a novel vaccine against porcine circovirus type 2 (pcv2 ... novel vaccine against porcine... ·...

Sh

A

St

Hua Colb Jia

1. I

Por201whsionexagen

Veterinary Microbiology xxx (2014) xxx–xxx

A R

Artic

Rece

Rece

Acce

Keyw

Porc

Stre

Reco

Vacc

*

Agri

G Model

VETMIC-6565; No. of Pages 8

PlSt

m

http

037

ort Communication

novel vaccine against Porcine circovirus type 2 (PCV2) andreptococcus equi ssp. zooepidemicus (SEZ) co-infection

i-xing Lin a, Zhe Ma a, Xu-qiu Yang a, Hong-jie Fan a,b,*, Cheng-ping Lu a

lege of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

ngsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, China

ntroduction

Porcine circovirus type 2 (PCV2) is the main pathogen ofcine circovirus associated disease (PCVAD) (Rose et al.,2). PCV2 preferentially targets the lymphoid tissues,

ich leads to lymphoid depletion and immunosuppres- in pigs (Wikstrom et al., 2011). PCVAD would be

cerbated by concurrent infections with other patho-s, such as porcine reproductive and respiratory

syndrome virus (PRRSV) and Streptococcus equi ssp.

zooepidemicus (SEZ) (Metwally et al., 2010; Opriessniget al., 2008). The capsid protein (Cap) which binds to hostcell receptors, is the primary immunogenic protein ofPCV2, and thus has been the target for development ofvaccines of PCV2.

SEZ infects a wide range of animals, including equine,swine, bovine, ovine, avian, canine, feline, and harbor seals(Akineden et al., 2005; Blum et al., 2010). In China, SEZ isthe main pathogen of swine streptococcosis (Wei et al.,2012). Humans may also be infected by SEZ via consumingcontaminated food or having close contact with theinfected animals (Kuusi et al., 2006). M-like protein(SzP) is a cell surface-anchored protein that conveys

T I C L E I N F O

le history:

ived 30 December 2013

ived in revised form 7 March 2014

pted 10 March 2014

ords:

ine circovirus type 2

ptococcus equi ssp. zooepidemicus

mbinant swinepox virus

ine

A B S T R A C T

To develop a vaccine against Porcine circovirus type 2 (PCV2) and Streptococcus equi ssp.

zooepidemicus (SEZ) co-infection, the genes of porcine IL-18, capsid protein (Cap) of PCV2

and M-like protein (SzP) of SEZ were inserted into the swinepox virus (SPV) genome by

homologous recombination. The recombinant swinepox virus rSPV-ICS was verified by

PCR and indirect immunofluorescence assays. To evaluate the immunogenicity of rSPV-

ICS, 28 PCV2 and SEZ seronegative Bama minipigs were immunized with rSPV-ICS (n = 8),

commercial PCV2 vaccine and SEZ vaccine (n = 8) or wild type SPV (n = 8). The results

showed that SzP-specific antibody and PCV2 neutralizing antibody of the rSPV-ICS

immunized group increased significantly compared to the wild type SPV treated group

after vaccination and increased continuously over time. The levels of IL-4 and IFN-g in the

rSPV-ICS immunized group were significantly higher than the other three groups,

respectively. After been co-challenged with PCV2 and SEZ, 87.5% piglets in rSPV-ICS

immunized group were survived. Significant reductions in gross lung lesion score,

histopathological lung lesion score, and lymph node lesion score were noticed in the rSPV-

ICS immunized group compared with the wtSPV treated group. The results suggested that

the recombinant rSPV-ICS provided piglets with significant protection against PCV2-SEZ

co-infection; thus, it offers proof-of-principle for the development of a vaccine for the

prevention of these swine diseases.

� 2014 Elsevier B.V. All rights reserved.

Corresponding author at: College of Veterinary Medicine, Nanjing

cultural University, Nanjing, China. Tel.: +86 25 84395605.

E-mail address: [email protected] (H.-j. Fan).

Contents lists available at ScienceDirect

Veterinary Microbiology

jo u rn al ho m epag e: ww w.els evier .c o m/lo cat e/vetmic

://dx.doi.org/10.1016/j.vetmic.2014.03.018

ease cite this article in press as: Lin, H.-x., et al., A novel vaccine against Porcine circovirus type 2 (PCV2) andreptococcus equi ssp. zooepidemicus (SEZ) co-infection. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vet-ic.2014.03.018

8-1135/� 2014 Elsevier B.V. All rights reserved.

http://dx.doi.org/10.1016/j.vetmic.2014.03.018

mailto:[email protected]



http://www.sciencedirect.com/science/journal/03781135


H.-x. Lin et al. / Veterinary Microbiology xxx (2014) xxx–xxx2

G Model


phagocytosis resistance and is an important protectiveantigen, so M-like protein is therefore an ideal target fordeveloping a vaccine against SEZ infections.

In previous studies, we constructed several recombinantSPV vaccines expressing protective antigens of swinepathogens, such as the recombinant rSPV-MRP expressingmuramidase-released protein (MRP) of Streptococcus suis,the recombinant rSPV-szp expressing M-like protein (SzP) ofSEZ and the recombinant rSPV-cap expressing capsidprotein (Cap) of PCV2 (Huang et al., 2012; Lin et al., 2011,2012), respectively. The results showed that all of therecombinant SPV could express the foreign gene for morethan 30 passages and could provide the immunized animalswith significant protections. In this study, a recombinantswinepox virus co-expressing porcine IL-18, Cap and SzPwas constructed and the potential of using the recombinantswinepox virus as a porcine vaccine candidate against PCV2and SEZ co-infections also had been explored.

2. Materials and methods

2.1. Viruses, cells and animals

Wild type swinepox virus (wtSPV, Kasza strain, VR-363TM) and PCV-free PK-15 cells (CCL-33TM) used in thisstudy were purchased from the American Type CultureCollection (ATCC). Twenty-eight 21 day old PCV2 and SEZseronegative gnotobiotic Bama minipigs were purchasedfrom Shanghai Academy of Agricultural Sciences. Theywere randomly divided into four groups and housed in fourseparate rooms. All experimental protocols were approvedby the Laboratory Animal Monitoring Committee ofJiangsu Province and performed accordingly.

2.2. Construction of the transfer vector

The transfer vector pUSG11/P28ICS was constructedusing the pUC19 plasmid (Takara) backbone (Fig. 1). A1.1 kb flanking region upstream of SPV016 (GenBank:AF410153), containing SPV020, SPV019, SPV018 andSPV017 was amplified from the SPV genomic DNA usingprimers LF1/LF2 (Table 1); a 1.4 kb flanking regiondownstream of SPV022, containing SPV021 and SPV020(Huang et al., 2012), was amplified using primers RF1/RF2(Table 1). These two PCR amplicons were cloned intopUC19 to construct the plasmid pUS01. A 774 bp GFP genewith the promoter P11 sequence was amplified from thepEGFP-N1 plasmid (Takara) using primers 11G1/11G2(Table 1). A 78 bp DNA fragment containing the promoterP28 sequence and a multiple cloning site (MCS) wasformed by annealing of oligonucleotides 28M1/28M2(Table 1). These two fragments were cloned into theplasmid pUS01 to construct the plasmid pUSG11/P28.Finally, the 576 bp porcine IL-18 gene (GenBank:AF191088.1) was amplified from the total RNA extractsof swine spleen cells by RT-PCR using primers IL181/IL182(Table 1); the 699 bp cap gene (GenBank: JN382185.2) wasamplified from the PCV2 genomic DNA using primersCAP1/CAP2 (Table 1); the partial 1, 041 bp szp gene(GenBank: EU624402) was amplified from the SEZATCC35246 genomic DNA using primers SZP1/SZP2

(Table 1); These three fragments were cloned into theplasmid pUSG11/P28 to create the recombinant plasmidpUSZ11/P28ICS.

2.3. Construction and identification of the recombinant

swinepox virus

The recombinant swinepox virus rSPV-ICS was con-structed by homologous recombination of wtSPV withpUSG11/P28ICS as previously described (Lin et al., 2011).Briefly, PK-15 cells grown in a 6-well plate were infectedwith the SPV (m.o.i. of 0.05) for 1 h, and subsequentlytransfected with 4.0 mg of the pUSG11/P28ICS plasmidusing ExfectTM Transfection Reagent (Vazyme Biotech Co.,Ltd.). The cells were collected after 4 days of incubation in2 ml EMEM medium with 2.0% FBS. The virus was releasedby freezing and thawing of the cell suspension three times.The appropriate dilution of the lysate was used to infectPK-15 cells grown in a 6-well plate, for the furtherpurification of the recombinant virus. The rSPV-ICS wasidentified by PCR, western blot and indirect immunofluo-rescence (Lin et al., 2011).

2.4. Animal experimental design

Twenty-eight 21 day old PCV2 and SEZ seronegativegnotobiotic Bama minipigs were purchased from ShanghaiAcademy of Agricultural Sciences. The piglets wererandomly divided into four groups and housed in fourseparate rooms. Group1 (n = 8) was vaccinated intramus-cularly with rSPV-ICS by 5.0 � 106 TCID50 per piglet.Group2 (n = 8) was vaccinated intramuscularly, followingthe recommended dose, with 1 ml commercial PCV2vaccine (Boerhringer Ingelheim Vetmedica Inc.) and 1 mlcommercial SEZ vaccine (Nanjing Tianbang Bio-industryCo., Ltd.) per piglet. Group 3 (n = 8) and group 4 (n = 4) werethe challenge control (intramuscularly treated with5.0 � 106 TCID50 wtSPV) and empty control (withouttreatment), respectively. All piglets were boosted withsame dose 14 days later. At 37 days post primaryinoculation, Groups 1, 2, and 3 were challenged withPCV2 (1.0 � 105 TCID50, oronasally) and SEZ(4.0 � 107 CFU, intramuscularly). The animals were moni-tored for 14 days post-challenge; rectal temperatures,clinical signs, average daily weight gain (ADG) andmortality were observed daily by observers blinded totheir vaccination status (Lin et al., 2012). At the end ofexperiment, the pigs of each group were euthanized fornecropsy and pathological examination.

2.5. Serology

Before and after vaccination, sera samples werecollected at 7-day intervals for detection of SzP-specificantibodies (Lin et al., 2011) and PCV2 neutralizingantibodies (Wang et al., 2006) as previously described.

2.6. rSPV-ICS induced immune reactions

The levels of serum IFN-g and IL-4 induced by rSPV-ICSwere investigated to evaluate the cellular immune

Please cite this article in press as: Lin, H.-x., et al., A novel vaccine against Porcine circovirus type 2 (PCV2) andStreptococcus equi ssp. zooepidemicus (SEZ) co-infection. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vet-mic.2014.03.018



Administrator

高亮

resandIL-2phaproantimmsurdetthegen

Fig.

viru

H.-x. Lin et al. / Veterinary Microbiology xxx (2014) xxx–xxx 3

G Model


PlSt

m

ponse. Immune responses were mainly evoked by Th1 Th2 T-cell subgroups. Th1 cells, which produce IFN-g,

and TNF-b, evoke cell-mediated immunity andgocyte-dependent inflammation. Th2 cells, whichduce IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13, evoke strongibody responses and eosinophil accumulation. The

une response type was assessed indirectly by mea-ing the levels of IFN-g and IL-4 in serum. They wereected using ELISA kits (ExCell Bio, China) according to manufacturer’s instructions. Standard curves were

twofold in PBS and coated onto ELISA plates overnight at37 8C. The levels of serum IFN-g and IL-4 were calculatedaccording to their corresponding standard curves.

2.7. Gross pathology and histopathology evaluation

The total extent of macroscopic lung lesions, thehistopathological changes in lung and lymph nodes foreach treatment were estimated and calculated as previ-ously described (Straw et al., 1986). Observers were

1. Construction of the transfer vector pUSG11/P28ICS. LF and RF respectively indicate left flanking sequences and right flanking sequences of swinepox

s (SPV). P11 and P28 are vaccinia virus (VV) promoters. The gene of GFP reporter is also included in the plasmid.

ded to vaccination status.
erated using control IFN-g and IL-4 serially diluted blin




G Model


2.8. Statistical analysis

All data were analyzed using one-way ANOVA andvalues of P < 0.05 were considered statistically significant.

3. Results

3.1. Construction and identification of the recombinant

swinepox virus

A cloning system was developed to generate therecombinant swinepox virus rSPV-ICS. The foreign geneswere inserted into the SPV genome by homologousrecombination and the recombinant SPV was screenedusing the GFP reporter (Fig. 2).

The genome of rSPV-ICS was analyzed by PCR usingprimers IL181/IL182, Cap1/Cap2 and SzP1/SzP2, whichamplified the gene fragments present in the recombinantvirus, but not in the wtSPV (Fig. 3). To ensure the viralgenomic DNA of rSPV-ICS clones without mutation, onepair of oligonucleotide primers rSPV1/rSPV2 (Table 1)annealing in the flanking regions were designed to amplify2543 bp of all inserted genes. The amplified products weresequenced, and the results proved the genetic homogeneityand genetic stability of all recombinant virus. Western blotanalysis verified the gene products of approximately 41 kDa(SzP), 28 kDa (Cap) and 22 kDa (IL-18) in size, which weredetected in rSPV-ICS infected PK-15 cells (Fig. 4).

An indirect immunofluorescence assay was used toverify the expression and localization of IL-18, Cap and SzP.

Fig. 2. The genome of rSPV-ICS. LF and RF respectively indicate left flanking sequences and right flanking sequences of SPV. GFP was the reporter gene.

Table 1

Primers used in this study.

Primer Sequence (50–30) Restriction

enzyme

Target gene

LF1 GAATTCTAAATCTACTTCTTCAACGG EcoR I LF

LF2 GGTACCTATAACTACTAGGTCCACAC Kpn I

RF1 CTCGAGAGGCGATTATTTATGTTATTA Xho I RF

RF2 AAGCTTATTTTTATCCTATTGTTGTTC Hind III

11G1 GCGGCCGCTTTACTTGTACAGCTCGTCCAT Not I P11; GFP

11G2 CTCGAGATATAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATGAACATGGTGAGCAAGGGCGAGGAG Xho I

28M1 CAGATCTTTTTTTTTTTTTTTTTTTTTGGCATATAAATGGTCGACTCGAGAGCTCCCGGGGATCCATCGATGC P28 promoter; MCS

28M2 GCGGCCGCATCGATGGATCCCCGGGAGCTCTCGAGTCGACCATTTATATGCCAAAAAAAAAAAAAAAAAAAAAG

ATCTGGTACC

Not I; Kpn I

IL181 GTCGACATGGCTGCTGAACCGGA Sal I Porcine IL-18

IL182 GAGCTCGTTCTTGTTTTGAACAGTGAACATT Sac I

CAP1 GAGCTCAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATATGAATGGCATCTTCAACACCC Sac I P11 promoter; cap

CAP2 GGATCCAGGGTTAAGTGGGGGGT BamH I

SZP1 GCGGCCGCCTTTTTTTTTTTTTTTTTTTTGGCATATAAATGGATTCTGTTGAGTCAGCTAAG Not I P28 promoter; szp

SZP2 GGATCCGTTTTCTTTGCGTCTTG BamH I

rSPV1 GTGTGGACCTAGTAGTTATAGGTACCAG All inserted genes

rSPV2 GCAAAGACCCCAACGAGAA

Italic = restriction enzyme site.

Fig. 3. PCR analysis of rSPV-ICS. Lane M: DL5000 DNA marker. Lane 1: wtSPV (template), IL181/IL182 (primers). Lane 2: rSPV-ICS, IL181/IL182. Lane 3:

wtSPV, CAP1/CAP2. Lane 4: rSPV-ICS, CAP1/CAP2. Lane 5: wtSPV, SZP1/SZP2. Lane 6: rSPV-ICS, SZP1/SZP2.




A sinfedetthemoweide

3.2.

obs

Fig.

Lane

Lane

app

Fig.

cyto


G Model


PlSt

m

ignificant red fluorescence was observed in rSPV-capcted cells, whereas no specific red fluorescence was

ected in the wtSPV infected cells (Fig. 5). The majority of Cap was distributed throughout the cytoplasm. Ofre than 30 passages of rSPV-ICS infected cells, PCR,stern blot and IFA analysis of the lysate were able tontify the genes and gene products, respectively.

Clinical evaluation after vaccination

Prior to PCV2 and SEZ challenge, no clinical signs wereerved in the four groups. The rectal temperature of the

four groups was all below 40.0 8C and no pox spot or papulewas observed on the skin surface including injection sites.The average daily weight gain (ADG) difference of the fourgroups was not significant.

3.3. Detection of SzP-specific antibody

ELISA analysis showed that a SzP-specific antibodyresponse was detected in the rSPV-ICS immunized group7 days after the first immunization. The antibody level ofthe rSPV-ICS immunized group gradually increased tomaximum titers of 2180 at 35 days after the firstvaccination. The difference of the rSPV-ICS immunizedgroup and the commercial SEZ vaccine immunized groupwas not significant in 4 weeks. The antibody level of therSPV-ICS immunized group (2180) was significant higherthan the commercial SEZ vaccine immunized group(420) at 35 days post-vaccination (P < 0.05). No signifi-cant SzP-specific antibody was observed between thewtSPV treated group and the empty control group.

3.4. Detection of PCV2 neutralizing antibody

For detecting the PCV2 neutralizing activity of serafrom immunized piglets, PK15 cells were challengedwith PCV2. The results showed that the sera of the rSPV-ICS immunized group protected PK15 cells from PCV2challenge in vitro, with neutralizing titers up to 1:49 on35 days after first immunization, whereas sera from thewtSPV treated or empty control group showed noneutralization activity. The antibody titers of the rSPV-ICS vaccinated group were significantly higher than thecommercial PCV2 and SEZ vaccines vaccinated group(P < 0.05) by day 14, 28 and 35 post-vaccination.

4. Western blot assay of rSPV-ICS. Lane M: prestained protein ladder.

1: rSPV-ICS with mAbs for SzP. Lane 2: rSPV-ICS with mAbs for Cap.

3: rSPV-ICS with PcAbs for IL-18. The arrow at the right indicates the

roximately size.

5. Indirect immunofluorescence assay of rSPV-ICS. Red fluorescence could be observed in rSPV-ICS infected cells with the fluorescence localized to the

plasm. No fluorescence was observed in cells infected with wtSPV.





G Model


3.5. IL-4 and IFN-g detection

Changes in serum IL-4 and IFN-g levels in immunizedpiglets were analyzed using ELISA kits (ExCell Bio, China)according to the manufacturer’s instructions. The resultsshowed that the levels of IL-4 and IFN-g in the rSPV-ICSimmunized group were significantly higher than the otherthree groups (P < 0.05), respectively (Figs. 6 and 7).

3.6. Clinical signs after challenge

All piglets in the wtSPV treated group showed severeclinical symptoms, including rough hair, decreased mobil-ity, arthritis, septicemia, and died within 4 days. Incontrast, eight piglets immunized with the commercialPCV2 vaccine and the commercial SEZ vaccine showedno obvious clinical symptoms and were survived during

the trial period. However, one piglet in the rSPV-ICSimmunized group showed moderate arthritis and died on 4days post-challenge. The survival rate of the rSPV-ICSvaccinated group was 87.5%. The results indicated thatrSPV-ICS provided piglets with a strong protection againstPCV2 and SEZ co-challenge.

3.7. Gross pathology and histopathology studies

Gross lesions were observed of the lungs in the wtSPVtreated group, including severe pulmonary congestion andatrophy. A significant reduction in gross lung lesion scoreswas noted in the rSPV-ICS immunized group comparedwith the wtSPV treated group (P < 0.05). Meanwhile, nosignificant difference was observed between the rSPV-ICSimmunized group and the commercial PCV2 vaccine andthe commercial SEZ vaccine immunized group (Table 2).

For the morphometric analysis of histopathologicalpulmonary changes, severe interstitial congestion andthickening, alveolar neutrophil infiltration, and interstitiallymphocyte infiltration were observed. A significantreduction in histopathological lung lesion scores wasnoted in the rSPV-ICS immunized group compared withthe wtSPV treated group (P < 0.05). Meanwhile, nosignificant difference was observed between the rSPV-ICS immunized group and the commercial PCV2 vaccineand the commercial SEZ vaccine immunized group. Noobvious histopathological pulmonary lesions were ob-served in the empty control group (Table 2).

Multifocal lymphoid congestion and necrosis accom-panied by inflammatory cells infiltration were observed inthe lymph nodes of the wtSPV treated group. Morphomet-ric analysis of histopathological changes in the lymph nodeshowed a significant reduction of histopathological lymphnode lesion scores in the rSPV-ICS immunized groupcompared with the wtSPV treated group (P < 0.05).Meanwhile, no significant difference was observed be-tween the rSPV-ICS immunized group and the commercialPCV2 vaccine and the commercial SEZ vaccine immunizedgroup. No histopathological lymph node lesions wereobserved in the empty control group.

4. Discussion

PCV2 infection could lead to immunosuppression inpigs, and, therefore, more prone to develop co-infections,

0

50

100

150

200

250

300

0 7 14 21 28 35

Days post vacc ination

IL-4

(pg

/ml)

rSPV-ICS

SEZ+PCV2

wtSPV

empty control

Fig. 6. The IL-4 levels post-vaccination. The IL-4 level of the rSPV-ICS

vaccinated group was significantly higher than the commercial PCV2 and

SEZ vaccines vaccinated group and the wtSPV treated group (P < 0.05) by

day 14, 21, 28 and 35 post-vaccination.

0

100

200

300

400

500

600

700

800

900

1000

0 7 14 21 28 35

Days post vacc ination

IFN

-γ(p

g/m

l)

rSP V-ICS

SEZ+PCV2

wtSP V

empty co ntrol

Fig. 7. The IFN-g levels post-vaccination. The IFN-g level of the rSPV-ICS

vaccinated group was significantly higher than the commercial PCV2 and

SEZ vaccines vaccinated group and the wtSPV treated group (P < 0.05) by

day 7, 14, 21, 28 and 35 post-vaccination.

Table 2

Lung lesion scores and lymph node lesion scores of different treatment groups (group mean � standard error).

Group n Lung lesion Lymph node lesion

Gross scorea Microscopic scoreb Microscopic scorec

rSPV-ICS 8 0.72 � 0.47 1.33 � 0.32 0.51 � 0.24

SEZ + PCV2 8 0.63 � 0.30 1.28 � 0.33 0.45 � 0.15

wtSPV 8 8.57 � 0.73* 6.63 � 0.52* 4.35 � 0.44*

Empty control 4 0.00 � 0.00 0.00 � 0.00 0.00 � 0.00

a Ranges from 0 (normal) to 10 (severe lesions).b Ranges from 0 (no lesion visible) to 9 (severe lesions).c Ranges from 0 (normal) to 5 (severe lymphoid depletion and granulomatous replacement).

* Indicates significantly (P < 0.05) higher lesion scores of the wtSPV treated group compared to the rSPV-ICS immunized group and the commercial PCV2

and SEZ vaccines immunized group.




sucavavac(SPbecand(XuDNproposchrvirainfeeffiof s

proenhoucandfacimpet

exptypSimwittheimmNK18

andThethis

ICSthemincancomspebodhigPCVprochanovICSexplevstim

patwaandinfepreoccbennovdet


G Model


PlSt

m

h as SEZ (Wikstrom et al., 2011). Majority of currentlyilable vaccines against PCV2 or SEZ are inactivatedcines or subunit vaccines. Recombinant swinepox virusV) immunization represents a novel vaccine strategy,ause of their ease of production, safety, and stability,

also can induce both cellular and humoral immunity et al., 2013). SPV possesses a large double strandedA genome and a host range limited to swine. SPV onlypagate strictly in the cytoplasm, which avoids thesibility of the integration of its genome into the host’somosome. And the processing and presentation of thel epitope occurs in a way that is similar to naturalction. Many studies have already demonstrated the

cacy of recombinant SPV expressing protective antigenswine pathogens.Cytokine adjuvants have been widely used tomote the induction of immune responses andance the immune-protectiveness of vaccines (Bar-h et al., 2004; Buglione-Corbett et al., 2013; Decker

Safdar, 2011). IL-18, also known as IFN-g inducingtor (IGIF), is a pleiotropic cytokine that plays anortant role in both innate and acquired immunity (Li

al., 2009; Schneider et al., 2010). IL-18 mRNA isressed in a wide range of cells, including variouses of immune competent cells and non-immune cells.ilar to IL-1 in structure, its function is consistenth IL-12 (Takeda et al., 1998), that mainly reflected in

T cell and the enhancement of cell-mediatedunity. In particular, IL-18 augments cytotoxicity of

cells and enhances the activity of T and NK cells. IL-is a unique cytokine that enhances innate immunity

both Th1 and Th2 type immune responses.refore, we chose porcine IL-18 as the adjuvant for

recombinant swine poxvirus vaccine.In this study, we constructed a recombinant SPV (rSPV-) co-expressing the porcine IL-18, the Cap of PCV2 and

SzP of SEZ, and tested its immunogenicity in Bamaipigs. The result showed that vaccinated with rSPV-ICS

induce capacity immune responses as vaccinated withmercial PCV2 vaccine and SEZ vaccine. The SzP-

cific antibody response and PCV2 neutralizing anti-ies of the rSPV-ICS vaccinated piglets were significantly

her than the wtSPV treated piglets and the commercial2 and SEZ vaccines immunized group. The immuno-

tection of rSPV-ICS vaccinated piglets against co-llenge of PCV2 and SEZ was 87.5%, indicating that thisel vaccine was effective. The protective efficacy of rSPV-

could be enhanced significantly by simultaneousression of porcine IL-18. The serum IL-4 and IFN-g

els in immunized piglets indicated that rSPV-ICS hadulated both Th1 and Th2-mediated immune responses.

In conclusion, the results of immune response andhogens challenge showed that the rSPV-ICS vaccines able to elicit strong cellular and humoral response

was able to protect piglets from PCV2 and SEZ co-ction. This new construction will avoid immunosup-

ssion caused by PCV2 infection and prevent theurrence of streptococcal disease, so it would beeficial to swine producers. The effectiveness of thisel vaccine in actual field application remains to be

Acknowledgements

This study was supported by Program from the NationalBasic Research Program (973) of China (2012CB518804),the National Transgenic Major Program (2014ZX08009-046B), the Jiangsu Agriculture Science and TechnologyInnovation Fund (CX(12)3078), the Jiangsu ProvinceScience and Technology Support Program (BE2013433),the National Natural Science Foundation of China(31272581 and 31172319) and the Project Funded bythe Priority Academic Program Development of JiangsuHigher Education Institutions.

References

Akineden, O., Hassan, A., Alber, J., El-Sayed, A., Estoepangestie, A.T.,Lammler, C., Weiss, R., Siebert, U., 2005. Phenotypic and genotypicproperties of Streptococcus equi subsp. zooepidemicus isolated fromharbor seals (Phoca vitulina) from the German North Sea during thephocine distemper outbreak in 2002. Vet. Microbiol. 110, 147–152.

Barouch, D.H., Letvin, N.L., Seder, R.A., 2004. The role of cytokine DNAs asvaccine adjuvants for optimizing cellular immune responses. Immu-nol. Rev. 202, 266–274.

Blum, S., Elad, D., Zukin, N., Lysnyansky, I., Weisblith, L., Perl, S., Netanel,O., David, D., 2010. Outbreak of Streptococcus equi subsp. zooepi-demicus infections in cats. Vet. Microbiol. 144, 236–239.

Buglione-Corbett, R., Pouliot, K., Marty-Roix, R., West, K., Wang, S., Lien,E., Lu, S., 2013. Serum cytokine profiles associated with specificadjuvants used in a DNA prime-protein boost vaccination strategy.PloS ONE 8, e74820.

Decker, W.K., Safdar, A., 2011. Cytokine adjuvants for vaccine therapy ofneoplastic and infectious disease. Cytokine Growth Factor Rev. 22,177–187.

Huang, D., Zhu, H., Lin, H., Xu, J., Lu, C., 2012. First insights into theprotective effects of a recombinant swinepox virus expressing trun-cated MRP of Streptococcus suis type 2 in mice. Berl. Munch. Tierarztl.Wochenschr. 125, 144–152.

Kuusi, M., Lahti, E., Virolainen, A., Hatakka, M., Vuento, R., Rantala, L.,Vuopio-Varkila, J., Seuna, E., Karppelin, M., Hakkinen, M., Takkinen, J.,Gindonis, V., Siponen, K., Huotari, K., 2006. An outbreak of Strepto-coccus equi subspecies zooepidemicus associated with consumption offresh goat cheese. BMC Infect. Dis. 6, 36.

Li, W., Yamamoto, H., Kubo, S., Okamura, H., 2009. Modulation of innateimmunity by IL-18. J. Reprod. Immunol. 83, 101–105.

Lin, H.X., Huang, D.Y., Wang, Y., Lu, C.P., Fan, H.J., 2011. A novel vaccineagainst Streptococcus equi ssp. zooepidemicus infections: the recom-binant swinepox virus expressing M-like protein. Vaccine 29, 7027–7034.

Lin, H.X., Ma, Z., Fan, H.J., Lu, C.P., 2012. Construction and immunogenicityof recombinant swinepox virus expressing capsid protein of PCV2.Vaccine 30, 6307–6313.

Metwally, S., Mohamed, F., Faaberg, K., Burrage, T., Prarat, M., Moran, K.,Bracht, A., Mayr, G., Berninger, M., Koster, L., To, T.L., Nguyen, V.L.,Reising, M., Landgraf, J., Cox, L., Lubroth, J., Carrillo, C., 2010. Patho-genicity and molecular characterization of emerging porcine repro-ductive and respiratory syndrome virus in Vietnam in 2007.Transboundary Emerg. Dis. 57, 315–329.

Opriessnig, T., Madson, D.M., Prickett, J.R., Kuhar, D., Lunney, J.K., Elsener,J., Halbur, P.G., 2008. Effect of Porcine circovirus type 2 (PCV2)vaccination on porcine reproductive and respiratory syndrome virus(PRRSV) and PCV2 coinfection. Vet. Microbiol. 131, 103–114.

Rose, N., Opriessnig, T., Grasland, B., Jestin, A., 2012. Epidemiology andtransmission of Porcine circovirus type 2 (PCV2). Virus Res. 164, 78–89.

Schneider, B.E., Korbel, D., Hagens, K., Koch, M., Raupach, B., Enders, J.,Kaufmann, S.H., Mittrucker, H.W., Schaible, U.E., 2010. A role for IL-18in protective immunity against Mycobacterium tuberculosis. Eur. J.Immunol. 40, 396–405.

Straw, B.E., Backstrom, L., Lehman, A.D., 1986. Examination of swine atslaughter. Part II. Findings at slaughter and their significance. Comp.Contin. Educ. Pract. Vet. 8, S106–S122.

Takeda, K., Tsutsui, H., Yoshimoto, T., Adachi, O., Yoshida, N., Kishimoto, T.,
Okamura, H., Nakanishi, K., Akira, S., 1998. Defective NK cell activityand Th1 response in IL-18-deficient mice. Immunity 8, 383–390. ermined in the future.

http://refhub.elsevier.com/S0378-1135(14)00168-0/sbref0005




















































G Model


Wang, X., Jiang, W., Jiang, P., Li, Y., Feng, Z., Xu, J., 2006. Construction andimmunogenicity of recombinant adenovirus expressing the capsidprotein of Porcine circovirus 2 (PCV2) in mice. Vaccine 24, 3374–3380.

Wei, Z., Fu, Q., Chen, Y., Cong, P., Xiao, S., Mo, D., He, Z., Liu, X., 2012. Thecapsule of Streptococcus equi ssp. zooepidemicus is a target for attenu-ation in vaccine development. Vaccine 30, 4670–4675.

Wikstrom, F.H., Fossum, C., Fuxler, L., Kruse, R., Lovgren, T., 2011.Cytokine induction by immunostimulatory DNA in porcine PBMC

is impaired by a hairpin forming sequence motif from the genome ofPorcine circovirus type 2 (PCV2). Vet. Immunol. Immunopathol. 139,156–166.

Xu, J., Huang, D., Liu, S., Lin, H., Zhu, H., Liu, B., Chen, W., Lu, C., 2013.Immune responses and protective efficacy of a recombinant swinepoxvirus co-expressing HA1 genes of H3N2 and H1N1 swine influenzavirus in mice and pigs. Vet. Microbiol. 162, 259–264.

















a novel vaccine against porcine circovirus type 2 (pcv2 ... novel vaccine against porcine... ·...

Documents