a poxvirus bidirectional promoter element with early/late and late functions

VIROLOGY179, 151-158/1990)

A Poxvirus Bidirectional Promoter Element with Early/Late and Late Functions

SHARAD KUMAR AND DAVID B. BOYLE’

Commonwealth Soentlfic industrial Research Organisation, Australian Anfmai Health Laboratory, P. 0. Bag 24, Geelong, Victoria 3220, Australia

Receivedjanuary 22, 1990; accepted /u/y 2, 1990

A novel bidirectional promoter element of fowlpox virus (FPV) was characterized by transcription analysis, transient expression assays, and recombinant virus construction. This promoter element contained an early/late and a late func-

tion in opposite orientation, all within 42 bp of the DNA sequence. The 42-bp sequence was sufficient to express two reporter genes simultaneously in a temporally regulated manner. Both early and late mRNA from the early/late pro-

moter originated at the same TAAAT motif and lacked a long 5’-poly(A) leader sequence. Late mRNA, initiated from a TAAAT motif of the oppositely oriented late promoter strand, had a leader sequence of approximately 26 bases. Se-

quence alignment of two strands of the bidirectional element showed that 28 of 42 bases matched. Because of its small and defined size as well as unique structure, this bidirectional promoter should prove to be an important tool in

defining the sequences required for the temporal regulation of poxvirus genes. Q 1990 Academic PWS, IW.

INTRODUCTION

Transcriptional regulation of gene expression in eu- karyotes is a complex process involving the co-operative action of a number of transcription factors, promoter-specific DNA-binding proteins and RNA polymerase II (for reviews see Dynan and Tjian, 1985; Mitchell and Tjian, 1989). Nuclear DNA viruses (e.g., SV40 and herpes simplex 1) and retroviruses (e.g., HIVl) employ similar mechanisms and their regulatory sequences share similarities with their eukaryotic host cell regulatory elements (Dynan and Tjian, 1983; Jones et al., 1985; Ratner et al., 1985).

Poxviruses replicate in the cytoplasm of their host cells (Moss, 1985) and hence are unable to interact with the host cell transcription factors located in the nucleus. The expression of poxvirus genes is temporally regulated (Moss, 1985). Virus infection is followed by two distinct phases of gene expression, pre- and post-replication of DNA or early and late, respectively (Moss and Flexner, 1987). A third class of genes, dere- pressed upon DNA replication (intermediate), has been recently described (Vos and Stunnenberg, 1988). The transcription of early genes, commencing immediately after infection, is carried out by factors contained within the virus particles (Wei and Moss, 1975; Ba- roudy and Moss, 1980; Rohrmann et a/., 1986) while late gene transcription is dependent upon virus DNA replication and early gene products. A common feature of late genes is the presence of a conserved TAAAT motif nearthe transcription start site (Rose1 eta/., 1986;

’ To whom requests for reprints should be addressed.

Hanggi et al., 1986). With the exception of the cowpox virus major late gene (Pate1 and Pickup, 1987), late gene mRNAs have heterogenous 3’-ends because of transcriptional read-through by RNA polymerase in the late phase of infection. Another feature of late mRNAs is the presence of a 5’-poly(A) head, probably gener- ated by slippage of RNA polymerase at the TAAAT motif (Pate1 and Pickup, 1987; Schwer et al., 1987). The mechanisms of temporal regulation of the poxvirus genes are poorly understood. Sequences upstream of early genes of vaccinia virus (VV) share some homol- ogy (Vassef, 1987); however, the elements controlling temporal regulation have not been identified. Sequence-specific proteins which bind to the upstream region of early and late genes have been impli- cated in the regulation of transcription (Yuen et a/., 1987; Miner and Hruby, 1989). Analysis of an early/late promoter of VV (P7.5) showed that a 3 1 -bp sequence upstream of the early or late start site was enough to maintain the activity and temporal regulation of the promoter (Cochran et al., 1985). For two VV late promoters, PLl 1 and PL28,25-30 bp of DNA upstream of the RNA start site was sufficient for late gene expression (Weir and Moss, 1987). These observations suggested that the information required for the temporal regulation of poxvirus genes is contained within short sequences upstream of the RNA transcription start sites.

Recently we have characterized a major early/late gene of fowipox virus (FPV) (Kumar and Boyle, 1989). In the present article we show that the upstream region of this gene contains a bidirectional promoter element within a short DNA sequence of 42 bp. It has both early/late and late functions in opposite orientations.

151 0042-6822190 $3.00 CopyrIght c) 1990 by Academic Press, Inc All rights of reprodu<tson I” any form reserved

152 KUMAR AND BOYLE

Both early and late mRNAs from the early/late promoter initiate at the same transcription start site and the late mRNA originating from this promoter lacks a long poly- (A) leader sequence. The novel structure of this promoter element should make it an important tool for the study of regulation of poxvirus gene expression.

MATERIALS AND METHODS

Virus and cell culture

FPV was grown and maintained in chicken embryo skin (CES) cells (Boyle and Coupar, 1988). VV-WR strain and recombinants were grown in human 1438 or CV-1 cells (Boyle eta/., 1985).

Sl nuclease analysis of the 5’-ends of transcripts

Forty micrograms of total cellular RNA was hybridized to 32P-labeled ssDNA probe at 40” for 16-l 8 hr followed by treatment with 200 units/ml of Sl nuclease for 1 hr at 25”. Protected fragments were resolved on 6-89ib sequencing gels (Davis et a/., 1986).

Construction of plasmids and recombinant viruses

To assess the promoter activity, DNA sequence composing both the early/late and late mRNA start sites, as well as codons for the first two amino acids (ATG and following 3 bases) flanked by Salt linkers, was synthesized and cloned into the &/I site of pUC12 in both orientations (pSKO6 and pSK07, respectively). A BamHl fragment from pGH101 containing the LacZ gene of Escherichia co/i (Herman et al., 1986) was then placed downstream of the promoters at the BamHl sites of pSKO6 and pSK07 to generate pSK08 and pSKO9, respectively(Fig. 2f. Forthe transfer of chimeric genes into the genome of poxviruses, the 105bp ~coRl/~~~dlll fragment from pSKO6 or pSKO7 was cloned into fcoRl/~;~dl~l sites of pJ43 and pDBi 8 con- tanning VV-TK and FPV-TK genes, respect;vely (Boyle et a/., 1985; Boyle and Coupar, 1988), to generate pSK12, f3, 14, and 15, respectively. LacZ and CAT genes were then placed on either side of the promoter element in the BamHl and Hindlll sites, respectively. The structures of resultant plasmids (pSK20, pSK22, and pSK24) are shown in Fig. 3. Recombinant VV (from pSK20) and FPV (from pSK22 and 24) were constructed by established techniques (Boyle et al., 1985; Boyle and Coupar, 1988) and purified by four cycles of plaque purification.

Transient expression of BG and CAT

Transient expression assays using plasmids containing promoter and reporter gene constructs were

carried out as described (Chakrabarti eta/., 1985) using 25 pg of plasmid DNA and 3 X 10” CV-1 cells/plate.

Time course of BG and CAT expressed by recombinant FPV

CES cells were infected with recombinant viruses at a multiplicity of 20-30 PFU/cell and incubated with or without 50 pglml of cytosine arabinoside (AraC). At the indj~ated times, monolayers were washed twice with PBS and harvested into 0.5 ml of a buffer containing 0.25 M sucrose, 10 mNI Tris-HCI, pH 7.6, and f mM EDTA. Cells were lysed by four cycles of freezing and thawing and clarified by centrifugation, and aliquots of the supernatant (l-20 hg protein) were used for BG and CAT assays according to published methods (Mil- ler, 1972; Gorman et a/., 1982).

Pulse labeling of polypeptides

Monolayers of 143B cells were infected with VV recombinants at a multiplicity of 30 PFU/cells and incubated in the presence or absence of 50 gglml of AraC. Proteins were labeled for 7 0 min with 50 &i/ml of L-

~35S~methionine after an incubation for 15 min in methionine-free medium. Cells were harvested in PBS and solubilized by the addition of 2X Laemmli buffer followed by boiling for IO min prior to electrophoresis on 10% polyacrylamide-SDS gels (Laemmli, 1970).

Primer extension analysis of mRNA transcript

Total cellular RNA (20 pg) from virus-infected cells was annealed to a 32P-labeled CAT primer which was then extended with reverse transcriptase in the presence of deoxy nucleotides (Pate1 and Pickup, 1987). Primer extended products were analyzed on 8% sequencing gels (Davis et al., 1986).

RESULTS

Characterization of a late mRNA start site upstream and in opposite orientation to an early/late mRNA start site

Using Northern hybridization analysis we have mapped a major early/late gene of FPV to the Pstl F fragment of the FPV genome (Kumar and Boyle, 1989). Analysis of the 5’-ends of mRNA transcribed from this gene showed that the start site of both early and late transcripts map to the sequence TAAAT near the trans- lation start site (ATG). The sequence upstream of the early/late gene contained another open reading frame (ORF) starting 35 bp from the early/late gene and in the opposite orientation. This ORF started with a TAAAT G sequence suggesting that it may be a late gene. Sl nuclease analysis of mRNA transcripts from this gene

POXVIRUS BIDIRECTIONAL PROMOTER 153

B E/L-

Pfam,

=A‘,

I ECORl

k-

5’ b

Probe (453 bases) 3’

FIG. 1. St nuclease analysis of FPV RNA. 32P-labeled ssDNA probe

complementary to the RNA-like strand was prepared by extending a 15-mer oligonucleotide located 124 bp downstream of the C/al site

on a ssDNA template in the presence of [32P]dCTP and Klenow fragment of DNA polymerase, followed by digestion with EcoRl and isola-

tion of the 453.base probe from sequencing gels. (A) Probe (P) was hybridized to total cellular RNA isolated from uninfected cells (lane 1)

or from FPV-infected cell incubated in the presence of 100 pg/ml cycloheximide (lane 2) or 50 pg/ml AraC (lane 3), or with no addition (lane 4). Following Sl treatment of DNA/RNA hybrids, the protected

fragments were analyzed on 6% sequencing gels, alongside a se-

quencing ladder obtained by using the same primer and DNA template as used for the preparation of probe and 32P-labeled Hpall cut pBR322 fragments (M). The sequences around the protected frag-

ments are shown for the RNA-like strand. (B) Diagrammatic representation of the bidirectional promoter of FPV. E/L and L are early/late

and late start sites, respectively, of the two oppositely oriented

genes.

mapped the 5’-ends of late transcripts to the TAAAT sequence and a ATTA sequence 30 bp upstream (Fig. 1). No early mRNA protected fragments were detected confirming that this was a late gene. Large Sl nuclease resistant fragments in Fig. 1 represented heteroge- neous 3’-ends of a late gene further upstream (S.K., unpublished data). The 40-bp DNA between the early/late and late genes contained a potential bidirectional promoter.

Activity of bidirectional promoter element in transient expression assays

To assess promoter activities, plasmids containing a reporter gene downstream of the bidirectional promoter element were constructed (Figs. 2 and 3) and used in transient expression assays. The results indicated that both the early/late and late promoters were functional (Tables 1 and 2). The temporal regulation of the late promoter was maintained since the inclusion of AraC inhibited the expression of reporter genes in pSKO9 and pSK24. However, in the presence of AraC an accumulation of gene product was evident when the early/late promoter was used to express reporter genes (pSK08, 20, 22, and 24). The /3-galactosidase (BG) expression data showed that the activity of the early/late promoter was approximately six times that of the oppositely oriented late promoter. With a mutant of the early/late promoter (pSK08A), where the region upstream of the mRNA start site was deleted, BG activity was completely abolished (Table 1). Deletion of 2 bp near the late RNA start site (pSKO9A) resulted in complete loss of late promoter function (Fig. 1; Table 1). While this 2-bp deletion abolished late function it can- not be excluded that another late promoter element not contained within the synthetic promoter is operational in virus since an additional late transcription start site ATTA was identified by Sl nuclease analysis of transcripts. These deletion experiments confirmed that the expression of LacZ was under control of the bidirectional promoter element and not some fortituous upstream sequences.

In plasmid constructs where both LacZ and chloramphenicol acetyltransferase (CAT) genes were placed on either side of the bidirectional promoter element (pSK20, 22, and 24) both genes were expressed simultaneously and their respective temporal regulation was maintained. Differences in LacXAT activity ra- tios under control of the late promoter (20% of early/ late for BG to 40% of early/late for CAT) were apparent (Table 2); however, these differences were not observed with FPV recombinants examined later (Fig. 4).

The results in Table 2 show that activity of the FPV early/late promoter was equal to that of VV-PLl 1 and about three times that of the late function of VV-P7.5. These relative values of promoter strengths should be interpreted with the qualification that factors other than promoter strength, e.g., translational efficiency and mRNA stability, may influence levels of gene expression which have been used here as a measure of promoter strength.

Temporal regulation of the bidirectional promoter in recombinant viruses

The data above showed that the bidirectional promoter functioned in both directions in the VV-transient

154 KUMAR AND BOYLE

A fz E rc : 0

-10 v CCaTTT*GT*T~~****TTG*~~TGT*ATTP_T*AT

pSK06

pSK07 GTAAATCATAGG-AZTTTAACTT-gCATTAATA-G$TATTATTT$CCT

= s e

Y I

6 E/L

~AGCCATTTAGTATCCTAAAATTGAATT~~TAATTATCGATAATAA~A~~ PSKOS

E/L

T!GATAATAA%AC~~ PSKOBA

pSK09 'L~~ZCGGTAAATCATAGGATTTTAACTTAACATTAATAGCTATTATTTACCTG~

-L

FIG. 2. Construction of plasmids used in the transient expression experiments. (A) Two complementary 56.base oligonucleotides representing

both strands of the bidirectional promoter, flanked by SalI linkers, were annealed and then cloned into the Sal1 site of pUC12 in both orientations (pSKO6 and pSK07). The mRNA start sites and the directions of early/late (E/L) and late (L) transcription are indicated and the ATGs of the two

genes are underlined. (6) pSK08 and pSKO9 were constructed by cloning the E. co/i LacZ gene into BamHl sites of pSKO6 and pSK07, respectively. In pSK08A, the sequence between the C/al and HindIll sites has been deleted. In pSKOSA, 2 bp near the late transcription start site has been deleted. For pSK08 and pSK08A promoter sequences are shown for the top strand (5’-3’) while for pSKO9 and pSKO9A promoter se-

quences are shown for the bottom strand (3’-5’).

expression system (Tables 1 and 2). To investigate if the transient expression results faithfully mirror the viral genome location of the promoter-gene constructs, recombinant FPVs were constructed using pSK22 and pSK24 in which the promoter reporter chimera was in- serted into the TK region of viral genome. In time course experiments, activities of LacZ and CAT were monitored in the presence and absence of AraC. The results showed that in both viruses, LacZ and CAT were expressed under control of their respective promoter elements in a temporally regulated manner (Fig. 4). Inclusion of AraC resulted in a 509/o inhibition of both reporter gene products under control of the early/late promoter indicating that half of the promoter activity was contributed by the late function (Fig. 4). As ex- pected, AraC treatment resulted in complete abolition of late promoter expressed reporter gene products (Fig. 4).

As these time course and transient expression experiments demonstrated the steady-state levels of protein only at the time of measurement, we have also carried out pulse labeling experiments to determine the rates of protein synthesis at given stages of infection. A recombinant VV, containing LacZ under control of the early/late promoter element (derived from pSK20), was used alongside a VV-PLl 1 -LacZ recombinant as a control. VV recombinants were used because VV infection of the host cell results in the inhibition of host cell

protein synthesis and thus during later stages of infection 35S-labeled viral-coded polypeptides can be easily identified by fluorography. The control experiments

pSK1.S

E/L oSK20

I.

E/L pSK 22

L

L pSK24

- E/L

pTP 4

FIG. 3. Diagrammatic representation of the W and FPV vector plasmids used in transient expression system and recombinant virus construction. The directions of early/late (E/L) and late (L) transcription from the bidirectional promoter(P) and the orientation of other cloned genes are indicated by arrows.


TABLE 1

BG EXPRESSION BY PLASMIO CONSTRUCTS CONTAININGTHE FPV PROMOTERS IN VV-TRANSIENT EXPRESSION SYSTEM

BG activity

Plasmid construct -AraC +AraC

pSK08 (LacZ-E/L) 71 101

pSK08 (Lad-A E/L) 0.2 0

pSKO9 (LacZ-L) 13 0.5 pSKO9 (LacZ-AL) 0.3 0

pSK08 (no virus infection) 0 0

Note. BG activity is expressed as micromoles of 0-nitrophenol

(ONP) produced per 3 X 10” cells per hour at 28”. E/L and L are early/ late and late elements of the FPV bidirectional promoter.

with VV-PLl I-LacZ showed a typical example of BG expression under control of a late promoter which was completely inhibited by the inclusion of AraC (Fig. 5A). On the other hand, in the VV recombinant in which LacZ was placed downstream of the early/late promoter (VV-P E/L-LacZ), BG was detected immediately after virus infection (2 hr) and was not inhibited by AraC during early stages of virus infection (Fig. 5B). How- ever, a clear inhibition of BG rate of synthesis by AraC was observed later in the infection (after 6 hr of infection). We concluded that this was caused by the inhibition of the late function of the early/late promoter.

Analysis of the 5’-ends of reporter gene mRNA expressed by recombinant FPV

Sl nuclease protection analysis of BG and CAT mRNA from FPV recombinant infected cells revealed that the 5’-ends of these transcripts mapped to the pre- dicted respective TAAAT motifs for both the early/late

TABLE 2

BG AND CAT EXPRESSION BY PLASMID CONSTRUCTS CONTAINING VV

AND FPV PROMOTERS IN VV-TRANSIENT EXPRESSION SYSTEM

BG activity CAT activity

Plasmid construct -AraC +AraC -AraC +AraC

pSKl8 (LacZ-E/L) 50 69 - pSK20 (LacZ-E/L, CAT-L) 53 65 26 0.8 pSK22 (LacZ-E/L, CAT-L) 49 60 30 3 pSK24 (CAT-E/L, LacZ-L) 9 0.5 61 77

pTP4 (LacZ-P7.5) 14 0.4 - - pDB22-LacZ(LacZ-PLl l) 50 0.7

Note. E/L and L are early/late and late elements of the FPV bidirec-

tional promoter. BG activity is expressed as micromoles of ONP produced per 3 X lo6 cells per hour at 28” while CAT activity is ex-

pressed as nanomoles chloramphenicol acetylated per 3 X 1 O6 cells per hour at 37”

1 I I 0 2s so 75 loo0 2!i 50 75 loo

Tmo(hrpoetMeettcln)

FIG. 4. Time course of BG and CAT activities in CES cells Infected

with two recombinant FPV. (A) FPV recombinant derived from pSK22 (LacZ under control of early/late promoter, CAT under control of late

promoter). (B) FPV recombinant derived from pSK24 (CAT under control of early/late promoter, LacZ under control of late promoter). Cells

were infected at a multiplicity of 20 PFUlcell and incubated in the

presence (0, A) or absence (0, A.) of 50 pg/ml of AraC. BG (0, 0) and CAT (A, A) activities were momtored in cell extracts at indicated times. One unit of BG is defined as pmol ONP produced/min at 28”,

while 1 unit of CAT is nmol of chloramphenlcol acetylatedlmin at 37”.

and late promoters (data not shown). Since poxvirus late mRNAs have poly(A) leader sequences (Pate1 and Pickup, 1987; Schwer et al., 1987) it was of interest to analyze the 5’-ends of recombinant FPV-expressed BG

A Time (hr post infection)

u u B

Time (hr Do& infection)

-Are c *Are c

FIG. 5. Pulse labeling of polypeptides in cells infected with VV-LacZ recombinants. Human 1438 cells were Infected at a multiplicity of

30 PFWcell of either (A) VV-PLl 1 -LacZ or(B) VV-PE/L-LacZ and incubated with or without 50 pg/ml of AraC. At indicated times postinfec- tion, cells were pulse labeled with [35S]methionine for 10 mln after a

15-min methionine starvation period. Solubilized protein samples were electrophoresed on 10% polyacrylamide gels and autoradio-

graphed. The position of BG is indicated by arrowheads. Only rele- vant portions of the gels are shown.

156 KUMAR AND BOYLE

FIG. 6. Primer extension analysis of 5’.ends of CAT mRNA ex-

pressed by FPV recombinants. A 32P-labeled 26-base primercomple- mentary to bases +71 to +96 of CAT mRNA-like strand was an-

nealed to 20 pg early (+A) or late (-A) RNA from virus-infected cells. Primer was extended with 30 units of reverse transcriptase at 42” for

30 min and products were analyzed on 8% sequencing gels. PL-CAT and PEWCAT are two FPV recombinants in which CAT gene was

placed under control of the late and early/late promoters, respectively. The average sizes of primer extended products in bases is shown. The 97.base product maps to position -1 of the early/late

promoter (Fig. 2).

and CAT mRNA transcripts by primer extension. As ex- pected, the product of primer extension for CAT late mRNA expressed by the late promoter (PL-CAT) was approximately 26 bases longer than the Sl product indicating the presence of a 5’-leader sequence unre- lated to the upstream promoter sequence (Fig. 6). On the other hand, primer extended products of both the CAT early and late mRNA expressed from the early/late promoter (PE/L-CAT) mapped to the TAAAT sequence indicating the lack of a long 5’-leader sequence (Fig. 6).

Similar results were obtained for LacZ mRNA produced from either VV or FPV recombinants (data not shown).

DISCUSSION

Because of the cytoplasmic location of poxvirus replication, poxvirus promoters are unique and differ from eukaryotic and bacterial promoters (Moss and Flexner, 1987). The promoter described in the present study is a novel poxvirus element for three reasons. First, it is a small sequence of DNA with bidirectional promoter activity having head to head early/late and late functions in apparently palindromic sequences (Fig. 7). Second, early and late mRNA start sites of the early/

late promoter map to the same site on DNA. Third, the late mRNAs originating from the early/late start site lack long 5’ poly(A) leader sequences.

The early/late promoter of FPV is distinctly different from the only other well-characterized early/late poxvirus promoter, VV-P7.5, which has two mRNA start sites, approximately 60 bp apart, and used specifically during early or late stages of infection (Cochran et a/., 1985). Unlike VV-P7.5, the early and late functions of the FPV promoter are contained within the same short sequence of DNA. Another important aspect of this element is the strength of the early/late promoter function which was as strong as the VV-PLl 1 promoter, making it the strongest known poxvirus early/late promoter. The bidirectional function of the promoter was clearly demonstrated by the transient expression experiments as well as by the expression of two reporter genes simultaneously in recombinant viruses. Not only is this short DNA sequence able to express genes placed downstream of it, but it also contains enough information to temporally regulate their respective ex- pressions. From earlier deletion studies with vaccinia virus promoters, it is apparent that both early and late promoters require short DNA sequences of less than 40 bp for both optimal expression and temporal regulation (Weir and Moss, 1987). This observation is further substantiated by the results presented in the present study. It is also clear that the TAAAT sequence com- prising the late transcription site (Rose1 et a/., 1986; Hanggi eta/., 1986) is essential for late gene transcription, as mutations within or near the TAAAT motif abol- ish transcriptional activity of the promoters; however, what determines the strength of late promoters re- mains unclear. The results with the VV-PLl 1 promoter indicate that base deletions in a stretch of T residues upstream of the transcription start site can drastically affect the promoter activity (Cochran et al., 1985; Ber- tholet et a/., 1986). Hence, it is possible that the sequences directly upstream of the RNA start site of late promoters determine their relative strengths, while the TAAAT sequence is involved in their temporal regulation.

The components required for poxvirus early gene transcription which follows immediately after infection of the host cell are contained within the virus core (Wei and Moss, 1975; Baroudy and Moss, 1980; Rohrman et a/., 1986). How the RNA polymerase contained within the virus particles discriminates between early

S’ATHAQTATCCTAAAAHQAA HQTAAHATCQA TAATAAAT -I, E /L +m+ l *** t* + l * ** l l t l * ** l * ***

S’-ATTTATTATCQATAATTACAATTCAATTTTAQQATACTAAAT -I> L

FIG. 7. Alignment of early/late and late promoter elements of bidirectional promoter.


and late promoters is not understood. A &-acting element which binds to the 5’-upstream region of the gene may play an important function in the early gene transcriptional regulation (Yuen eta/., 1987). A comparison of the sequence of the FPV early/late element with other poxvirus early gene upstream regions showed short regions of similarities (Kumar and Boyle, 1989). An alignment of the FPV early/late and FPV late element (or two strands of the bidirectional element) showed that 28 of 42 bases match (Fig. 7). This may identify the regions of dissimilarity which could define the functional aspects of the promoters. With site-directed mutagenesis it should be possible to identify the regions responsible for temporal regulation. Our pre- liminary results indicate that a single base substitution in the late promoter can change its function to early/ late (Kumar, unpublished data). More detailed studies involving site-directed mutagenesis and DNA/protein interaction are under way.

Another interesting observation was the use of the same start site by the early/late promoter during both early and late stages of infection and the apparent lack of a long 5’-poly(A) head on late mRNA originating from this start site. The rpo 132 gene of cowpox virus has recently been shown to have two transcriptional start sites, one of which is operative both at early times and at late times. Neither early nor late transcripts originating from this site contain long 5’-terminal poly(A) lead- ers (Pate1 and Pickup, 1989). Transcription start sites of several poxvirus early genes share little similarity (Vassef, 1987) and it is possible that the RNA polymerase binding site is determined by its distance from a c&acting element binding site rather than the sequence of the transcription start site itself. An earlier observation that a c&acting element binds to sequences approximately 20-25 bp upstream of the transcription start site (Yuen et al., 1987) supports this no- tion. Substitutions around the FPV early/late start site should provide evidence whether the sequence of the start site or the distance from the cis-element binding site determines the temporal regulation of the early genes.

Because of the strong early/late function associated with this FPV promoter, it should be useful in developing poxvirus expression vectors in general and espe- ciallywhen high levels of expression of an early product are required. Recent studies have shown that, at least in some cases, early expressed products of recombinant viruses would be preferred because of the lack of ability of late expressed gene products to stimulate T cell responses (Coupar et al., 1986; Townsend et a/., 1988; Wachsman et al., 1989). This should be an important consideration in developing a recombinant poxvirus as a vaccine.

ACKNOWLEDGMENTS

We thank Adam Foord for skilled technlcal assistance. SK. was supported in part by a National Research Fellowship from the Depart-

ments of Science, Australia.

REFERENCES

BAROUDY, B. M., and Moss, B. (1980). Purification and charactenza- tion of a DNA-dependent RNA polymerase from vacclnia vlrions. 1.

Biol. Chem. 255, 4372-4380. BERTHOLET, C., STOCCO, P., VAN MEIR, E., and WITTEK. R. (1986).

Functional analysis of the 5’flanking sequences of a vaccinia virus lategene. EMBO/. 5. 1951-1957.

BOYLE, D. B., and COUPAR, B. E. H. (1988). Construction of recombl- nant fowlpox viruses as vectors for poultry vaccines. Virus Res. 10,

343-356. BOYLE, D. B., COUPAR, 8. E. H., and BOTH, G. W. (1985). Multiple-

cloning-site plasmlds for the rapid construction of recombinant poxviruses. Gene 35, 169-l 77.

CHAKRABARTI, S., BRECHLING, K., and Moss, B. (1985). Vaccinia virus expression vector: Coexpression of p-galactosldase provides vi-

sual screening of recombinant virus plaques. MO/. Cell. Bioi. 5, 3403-3409.

COCHRAN, M. A., MACKETT, M., and Moss, B. (1985). Eukaryotic transient expression system dependent on transcriptjon factors and

regulatory DNA sequences of vacclnia virus. Proc. /Vat/. Acad. So. USA 82, 19-23.

COUPAR, B. E H., ANDREW, M. E., BOTH, G. W., and BOYLE, D. B. (1986). Temporal regulation of influenza hemagglutinln expression

in vacclnia virus recombinants and effects on the Immune re- sponse. Eur. J. lmmunol. 16, 1479-l 487.

DAVIS, L. G., DIBNER, M. D., and BATEY, J. F. (1986). “Basic Methods in Molecular Biology.” Elsevier Scientific New York.

DYNAN, W. S.. and TJIAN, R. (1983). The promoter-specific transcnp- tlon factor Spl binds to upstream sequences in the SV40 early

promoter. Cell 35,79-87. DYNAN. W. S., and TJIAN, R. (1985). Control of eukaryotic messenger

RNA synthesis by sequence-specific DNA-binding proteins. Na-

ture (London) 316,774-778. GORMAN, C. M.. MOFFAT, L. F., and HOWARD, B. H. (1982). Recombi-

nant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Bioi. 2, 1044- 105 1

HANGGI, M., BANNWARTH, W., and STUNNENBERG, H. G. (1986). Con- served TAAAT motif in vacclnia virus late promoters: Overlapplng TATA box and site of transcription Inltlatlon. EMBO J. 5, 1071-

1076.

HERMAN, G. E , O’BRIEN, W. E., and BEAUDET, A. L. (1986). An f. co//[% galactosidase cassette suitable for study of eukaryotlc expression.

Nucleic Acids Res. 14, 7 130. JONES, K. A , YAMAMOTO, K. R., and TJIAN. R. (1985). Two distinct tran-

scription factors bind to the HSV thymidine klnase promoter In vi-

tro. Ceil 42, 559--572.

KUMAR, S., and BOYLE, D. 8. (1989). Mapping of a major early/late gene of fowlpox virus. Virus Res 15, 175-l 86.

LAEMMLI, U. K. (1970). Cleavage of structural proteins during the as- sembly of the head of bacteriophage T4. /Vature (London) 227, 680-685.

MILLER, J. H. (1972). “Experiments In Molecular Genetics.” Cold

Spring Harbor Laboratory, Cold Spring Harbor, NY MINER, J. N.. and HRUBY, D. E. (1989). DNA sequences that regulate

expressjon of a vaccinia virus late gene (L65) and interact with a DNA-blnding protein from infected cells. /. VKO/. 63, 2726-2736.

MITCHELL, P. J., and TJIAN, R. (1989). Transcnptlonal regulation in mammallan cells by sequence-speclflc DNA binding proteins. SC/- ence 245,37 l-378.

158 KUMAR AND BOYLE

Moss, B. (1985). ln “Virology” (B. N. Fields, Ed.), pp. 685-703. Ra- ven Press, New York.

Moss, B., and FLEXNER, C. (1987). Vaccinia virus expression vectors.

Annu. Rev. Immunol. 6,305-324.

PATEL, D. D., and PICKUP, D. J. (1987). Messenger RNAs of a strongly- expressed late gene of cowpox virus contain 5’-terminal poly(A) sequences. EMBO J. 6,3787-3794.

PATEL, D. D., and PICKUP, D. J. (1989). The second-largest subunit of the poxvirus RNA polymerase is similar to the corresponding subunits of procaryotic and eucaryotic RNA polymerases. /. Viral.

63,1076-l 086. RATNER, L., HASELTINE, W.. PATARCA, R., LIVAK, K. J., STARCICH. B.,

JOSEPHS, S. F., DORAN, E. R., RAFALSKI, 1. A., WHITEHORN, E. A.,

BAUMEISTER. K.. IVANOFF, L., PET~EWAY, S. R., PEARSON, M. L., LAUTENBERGER, J. A.. PAPAS, T. S.. GHRAYEB, J., CHANG, N. T., GALLO,

R. C., and WONG-STAAL, F. (1985). Complete nucleotide sequence of the AIDS virus HTLV-III. Nature (London) 313,277-284.

ROHRMANN, G., YUEN, L., and Moss, B. (1986). Transcription of vaccinia virus early genes by enzymes isolated from vaccinia virions

terminates downstream of a regulatory sequence. Cell 46, 1029-

1035. ROSEL, 1. L., EARL, P. L., WEIR, J. P., and Moss, B. (1986). Conserved

TAAATG sequence at the transcriptional and translational initia-

tion sites of vaccinia virus late genes deduced by structural and

functional analysis of the Hind III H genome fragment. J. Viral. 60, 436-449.

SCHWER, B., VISCA, P., Vos, 1. C., and STUNNENBERG, H. G. (1987).

Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5’ poly(A) leader. Ce// 50, 163-l 69.

TOWNSEND, A., BASTIN, J., GOULD, K., BROWNLEE, G., ANDREW, M.,

COUPAR, B., BOYLE, D., CHAN, S., and SMITH, G. (1988). Defective

presentation to class l-restricted cytotoxic T lymphocytes in vac- ciniainfected cells is overcome by enhanced degradation of anti-

gen./. Exp. Med. 168, 1211-1224. VASSEF, A. (1987). Conserved sequences near the early transcription

start sites of vaccinia virus. Nucleic Acids Res. 15, 1427-l 443. Vos, J. C.. and STUNNENBERG, H. G. (1988). Derepression of a novel

class of vaccinia virus genes upon DNA replication. EMBO 1. 7,

3487-3492. WACHSMAN, M., AURELIAN, L., SMITH, C. C., PERKUS, M. E., and PAOLE-

TTI, E. (1989). Regulation of expression of herpes simplex virus (HSV) glycoprotein D in vaccinia recombinants affects their ability

to protect from cutaneous HSV-2 disease. J. Infect. Dis. 159,625- 634.

WEI, C. M., and Moss, B. (1975). Methylated nucleotides block 5’ terminus of vaccinia virus messenger RNA. Proc. Nat/. Acad. Sci.

USA 72,318-322. WEIR, J. P., and Moss, B. (1987). Determination of the transcriptional

regulatory region of a vaccinia late gene. f. Viral. 61, 75-80.

YUEN, L., DAVISON, A. J., and Moss, B. (1987). Early promoter-binding factor from vaccinia virions. Proc. Nat/. Acad. Sci, USA 84, 6069- 6073.

a poxvirus bidirectional promoter element with early/late and late functions

Documents