C., Gustavsson, I. & Pettersson, U. Benign ovarian teratomas. An analysis of their cellular origin. Cancer Genet Cytogenet 46, 115-123, (1990).
95 Deka, R. et al. Genetics and biology of human ovarian teratomas. II. Molecular analysis of origin of nondisjunction and gene-centromere mapping of chromosome I markers. Am J Hum Genet 47, 644-655, (1990).
96 Surti, U., Hoffner, L., Chakravarti, A. & Ferrell, R. E. Genetics and biology of human ovarian teratomas. I. Cytogenetic analysis and mechanism of origin. Am J Hum Genet 47, 635-643, (1990).
97 Goldberg, A. D., Allis, C. D. & Bernstein, E. Epigenetics: a landscape takes shape. Cell 128, 635-638, (2007).
98 Jones, P. A. & Takai, D. The role of DNA methylation in mammalian epigenetics. Science 293, 1068-1070, (2001).
99 Yoder, J. A., Walsh, C. P. & Bestor, T. H. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet 13, 335-340, (1997).
100 Riggs, A. D. X inactivation, differentiation, and DNA methylation. Cytogenet Cell Genet 14, 9-25, (1975).
101 Graves, J. A. 5-azacytidine-induced re-expression of alleles on the inactive X chromosome in a hybrid mouse cell line. Exp Cell Res 141, 99-105, (1982).
105
102 Norris, D. P. et al. Evidence that random and imprinted Xist expression is controlled by preemptive methylation. Cell 77, 41-51, (1994).
103 Bestor, T. H. The DNA methyltransferases of mammals. Hum Mol Genet 9, 2395-2402, (2000).
104 Feinberg, A. P. & Tycko, B. The history of cancer epigenetics. Nat Rev Cancer 4, 143-153, (2004).
105 Xu, G. L. et al. Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 402, 187-191, (1999).
106 Reik, W. Stability and flexibility of epigenetic gene regulation in mammalian development. Nature 447, 425-432, (2007).
107 Yoder, J. A. & Bestor, T. H. A candidate mammalian DNA methyltransferase related to pmt1p of fission yeast. Hum Mol Genet 7, 279-284, (1998).
108 Gruenbaum, Y., Cedar, H. & Razin, A. Substrate and sequence specificity of a eukaryotic DNA methylase. Nature 295, 620-622, (1982).
109 Okano, M., Xie, S. & Li, E. Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat Genet 19, 219-220, (1998).
110 Robertson, K. D. DNA methylation and chromatin - unraveling the tangled web. Oncogene 21, 5361-5379, (2002).
111 Fatemi, M., Hermann, A., Pradhan, S. & Jeltsch, A. The activity of the murine DNA methyltransferase Dnmt1 is controlled by interaction of the catalytic domain with the N-terminal part of the enzyme leading to an allosteric activation of the enzyme after binding to methylated DNA. J Mol Biol 309, 1189-1199, (2001).
112 Li, E., Bestor, T. H. & Jaenisch, R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69, 915-926, (1992).
113 Pradhan, S. & Esteve, P. O. Mammalian DNA (cytosine-5) methyltransferases and their expression. Clin Immunol 109, 6-16, (2003).
114 Okano, M., Bell, D. W., Haber, D. A. & Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257, (1999).
115 Aapola, U. et al. Isolation and initial characterization of a novel zinc finger gene, DNMT3L, on 21q22.3, related to the cytosine-5-methyltransferase 3 gene family. Genomics 65, 293-298, (2000).
116 Hata, K., Okano, M., Lei, H. & Li, E. Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 129, 1983-1993, (2002).
106
117 Bourc'his, D., Xu, G. L., Lin, C. S., Bollman, B. & Bestor, T. H. Dnmt3L and the establishment of maternal genomic imprints. Science 294, 2536-2539, (2001).
118 Webster, K. E. et al. Meiotic and epigenetic defects in Dnmt3L-knockout mouse spermatogenesis. Proc Natl Acad Sci U S A 102, 4068-4073, (2005).
119 Lister, R. et al. Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462, 315-322, (2009).
120 Swartz, M. N., Trautner, T. A. & Kornberg, A. Enzymatic synthesis of deoxyribonucleic acid. XI. Further studies on nearest neighbor base sequences in deoxyribonucleic acids. J Biol Chem 237, 1961-1967, (1962).
121 Russell, G. J., Walker, P. M., Elton, R. A. & Subak-Sharpe, J. H. Doublet frequency analysis of fractionated vertebrate nuclear DNA. J Mol Biol 108, 1-23, (1976).
122 Gardiner-Garden, M. & Frommer, M. CpG islands in vertebrate genomes. J Mol Biol 196, 261-282, (1987).
123 Takai, D. & Jones, P. A. Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc Natl Acad Sci U S A 99, 3740-3745, (2002).
124 Fatemi, M. et al. Footprinting of mammalian promoters: use of a CpG DNA methyltransferase revealing nucleosome positions at a single molecule level. Nucleic Acids Res 33, e176, (2005).
125 Cross, S. H. & Bird, A. P. CpG islands and genes. Curr Opin Genet Dev 5, 309-314, (1995).
126 Rozenberg, J. M. et al. All and only CpG containing sequences are enriched in promoters abundantly bound by RNA polymerase II in multiple tissues. BMC Genomics 9, 67, (2008).
127 Deng, G., Chen, A., Pong, E. & Kim, Y. S. Methylation in hMLH1 promoter interferes with its binding to transcription factor CBF and inhibits gene expression. Oncogene 20, 7120-7127, (2001).
128 Comb, M. & Goodman, H. M. CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nucleic Acids Res 18, 3975-3982, (1990).
129 Pang, R. T., Lee, L. T., Ng, S. S., Yung, W. H. & Chow, B. K. CpG methylation and transcription factors Sp1 and Sp3 regulate the expression of the human secretin receptor gene. Mol Endocrinol 18, 471-483, (2004).
130 Kim, J., Kollhoff, A., Bergmann, A. & Stubbs, L. Methylation-sensitive binding of transcription factor YY1 to an insulator sequence within the paternally expressed imprinted gene, Peg3. Hum Mol Genet 12, 233-245, (2003).
107
131 Bell, A. C. & Felsenfeld, G. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482-485, (2000).
132 Vostrov, A. A., Taheny, M. J. & Quitschke, W. W. A region to the N-terminal side of the CTCF zinc finger domain is essential for activating transcription from the amyloid precursor protein promoter. J Biol Chem 277, 1619-1627, (2002).
133 Burcin, M. et al. Negative protein 1, which is required for function of the chicken lysozyme gene silencer in conjunction with hormone receptors, is identical to the multivalent zinc finger repressor CTCF. Mol Cell Biol 17, 1281-1288, (1997).
134 Bell, A. C., West, A. G. & Felsenfeld, G. The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98, 387-396, (1999).
135 Filippova, G. N. et al. An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. Mol Cell Biol 16, 2802-2813, (1996).
136 Vostrov, A. A. & Quitschke, W. W. The zinc finger protein CTCF binds to the APBbeta domain of the amyloid beta-protein precursor promoter. Evidence for a role in transcriptional activation. J Biol Chem 272, 33353-33359, (1997).
137 Xie, X. et al. Systematic discovery of regulatory motifs in conserved regions of the human genome, including thousands of CTCF insulator sites. Proc Natl Acad Sci U S A 104, 7145-7150, (2007).
138 Kim, T. H. et al. Analysis of the vertebrate insulator protein CTCF-binding sites in the human genome. Cell 128, 1231-1245, (2007).
139 Baylin, S. B. & Herman, J. G. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 16, 168-174, (2000).
140 Baldwin, R. L. et al. BRCA1 promoter region hypermethylation in ovarian carcinoma: a population-based study. Cancer Res 60, 5329-5333, (2000).
141 Balch, C., Fang, F., Matei, D. E., Huang, T. H. & Nephew, K. P. Minireview: epigenetic changes in ovarian cancer. Endocrinology 150, 4003-4011, (2009).
142 Balch, C., Huang, T. H., Brown, R. & Nephew, K. P. The epigenetics of ovarian cancer drug resistance and resensitization. Am J Obstet Gynecol 191, 1552-1572, (2004).
143 Ibanez de Caceres, I. et al. Tumor cell-specific BRCA1 and RASSF1A hypermethylation in serum, plasma, and peritoneal fluid from ovarian cancer patients. Cancer Res 64, 6476-6481, (2004).
144 Sellar, G. C. et al. OPCML at 11q25 is epigenetically inactivated and has tumor-suppressor function in epithelial ovarian cancer. Nat Genet 34, 337-343, (2003).
108
145 Petrocca, F. et al. Alterations of the tumor suppressor gene ARLTS1 in ovarian cancer. Cancer Res 66, 10287-10291, (2006).
146 Yanaihara, N. et al. Reduced expression of MYO18B, a candidate tumor-suppressor gene on chromosome arm 22q, in ovarian cancer. Int J Cancer 112, 150-154, (2004).
147 Socha, M. J. et al. Aberrant promoter methylation of SPARC in ovarian cancer. Neoplasia 11, 126-135, (2009).
148 Kikuchi, R. et al. Promoter hypermethylation contributes to frequent inactivation of a putative conditional tumor suppressor gene connective tissue growth factor in ovarian cancer. Cancer Res 67, 7095-7105, (2007).
149 Kikuchi, R. et al. Frequent inactivation of a putative tumor suppressor, angiopoietin-like protein 2, in ovarian cancer. Cancer Res 68, 5067-5075, (2008).
150 Feng, W. et al. Imprinted tumor suppressor genes ARHI and PEG3 are the most frequently down-regulated in human ovarian cancers by loss of heterozygosity and promoter methylation. Cancer 112, 1489-1502, (2008).
151 Cvetkovic, D., Pisarcik, D., Lee, C., Hamilton, T. C. & Abdollahi, A. Altered expression and loss of heterozygosity of the LOT1 gene in ovarian cancer. Gynecol Oncol 95, 449-455, (2004).
152 Terasawa, K. et al. Epigenetic inactivation of TMS1/ASC in ovarian cancer. Clin Cancer Res 10, 2000-2006, (2004).
153 Pruitt, K. et al. Ras-mediated loss of the pro-apoptotic response protein Par-4 is mediated by DNA hypermethylation through Raf-independent and Raf-dependent signaling cascades in epithelial cells. J Biol Chem 280, 23363-23370, (2005).
154 Potapova, A., Hoffman, A. M., Godwin, A. K., Al-Saleem, T. & Cairns, P. Promoter hypermethylation of the PALB2 susceptibility gene in inherited and sporadic breast and ovarian cancer. Cancer Res 68, 998-1002, (2008).
155 Dobrovic, A. & Simpfendorfer, D. Methylation of the BRCA1 gene in sporadic breast cancer. Cancer Res 57, 3347-3350, (1997).
156 Esteller, M. et al. Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J Natl Cancer Inst 92, 564-569, (2000).
157 Niwa, Y., Oyama, T. & Nakajima, T. BRCA1 expression status in relation to DNA methylation of the BRCA1 promoter region in sporadic breast cancers. Jpn J Cancer Res 91, 519-526, (2000).
158 Rice, J. C., Ozcelik, H., Maxeiner, P., Andrulis, I. & Futscher, B. W. Methylation of the BRCA1 promoter is associated with decreased BRCA1 mRNA levels in clinical breast cancer specimens. Carcinogenesis 21, 1761-1765, (2000).
109
159 Magdinier, F. et al. Regional methylation of the 5' end CpG island of BRCA1 is associated with reduced gene expression in human somatic cells. FASEB J 14, 1585-1594, (2000).
160 Kane, M. F. et al. Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res 57, 808-811, (1997).
161 Veigl, M. L. et al. Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers. Proc Natl Acad Sci U S A 95, 8698-8702, (1998).
162 Arima, T., Drewell, R. A., Oshimura, M., Wake, N. & Surani, M. A. A novel imprinted gene, HYMAI, is located within an imprinted domain on human chromosome 6 containing ZAC. Genomics 67, 248-255, (2000).
163 Kou, Y. C. et al. A recurrent intragenic genomic duplication, other novel mutations in NLRP7 and imprinting defects in recurrent biparental hydatidiform moles. Mol Hum Reprod 14, 33-40, (2008).
164 Judson, H., Hayward, B. E., Sheridan, E. & Bonthron, D. T. A global disorder of imprinting in the human female germ line. Nature 416, 539-542, (2002).
165 Van den Veyver, I. B., Norman, B., Tran, C. Q., Bourjac, J. & Slim, R. The human homologue (PEG3) of the mouse paternally expressed gene 3 (Peg3) is maternally imprinted but not mutated in women with familial recurrent hydatidiform molar pregnancies. J Soc Gynecol Investig 8, 305-313, (2001).
166 El-Maarri, O. et al. Maternal alleles acquiring paternal methylation patterns in biparental complete hydatidiform moles. Hum Mol Genet 12, 1405-1413, (2003).
167 Jinno, Y. et al. Mouse/human sequence divergence in a region with a paternal-specific methylation imprint at the human H19 locus. Hum Mol Genet 5, 1155-1161, (1996).
168 Kerjean, A. et al. Establishment of the paternal methylation imprint of the human H19 and MEST/PEG1 genes during spermatogenesis. Hum Mol Genet 9, 2183-2187, (2000).
169 Geuns, E., Hilven, P., Van Steirteghem, A., Liebaers, I. & De Rycke, M. Methylation analysis of KvDMR1 in human oocytes. J Med Genet 44, 144-147, (2007).
170 Glenn, C. C. et al. Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene. Am J Hum Genet 58, 335-346, (1996).
171 El Hajj, N. et al. Methylation status of imprinted genes and repetitive elements in sperm DNA from infertile males. Sex Dev 5, 60-69, (2011).
172 Frevel, M. A., Sowerby, S. J., Petersen, G. B. & Reeve, A. E. Methylation sequencing analysis refines the region of H19 epimutation in Wilms tumor. J Biol Chem 274, 29331-29340, (1999).
110
173 Chen, S. L., Shi, X. Y., Zheng, H. Y., Wu, F. R. & Luo, C. Aberrant DNA methylation of imprinted H19 gene in human preimplantation embryos. Fertil Steril 94, 2356-2358, 2358 e2351, (2010).
174 Hamatani, T. et al. Epigenetic mark sequence of the H19 gene in human sperm. Biochim Biophys Acta 1518, 137-144, (2001).
175 Geuns, E. et al. Methylation analysis of the intergenic differentially methylated region of DLK1-GTL2 in human. Eur J Hum Genet 15, 352-361, (2007).
176 Miura, K. et al. Methylation imprinting of H19 and SNRPN genes in human benign ovarian teratomas. Am J Hum Genet 65, 1359-1367, (1999).
177 Sato, A., Otsu, E., Negishi, H., Utsunomiya, T. & Arima, T. Aberrant DNA methylation of imprinted loci in superovulated oocytes. Hum Reprod 22, 26-35, (2007).
178 Borghol, N., Lornage, J., Blachere, T., Sophie Garret, A. & Lefevre, A. Epigenetic status of the H19 locus in human oocytes following in vitro maturation. Genomics 87, 417-426, (2006).
179 Arima, T. & Wake, N. Establishment of the primary imprint of the HYMAI/PLAGL1 imprint control region during oogenesis. Cytogenet Genome Res 113, 247-252, (2006).
180 Grabowski, M. et al. The epsilon-sarcoglycan gene (SGCE), mutated in myoclonus-dystonia syndrome, is maternally imprinted. Eur J Hum Genet 11, 138-144, (2003).
181 Kagami, M. et al. Deletions and epimutations affecting the human 14q32.2 imprinted region in individuals with paternal and maternal upd(14)-like phenotypes. Nat Genet 40, 237-242, (2008).
182 Rosa, A. L. et al. Allele-specific methylation of a functional CTCF binding site upstream of MEG3 in the human imprinted domain of 14q32. Chromosome Res 13, 809-818, (2005).
183 Sutcliffe, J. S. et al. Deletions of a differentially methylated CpG island at the SNRPN gene define a putative imprinting control region. Nat Genet 8, 52-58, (1994).
184 Inoue, J. et al. Construction of 700 human/mouse A9 monochromosomal hybrids and analysis of imprinted genes on human chromosome 6. J Hum Genet 46, 137-145, (2001).
185 Sparago, A. et al. Microdeletions in the human H19 DMR result in loss of IGF2 imprinting and Beckwith-Wiedemann syndrome. Nat Genet 36, 958-960, (2004).
186 Sparago, A. et al. Mechanisms causing imprinting defects in familial Beckwith-Wiedemann syndrome with Wilms' tumour. Hum Mol Genet 16, 254-264, (2007).
187 Beuten, J. et al. Angelman syndrome in an inbred family. Hum Genet 97, 294-298, (1996).
111
188 Kamiya, M. et al. The cell cycle control gene ZAC/PLAGL1 is imprinted--a strong candidate gene for transient neonatal diabetes. Hum Mol Genet 9, 453-460, (2000).
189 Bastepe, M. et al. Positional dissociation between the genetic mutation responsible for pseudohypoparathyroidism type Ib and the associated methylation defect at exon A/B: evidence for a long-range regulatory element within the imprinted GNAS1 locus. Hum Mol Genet 10, 1231-1241, (2001).
190 Schneid, H. et al. Parental allele specific methylation of the human insulin-like growth factor II gene and Beckwith-Wiedemann syndrome. J Med Genet 30, 353-362, (1993).
191 Katrincsakova, B. et al. Methylation analysis of the imprinted DLK1-GTL2 domain supports the random parental origin of the IGH-involving del(14q) in B-cell malignancies. Epigenetics 4, 469-475, (2009).
192 Yamazawa, K. et al. Molecular and clinical findings and their correlations in Silver-Russell syndrome: implications for a positive role of IGF2 in growth determination and differential imprinting regulation of the IGF2-H19 domain in bodies and placentas. J Mol Med 86, 1171-1181, (2008).
193 Vu, T. H. et al. Symmetric and asymmetric DNA methylation in the human IGF2-H19 imprinted region. Genomics 64, 132-143, (2000).
194 Kawakami, T., Zhang, C., Okada, Y. & Okamoto, K. Erasure of methylation imprint at the promoter and CTCF-binding site upstream of H19 in human testicular germ cell tumors of adolescents indicate their fetal germ cell origin. Oncogene 25, 3225-3236, (2006).
195 Sandovici, I. et al. Familial aggregation of abnormal methylation of parental alleles at the IGF2/H19 and IGF2R differentially methylated regions. Hum Mol Genet 12, 1569-1578, (2003).
196 El-Maarri, O. et al. Gender specific differences in levels of DNA methylation at selected loci from human total blood: a tendency toward higher methylation levels in males. Hum Genet 122, 505-514, (2007).
197 Murrell, A. et al. Distinct methylation changes at the IGF2-H19 locus in congenital growth disorders and cancer. PLoS One 3, e1849, (2008).
198 El-Maarri, O. et al. Patients with familial biparental hydatidiform moles have normal methylation at imprinted genes. Eur J Hum Genet 13, 486-490, (2005).
199 Takai, D., Gonzales, F. A., Tsai, Y. C., Thayer, M. J. & Jones, P. A. Large scale mapping of methylcytosines in CTCF-binding sites in the human H19 promoter and aberrant hypomethylation in human bladder cancer. Hum Mol Genet 10, 2619-2626, (2001).
200 Wong, H. L. et al. Rapid and quantitative method of allele-specific DNA methylation analysis. Biotechniques 41, 734-739, (2006).
112
201 Nakagawa, H. et al. Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer. Proc Natl Acad Sci U S A 98, 591-596, (2001).
202 Ulaner, G. A. et al. Loss of imprinting of IGF2 and H19 in osteosarcoma is accompanied by reciprocal methylation changes of a CTCF-binding site. Hum Mol Genet 12, 535-549, (2003).
203 Cui, H. et al. Loss of imprinting of insulin-like growth factor-II in Wilms' tumor commonly involves altered methylation but not mutations of CTCF or its binding site. Cancer Res 61, 4947-4950, (2001).
204 Wu, J., Qin, Y., Li, B., He, W. Z. & Sun, Z. L. Hypomethylated and hypermethylated profiles of H19DMR are associated with the aberrant imprinting of IGF2 and H19 in human hepatocellular carcinoma. Genomics 91, 443-450, (2008).
205 Beatty, L., Weksberg, R. & Sadowski, P. D. Detailed analysis of the methylation patterns of the KvDMR1 imprinting control region of human chromosome 11. Genomics 87, 46-56, (2006).
206 Weksberg, R., Shuman, C. & Beckwith, J. B. Beckwith-Wiedemann syndrome. Eur J Hum Genet 18, 8-14, (2010).
207 Abu-Amero, S. et al. Epigenetic signatures of Silver-Russell syndrome. J Med Genet 47, 150-154, (2010).
208 Butler, M. G. Genomic imprinting disorders in humans: a mini-review. J Assist Reprod Genet 26, 477-486, (2009).
209 Glenn, C. C., Driscoll, D. J., Yang, T. P. & Nicholls, R. D. Genomic imprinting: potential function and mechanisms revealed by the Prader-Willi and Angelman syndromes. Mol Hum Reprod 3, 321-332, (1997).
210 Guo, L. et al. Altered gene expression and methylation of the human chromosome 11 imprinted region in small for gestational age (SGA) placentae. Dev Biol 320, 79-91, (2008).
211 Bartolomei, M. S., Webber, A. L., Brunkow, M. E. & Tilghman, S. M. Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev 7, 1663-1673, (1993).
212 Szabo, P., Tang, S. H., Rentsendorj, A., Pfeifer, G. P. & Mann, J. R. Maternal-specific footprints at putative CTCF sites in the H19 imprinting control region give evidence for insulator function. Curr Biol 10, 607-610, (2000).
213 Randhawa, G. S. et al. Loss of imprinting in disease progression in chronic myelogenous leukemia. Blood 91, 3144-3147, (1998).
113
214 Ogawa, O. et al. Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour. Nature 362, 749-751, (1993).
215 Steenman, M. J. et al. Loss of imprinting of IGF2 is linked to reduced expression and abnormal methylation of H19 in Wilms' tumour. Nat Genet 7, 433-439, (1994).
216 Wang, W. H., Duan, J. X., Vu, T. H. & Hoffman, A. R. Increased expression of the insulin-like growth factor-II gene in Wilms' tumor is not dependent on loss of genomic imprinting or loss of heterozygosity. J Biol Chem 271, 27863-27870, (1996).
217 Vu, T. H. & Hoffman, A. Alterations in the promoter-specific imprinting of the insulin-like growth factor-II gene in Wilms' tumor. J Biol Chem 271, 9014-9023, (1996).
218 Kinouchi, Y. et al. Relaxation of imprinting of the insulin-like growth factor II gene in colorectal cancer. Cancer Lett 107, 105-108, (1996).
219 Yun, K., Soejima, H., Merrie, A. E., McCall, J. L. & Reeve, A. E. Analysis of IGF2 gene imprinting in breast and colorectal cancer by allele specific-PCR. J Pathol 187, 518-522, (1999).
220 Takano, Y., Shiota, G. & Kawasaki, H. Analysis of genomic imprinting of insulin-like growth factor 2 in colorectal cancer. Oncology 59, 210-216, (2000).
221 Nonomura, N. et al. Loss of imprinting of the insulin-like growth factor II gene in renal cell carcinoma. Cancer Res 57, 2575-2577, (1997).
222 Oda, H., Kume, H., Shimizu, Y., Inoue, T. & Ishikawa, T. Loss of imprinting of igf2 in renal-cell carcinomas. Int J Cancer 75, 343-346, (1998).
223 Mori, M. et al. Relaxation of insulin-like growth factor 2 gene imprinting in esophageal cancer. Int J Cancer 68, 441-446, (1996).
224 Xu, W., Fan, H., He, X., Zhang, J. & Xie, W. LOI of IGF2 is associated with esophageal cancer and linked to methylation status of IGF2 DMR. J Exp Clin Cancer Res 25, 543-547, (2006).
225 Terdiman, J. P., Conrad, P. G. & Sleisenger, M. H. Genetic testing in hereditary colorectal cancer: indications and procedures. Am J Gastroenterol 94, 2344-2356, (1999).
226 Sun, M., Lughezzani, G., Perrotte, P. & Karakiewicz, P. I. Treatment of metastatic renal cell carcinoma. Nat Rev Urol 7, 327-338, (2010).
227 Cui, H. et al. Loss of imprinting in colorectal cancer linked to hypomethylation of H19 and IGF2. Cancer Res 62, 6442-6446, (2002).
228 Leighton, P. A., Ingram, R. S., Eggenschwiler, J., Efstratiadis, A. & Tilghman, S. M. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 375, 34-39, (1995).
114
229 Ravenel, J. D. et al. Loss of imprinting of insulin-like growth factor-II (IGF2) gene in distinguishing specific biologic subtypes of Wilms tumor. J Natl Cancer Inst 93, 1698-1703, (2001).
230 Sakatani, T. et al. Loss of imprinting of Igf2 alters intestinal maturation and tumorigenesis in mice. Science 307, 1976-1978, (2005).
231 Lin, S. P. et al. Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome 12. Nat Genet 35, 97-102, (2003).
232 Yu, Y. et al. NOEY2 (ARHI), an imprinted putative tumor suppressor gene in ovarian and breast carcinomas. Proc Natl Acad Sci U S A 96, 214-219, (1999).
233 Shi, Z. et al. [NOEY2 gene mRNA expression in breast cancer tissue and its relation to clinicopathological parameters]. Zhonghua Zhong Liu Za Zhi 24, 475-478, (2002).
234 Hisatomi, H., Nagao, K., Wakita, K. & Kohno, N. ARHI/NOEY2 inactivation may be important in breast tumor pathogenesis. Oncology 62, 136-140, (2002).
235 Feuer, E. J. et al. The lifetime risk of developing breast cancer. J Natl Cancer Inst 85, 892-897, (1993).
236 Pluta, R. M. & Golub, R. M. JAMA patient page. BRCA genes and breast cancer. JAMA 305, 2244, (2011).
237 Xu, F. et al. The human ARHI tumor suppressor gene inhibits lactation and growth in transgenic mice. Cancer Res 60, 4913-4920, (2000).
238 Qiu, J. Epigenetics: unfinished symphony. Nature 441, 143-145, (2006).
239 Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F. & Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260, (1997).
240 Richmond, T. J. & Davey, C. A. The structure of DNA in the nucleosome core. Nature 423, 145-150, (2003).
241 Strahl, B. D. & Allis, C. D. The language of covalent histone modifications. Nature 403, 41-45, (2000).
242 Kouzarides, T. Chromatin modifications and their function. Cell 128, 693-705, (2007).
243 Spivakov, M. & Fisher, A. G. Epigenetic signatures of stem-cell identity. Nat Rev Genet 8, 263-271, (2007).
244 Lyko, F., Beisel, C., Marhold, J. & Paro, R. Epigenetic regulation in Drosophila. Curr Top Microbiol Immunol 310, 23-44, (2006).
115
245 Ringrose, L. & Paro, R. Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu Rev Genet 38, 413-443, (2004).
246 Simon, J. A. & Kingston, R. E. Mechanisms of polycomb gene silencing: knowns and unknowns. Nat Rev Mol Cell Biol 10, 697-708, (2009).
247 Grant, P. A. & Berger, S. L. Histone acetyltransferase complexes. Semin Cell Dev Biol 10, 169-177, (1999).
248 Strahl, B. D., Ohba, R., Cook, R. G. & Allis, C. D. Methylation of histone H3 at lysine 4 is highly conserved and correlates with transcriptionally active nuclei in Tetrahymena. Proc Natl Acad Sci U S A 96, 14967-14972, (1999).
249 Nishioka, K. et al. PR-Set7 is a nucleosome-specific methyltransferase that modifies lysine 20 of histone H4 and is associated with silent chromatin. Mol Cell 9, 1201-1213, (2002).
250 Fang, J. Y. & Lu, Y. Y. Effects of histone acetylation and DNA methylation on p21( WAF1) regulation. World J Gastroenterol 8, 400-405, (2002).
251 Kapranov, P. et al. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316, 1484-1488, (2007).
252 Carninci, P. et al. The transcriptional landscape of the mammalian genome. Science 309, 1559-1563, (2005).
253 Feng, J. et al. The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator. Genes Dev 20, 1470-1484, (2006).
254 Martianov, I., Ramadass, A., Serra Barros, A., Chow, N. & Akoulitchev, A. Repression of the human dihydrofolate reductase gene by a non-coding interfering transcript. Nature 445, 666-670, (2007).
255 Beltran, M. et al. A natural antisense transcript regulates Zeb2/Sip1 gene expression during Snail1-induced epithelial-mesenchymal transition. Genes Dev 22, 756-769, (2008).
256 Centonze, D. et al. The brain cytoplasmic RNA BC1 regulates dopamine D2 receptor-mediated transmission in the striatum. J Neurosci 27, 8885-8892, (2007).
257 Sanchez-Elsner, T., Gou, D., Kremmer, E. & Sauer, F. Noncoding RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax. Science 311, 1118-1123, (2006).
258 Braidotti, G. et al. The Air noncoding RNA: an imprinted cis-silencing transcript. Cold Spring Harb Symp Quant Biol 69, 55-66, (2004).
116
259 Wutz, A. & Gribnau, J. X inactivation Xplained. Curr Opin Genet Dev 17, 387-393, (2007).
260 Ng, K., Pullirsch, D., Leeb, M. & Wutz, A. Xist and the order of silencing. EMBO Rep 8, 34-39, (2007).
261 Mitsuya, K. et al. LIT1, an imprinted antisense RNA in the human KvLQT1 locus identified by screening for differentially expressed transcripts using monochromosomal hybrids. Hum Mol Genet 8, 1209-1217, (1999).
262 Mancini-Dinardo, D., Steele, S. J., Levorse, J. M., Ingram, R. S. & Tilghman, S. M. Elongation of the Kcnq1ot1 transcript is required for genomic imprinting of neighboring genes. Genes Dev 20, 1268-1282, (2006).
263 Lund, E. & Dahlberg, J. E. Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs. Cold Spring Harb Symp Quant Biol 71, 59-66, (2006).
264 Rana, T. M. Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8, 23-36, (2007).
265 Friedman, R. C., Farh, K. K., Burge, C. B. & Bartel, D. P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 19, 92-105, (2009).
266 Brennecke, J., Hipfner, D. R., Stark, A., Russell, R. B. & Cohen, S. M. bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113, 25-36, (2003).
267 Chen, C. Z., Li, L., Lodish, H. F. & Bartel, D. P. MicroRNAs modulate hematopoietic lineage differentiation. Science 303, 83-86, (2004).
268 Lagos-Quintana, M. et al. Identification of tissue-specific microRNAs from mouse. Curr Biol 12, 735-739, (2002).
269 Lee, M. R., Kim, J. S. & Kim, K. S. miR-124a is Important for Migratory Cell Fate Transition During Gastrulation of Human Embryonic Stem Cells. Stem Cells, (2010).
270 Wiklund, E. D. et al. Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer. Int J Cancer, (2010).
271 Park, S. M., Gaur, A. B., Lengyel, E. & Peter, M. E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev 22, 894-907, (2008).
272 Korpal, M., Lee, E. S., Hu, G. & Kang, Y. The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem 283, 14910-14914, (2008).
273 Gregory, P. A. et al. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 10, 593-601, (2008).
117
274 Burk, U. et al. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep 9, 582-589, (2008).
275 Bracken, C. P. et al. A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res 68, 7846-7854, (2008).
276 Klose, R. J. & Bird, A. P. Genomic DNA methylation: the mark and its mediators. Trends Biochem Sci 31, 89-97, (2006).
277 Hutchins, A. S. et al. Gene silencing quantitatively controls the function of a developmental trans-activator. Mol Cell 10, 81-91, (2002).
278 Magdinier, F. & Wolffe, A. P. Selective association of the methyl-CpG binding protein MBD2 with the silent p14/p16 locus in human neoplasia. Proc Natl Acad Sci U S A 98, 4990-4995, (2001).
279 Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V. A. & Bird, A. Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development. Genes Dev 15, 710-723, (2001).
280 Kantor, B., Makedonski, K., Shemer, R. & Razin, A. Expression and localization of components of the histone deacetylases multiprotein repressory complexes in the mouse preimplantation embryo. Gene Expr Patterns 3, 697-702, (2003).
281 Nan, X. et al. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393, 386-389, (1998).
282 Jones, P. L. et al. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet 19, 187-191, (1998).
283 Hendrich, B. & Bickmore, W. Human diseases with underlying defects in chromatin structure and modification. Hum Mol Genet 10, 2233-2242, (2001).
284 Fuks, F. et al. The methyl-CpG-binding protein MeCP2 links DNA methylation to histone methylation. J Biol Chem 278, 4035-4040, (2003).
285 Laherty, C. D. et al. Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression. Cell 89, 349-356, (1997).
286 Nagy, L. et al. Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89, 373-380, (1997).
287 Heinzel, T. et al. A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387, 43-48, (1997).
288 Kim, J. et al. Tudor, MBT and chromo domains gauge the degree of lysine methylation. EMBO Rep 7, 397-403, (2006).
118
289 Fuks, F., Hurd, P. J., Deplus, R. & Kouzarides, T. The DNA methyltransferases associate with HP1 and the SUV39H1 histone methyltransferase. Nucleic Acids Res 31, 2305-2312, (2003).
290 Zhang, Y., Iratni, R., Erdjument-Bromage, H., Tempst, P. & Reinberg, D. Histone deacetylases and SAP18, a novel polypeptide, are components of a human Sin3 complex. Cell 89, 357-364, (1997).
291 McNamara, T. O., Gooding, C. A., Kaplan, S. L. & Clark, R. E. Exomphalos-macroglossia-gigantism (visceromegaly) syndrome. (The Beckwith-Wiedemann syndrome). Am J Roentgenol Radium Ther Nucl Med 114, 264-267, (1972).
292 Tan, T. Y. & Amor, D. J. Tumour surveillance in Beckwith-Wiedemann syndrome and hemihyperplasia: a critical review of the evidence and suggested guidelines for local practice. J Paediatr Child Health 42, 486-490, (2006).
293 Pettenati, M. J. et al. Wiedemann-Beckwith syndrome: presentation of clinical and cytogenetic data on 22 new cases and review of the literature. Hum Genet 74, 143-154, (1986).
294 Weng, E. Y., Mortier, G. R. & Graham, J. M., Jr. Beckwith-Wiedemann syndrome. An update and review for the primary pediatrician. Clin Pediatr (Phila) 34, 317-326, (1995).
295 Winter, S. C. et al. Prenatal diagnosis of the Beckwith-Wiedemann syndrome. Am J Med Genet 24, 137-141, (1986).
296 Greenwood, R. D., Somer, A., Rosenthal, A., Craenen, J. & Nadas, A. S. Cardiovascular abnormalities in the Beckwith-Wiedemann syndrome. Am J Dis Child 131, 293-294, (1977).
297 Tank, E. S. & Kay, R. Neoplasms associated with hemihypertophy, Beckwith-Wiedemann syndrome and aniridia. J Urol 124, 266-268, (1980).
298 Lapunzina, P. Risk of tumorigenesis in overgrowth syndromes: a comprehensive review. Am J Med Genet C Semin Med Genet 137C, 53-71, (2005).
299 Sasaki, K. et al. Japanese and North American/European patients with Beckwith-Wiedemann syndrome have different frequencies of some epigenetic and genetic alterations. Eur J Hum Genet 15, 1205-1210, (2007).
300 Gaston, V. et al. Analysis of the methylation status of the KCNQ1OT and H19 genes in leukocyte DNA for the diagnosis and prognosis of Beckwith-Wiedemann syndrome. Eur J Hum Genet 9, 409-418, (2001).
301 DeBaun, M. R. et al. Epigenetic alterations of H19 and LIT1 distinguish patients with Beckwith-Wiedemann syndrome with cancer and birth defects. Am J Hum Genet 70, 604-611, (2002).
119
302 Bliek, J. et al. Epigenotyping as a tool for the prediction of tumor risk and tumor type in patients with Beckwith-Wiedemann syndrome (BWS). J Pediatr 145, 796-799, (2004).
303 Abu-Amero, S. et al. The genetic aetiology of Silver-Russell syndrome. J Med Genet 45, 193-199, (2008).
304 Price, S. M., Stanhope, R., Garrett, C., Preece, M. A. & Trembath, R. C. The spectrum of Silver-Russell syndrome: a clinical and molecular genetic study and new diagnostic criteria. J Med Genet 36, 837-842, (1999).
305 Moore, G. E. et al. The search for the gene for Silver-Russell syndrome. Acta Paediatr Suppl 88, 42-48, (1999).
306 Stanhope, R., Albanese, A. & Azcona, C. Growth hormone treatment of Russell-Silver syndrome. Horm Res 49 Suppl 2, 37-40, (1998).
307 Gicquel, C. et al. Epimutation of the telomeric imprinting center region on chromosome 11p15 in Silver-Russell syndrome. Nat Genet 37, 1003-1007, (2005).
308 Bliek, J. et al. Hypomethylation of the H19 gene causes not only Silver-Russell syndrome (SRS) but also isolated asymmetry or an SRS-like phenotype. Am J Hum Genet 78, 604-614, (2006).
309 Eggermann, T. et al. Epigenetic mutations in 11p15 in Silver-Russell syndrome are restricted to the telomeric imprinting domain. J Med Genet 43, 615-616, (2006).
310 Netchine, I. et al. 11p15 imprinting center region 1 loss of methylation is a common and specific cause of typical Russell-Silver syndrome: clinical scoring system and epigenetic-phenotypic correlations. J Clin Endocrinol Metab 92, 3148-3154, (2007).
311 Schonherr, N., Meyer, E., Binder, G., Wollmann, H. A. & Eggermann, T. No evidence for additional imprinting defects in Silver-Russell syndrome patients with maternal uniparental disomy 7 or 11p15 epimutation. J Pediatr Endocrinol Metab 20, 1329-1331, (2007).
312 Schonherr, N. et al. The centromeric 11p15 imprinting centre is also involved in Silver-Russell syndrome. J Med Genet 44, 59-63, (2007).
313 Zeschnigk, M. et al. IGF2/H19 hypomethylation in Silver-Russell syndrome and isolated hemihypoplasia. Eur J Hum Genet 16, 328-334, (2008).
314 Bartholdi, D. et al. Epigenetic mutations of the imprinted IGF2-H19 domain in Silver-Russell syndrome (SRS): results from a large cohort of patients with SRS and SRS-like phenotypes. J Med Genet 46, 192-197, (2009).
315 Bruce, S., Hannula-Jouppi, K., Peltonen, J., Kere, J. & Lipsanen-Nyman, M. Clinically distinct epigenetic subgroups in Silver-Russell syndrome: the degree of H19 hypomethylation associates with phenotype severity and genital and skeletal anomalies. J Clin Endocrinol Metab 94, 579-587, (2009).
120
316 Eggermann, T. et al. Broad clinical spectrum in Silver-Russell syndrome and consequences for genetic testing in growth retardation. Pediatrics 123, e929-931, (2009).
317 Butler, M. G. Prader-Willi syndrome: current understanding of cause and diagnosis. Am J Med Genet 35, 319-332, (1990).
318 Cassidy, S. B. & Driscoll, D. J. Prader-Willi syndrome. Eur J Hum Genet 17, 3-13, (2009).
319 Bittel, D. C. & Butler, M. G. Prader-Willi syndrome: clinical genetics, cytogenetics and molecular biology. Expert Rev Mol Med 7, 1-20, (2005).
320 Robinson, W. P. et al. Molecular, cytogenetic, and clinical investigations of Prader-Willi syndrome patients. Am J Hum Genet 49, 1219-1234, (1991).
321 Mascari, M. J. et al. The frequency of uniparental disomy in Prader-Willi syndrome. Implications for molecular diagnosis. N Engl J Med 326, 1599-1607, (1992).
322 Goldstone, A. P. Prader-Willi syndrome: advances in genetics, pathophysiology and treatment. Trends Endocrinol Metab 15, 12-20, (2004).
323 Clayton-Smith, J. & Laan, L. Angelman syndrome: a review of the clinical and genetic aspects. J Med Genet 40, 87-95, (2003).
324 Van Buggenhout, G. & Fryns, J. P. Angelman syndrome (AS, MIM 105830). Eur J Hum Genet 17, 1367-1373, (2009).
325 Williams, C. A. et al. Angelman syndrome 2005: updated consensus for diagnostic criteria. Am J Med Genet A 140, 413-418, (2006).
326 Clayton-Smith, J. & Pembrey, M. E. Angelman syndrome. J Med Genet 29, 412-415, (1992).
327 Steffenburg, S., Gillberg, C. L., Steffenburg, U. & Kyllerman, M. Autism in Angelman syndrome: a population-based study. Pediatr Neurol 14, 131-136, (1996).
328 Petersen, M. B., Brondum-Nielsen, K., Hansen, L. K. & Wulff, K. Clinical, cytogenetic, and molecular diagnosis of Angelman syndrome: estimated prevalence rate in a Danish county. Am J Med Genet 60, 261-262, (1995).
329 Driscoll, D. J. et al. A DNA methylation imprint, determined by the sex of the parent, distinguishes the Angelman and Prader-Willi syndromes. Genomics 13, 917-924, (1992).
330 Knoll, J. H. et al. Angelman syndrome: three molecular classes identified with chromosome 15q11q13-specific DNA markers. Am J Hum Genet 47, 149-154, (1990).
331 Magenis, R. E. et al. Comparison of the 15q deletions in Prader-Willi and Angelman syndromes: specific regions, extent of deletions, parental origin, and clinical consequences. Am J Med Genet 35, 333-349, (1990).
121
332 Chan, C. T. et al. Molecular mechanisms in Angelman syndrome: a survey of 93 patients. J Med Genet 30, 895-902, (1993).
333 Zackowski, J. L. et al. Cytogenetic and molecular analysis in Angelman syndrome. Am J Med Genet 46, 7-11, (1993).
334 Saitoh, S. et al. Minimal definition of the imprinting center and fixation of chromosome 15q11-q13 epigenotype by imprinting mutations. Proc Natl Acad Sci U S A 93, 7811-7815, (1996).
335 Strichman-Almashanu, L. Z. et al. A genome-wide screen for normally methylated human CpG islands that can identify novel imprinted genes. Genome Res 12, 543-554, (2002).
336 Luedi, P. P. et al. Computational and experimental identification of novel human imprinted genes. Genome Res 17, 1723-1730, (2007).
337 Pollard, K. S. et al. A genome-wide approach to identifying novel-imprinted genes. Hum Genet 122, 625-634, (2008).
338 Maynard, N. D., Chen, J., Stuart, R. K., Fan, J. B. & Ren, B. Genome-wide mapping of allele-specific protein-DNA interactions in human cells. Nat Methods 5, 307-309, (2008).
339 Sharp, A. J. et al. Methylation profiling in individuals with uniparental disomy identifies novel differentially methylated regions on chromosome 15. Genome Res 20, 1271-1278, (2010).
340 Nakabayashi, K. et al. Methylation screening of reciprocal genome-wide UPDs identifies novel human-specific imprinted genes. Hum Mol Genet 20, 3188-3197, (2011).
341 Yuen, R. K., Jiang, R., Penaherrera, M. S., McFadden, D. E. & Robinson, W. P. Genome-wide mapping of imprinted differentially methylated regions by DNA methylation profiling of human placentas from triploidies. Epigenetics Chromatin 4, 10, (2011).
342 Valleley, E. M., Cordery, S. F., Carr, I. M., MacLennan, K. A. & Bonthron, D. T. Loss of expression of ZAC/PLAGL1 in diffuse large B-cell lymphoma is independent of promoter hypermethylation. Genes Chromosomes Cancer 49, 480-486, (2010).
343 Li, T. et al. An imprinted PEG1/MEST antisense expressed predominantly in human testis and in mature spermatozoa. J Biol Chem 277, 13518-13527, (2002).
344 Murrell, A. et al. An association between variants in the IGF2 gene and Beckwith-Wiedemann syndrome: interaction between genotype and epigenotype. Hum Mol Genet 13, 247-255, (2004).
345 Vu, T. H., Li, T. & Hoffman, A. R. Promoter-restricted histone code, not the differentially methylated DNA regions or antisense transcripts, marks the imprinting status of IGF2R in human and mouse. Hum Mol Genet 13, 2233-2245, (2004).
122
346 Li, J. et al. Imprinting of the human L3MBTL gene, a polycomb family member located in a region of chromosome 20 deleted in human myeloid malignancies. Proc Natl Acad Sci U S A 101, 7341-7346, (2004).
347 Luedi, P. P., Hartemink, A. J. & Jirtle, R. L. Genome-wide prediction of imprinted murine genes. Genome Res 15, 875-884, (2005).
348 Serre, D. et al. Differential allelic expression in the human genome: a robust approach to identify genetic and epigenetic cis-acting mechanisms regulating gene expression. PLoS Genet 4, e1000006, (2008).
349 Palacios, R. et al. Allele-specific gene expression is widespread across the genome and biological processes. PLoS One 4, e4150, (2009).
350 Morcos, L. et al. Genome-wide assessment of imprinted expression in human cells. Genome Biol 12, R25, (2011).
351 Vidal, D. O. et al. Analysis of allelic differential expression in the human genome using allele-specific serial analysis of gene expression tags. Genome 54, 120-127, (2011).
352 Dimas, A. S. et al. Modifier effects between regulatory and protein-coding variation. PLoS Genet 4, e1000244, (2008).
353 Daelemans, C. et al. High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta. BMC Genet 11, 25, (2010).
354 Wang, X., Soloway, P. D. & Clark, A. G. A Survey for Novel Imprinted Genes in the Mouse Placenta by mRNA-seq. Genetics 189, 109-122, (2011).
355 Buiting, K. et al. Inherited microdeletions in the Angelman and Prader-Willi syndromes define an imprinting centre on human chromosome 15. Nat Genet 9, 395-400, (1995).
356 Dittrich, B. et al. Molecular diagnosis of the Prader-Willi and Angelman syndromes by detection of parent-of-origin specific DNA methylation in 15q11-13. Hum Genet 90, 313-315, (1992).
357 Zhang, A. et al. Novel retrotransposed imprinted locus identified at human 6p25. Nucleic Acids Res 39, 5388-5400, (2011).
358 Weksberg, R. et al. A method for accurate detection of genomic microdeletions using real-time quantitative PCR. BMC Genomics 6, 180, (2005).
359 Choufani, S. et al. A novel approach identifies new differentially methylated regions (DMRs) associated with imprinted genes. Genome Res 21, 465-476, (2011).
360 Clark, S. J., Statham, A., Stirzaker, C., Molloy, P. L. & Frommer, M. DNA methylation: bisulphite modification and analysis. Nat Protoc 1, 2353-2364, (2006).
123
361 Shapiro, R., Braverman, B., Louis, J. B. & Servis, R. E. Nucleic acid reactivity and conformation. II. Reaction of cytosine and uracil with sodium bisulfite. J Biol Chem 248, 4060-4064, (1973).
362 Hayatsu, H., Wataya, Y. & Kazushige, K. The addition of sodium bisulfite to uracil and to cytosine. J Am Chem Soc 92, 724-726, (1970).
363 Hart, A. Mann-Whitney test is not just a test of medians: differences in spread can be important. BMJ 323, 391-393, (2001).
364 Storey, J. D. & Tibshirani, R. Statistical significance for genomewide studies. Proc Natl Acad Sci U S A 100, 9440-9445, (2003).
365 Bliek, J. et al. Hypomethylation at multiple maternally methylated imprinted regions including PLAGL1 and GNAS loci in Beckwith-Wiedemann syndrome. Eur J Hum Genet 17, 611-619, (2009).
366 Dasoula, A., Georgiou, I., Kontogianni, E., Sofikitis, N. & Syrrou, M. Methylation status of the SNRPN and HUMARA genes in testicular biopsy samples. Fertil Steril 87, 805-809, (2007).
367 Green, J. et al. Overexpression of the Axl tyrosine kinase receptor in cutaneous SCC-derived cell lines and tumours. Br J Cancer 94, 1446-1451, (2006).
368 Shieh, Y. S. et al. Expression of axl in lung adenocarcinoma and correlation with tumor progression. Neoplasia 7, 1058-1064, (2005).
369 Sainaghi, P. P. et al. Gas6 induces proliferation in prostate carcinoma cell lines expressing the Axl receptor. J Cell Physiol 204, 36-44, (2005).
370 Meric, F. et al. Expression profile of tyrosine kinases in breast cancer. Clin Cancer Res 8, 361-367, (2002).
371 Wu, C. W. et al. Clinical significance of AXL kinase family in gastric cancer. Anticancer Res 22, 1071-1078, (2002).
372 Dupont, J. M., Tost, J., Jammes, H. & Gut, I. G. De novo quantitative bisulfite sequencing using the pyrosequencing technology. Anal Biochem 333, 119-127, (2004).
373 Frommer, M. et al. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 89, 1827-1831, (1992).
374 Clark, S. J., Harrison, J., Paul, C. L. & Frommer, M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res 22, 2990-2997, (1994).
375 Pinto, D., Marshall, C., Feuk, L. & Scherer, S. W. Copy-number variation in control population cohorts. Hum Mol Genet 16 Spec No. 2, R168-173, (2007).
124
376 Liu, J. H. et al. Diploid parthenogenetic embryos adopt a maternal-type methylation pattern on both sets of maternal chromosomes. Genomics 91, 121-128, (2008).
377 Zhang, Y. et al. Imprinting of human H19: allele-specific CpG methylation, loss of the active allele in Wilms tumor, and potential for somatic allele switching. Am J Hum Genet 53, 113-124, (1993).
378 Wood, A. J. et al. A screen for retrotransposed imprinted genes reveals an association between X chromosome homology and maternal germ-line methylation. PLoS Genet 3, e20, (2007).
379 Pant, P. V. et al. Analysis of allelic differential expression in human white blood cells. Genome Res 16, 331-339, (2006).
380 Rakyan, V. K. et al. An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs). Genome Res 18, 1518-1529, (2008).
381 Schneider, E. et al. Spatial, temporal and interindividual epigenetic variation of functionally important DNA methylation patterns. Nucleic Acids Res 38, 3880-3890, (2010).
382 Mayall, B. H. Deoxyribonucleic acid cytophotometry of stained human leukocytes. I. Differences among cell types. J Histochem Cytochem 17, 249-257, (1969).
383 Contractor, S. F., Routledge, A. & Sooranna, S. R. Identification and estimation of cell types in mixed primary cell cultures of early and term human placenta. Placenta 5, 41-53, (1984).
384 Jones, C. J. & Fox, H. Ultrastructure of the normal human placenta. Electron Microsc Rev 4, 129-178, (1991).
385 Novakovic, B. et al. DNA methylation-mediated down-regulation of DNA methyltransferase-1 (DNMT1) is coincident with, but not essential for, global hypomethylation in human placenta. J Biol Chem 285, 9583-9593, (2010).
386 Weaver, J. R. et al. Domain-specific response of imprinted genes to reduced DNMT1. Mol Cell Biol 30, 3916-3928, (2010).
387 Mohammad, F., Mondal, T., Guseva, N., Pandey, G. K. & Kanduri, C. Kcnq1ot1 noncoding RNA mediates transcriptional gene silencing by interacting with Dnmt1. Development 137, 2493-2499, (2010).
388 Aguirre-Arteta, A. M., Grunewald, I., Cardoso, M. C. & Leonhardt, H. Expression of an alternative Dnmt1 isoform during muscle differentiation. Cell Growth Differ 11, 551-559, (2000).
389 Li, X. et al. A maternal-zygotic effect gene, Zfp57, maintains both maternal and paternal imprints. Dev Cell 15, 547-557, (2008).
125
390 Biniszkiewicz, D. et al. Dnmt1 overexpression causes genomic hypermethylation, loss of imprinting, and embryonic lethality. Mol Cell Biol 22, 2124-2135, (2002).
391 Hu, Y. G. et al. Regulation of DNA methylation activity through Dnmt3L promoter methylation by Dnmt3 enzymes in embryonic development. Hum Mol Genet 17, 2654-2664, (2008).
392 Ninomiya, Y. et al. Genomic organization and isoforms of the mouse ELP gene. J Biochem 118, 380-389, (1995).
393 Iqbal, K., Jin, S. G., Pfeifer, G. P. & Szabo, P. E. Reprogramming of the paternal genome upon fertilization involves genome-wide oxidation of 5-methylcytosine. Proc Natl Acad Sci U S A 108, 3642-3647, (2011).
394 Olesen, C. et al. Identification of human candidate genes for male infertility by digital differential display. Mol Hum Reprod 7, 11-20, (2001).
395 Ito, S. et al. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature 466, 1129-1133, (2010).
396 Weber, M. et al. Extensive tissue-specific variation of allelic methylation in the Igf2 gene during mouse fetal development: relation to expression and imprinting. Mech Dev 101, 133-141, (2001).
397 Reik, W. et al. Allelic methylation of H19 and IGF2 in the Beckwith-Wiedemann syndrome. Hum Mol Genet 3, 1297-1301, (1994).
398 Murphy, S. K. et al. Epigenetic detection of human chromosome 14 uniparental disomy. Hum Mutat 22, 92-97, (2003).
399 Harris, R. A. et al. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications. Nat Biotechnol 28, 1097-1105, (2010).
400 Valleley, E. M., Cordery, S. F. & Bonthron, D. T. Tissue-specific imprinting of the ZAC/PLAGL1 tumour suppressor gene results from variable utilization of monoallelic and biallelic promoters. Hum Mol Genet 16, 972-981, (2007).
401 Weksberg, R. et al. Tumor development in the Beckwith-Wiedemann syndrome is associated with a variety of constitutional molecular 11p15 alterations including imprinting defects of KCNQ1OT1. Hum Mol Genet 10, 2989-3000, (2001).
402 Riesewijk, A. M. et al. Maternal-specific methylation of the human IGF2R gene is not accompanied by allele-specific transcription. Genomics 31, 158-166, (1996).
403 Noguer-Dance, M. et al. The primate-specific microRNA gene cluster (C19MC) is imprinted in the placenta. Hum Mol Genet 19, 3566-3582, (2010).
126
404 Smith, R. J., Dean, W., Konfortova, G. & Kelsey, G. Identification of novel imprinted genes in a genome-wide screen for maternal methylation. Genome Res 13, 558-569, (2003).
405 Giannoukakis, N., Deal, C., Paquette, J., Kukuvitis, A. & Polychronakos, C. Polymorphic functional imprinting of the human IGF2 gene among individuals, in blood cells, is associated with H19 expression. Biochem Biophys Res Commun 220, 1014-1019, (1996).
406 Monk, D. et al. Limited evolutionary conservation of imprinting in the human placenta. Proc Natl Acad Sci U S A 103, 6623-6628, (2006).
127
128
Appendices
129
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 1 of 11)
Findings of journal articles that assessed cytosine methylation within known parent-of-origin-specific DMRs.
Approximately 50% allele-specific DNA methylation indicates one of the two alleles is methylated and the other allele is
unmethylated. The gene(s) associated with each analyzed region is indicated in brackets.
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Androgenetic complete hydatidiform mole (AnCHM)
(PLAGL1)
chr6:144370175-144370176;
(PLAGL1)
chr6:144370822-144370831;
(PLAGL1)
chr6:144370994-144370995;
(PLAGL1)
chr6:144371007-144371013;
(KCNQ1OT1)
chr11:2677698-2678017;
(SNRPN)
chr15:22751097-22751347;
(PEG3)
chr19:62041857-62041864;
(PEG3)
chr19: 62043569-62043955;
(GNAS)
chr20:56862420-56862758;
(GNAS)
chr20:56898168-56898323
~0% Arima et al. (2000)162; Kou et al. (2008)163; Judson et al. (2002)164; Van den Veyver et al. (2001)165
Androgenetic complete hydatidiform mole (AnCHM)
(H19)
chr11:1977679-1978931;
(GNAS)
chr20:56848531-56848821
~100% El-Maarri et al. (2003)166; Kou et al. (2008)163; Jinno et al. (1996)167; Judson et al. (2002)164
130
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 2 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Sperm (PLAGL1)
chr6:144370175-144370176;
(PLAGL1)
chr6:144370822-144370831;
(PLAGL1)
chr6:144370994-144370995;
(PLAGL1)
chr6:144371007-144371013;
(MEST)
chr7:129919324-129919502;
(KCNQ1OT1)
chr11:2677095-2677190;
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22752107-22752114;
(PEG3)
chr19:62043777-62043837
~0% Arima et al. (2000)162; Kerjean et al. (2000)168; Geuns et al. (2007)169; Glenn et al. (1996)170; El Hajj et al. (2011)171
Sperm (H19)
chr11:1977470-1978931;
(H19)
chr11:1980073-1980074;
(DLK1/MEG3)
chr14:100346971-100347214
~100% Frevel et al. (1999)172; Jinno et al. (1996)167; Chen et al. (2010)173; Hamatani et al. (2001)174; Kerjean et al. (2000)168; Geuns et al. (2007)175
131
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 3 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Mature cystic ovarian teratoma (MCT) (H19)
chr11:1975666-1976289
~25% Miura et al. (1999)176
Mature cystic ovarian teratoma (MCT) (SNRPN)
chr15:22752107-22752114
~75% Miura et al. (1999)176
Oocytes (H19)
chr11:1977679-1977938;
(DLK1/MEG3)
chr14:100346971-100347214
~0% Sato et al. (2007)177; Borghol et al. (2006)178; Chen et al. (2010)173; Geuns et al. (2007)175
Oocytes (PLAGL1)
chr6:144370924-144371025;
(PLAGL1)
chr6:144371287-144371496;
(MEST)
chr7:129919324-129919502;
(KCNQ1OT1)
chr11:2677095-2677190;
(KCNQ1OT1)
chr11:2678186-2678318
~100% Sato et al. (2007)177; Arima et al. (2006)179; Geuns et al. (2007)169
132
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 4 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Peripheral blood leukocytes (PBLs) with maternal uniparental disomy for chromosome 7 (mUPD7)
(GRB10)
chr7:50817553-50818298;
(MEST)
chr7:129918720-129919874
~100% Arnaud et al. (2003)21; Riesewijk et al. (1997)24
Peripheral blood leukocytes (PBLs) with paternal uniparental disomy for chromosome 7 (pUPD7)
(GRB10)
chr7:50817553-50818298;
(MEST)
chr7:129918720-129919874
~0% Arnaud et al. (2003)21; Riesewijk et al. (1997)24
Lymphoblastoid cell line (LCL) with maternal uniparental disomy for chromosome 7 (mUPD7)
(PEG10)
chr7:94124144-94124463
~100% Grabowski et al. (2003)180
Lymphoblastoid cell line (LCL) with paternal uniparental disomy for chromosome 7 (pUPD7)
(PEG10)
chr7:94124144-94124463
~0% Grabowski et al. (2003)180
Peripheral blood leukocytes (PBLs) with paternal uniparental disomy for chromosome 14 (pUPD14)
(DLK1/MEG3)
chr14:100345458-100345644;
(DLK1/MEG3)
chr14:100346971-100347328;
(MEG3)
chr14:100361297-100361356;
(MEG3)
chr14:100361746-100361908;
(MEG3)
chr14:100361948-100362060
~100% Kagami et al. (2008)181; Kagami et al. (2010)16; Rosa et al. (2005)182
133
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 5 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Peripheral blood leukocytes (PBLs) with maternal uniparental disomy for chromosome 14 (mUPD14)
(DLK1/MEG3)
chr14:100345458-100345644;
(DLK1/MEG3)
chr14:100346971-100347328;
(MEG3)
chr14:100361297-100361356;
(MEG3)
chr14:100361746-100361908;
(MEG3)
chr14:100361948-100362060
~0% Kagami et al. (2008)181; Kagami et al. (2010)16; Rosa et al. (2005)182
Lymphoblastoid cell line (LCL) with maternal uniparental disomy for chromosome 15 (mUPD15); Peripheral blood leukocytes (PBLs) with maternal uniparental disomy for chromosome 15 (mUPD15); Skin fibroblasts with maternal uniparental disomy for chromosome 15 (mUPD15)
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22752107-22752114
~100% Glenn et al. (1996)170; Sutcliffe et al. (1994)183
Lymphoblastoid cell line (LCL) with paternal uniparental disomy for chromosome 15 (pUPD15); Peripheral blood leukocytes (PBLs) with paternal uniparental disomy for chromosome 15 (pUPD15); Skin fibroblasts with paternal uniparental disomy for chromosome 15 (pUPD15)
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22752107-22752114
~0% Glenn et al. (1996)170; Sutcliffe et al. (1994)183
134
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 6 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
A9-Maternal chromosome 1 hybrid cells (maternal chromosome 1 from a donor normal breast epithelial cell)
(DIRAS3)
chr1:68285451-68285454;
(DIRAS3)
chr1:68288917-68288920;
(DIRAS3)
chr1:68289869-68289870
~100% Yuan et al. (2003)18
A9-Paternal chromosome 1 hybrid cells (paternal chromosome 1 from a donor normal breast epithelial cell)
(DIRAS3)
chr1:68285451-68285454;
(DIRAS3)
chr1:68288917-68288920;
(DIRAS3)
chr1:68289869-68289870
~0% Yuan et al. (2003)18
A9-Maternal chromosome 6 hybrid cells (maternal chromosome 6 from a donor fibroblast)
(PLAGL1)
chr6:144370822-144370831
~100% Inoue et al. (2001)184
A9-Paternal chromosome 6 hybrid cells (paternal chromosome 6 from a donor fibroblast)
(PLAGL1)
chr6:144370822-144370831
~0% Inoue et al. (2001)184
135
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 7 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Peripheral blood leukocytes (PBLs) with maternal deletion of analyzed region
(H19)
chr11:1978491-1978641;
(H19)
chr11:1979961-1980074;
(H19)
chr11:1980325-1980584
~100% Sparago et al. (2004)185; Sparago et al. (2007)186
Peripheral blood leukocytes (PBLs) with paternal deletion of analyzed region
(H19)
chr11:1978491-1978641;
(H19)
chr11:1979961-1980074;
(H19)
chr11:1980325-1980584
~0% Sparago et al. (2004)185; Sparago et al. (2007)186
Peripheral blood leukocytes (PBLs) with paternal deletion of analyzed region
(SNRPN)
chr15:22751170-22751173;
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22751544-22751547;
(SNRPN)
chr15:22752107-22752114
~100% Glenn et al. (1996)170; Beuten et al. (1996)187
Peripheral blood leukocytes (PBLs) with maternal deletion of analyzed region
(SNRPN)
chr15:22751170-22751173;
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22751544-22751547;
(SNRPN)
chr15:22752107-22752114
~0% Glenn et al. (1996)170; Beuten et al. (1996)187
136
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 8 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Skin fibroblasts with paternal deletion of analyzed region; Lymphoblastoid cell line (LCL) with paternal deletion of analyzed region
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22752107-22752114
~100% Glenn et al. (1996)170
Skin fibroblasts with maternal deletion of analyzed region; Lymphoblastoid cell line (LCL) with maternal deletion of analyzed region
(SNRPN)
chr15:22751238-22751243;
(SNRPN)
chr15:22752107-22752114
~0% Glenn et al. (1996)170
137
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 9 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Placenta (PLAGL1)
chr6:144370822-144370831;
(PLAGL1)
chr6:144371249-144371258
~50% (maternal allele methylated, paternal allele unmethylated)
Kamiya et al. (2000)188
Peripheral blood leukocytes (PBLs) (PEG10)
chr7:94124144-94124463;
(GNAS)
chr20:56897673-56897967;
(GNAS)
chr20:56898486-56898507
~50% (maternal allele methylated, paternal allele unmethylated)
Grabowski et al. (2003)180; Liu et al. (2000)28; Bastepe et al. (2001)189
Peripheral blood leukocytes (PBLs) (H19)
chr11:1977679-1977842;
(IGF2)
chr11:2110766-2110924;
(DLK1/MEG3)
chr14:100345458-100345644;
(DLK1/MEG3)
chr14:100346971-100347328
~50% (paternal allele methylated, maternal allele unmethylated)
El-Maarri et al. (2003)166; Schneid et al. (1993)190; Kagami et al. (2008)181; Katrincsakova et al. (2009)191
138
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 10 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Brain (PEG10)
chr7:94124144-94124463;
(H19)
chr11:1978150-1978239
~50% (allele-specific) Grabowski et al. (2003)180; Hamatani et al. (2001)174
Peripheral blood leukocytes (PBLs) (H19)
chr11:1976063-1976337;
(H19)
cht11:1977470-1977938;
(IGF2)
chr11:2125947-2126095;
(PEG3)
chr19:62043569-62043955;
(GNAS)
chr20:56848498-56848821
~50% (allele-specific) Yamazawa et al. (2008)192; Vu et al. (2000)193; Kawakami et al. (2006)194; Sandovici et al. (2003)195; El-Maarri et al. (2007)196; Murrell et al. (2008)197; El-Maarri et al. (2005)198
Placenta (H19)
chr11:1976063-1976203
~50% (allele-specific) Yamazawa et al. (2008)192
Fetal brain (H19)
chr11:1976124-1976289;
(H19)
chr11:1977607-1977751
~50% (allele-specific) Vu et al. (2000)193
Embryonic ureteral tissue (H19)
chr11:1977470-1977888
~50% (allele-specific) Takai et al. (2001)199
Bladder (H19)
chr11:1977470-1977888
~50% (allele-specific) Takai et al. (2001)199; Wong et al. (2006)200
Kidney (H19)
chr11:1977470-1977888;
(H19)
chr11:1978150-1978239
~50% (allele-specific) Frevel et al. (1999)172; Hamatani et al. (2001)174
139
Table A-1: DNA Methylation in Known Parent-of-Origin-Specific DMRs (Part 11 of 11)
Sample(s) Genomic location of analyzed region (Chromosome:Mapinfo NCBI Build 36)
DNA methylation Author(s) of journal article(s) and publication year(s)
Colorectal tumours with retention of imprinting (ROI) of IGF2
(H19)
chr11:1977551-1977842
~50% (allele-specific) Nakagawa et al. (2001)201
Osteosarcoma tumours with retention of imprinting of IGF2
(H19)
chr11:1977587-1977938
~50% (allele-specific) Ulaner et al. (2003)202
Fetal kidney (H19)
chr11:1977607-1977751;
(H19)
chr11:1977778-1977842
~50% (allele-specific) Vu et al. (2000)193; Cui et al. (2001)203
Liver (H19)
chr11:1977626-1977888
~50% (allele-specific) Wu et al. (2008)204
Lymphoblastoid cell line (LCL) (KCNQ1OT1)
chr11:2677843-2678153
~50% (allele-specific) Beatty et al. (2006)205
140
Table A-2: Description of Blood Samples
Each row contains the sample ID, the age (in year(s) after birth (rounded down to nearest
integer)) and sex of the individual the blood sample was collected from.
Sample ID Sex (male/female) Age (year(s))
WBC1 Male 26
WBC2 Male 35
WBC3 Male 12
WBC4 Male 3
WBC5 Male 19
WBC6 Male 7
WBC7 Male 13
WBC8 Male 4
WBC9 Female 33
WBC10 Female 28
WBC11 Female 2
WBC12 Female 21
WBC13 Female 8
WBC14 Female 13
WBC15 Female 4
WBC16 Female 12
WBC17 Female 1
WBC18 Female 16
WBC19 Female 10
WBC20 Female 3
141
Table A-3: Description of Placenta Samples
Each row contains the sample ID, the age (approximate number of weeks gestation) and sex of
the conceptus the placenta sample was collected from.
Sample ID Sex (male/female) Age (~weeks gestation)
Placenta1 Male 37
Placenta2 Male 39
Placenta3 Female 39
Placenta4 Female 26
Placenta5 Female 33
Placenta6 Female 25
Placenta7 Male 38
Placenta8 Female 39
Placenta9 Male 38
Placenta10 Male 38
Placenta11 Male 27
142
Table A-4: Number of CpG Methylated Proportions Replaced with “N/A”
Sample ID Number of CpG Methylated Proportions Replaced with “N/A”
AnCHM1 9
AnCHM2 431
AnCHM3 0
WBC1 1
WBC2 77
WBC3 3
WBC4 0
WBC5 4
WBC6 2
WBC7 96
WBC8 188
WBC9 29
WBC10 23
WBC11 1
WBC12 2
WBC13 3
WBC14 1
WBC15 879
WBC16 31
MCT 0
Placenta1 44
Placenta2 3
Placenta3 141
Placenta4 1
Placenta5 96
pUPD4 13
143
Table A-5: Array CpG Sites Located in DMRs Associated with Known Imprinted Genes
List of Illumina Infinium Human Methylation27 promoter microarray CpG sites located in known parent-of-orgin-specific
DMRs (associated with known imprinted genes). The highlighted (shaded in light blue) CpG sites are paternally
methylated (as they are located in the known paternally methylated GNAS NESP55 DMR). All the other CpG sites are
maternally methylated (as they are located in known maternally methylated DMRs (associated with known imprinted
genes)).
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 68285365 DIRAS3 cg22901840 7 129918494 MEST cg13917504
1 68285433 DIRAS3 cg13697378 7 129919741 MEST cg18183281
1 68285559 DIRAS3 cg09118625 11 2676805 KCNQ1 cg27119222
1 68285651 DIRAS3 cg21808053 15 22751346 SNURF cg18506672
1 68288376 DIRAS3 cg02317907 19 62041521 ZIM2 cg17663463
1 68288565 DIRAS3 cg19114595 19 62041627 ZIM2 cg19771589
1 68288681 DIRAS3 cg11465163 19 62041816 ZIM2 cg02793099
1 68288860 DIRAS3 cg22500004 19 62041908 ZIM2 cg01656470
1 68289041 DIRAS3 cg05392265 19 62042104 ZIM2 cg27519373
1 68289053 DIRAS3 cg16148270 19 62042315 ZIM2 cg07310951
6 144370610 PLAGL1 cg25350411 19 62043025 PEG3 cg20897667
6 144370745 PLAGL1 cg07077459 19 62043252 ZIM2 cg22354595
6 144370865 PLAGL1 cg22378065 19 62043454 PEG3 cg19335327
6 144371166 PLAGL1 cg00702231 19 62043603 PEG3 cg14849423
6 144371178 PLAGL1 cg12757684 20 56848355 GNAS cg14597908
6 144371473 PLAGL1 cg08263357 20 56848772 GNAS cg05558390
6 144371522 PLAGL1 cg17895149 20 56862672 GNAS cg21988465
6 144371602 PLAGL1 cg14161241 20 56863253 GNAS cg07284407
7 50818058 GRB10 cg12903171 20 56863708 GNAS cg21625881
7 94123578 PEG10 cg19107595 20 56864058 GNAS cg14203179
7 94123896 PEG10 cg08291000 20 56896922 GNAS cg10011623
7 94124144 PEG10 cg16492735 20 56898137 GNAS cg27027803
7 94124462 PEG10 cg06695761
144
Table A-6: Candidate Maternally Methylated CpG Sites in Blood (Part 1 of 3)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 884817 NOC2L cg19923810 3 51870732 IQCF2 cg14940420 1 19841472 NBL1 cg19136075 3 79722937 ROBO1 cg20145360
1 20338719 PLA2G2F cg11933267 3 115495602 VSIG9 cg20832020
1 20771708 CDA cg00750606 3 134601630 BFSP2 cg25249068
1 22201054 ELA3A cg10779183 3 150064527 CPA3 cg13424229
1 22836201 C1QA cg00108454 3 152174600 USH3A cg24365013
1 22842926 C1QC cg00136477 3 160473715 SCHIP1 cg24988345
1 22857181 C1QB cg22477971 3 174341611 SPATA16 cg06577725
1 22858524 C1QB cg03941108 3 185231921 HTR3D cg14483391
1 32417280 TXLNA cg21093060 3 195571421 LRRC15 cg26838900
1 41260024 FLJ23878 cg22005565 3 195572481 LRRC15 cg02121427
1 47306563 CYP4Z1 cg10751811 4 47650768 CNGA1 cg19000186
1 62558100 ANKRD38 cg00625425 4 71372315 MUC7 cg10189763
1 68285238 DIRAS3 cg24871743 4 71751036 IGJ cg25623640
1 103999392 AMY1A cg26507477 4 72423968 SLC4A4 cg19850370
1 117554836 VTCN1 cg22424746 4 89837660 NAP1L5 cg12759554
1 117555488 VTCN1 cg27446185 4 89838076 NAP1L5 cg01026744
1 119759492 HSD3B2 cg04087608 4 90252944 TIGD2 cg08377000
1 149220567 ANXA9 cg07337598 4 146778997 MMAA cg25421002
1 150947467 LCE4A cg21846488 4 153821239 FLJ32028 cg12968903
1 151222167 SPRR1A cg06101324 4 155921670 MGC27016 cg02992596
1 151240581 SPRR3 cg25856811 4 156806130 GUCY1A3 cg02210887
1 155094826 INSRR cg02049180 5 9684117 TAS2R1 cg23248452
1 155936844 FCRL3 cg25259754 5 20017186 CDH18 cg27043873
1 157440780 DARC cg23507131 5 38631977 LIFR cg01796228
1 158975863 SLAMF7 cg11721194 5 135259425 IL9 cg13842648
1 159786020 FCGR3A cg04384208 5 137447943 WNT8A cg08603768
1 165224845 MAEL cg18894878 5 149549469 SLC6A7 cg09588653
1 169484179 FMO1 cg15514848 5 151764634 NMUR2 cg03914397
1 195212153 CFHR5 cg25840094 5 168996141 DOCK2 cg02251134
1 205105925 IL20 cg23282674 6 11219880 HERV-FRD cg04304130
1 226358328 C1orf35 cg14925024 6 24597866 GPLD1 cg14023451
1 228579960 PGBD5 cg19560210 6 25938901 SLC17A1 cg03835296
2 20391158 PUM2 cg08659707 6 26608461 BTN1A1 cg07011110
2 25419299 DNMT3A cg21629895 6 30767622 NRM cg16979445
2 26634735 OTOF cg27305303 6 31026632 DPCR1 cg04645843
2 27215383 MGC44505 cg22937804 6 31188508 C6orf15 cg16150435
2 33514258 RASGRP3 cg01109219 6 32299873 NOTCH4 cg05973262
2 44356244 SLC3A1 cg02192965 6 41115500 UNC5CL cg22346765
2 45693157 FLJ10379 cg02630207 6 41411008 NCR2 cg07131544
2 87828661 PLGLB2 cg14003512 6 42231007 GUCA1A cg02091100
2 88250462 FLJ10916 cg24977027 6 47760421 GPR115 cg18841952
2 96535110 LINCR cg03102516 6 49789192 CRISP2 cg04595372
2 98352807 CNGA3 cg22241124 6 52061073 PKHD1 cg18885346
2 98353403 CNGA3 cg15954792 6 53991847 C6orf142 cg13281868
2 113752640 PAX8 cg07403255 6 54280337 TINAG cg27090087
2 135311793 ACMSD cg02812142 6 71069112 COL9A1 cg21789545
2 135312097 ACMSD cg18766847 6 74161589 DDX43 cg08124399
2 175338096 CHRNA1 cg05649009 6 88814597 SPACA1 cg13334277
2 183095173 PDE1A cg26465666 6 88912435 CNR1 cg23276695
2 191009029 FLJ20160 cg15998761 6 107185341 RTN4IP1 cg07476030
2 201688749 CFLAR cg18119407 6 131998704 ENPP3 cg08678755
2 210343863 C2orf21 cg22037121 6 159198742 LOC202459 cg11456838
2 218739143 IL8RA cg13519373 6 160852699 LPAL2 cg15398520
2 219404716 PRKAG3 cg23081213 7 5289112 SLC29A4 cg12838902
2 222996881 SGPP2 cg11300809 7 12692614 ARL4 cg09259772
2 233061180 ECEL1 cg25431974 7 27187829 HOXA10 cg00518911
2 234489672 TRPM8 cg15746445 7 37926280 EPDR1 cg27641018
3 12775469 TMEM40 cg21706946 7 44005601 WBSCR19 cg22222251
3 35658819 ARPP-21 cg05615150 7 50817425 GRB10 cg08835688
3 35658823 ARPP-21 cg12417466 7 65842232 RABGEF1 cg18884741
3 38322396 SLC22A14 cg16558203 7 72485111 FZD9 cg18438300
3 44890922 TGM4 cg09111917 7 86947735 ABCB4 cg18655915
3 46257770 CCR3 cg04111761 7 94124872 SGCE cg01169624
3 49032665 C3orf60 cg07109801 7 94124889 SGCE cg03682823
145
Table A-6: Candidate Maternally Methylated CpG Sites in Blood (Part 2 of 3)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
7 94124891 SGCE cg18139769 11 76675528 GDPD4 cg26443244 7 94374627 PPP1R9A cg15544721 11 92925818 FN5 cg00325491
7 97458059 OCM cg14260458 11 100507255 PGR cg01987509
7 107087523 SLC26A4 cg14646244 11 102251844 MMP12 cg03179866
7 122422758 TAS2R16 cg12150401 11 113434374 ZBTB16 cg25101936
7 126670180 GRM8 cg02946850 11 117204229 FXYD2 cg10997248
7 126670876 GRM8 cg09868882 11 117361217 IL10RA cg01697865
7 127042719 PAX4 cg16514843 11 117588449 AMICA1 cg23818978
7 129917832 MEST cg07427065 11 119514892 TRIM29 cg11466837
7 139175142 TBXAS1 cg14116596 12 5473803 NTF3 cg04740359
7 142178834 PRSS2 cg04958389 12 6951439 PHB2 cg10818781
7 151284387 GALNTL5 cg11091262 12 7792928 CLEC4C cg22194129
7 154059965 DPP6 cg26738880 12 8866576 A2ML1 cg27653134
8 4840683 CSMD1 cg01136458 12 12115256 BCL2L14 cg24921858
8 7308589 SPAG11 cg19787037 12 13421230 C12orf36 cg10207745
8 7330861 DEFB106A cg05810550 12 14024207 GRIN2B cg04016326
8 10419575 UNQ9391 cg01072821 12 18781846 PLCZ1 cg25573386
8 28229651 PNOC cg19391527 12 29268139 MLSTD1 cg21522988
8 38152078 BAG4 cg01607495 12 47251390 LALBA cg01726767
8 49083013 UBE2V2 cg25612480 12 48630730 AQP2 cg12650635
8 68820791 CPA6 cg21750887 12 50568077 ANKRD33 cg19948393
8 104900822 RIMS2 cg05341878 12 50866695 LOC144501 cg11051139
8 110168926 TRHR cg22268164 12 51047420 KRTHB5 cg06132342
8 118215599 SLC30A8 cg23338195 12 51047683 KRTHB5 cg21518208
8 144487860 TOP1MT cg12188860 12 51174747 KRT6A cg11471401
9 28708459 LRRN6C cg04151683 12 51383436 KRT1B cg18982568
9 33393037 AQP7 cg13246269 12 51529189 K5B cg07265310
9 35947984 OR2S2 cg26922202 12 53328560 DCD cg25372195
9 36159175 CCIN cg20870362 12 56447256 CYP27B1 cg18413900
9 103238083 ALDOB cg26181372 12 63440249 GNS cg00626466
9 116125879 ORM1 cg24552358 12 63802129 WIF1 cg20098478
9 130911826 PPP2R4 cg25587233 12 78135486 SYT1 cg22333868
9 134031851 NTNG2 cg08108641 12 98565053 FAM71C cg04282622
9 134032018 NTNG2 cg09059635 12 116284623 NOS1 cg21006686
9 136950169 FCN1 cg17357062 12 119250606 PLA2G1B cg16396488
9 137106405 OLFM1 cg08268099 12 129568871 RIMBP2 cg24272907
9 138762696 LCN6 cg11873854 13 23421698 FLJ46358 cg12682367
9 138780202 UNQ2541 cg17074151 13 26231506 GPR12 cg15726245
9 139474062 NELF cg01970325 13 45173353 NURIT cg16140179
10 43421575 ZNF485 cg25692323 14 22355205 SLC7A7 cg18960218
10 51678599 ASAH2 cg16792160 14 34169846 SNX6 cg17346022
10 61166193 SLC16A9 cg24443367 14 53493899 BMP4 cg24526899
10 90609553 ANKRD22 cg00098162 14 54976760 TBPL2 cg16036738
10 92670490 ANKRD1 cg14558138 14 69993648 ADAM21 cg05997860
10 95362435 PDE6C cg19635695 14 76362378 C14orf166B cg24887211
10 101532973 ABCC2 cg17044311 14 79747441 DIO2 cg00217795
10 111956019 MXI1 cg13017345 14 87863387 KCNK10 cg10935723
10 118947249 KCNK18 cg07637239 14 94097194 SERPINA4 cg19042947
11 1201109 MUC5B cg03609102 14 95011802 C14orf49 cg16522484
11 2447807 KCNQ1 cg01734338 14 95222519 TCL1B cg13771579
11 3077525 OSBPL5 cg11219178 14 95792705 BDKRB1 cg10238171
11 5233297 HBG2 cg10920765 14 98247530 FLJ25773 cg06906435
11 5247322 HBE1 cg08970694 15 21483851 NDN cg01989224
11 7016556 NALP14 cg25203856 15 22619883 SNRPN cg19803984
11 7066650 HNRNPG-T cg22062068 15 22751499 SNURF cg02125271
11 18226917 SAA2 cg12907644 15 22752317 SNRPN cg22555495
11 18244223 SAA1 cg15484375 15 72827787 CYP1A2 cg04968473
11 30208049 FSHB cg27420123 16 1245421 TPSD1 cg01375871
11 45072395 PRDM11 cg20227165 16 3194568 OR1F1 cg07879977
11 46914334 C11orf49 cg26198807 16 19204357 UNQ5810 cg26222045
11 56914937 PRG2 cg15357945 16 20271212 UMOD cg07456201
11 59390450 TCN1 cg20018806 16 23672805 LOC63928 cg21745164
11 59858137 MS4A6E cg08935003 16 27176649 NSMCE1 cg12391783
11 60281151 MGC35295 cg25072962 16 30031794 GDPD3 cg03297731
11 68209421 GAL cg04464446 16 31446447 ERAF cg14387505
146
Table A-6: Candidate Maternally Methylated CpG Sites in Blood (Part 3 of 3)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
16 47936080 FLJ44674 cg24217877 19 56026308 KLK15 cg26149550 16 47965498 MGC33367 cg24642468 19 56050056 KLK3 cg17687962
16 54467074 CES7 cg23092086 19 56067705 KLK2 cg07947016
16 55156689 MT4 cg01015871 19 56198085 KLK8 cg19149785
16 56721315 GTL3 cg25771195 19 56229640 KLK12 cg23894058
16 83874112 MGC22001 cg13391235 19 56452928 FLJ40235 cg21930712
16 88604267 MGC3101 cg04731384 19 56728011 SIGLEC6 cg16617137
17 1611869 SERPINF1 cg24214470 19 58486606 BIRC8 cg24454579
17 4972090 USP6 cg12954718 19 59107977 CACNG7 cg13672791
17 7062605 ACADVL cg21636577 19 59297454 OSCAR cg21098323
17 29669861 CCL8 cg27000831 19 59477160 LILRB2 cg05248470
17 36916506 KRT13 cg10742225 19 59739533 FLJ00060 cg03602500
17 38532148 BRCA1 cg06973652 19 62043946 ZIM2 cg02162069
17 39701014 SLC4A1 cg03580247 19 62044081 PEG3 cg19098268
17 42621516 CDC27 cg10910775 19 62044469 PEG3 cg18668753
17 59203720 CCDC47 cg20099806 20 1487641 SIRPD cg17423978
17 59342543 CSHL1 cg12911791 20 2465613 TMC2 cg19290962
17 59350761 GH1 cg10207917 20 2972204 GNRH2 cg07549715
17 70131151 CD300E cg04995095 20 3592151 GFRA4 cg06919203
17 71586687 LGICZ1 cg26545162 20 3660191 HSPA12B cg09458237
18 3402088 TGIF cg20322862 20 29491867 DEFB123 cg26063872
18 22474735 KCTD1 cg10539808 20 31105781 C20orf185 cg26111757
18 26997072 DSC1 cg04180953 20 31268562 C20orf71 cg01671881
18 42811817 TCEB3C cg08008233 20 41575865 L3MBTL cg20091959
18 75850362 TXNL4A cg02955504 20 41575908 L3MBTL cg23626798
19 243070 PPAP2C cg03237153 20 41576494 L3MBTL cg01071811
19 1193323 ATP5D cg07294734 20 41576510 L3MBTL cg02611863
19 3174915 BRUNOL5 cg06734812 20 41789039 FAM112A cg11398517
19 5640943 RPL36 cg17006282 20 43237051 PI3 cg02442161
19 9985267 RDH8 cg25661884 20 43609371 SPINLW1 cg10379687
19 14002098 IL27RA cg19282782 20 43609443 SPINLW1 cg23765993
19 14446209 PTGER1 cg10468702 20 44313922 CDH22 cg04640913
19 15023623 CASP14 cg01999333 20 54257492 MC3R cg19226099
19 15451069 PGLYRP2 cg17915429 20 55720103 TMEPAI cg00138126
19 15699895 OR10H2 cg24926780 20 56861337 GNAS cg00943909
19 15713574 OR10H3 cg25843439 20 56861427 GNAS cg24346429
19 16082719 RAB8A cg03621001 20 56864311 GNAS cg25283297
19 19188990 CSPG3 cg06952310 20 56864597 GNAS cg09437522
19 19234998 HAPLN4 cg21497439 20 60811330 NTSR1 cg14871138
19 38052872 SLC7A9 cg05467458 21 10012761 TPTE cg08538752
19 38555716 CEBPG cg15046693 21 10013225 TPTE cg02148834
19 40465314 HAMP cg17907567 21 18698487 PRSS7 cg20839025
19 40475132 MAG cg05055150 21 30734946 KRTAP15-1 cg16812893
19 40712072 SBSN cg23680518 21 30928577 KRTAP20-2 cg00948500
19 40746359 ATP4A cg06123346 21 40160387 PCP4 cg00895324
19 44921106 CLC cg07173760 21 42316009 C21orf121 cg18963171
19 46189062 CYP2B6 cg19756068 21 42689155 TMPRSS3 cg01214847
19 48401200 PSG4 cg27257987 22 21303200 cg10073042
19 51490709 HIF3A cg07022477 22 23947422 CRYBB2 cg10490064
19 53239260 CABP5 cg18534730 22 31183147 BPIL2 cg27195224
19 54227150 CGB2 cg15981554 22 34361187 LOC284912 cg13351406
19 54232053 CGB1 cg17164520 22 37684061 APOBEC3A cg22954818
19 55912349 SHANK1 cg11801011
147
Table A-7: Candidate Maternally Methylated CpG Sites in Placenta (Part 1 of 4)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 3659032 CCDC27 cg10051054 2 27358950 TRIM54 cg25218351 1 15675198 ELA2B cg24030609 2 33514258 RASGRP3 cg01109219
1 20489562 FLJ32784 cg00433406 2 46600883 ATP6V1E2 cg27485921
1 22201054 ELA3A cg10779183 2 49235663 FSHR cg17327492
1 25163534 RUNX3 cg14182690 2 51108810 NRXN1 cg16279786
1 32054053 SPOCD1 cg15789095 2 68951776 BMP10 cg11308639
1 32417280 TXLNA cg21093060 2 68952789 BMP10 cg12711530
1 44642675 C1orf164 cg21578207 2 70901157 CLEC4F cg21148892
1 53972666 GLIS1 cg21142398 2 70901644 CLEC4F cg18199266
1 57093273 C8A cg16648841 2 87828661 PLGLB2 cg14003512
1 57204698 C8B cg10620457 2 88208676 FABP1 cg19910382
1 57204738 C8B cg26851374 2 88996300 cg23984130
1 60311723 C1orf87 cg18870231 2 95975323 LOC400986 cg06098051
1 65124970 JAK1 cg02755455 2 98353403 CNGA3 cg15954792
1 67039389 INSL5 cg04979933 2 99162750 MRPL30 cg15612847
1 68285238 DIRAS3 cg24871743 2 102293829 IL1RL1 cg16386158
1 68289215 DIRAS3 cg12986021 2 108271244 SULT1C1 cg13968390
1 69998451 LRRC7 cg10576828 2 118491897 FLJ10996 cg22699362
1 75850818 SLC44A5 cg27336379 2 119416152 MARCO cg11009736
1 86706913 CLCA1 cg22181664 2 128120956 GPR17 cg15869022
1 110795047 PROK1 cg18434152 2 130817910 IMP4 cg09640202
1 117554836 VTCN1 cg22424746 2 138437785 HNMT cg02906939
1 119759492 HSD3B2 cg04087608 2 144768299 GTDC1 cg27003571
1 144124550 HFE2 cg06589885 2 152299238 NEB cg16753209
1 150242190 S100A10 cg10795646 2 156988657 GPD2 cg24579667
1 150653185 CRNN cg19370451 2 168383286 B3GALT1 cg19723473
1 150902698 LCE2D cg21312148 2 175338096 CHRNA1 cg05649009
1 150914401 LCE2C cg03960217 2 183095173 PDE1A cg26465666
1 150947467 LCE4A cg21846488 2 189547719 COL3A1 cg20770175
1 150948603 LCE4A cg17542385 2 190635795 GDF8 cg18862260
1 151116362 SMCP cg21948655 2 198523309 PLCL1 cg02833180
1 151209834 SPRR4 cg08763351 2 198524422 PLCL1 cg27609819
1 151222810 SPRR1A cg04505023 2 208702965 CRYGC cg05619712
1 151270946 SPRR1B cg18780284 2 210887805 MYL1 cg11059341
1 151281905 SPRR2D cg12891678 2 218739143 IL8RA cg13519373
1 151297375 SPRR2A cg26059632 2 219990525 DES cg26259363
1 151498186 LOR cg17761453 2 220016991 APEG1 cg10062065
1 151550465 PGLYRP3 cg09448880 2 233061180 ECEL1 cg25431974
1 152430678 TPM3 cg24490338 2 237987419 COL6A3 cg00573606
1 153538047 PKLR cg21985470 2 237988139 COL6A3 cg08950375
1 159474931 NR1I3 cg06277277 2 240165186 FLJ45964 cg17977362
1 159741600 FCGR2A cg24422489 2 241739293 PPP1R7 cg08157292
1 159787215 FCGR3A cg22202141 2 242400753 NEU4 cg00684178
1 159867393 FCGR3B cg04567009 2 242594120 FLJ38379 cg16173109
1 160614634 C1orf111 cg14701962 3 3127530 IL5RA cg10159529
1 161439273 RGS5 cg10604646 3 35658819 ARPP-21 cg05615150
1 169484179 FMO1 cg15514848 3 35658823 ARPP-21 cg12417466
1 169888355 MYOC cg22077553 3 38322396 SLC22A14 cg16558203
1 180685841 RGSL2 cg06025017 3 42426880 LYZL4 cg21044104
1 180723419 RGSL1 cg01939443 3 42702164 KBTBD5 cg16842214
1 184696590 PDC cg12723191 3 46257770 CCR3 cg04111761
1 190871876 RGS13 cg05023691 3 46893270 PTHR1 cg03391568
1 196776292 ATP6V1G3 cg12958813 3 51870732 IQCF2 cg14940420
1 196874171 PTPRC cg21171615 3 52839699 ITIH4 cg10929387
1 199348309 CACNA1S cg00095526 3 52839856 ITIH4 cg17890764
1 199448506 DKFZp434B1231 cg05666713 3 79722937 ROBO1 cg20145360
1 202922001 LRRN5 cg16456919 3 109958816 RETNLB cg14659547
1 205161776 FAIM3 cg06640279 3 115495602 VSIG9 cg20832020
1 205272148 C1orf116 cg01119135 3 126135480 MUC13 cg09081544
1 207925204 HSD11B1 cg04732193 3 127760710 C3orf22 cg02765820
1 209732752 C1orf36 cg00658007 3 134601630 BFSP2 cg25249068
2 20391116 PUM2 cg01888166 3 139333801 A4GNT cg17687282
2 20391158 PUM2 cg08659707 3 141879779 TRIM42 cg12242338
2 27215383 MGC44505 cg22937804 3 150064527 CPA3 cg13424229
2 27215924 MGC44505 cg00396894 3 150065842 CPA3 cg24290574
148
Table A-7: Candidate Maternally Methylated CpG Sites in Placenta (Part 2 of 4)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
3 152174600 USH3A cg24365013 7 92687787 LOC253012 cg11608424 3 185254193 HTR3C cg18271969 7 94124872 SGCE cg01169624
3 191650257 UNQ846 cg02912041 7 94124889 SGCE cg03682823
4 6040940 FLJ46481 cg00958560 7 94124891 SGCE cg18139769
4 68304786 GNRHR cg27219973 7 94953290 ASB4 cg11554605
4 68678354 TMPRSS11F cg20695587 7 97458059 OCM cg14260458
4 70950381 HTN1 cg06545504 7 99411214 AZGP1 cg19465374
4 71261606 SMR3A cg11799561 7 99412319 AZGP1 cg12019109
4 71372315 MUC7 cg10189763 7 106990684 DUS4L cg19770955
4 71751036 IGJ cg25623640 7 107231134 SLC26A3 cg04996020
4 77177150 CXCL11 cg08046471 7 107231964 SLC26A3 cg22294577
4 88462842 HSD17B13 cg24999727 7 122125815 RNF133 cg22828602
4 88790677 DMP1 cg18397653 7 126670876 GRM8 cg09868882
4 89837660 NAP1L5 cg12759554 7 127043912 PAX4 cg08886154
4 89838076 NAP1L5 cg01026744 7 128142953 NYD-SP18 cg07586911
4 123073415 TRPC3 cg18474934 7 129913072 MEST cg02490034
4 145046282 GYPE cg16998872 7 129917832 MEST cg07427065
4 145281410 GYPA cg09841009 7 135063389 SLC13A4 cg02005755
4 155702533 FGB cg18876189 7 139175142 TBXAS1 cg14116596
4 156806130 GUCY1A3 cg02210887 7 141604179 TRY1 cg14153740
5 22890461 CDH12 cg15175266 7 141604926 TRY1 cg10466917
5 41248929 C6 cg11976616 7 142539426 PIP cg26628847
5 72499443 MGC13034 cg05731779 7 150044826 GIMAP1 cg25168545
5 72500081 MGC13034 cg15905124 7 151284387 GALNTL5 cg11091262
5 131424256 IL3 cg17983064 8 7788776 DEFB4 cg02658251
5 134811085 C5orf20 cg14722162 8 7789670 DEFB4 cg22478614
5 137447943 WNT8A cg08603768 8 22074025 SFTPC cg19516009
5 146442048 PPP2R2B cg17342759 8 23376361 ENTPD4 cg24430616
5 156540696 ITK cg09453312 8 30825428 TEX15 cg19418958
5 178220323 ZNF354B cg19236727 8 38128705 STAR cg09793866
5 179951718 SCGB3A1 cg14472601 8 38445731 FGFR1 cg08722122
5 180258748 BTNL8 cg24024214 8 67568296 C8orf46 cg23704362
6 3794271 FAM50B cg01570885 8 68821882 CPA6 cg19250907
6 6568577 FLJ33708 cg18201198 8 86478130 CA1 cg17191715
6 24597866 GPLD1 cg14023451 8 87151181 PSKH2 cg19587887
6 25862169 SLC17A4 cg21627181 8 87180235 ATP6V0D2 cg00319692
6 30212531 TRIM40 cg07405796 8 87180271 ATP6V0D2 cg01248426
6 30236364 TRIM10 cg17232861 8 95291196 CDH17 cg20987610
6 32299873 NOTCH4 cg05973262 8 104900822 RIMS2 cg05341878
6 33148892 HLA-DPA1 cg13906813 8 120148806 COLEC10 cg05755779
6 33878828 MLN cg08332212 8 125252939 C8orf78 cg05412531
6 39390510 KCNK17 cg02611419 8 134273023 WISP1 cg22637941
6 41115500 UNC5CL cg22346765 8 143821003 SLURP1 cg07441143
6 41276779 TREML2 cg26928682 8 144487860 TOP1MT cg12188860
6 41411008 NCR2 cg07131544 9 5330039 RLN1 cg20789691
6 42231007 GUCA1A cg02091100 9 12683326 TYRP1 cg25989745
6 46869049 MEP1A cg16019620 9 14713496 CER1 cg01446692
6 47760421 GPR115 cg18841952 9 21156581 IFNA21 cg19982860
6 52061073 PKHD1 cg18885346 9 21208462 IFNA16 cg06479216
6 52217306 IL17F cg04063348 9 21218142 IFNA17 cg01074640
6 53991847 C6orf142 cg13281868 9 21399505 IFNA8 cg15669228
6 88912435 CNR1 cg23276695 9 34700657 CCL21 cg07269146
6 109867524 SMPD2 cg20811607 9 35032395 MGC41945 cg05000446
6 124000883 TRDN cg14462830 9 36159175 CCIN cg20870362
6 131998704 ENPP3 cg08678755 9 100745613 COL15A1 cg20503329
6 134251673 TCF21 cg10771262 9 103397922 PPP3R2 cg15765694
6 135313282 ALDH8A1 cg09533063 9 113597060 C9orf84 cg06643227
6 160247992 MAS1 cg08784110 9 113597374 C9orf84 cg13314167
7 989201 CYP2W1 cg15914863 9 116125879 ORM1 cg24552358
7 20653748 ABCB5 cg22066521 9 123963104 NDUFA8 cg01536400
7 27187829 HOXA10 cg00518911 9 138237697 LHX3 cg14091657
7 37926280 EPDR1 cg27641018 10 4994250 AKR1C1 cg07639198
7 44147129 MYL7 cg23370883 10 13584654 C10orf30 cg23114594
7 44196417 GCK cg15001372 10 17211701 CUBN cg10707565
7 75257240 CCL26 cg05556717 10 61819563 ANK3 cg12354377
149
Table A-7: Candidate Maternally Methylated CpG Sites in Placenta (Part 3 of 4)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
10 85991134 LRRC21 cg17827767 12 47251390 LALBA cg01726767 10 88418237 LDB3 cg08300860 12 48630730 AQP2 cg12650635
10 90609553 ANKRD22 cg00098162 12 51001958 KRTHB3 cg16791508
10 90702747 ACTA2 cg07436807 12 51066060 KRTHB4 cg18153060
10 95362185 PDE6C cg04298323 12 51299598 K6IRS3 cg07017706
10 95362435 PDE6C cg19635695 12 51457458 KRT2B cg11465372
10 98109069 TMEM10 cg06825166 12 51495029 KRT4 cg12610744
10 101532973 ABCC2 cg17044311 12 53043844 GPR84 cg21969640
10 102079671 PKD2L1 cg10365880 12 53177758 HEM1 cg17605084
10 115501494 C10orf81 cg10368842 12 53177901 HEM1 cg16509569
10 126480089 KIAA0157 cg26147480 12 53315414 LACRT cg07643942
10 127503180 UROS cg19346193 12 54911376 SLC39A5 cg03343942
10 127503243 UROS cg04117029 12 55729889 MYO1A cg09541248
11 552366 RASSF7 cg14896003 12 63802129 WIF1 cg20098478
11 831335 TSPAN4 cg03116740 12 69838603 TSPAN8 cg12965512
11 2401968 TRPM5 cg07882535 12 78135486 SYT1 cg22333868
11 2499264 KCNQ1 cg17229197 12 85756642 MGAT4C cg18344063
11 2499438 KCNQ1 cg12949760 12 103847526 SLC41A2 cg23855818
11 2550433 KCNQ1 cg08007665 13 23421698 FLJ46358 cg12682367
11 2550536 KCNQ1 cg26750319 13 30207799 ALOX5AP cg08529529
11 2550729 KCNQ1 cg20751395 13 31787023 BRCA2 cg12836863
11 3077862 OSBPL5 cg12514506 13 42043414 TNFSF11 cg24222324
11 3623059 ART1 cg21407055 13 42252674 FLJ40919 cg07409200
11 5205142 HBB cg14544583 13 42494577 DNAJC15 cg11679069
11 6419028 HPX cg11547724 13 44460280 KIAA1704 cg22539738
11 11988084 DKK3 cg25787984 13 69581128 KLHL1 cg20349377
11 18214899 SAA4 cg22587758 13 102516931 SLC10A2 cg18312429
11 19181235 CSRP3 cg14704941 13 107719053 TNFSF13B cg09646392
11 22646390 GAS2 cg06493930 13 113369467 GRK1 cg09034896
11 36544793 RAG1 cg11494699 14 20306951 FAM12B cg15842430
11 36546820 RAG1 cg10399228 14 20537342 SLC39A2 cg05654163
11 60139937 MGC39681 cg07484450 14 22911594 IL17E cg14366598
11 60858741 DAK cg25406518 14 23879599 RIPK3 cg10318258
11 61278578 C11orf9 cg04237003 14 53493899 BMP4 cg24526899
11 61279074 C11orf9 cg22627427 14 59781450 PPM1A cg17884373
11 61794235 SCGB2A2 cg22862656 14 73885069 C14orf115 cg21207436
11 62539699 SLC22A8 cg06917325 14 76362378 C14orf166B cg24887211
11 64079466 SLC22A11 cg09705062 14 76362486 C14orf166B cg08675585
11 66245214 SPTBN2 cg04985144 14 77245223 ALKBH cg20385229
11 67047602 CABP2 cg18138484 14 93927028 SERPINA1 cg24621042
11 75105846 MOGAT2 cg10585962 14 94147310 SERPINA3 cg16507522
11 76675528 GDPD4 cg26443244 15 21361373 MKRN3 cg16131766
11 88550066 TYR cg03417466 15 21362298 MKRN3 cg23234999
11 92925818 FN5 cg00325491 15 22751499 SNURF cg02125271
11 102251844 MMP12 cg03179866 15 22752317 SNRPN cg22555495
11 117205061 FXYD2 cg25894551 15 23073264 HBII-438B cg18499731
11 117361080 IL10RA cg26661481 15 28474184 CHRFAM7A cg06319346
11 117361217 IL10RA cg01697865 15 40077231 PLA2G4E cg15228639
11 117720322 CD3G cg15880738 15 41300855 EPB42 cg18431127
11 118524594 ABCG4 cg03222066 15 46200510 SLC24A5 cg01497576
11 118559919 PDZD3 cg05461276 15 46285777 SLC12A1 cg20226593
11 122214681 CRTAM cg10977115 15 69807614 THSD4 cg04616566
11 123986824 PANX3 cg08191915 15 72446954 CYP11A1 cg06285340
11 125154444 C11orf38 cg23743472 15 72827787 CYP1A2 cg04968473
11 131038494 C11orf39 cg25943276 15 72828439 CYP1A2 cg09207718
12 4569879 DYRK4 cg09418321 15 98901965 LASS3 cg00729708
12 5473803 NTF3 cg04740359 16 1851526 MGC35212 cg00892393
12 6423750 TNFRSF7 cg06495803 16 2741794 SRRM2 cg06736444
12 6819521 GNB3 cg05484458 16 10697202 FLJ32871 cg18609562
12 9252121 PZP cg01714932 16 20323467 PDILT cg04491443
12 11354646 PRB4 cg14076161 16 31312602 ITGAD cg02164442
12 14024207 GRIN2B cg04016326 16 47965498 MGC33367 cg24642468
12 14740535 GUCY2C cg18754342 16 55156689 MT4 cg01015871
12 18781846 PLCZ1 cg25573386 16 70645745 HP cg06172871
12 29268139 MLSTD1 cg21522988 16 70654445 HPR cg09584711
150
Table A-7: Candidate Maternally Methylated CpG Sites in Placenta (Part 4 of 4)
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
16 83874112 MGC22001 cg13391235 19 61202777 NALP5 cg26264314 17 7062572 ACADVL cg24825722 19 62043946 ZIM2 cg02162069
17 7062605 ACADVL cg21636577 19 62044081 PEG3 cg19098268
17 7931430 ALOX12B cg03742272 19 62044469 PEG3 cg18668753
17 16816676 TNFRSF13B cg23274244 20 155338 DEFB129 cg00769470
17 23823416 SLC13A2 cg11653858 20 186156 DEFB32 cg18239253
17 28341649 SPACA3 cg26829529 20 3660191 HSPA12B cg09458237
17 29636788 CCL11 cg24870391 20 23381349 CST11 cg06489008
17 29707167 CCL13 cg02706575 20 23496991 CST9L cg15210427
17 31332250 CCL16 cg10190509 20 23755958 CST2 cg01237132
17 31337750 CCL14 cg09256683 20 29492554 DEFB123 cg19241311
17 31354012 CCL15 cg26548883 20 30061355 C20orf160 cg11801374
17 31616166 TBC1D3C cg02601403 20 31105781 C20orf185 cg26111757
17 35975201 CCR7 cg17067993 20 31268562 C20orf71 cg01671881
17 36113460 KRT24 cg24340657 20 31335013 C20orf114 cg22789545
17 36113623 KRT24 cg23737768 20 36407859 LBP cg18979491
17 36165064 KRT25A cg22983092 20 41575865 L3MBTL cg20091959
17 36210026 KRT25D cg20484002 20 41575908 L3MBTL cg23626798
17 36997052 KRT14 cg01602596 20 41576494 L3MBTL cg01071811
17 38306255 G6PC cg26673195 20 41576510 L3MBTL cg02611863
17 43389454 ATAD4 cg10878307 20 41620770 SGK2 cg21685427
17 44226904 TTLL6 cg08137716 20 42777411 WISP2 cg03562120
17 53669778 LPO cg12032049 20 43766147 WFDC10B cg00690280
17 57810848 EFCAB3 cg07292816 20 43950634 C20orf165 cg21023770
17 64462140 ABCA8 cg21660392 20 56861225 GNAS cg17414107
17 69788532 DNAI2 cg11856697 20 56861337 GNAS cg00943909
17 69875229 GPR142 cg03803009 20 56861427 GNAS cg24346429
17 71975276 AANAT cg09382492 20 56864311 GNAS cg25283297
18 22474735 KCTD1 cg10539808 20 56898834 GNAS cg25983380
18 22699132 C18orf16 cg00729275 20 58063710 FLJ33860 cg09076077
18 22699316 C18orf16 cg15976539 20 62208641 NPBWR2 cg21628553
18 28024079 MEP1B cg01941619 20 62266251 MYT1 cg16772207
18 42816134 TCEB3B cg20879768 21 29314090 C21orf6 cg05406101
18 59734679 SERPINB10 cg23696618 21 30734946 KRTAP15-1 cg16812893
19 4132854 SIRT6 cg09936839 21 30797319 KRTAP19-5 cg07374637
19 8670345 MGC33407 cg18931750 22 18091327 GP1BB cg07359545
19 14002098 IL27RA cg19282782 22 20710839 cg00013618
19 14490905 DNAJB1 cg15712267 22 21303200 cg10073042
19 15451069 PGLYRP2 cg17915429 22 22907315 SUSD2 cg03599338
19 18890194 DDX49 cg14757492 22 25344415 CRYBB1 cg00757952
19 41191679 FLJ36445 cg21550442 22 29290857 GAL3ST1 cg09022808
19 44921106 CLC cg07173760 22 30981345 SLC5A4 cg21578906
19 45611085 PRX cg26200585 22 31082769 RFPL3 cg13005002
19 46884924 CEACAM7 cg07297178 22 31183844 BPIL2 cg14789590
19 47073790 CD79A cg04790874 22 34442848 APOL5 cg03128832
19 47623519 LIPE cg14679230 22 35734834 MGC35206 cg22088368
19 53500080 FLJ32926 cg11521325 22 36548891 GALR3 cg22975712
19 54091600 NUCB1 cg21252483 22 36782815 PRKCABP cg23621115
19 55123237 ATF5 cg23878206 22 38619484 FLJ25421 cg08245789
19 56728011 SIGLEC6 cg16617137 22 40856563 CYP2D6 cg10840135
19 56946034 FPR1 cg15811427
151
Table A-8: Candidate Paternally Methylated CpG Sites in Blood
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 15784289 AGMAT cg17385448 11 92342296 MTNR1B cg15842276 1 35811746 TFAP2E cg26372517 12 7234287 PEX5 cg15754084
1 111963591 RAP1A cg23301687 13 30671806 B3GTL cg21418052
1 153557921 C1orf104 cg22234962 13 94051677 ITR cg09582042
1 221633332 C1orf65 cg27202708 14 38804962 CTAGE5 cg13277939
1 221633417 C1orf65 cg05333568 14 80491864 TSHR cg09721659
2 27659126 ZNF512 cg01464985 15 32875399 ACTC cg06048973
2 101974624 IL1R2 cg17142183 15 51838835 WDR72 cg18613421
2 172572583 MAP1D cg16449464 15 72969183 MPI cg13828047
3 47492823 SCAP cg26614073 15 88344817 ZNF710 cg01185080
3 126414646 SLC12A8 cg14391622 16 704795 METRN cg11027330
4 110844529 CASP6 cg17714799 16 3433998 ZNF597 cg14654875
4 178601336 AGA cg00398048 16 8965866 USP7 cg12914014
5 134763443 H2AFY cg01550148 16 10943234 DEXI cg27425675
5 137637734 GFRA3 cg20178764 16 64957821 CDH5 cg08872742
5 139992912 CD14 cg25358289 16 65517230 RRAD cg19428417
5 178353920 GRM6 cg15674997 16 68890379 DDX19B cg14244577
5 179153151 LTC4S cg16361890 16 79829782 BCMO1 cg22947000
6 26472772 BTN3A2 cg14345882 16 79830001 BCMO1 cg17465631
6 153494647 RGS17 cg23651356 17 7225386 TNK1 cg25499099
6 158163595 SNX9 cg20179697 17 7883131 ALOX15B cg15799267
7 5051647 RBAK cg06914598 17 24531793 MYO18A cg00426498
7 126820931 LOC168850 cg08137040 17 25729371 CPD cg07156669
7 127668516 LEP cg19594666 17 45901117 CHAD cg06958829
9 2828508 KIAA0020 cg24471894 17 75428659 CBX4 cg04398978
9 5294611 RLN2 cg02875297 17 76884479 MGC15523 cg00466249
10 99249711 UBTD1 cg17296078 17 76884481 MGC15523 cg06850526
10 125415252 GPR26 cg07036530 18 54681282 ZNF532 cg12406559
10 125641024 CPXM2 cg09619146 19 1463314 ADAMTSL5 cg04601137
10 135011037 PRAP1 cg10742801 19 40939917 HSPB6 cg15125472
11 1976144 H19 cg17769238 19 41215245 CLIPR-59 cg06432655
11 1977136 H19 cg02657360 19 46417172 AXL cg14892768
11 2111008 IGF2 cg22956483 19 54707592 FCGRT cg15528736
11 2847033 KCNQ1DN cg13081704 20 56847934 GNAS cg25268451
11 5667230 TRIM22 cg12461141 20 56849616 GNAS cg24975842
11 32408763 WT1 cg01693350 20 56849901 GNAS cg18619398
11 65444453 Bles03 cg13547237 22 39405619 GPR24 cg21342728
11 65444468 Bles03 cg10467098 22 49333679 KLHDC7B cg18533225
11 85763271 FLJ23514 cg16404106
152
Table A-9: Candidate Paternally Methylated CpG Sites in Placenta
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 4613868 AJAP1 cg20959866 12 47975479 PRPH cg09595479 1 21867684 RAP1GA1 cg22396755 12 52696843 HOXC4 cg21487207
1 26360515 ZNF593 cg11418559 13 30671806 B3GTL cg21418052
1 26361575 ZNF593 cg18107827 13 32489130 KL cg23282559
1 36322313 TEKT2 cg24813212 13 94051677 ITR cg09582042
1 54392033 CDCP2 cg26185508 14 23873647 ADCY4 cg16761581
1 85498480 C1orf52 cg05654164 14 23878913 RIPK3 cg20822579
1 109005848 C1orf59 cg00328227 14 80491864 TSHR cg09721659
1 153557921 C1orf104 cg22234962 14 102459567 AMN cg01155039
1 204874797 DYRK3 cg09328024 15 51838835 WDR72 cg18613421
1 221633332 C1orf65 cg27202708 15 76419647 CRABP1 cg16703647
2 6935238 RSAD2 cg18201077 15 76419725 CRABP1 cg11200929
2 72997307 EMX1 cg26898166 15 76419916 CRABP1 cg17133183
2 172572583 MAP1D cg16449464 15 76420510 CRABP1 cg19777470
3 112743473 CD96 cg04039397 15 76420717 CRABP1 cg20550118
3 126414646 SLC12A8 cg14391622 15 82974955 SCAND2 cg17866455
3 142432606 ACPL2 cg00400028 16 360113 MRPL28 cg12437481
4 1981675 WHSC2 cg14217157 16 704795 METRN cg11027330
4 3504643 LRPAP1 cg25201363 16 3433998 ZNF597 cg14654875
4 39875171 RHOH cg11903057 16 8965866 USP7 cg12914014
4 108861860 PAPSS1 cg09191232 16 45474997 GPT2 cg18587271
5 151118744 ATOX1 cg06746171 16 66007362 ZDHHC1 cg11657615
6 35217099 TCP11 cg22407458 16 68155671 NFAT5 cg11147886
6 158163595 SNX9 cg20179697 16 73707957 LDHD cg03991512
7 37922801 SFRP4 cg08261094 16 83239008 C16orf44 cg23617760
7 43764312 BLVRA cg17571291 17 19822224 AKAP10 cg11630242
7 127668168 LEP cg12782180 17 24968711 CORO6 cg06038133
7 127668516 LEP cg19594666 17 25729371 CPD cg07156669
7 139409708 PARP12 cg07937272 17 38166489 RAMP2 cg14436761
7 150848513 RHEB cg03998173 17 38250104 AOC2 cg19317715
7 150848816 RHEB cg21134096 17 39574438 C17orf53 cg25425074
8 41287005 SFRP1 cg06166767 17 45858056 FLJ20920 cg14672994
9 33438382 AQP3 cg26624914 17 71648573 FOXJ1 cg01294702
9 129587031 CDK9 cg08999352 17 72046145 CYGB cg21301440
9 131468359 PRRX2 cg04713521 17 76884479 MGC15523 cg00466249
10 44201060 CXCL12 cg18618334 17 76884481 MGC15523 cg06850526
10 44815977 ZNF22 cg00899659 17 78267247 FN3KRP cg14688272
10 64245804 EGR2 cg19355190 18 54681282 ZNF532 cg12406559
10 73393227 CHST3 cg04268405 19 1463314 ADAMTSL5 cg04601137
10 90333188 C10orf59 cg06981182 19 3087710 GNA15 cg26482939
10 95351376 RBP4 cg12936747 19 4230441 SHD cg26646370
10 135043202 PAOX cg18361093 19 15204174 ABHD9 cg05488632
11 1976144 H19 cg17769238 19 17766332 B3GNT3 cg23771661
11 1977136 H19 cg02657360 19 41215245 CLIPR-59 cg06432655
11 2110567 IGF2 cg02807948 19 45016586 DYRK1B cg10294836
11 2111008 IGF2 cg22956483 19 45016824 DYRK1B cg18851831
11 2122537 IGF2AS cg11005826 19 45774154 SHKBP1 cg09381003
11 2510986 KCNQ1 cg16465939 19 47329470 POU2F2 cg22054191
11 2511159 KCNQ1 cg27491887 19 50693586 FLJ40125 cg00116838
11 5667230 TRIM22 cg12461141 20 34603023 MYL9 cg21671476
11 46310677 DGKZ cg18765542 20 44469045 ELMO2 cg14261863
11 47692758 AGBL2 cg01888601 20 56847934 GNAS cg25268451
11 56860207 SSRP1 cg01511567 20 56849616 GNAS cg24975842
11 65081734 LTBP3 cg08965235 20 56849901 GNAS cg18619398
12 5023549 KCNA5 cg20792062 20 60743500 SLCO4A1 cg09210315
12 7739360 GDF3 cg15992730 21 43973826 C21orf124 cg21755709
12 7916762 SLC2A14 cg05521696 21 44056660 LOC284837 cg00546897
12 47658741 WNT1 cg21948783 22 19699610 P2RXL1 cg19592945
153
Table A-10: PCR Conditions for Bisulfite Pyrosequencing
Reagent (first column)/DMR
(first row)
DIRAS3 KvDMR1 H19DMR IG-
DMR
NAP1L5 ZNF597 AXL RIMS2
Distilled water (μL) 17.25 19.25 18.25 17.25 18
10*BF (μL) 2.5
25 mM magnesium chloride
(μL)
2 0 1 2 1.25
10 mM dNTP solution (μL) 0.5
10 μM M13-Biotin Universal
Primer Complex (μL)
0.5
10 μM solution of forward
primer (μL)
0.5
10 μM solution of reverse
primer (μL)
0.5
HotStar Taq (μL) 0.25
Sodium bisulfite treated DNA
(μL)
1
154
Table A-11: PCR Cycling Conditions for Bisulfite Pyrosequencing
Note: stages follow each other in succession. N/A stands for not applicable.
Stage (first
column)/DMR
(first row)
DIRAS3 KvDMR1 H19DMR IG-DMR NAP1L5 ZNF597 AXL RIMS2
1 95°C for 15 minutes
2 30 cycles
of (95°C
for 30
seconds,
65°C
(decrease
temp after
first cycle
by 0.5°C
every 1
cycle) for
30 seconds,
72°C for
30
seconds)
10 cycles of
(95°C for
30 seconds,
57°C
(decrease
temp after
first cycle
by 0.5°C
every 1
cycle) for
30 seconds,
72°C for 30
seconds)
10 cycles of
(95°C for
30 seconds,
60°C
(decrease
temp after
cycle 1 by
0.5°C every
1 cycle) for
30 seconds,
72°C for 30
seconds)
10 cycles
of (95°C
for 20
seconds,
55°C
(decrease
temp after
cycle 1 by
0.5°C
every 1
cycle) for
20 seconds,
72°C for
20
seconds)
50 cycles
of (95°C
for 30
seconds,
65°C for
30
seconds,
72°C for
45
seconds)
10 cycles
of (95°C
for 30
seconds,
60°C
(decrease
temp after
first cycle
by 0.5°C
every 1
cycle) for
30 seconds,
72°C for
30
seconds)
50 cycles
of (95°C
for 30
seconds,
61°C for
30
seconds,
72°C for
30
seconds)
35 cycles
of (95°C
for 30
seconds,
56°C for
30
seconds,
72°C for
30
seconds)
3 20 cycles
of (95°C
for 30
seconds,
50°C for
30 seconds,
72°C for
30
seconds)
30 cycles of
(95°C for
30 seconds,
52°C for 30
seconds,
72°C for 30
seconds)
38 cycles of
(95°C for
30 seconds,
55°C for 30
seconds,
72°C for 30
seconds)
30 cycles
of (95°C
for 20
seconds,
50°C for
20 seconds,
72°C for
20
seconds)
72°C for
10
minutes
30 cycles
of (95°C
for 30
seconds,
55°C for
30 seconds,
72°C for
30
seconds)
72°C for
10
minutes
72°C for
7 minutes
4 72°C for 7 minutes N/A 72°C for 7
minutes
N/A N/A
155
Table A-12: Primer Sequences for PCR for Bisulfite Pyrosequencing
The underlined sequence was added to the PCR primers to enable the PCR products (one strand of the PCR product
specifically) to anneal to the Biotin-M13 Universal Primer complex.
DMR Forward primer (5’-3’) Reverse primer (5’-3’)
DIRAS3 CCAGGGTTTTCCCAGTCACGACGATTTTTTTGTGGGGTTTGAA CCAACTTTAACTCCAAAAAACA
Kv GTGATGTGTTTATTATT CGCCAGGGTTTTCCCAGTCACGACCTAAACRCCCACAAACCTCCA
H19 TGAGTGTTTTATTTTTAGATGATTTT CGCCAGGGTTTTCCCAGTCACGACACAATACAAACTCACACATCACAAC
IG- GTTTTATTATTGAATTGGGTTTGTTAGTA CGCCAGGGTTTTCCCAGTCACGACTCAAAACAACTCAAATCCTTTATAAC
NAP1L5 GGTTTTGTATTAGAGTTGGTTTAGAGAGAT CGCCAGGGTTTTCCCAGTCACGACAAACACCTCCAACAACTACTAACACTCC
ZNF597 GGTTAGGTTTAGAAAGGGGTTTAT CGCCAGGGTTTTCCCAGTCACGACCCTCTCCCAACTACCCAATAACTA
AXL TTGGGAGTTTACTAATTTTTGAGGAAAG CGCCAGGGTTTTCCCAGTCACGACCATCACTCACCCCTAAAAACCATA
RIMS2 CGCCAGGGTTTTCCCAGTCACGACTTTTAGTTGGGAATGTTTAAAAAG CCCCAATCAAATTCCATATTTC
156
Table A-13: Primer Sequences For Bisulfite Pyrosequencing Reactions
DMR Sequencing primer (5’-3’) Amplicon size of PCR product to
be pyrosequenced (base pairs)
Number of CpG sites
assayed by pyrosequencing
DIRAS3 CAAAAAACAAAAACTACTAA 95 3
Kv GTGATGTGTTTATTATT 123 5
H19 GTGGTTTGGGTGATT 148 3
IG TGAATTGGGTTTGTTAGTAG 101 5
NAP1L5 TTTTGAGGATGAGGTAAGT 298 6
ZNF597 TTTGATAGGAGTTGTAGAAA 316 4
AXL GGTGTTTTAGGATGGGTAG 133 4
RIMS2 CCTAAAAAATTCAATACCC 197 2
157
Table A-14: PCR Conditions for Sodium Bisulfite Sequencing
Reagent Volume (μL)
Distilled water (μL) 19.75
10*BF (μL) 2.5
10 mM dNTP solution (μL) 0.5
10 μM solution of forward primer (μL) 0.5
10 μM solution of reverse primer (μL) 0.5
HotStar Taq (μL) 0.25
Sodium bisulfite treated DNA (μL) 1
158
Table A-15: PCR Cycling Conditions for Sodium Bisulfite Sequencing
Note: stages follow each other in succession.
Stage Program
1 95°C for 15 minutes
2 10 cycles of (95°C for 30 seconds, 60°C (decrease temp after first cycle by 0.5°C every 1 cycle) for 30 seconds, 72°C
for 30 seconds)
3 30 cycles of (95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds)
4 72°C for 7 minutes
159
Table A-16: Primer Sequences for PCR for Sodium Bisulfite Sequencing
Forward primer (5’-3’) Reverse primer (5’-3’)
GAGGTAGGGGTGTTGAGAAG CCCCACACCTACCATCAT
160
Table A-17: PCR Conditions for SNP (rs1051008) Pyrosequencing
Reagent Volume (μL)
Distilled water (μL) 18.25
10*BF (μL) 2.5
25 mM magnesium chloride (μL) 0.5
10 mM dNTP solution (μL) 0.5
10 μM M13-Biotin Universal Primer Complex (μL) 0.5
10 μM solution of forward primer (μL) 0.5
10 μM solution of reverse primer (μL) 0.5
HotStar Taq (μL) 0.25
DNA (μL) 2
161
Table A-18: PCR Cycling Conditions for SNP (rs1051008) Pyrosequencing
Note: stages follow each other in succession.
Stage Program
1 95°C for 15 minutes
2 40 cycles of (95°C for 20 seconds, 54°C for 20 seconds, 72°C for 20 seconds)
3 72°C for 7 minutes
162
Table A-19: Primer Sequences for PCR for SNP (rs1051008) Pyrosequencing
The underlined sequence was added to the PCR primers to enable the PCR products (one strand of the PCR product
specifically) to anneal to the Biotin-M13 Universal Primer complex.
Forward primer (5’-3’) Reverse primer (5’-3’)
CCAGGGTTTTCCCAGTCACGACCTTTGCTGCATTCTGCCTCTCT GGAAAGGAGGCATCCCTAAT
163
Table A-20: Primer Sequence for SNP (rs1051008) Pyrosequencing Reactions
Sequencing primer (5’-3’) Amplicon size of PCR product to be pyrosequenced (base pairs)
GTGCCTAGAACTATAAGATT 290
164
Table A-21: Overlapping Candidate Maternally Methylated CpG sites
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 22201054 ELA3A cg10779183 7 151284387 GALNTL5 cg11091262 1 32417280 TXLNA cg21093060 8 104900822 RIMS2 cg05341878
1 68285238 DIRAS3 cg24871743 8 144487860 TOP1MT cg12188860
1 117554836 VTCN1 cg22424746 9 36159175 CCIN cg20870362
1 119759492 HSD3B2 cg04087608 9 116125879 ORM1 cg24552358
1 150947467 LCE4A cg21846488 10 90609553 ANKRD22 cg00098162
1 169484179 FMO1 cg15514848 10 95362435 PDE6C cg19635695
2 20391158 PUM2 cg08659707 10 101532973 ABCC2 cg17044311
2 27215383 MGC44505 cg22937804 11 76675528 GDPD4 cg26443244
2 33514258 RASGRP3 cg01109219 11 92925818 FN5 cg00325491
2 87828661 PLGLB2 cg14003512 11 102251844 MMP12 cg03179866
2 98353403 CNGA3 cg15954792 11 117361217 IL10RA cg01697865
2 175338096 CHRNA1 cg05649009 12 5473803 NTF3 cg04740359
2 183095173 PDE1A cg26465666 12 14024207 GRIN2B cg04016326
2 218739143 IL8RA cg13519373 12 18781846 PLCZ1 cg25573386
2 233061180 ECEL1 cg25431974 12 29268139 MLSTD1 cg21522988
3 35658819 ARPP-21 cg05615150 12 47251390 LALBA cg01726767
3 35658823 ARPP-21 cg12417466 12 48630730 AQP2 cg12650635
3 38322396 SLC22A14 cg16558203 12 63802129 WIF1 cg20098478
3 46257770 CCR3 cg04111761 12 78135486 SYT1 cg22333868
3 51870732 IQCF2 cg14940420 13 23421698 FLJ46358 cg12682367
3 79722937 ROBO1 cg20145360 14 53493899 BMP4 cg24526899
3 115495602 VSIG9 cg20832020 14 76362378 C14orf166B cg24887211
3 134601630 BFSP2 cg25249068 15 22751499 SNURF cg02125271
3 150064527 CPA3 cg13424229 15 22752317 SNRPN cg22555495
3 152174600 USH3A cg24365013 15 72827787 CYP1A2 cg04968473
4 71372315 MUC7 cg10189763 16 47965498 MGC33367 cg24642468
4 71751036 IGJ cg25623640 16 55156689 MT4 cg01015871
4 89837660 NAP1L5 cg12759554 16 83874112 MGC22001 cg13391235
4 89838076 NAP1L5 cg01026744 17 7062605 ACADVL cg21636577
4 156806130 GUCY1A3 cg02210887 18 22474735 KCTD1 cg10539808
5 137447943 WNT8A cg08603768 19 14002098 IL27RA cg19282782
6 24597866 GPLD1 cg14023451 19 15451069 PGLYRP2 cg17915429
6 32299873 NOTCH4 cg05973262 19 44921106 CLC cg07173760
6 41115500 UNC5CL cg22346765 19 56728011 SIGLEC6 cg16617137
6 41411008 NCR2 cg07131544 19 62043946 ZIM2 cg02162069
6 42231007 GUCA1A cg02091100 19 62044081 PEG3 cg19098268
6 47760421 GPR115 cg18841952 19 62044469 PEG3 cg18668753
6 52061073 PKHD1 cg18885346 20 3660191 HSPA12B cg09458237
6 53991847 C6orf142 cg13281868 20 31105781 C20orf185 cg26111757
6 88912435 CNR1 cg23276695 20 31268562 C20orf71 cg01671881
6 131998704 ENPP3 cg08678755 20 41575865 L3MBTL cg20091959
7 27187829 HOXA10 cg00518911 20 41575908 L3MBTL cg23626798
7 37926280 EPDR1 cg27641018 20 41576494 L3MBTL cg01071811
7 94124872 SGCE cg01169624 20 41576510 L3MBTL cg02611863
7 94124889 SGCE cg03682823 20 56861337 GNAS cg00943909
7 94124891 SGCE cg18139769 20 56861427 GNAS cg24346429
7 97458059 OCM cg14260458 20 56864311 GNAS cg25283297
7 126670876 GRM8 cg09868882 21 30734946 KRTAP15-1 cg16812893
7 129917832 MEST cg07427065 22 21303200 cg10073042
7 139175142 TBXAS1 cg14116596
165
Table A-22: Overlapping Candidate Paternally Methylated CpG sites
Chromosome Mapinfo Gene associated Illumina Chromosome Mapinfo Gene associated Illumina
NCBI build 36 with CpG site TargetID NCBI build 36 with CpG site TargetID
1 153557921 C1orf104 cg22234962 15 51838835 WDR72 cg18613421 1 221633332 C1orf65 cg27202708 16 704795 METRN cg11027330
2 172572583 MAP1D cg16449464 16 3433998 ZNF597 cg14654875
3 126414646 SLC12A8 cg14391622 16 8965866 USP7 cg12914014
6 158163595 SNX9 cg20179697 17 25729371 CPD cg07156669
7 127668516 LEP cg19594666 17 76884479 MGC15523 cg00466249
11 1976144 H19 cg17769238 17 76884481 MGC15523 cg06850526
11 1977136 H19 cg02657360 18 54681282 ZNF532 cg12406559
11 2111008 IGF2 cg22956483 19 1463314 ADAMTSL5 cg04601137
11 5667230 TRIM22 cg12461141 19 41215245 CLIPR-59 cg06432655
13 30671806 B3GTL cg21418052 20 56847934 GNAS cg25268451
13 94051677 ITR cg09582042 20 56849616 GNAS cg24975842
14 80491864 TSHR cg09721659 20 56849901 GNAS cg18619398
166
Table A-23: Candidate DMCpGs That May Represent Components of Known DMRs
Chromosome Mapinfo (NCBI
build 36/hg18)
Illumina TargetID Distance to closest
known parent-of-origin-
specific DMR associated
with known imprinted
genes (base pairs)
Name of closest known
parent-of-origin-specific
DMR associated with
known imprinted genes
Is the closest known parent-
of-origin-specific DMR
associated with known
imprinted genes maternally
or paternally methylated?
1 68285238 cg24871743 < 300 DIRAS3
94124872 cg01169624
94124889 cg03682823
94124891 cg18139769
< 500 PEG10 7
129917832 cg07427065 < 900 MEST
Maternally
11 1977136 cg02657360 < 600 IC1 (H19DMR)
11 2111008 cg22956483 IGF2 DMR2
Paternally
22751499 cg02125271
< 100
15
22752317 cg22555495 < 300
SNRPN Maternally