a role for nonessential domain ii of initiator protein ... · product from the template. the...

Copyright � 2009 by the Genetics Society of AmericaDOI: 10.1534/genetics.109.104760

A Role for Nonessential Domain II of Initiator Protein, DnaA,in Replication Control

Kathryn L. Molt, Vincent A. Sutera, Jr., Kathryn K. Moore1 and Susan T. Lovett2

Department of Biology and Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, Massachusetts 02454-9110

Manuscript received May 5, 2009Accepted for publication June 16, 2009

ABSTRACT

The initiation of replication in bacteria is regulated via the initiator protein DnaA. ATP-bound DnaAbinds to multiple sequences at the origin of replication, oriC, unwinding the DNA and promoting thebinding of DnaB helicase. From an Escherichia coli mutant highly perturbed for replication control,obgETTn5-EZ seqAD, we isolated multiple spontaneous suppressor mutants with enhanced growth andviability. These suppressors suppressed the replication control defects of mutants in seqA alone andgenetically mapped to the essential dnaA replication initiator gene. DNA sequence analysis of fourindependent isolates revealed an identical deletion of the DnaA-coding region at a repeatedhexanucleotide sequence, causing a loss of 25 amino acids in domain II of the DnaA protein. Previouswork has established no function for this region of protein, and deletions in the region, unlike otherdomains of the DnaA protein, do not produce lethality. Flow cytometric analysis established that thisallele, dnaAD96-120, ameliorated the over-replication phenotype of seqA mutants and reduced the DNAcontent of wild-type strains; virtually identical effects were produced by loss of the DnaA-positiveregulatory protein DiaA. DiaA binds to multiple DnaA subunits and is thought to promote cooperativeDnaA binding to weak affinity DNA sites through interactions with DnaA in domains I and/or II. ThednaAD96-120 mutation did not affect DiaA binding in pull-down assays, and we propose that domain II, likeDiaA, is required to promote optimal DnaB recruitment to oriC.

REPLICATION initiation in bacteria is controlled bya number of factors that regulate the activity ofthe the AAA1 DnaA protein (reviewed in Messer 2002;Leonard and Grimwade 2005; Kaguni 2006; Katayama2008), the functional and structural equivalent ofeukaryotic Cdc6/Orc proteins. DnaA binds to severalhigh-affinity binding sites, known as DnaA boxes, nearthe origin of replication, oriC, in Escherichia coli. In thepresence of ATP, DnaA binding extends to several othersites by cooperative interactions, ultimately leading tothe melting of an AT-rich region in oriC. The replicativehelicase, DnaB, escorted by DnaC, is then recruited tothis site, through interactions with the DnaA protein.Once the helicase is assembled on DNA, other factorsincluding the DNA polymerase holoenzyme, processivityclamp, and primase bind to establish bidirectionalreplication forks emanating from oriC.

A number of regulatory systems impinge on replica-tion initiation via DnaA. One of these involves SeqA, aprotein that binds cooperatively to GATC sites found inabundance near the origin. SeqA’s binding is strongerwhen such sites are hemi-methylated by DNA adenine

methylase (Dam), a situation that occurs transientlyafter these sequences are replicated. The binding ofSeqA ‘‘sequesters’’ the origin (hence its name) and pre-vents it from accessing Dam and becoming fully methy-lated for up to one-third of the cell cycle (Campbell andKleckner 1990; Lu et al. 1994; von Freiesleben et al.2000). This sequestration establishes an ‘‘eclipse’’ pe-riod, a time at which binding of DnaA and reinitiation isactively prevented. In seqA mutants, cells initiate repli-cation more frequently and more asynchronously thanwild-type cells.

A second system controls initiation capacity by alter-ing the levels of ATP-bound DnaA protein. A proteinhomologous to DnaA (Hda, for homolog of DnaA)binds the processivity clamp, b, and DnaA, promotinghydrolysis of ATP (Kato and Katayama 2001). Mutantsin hda are somewhat inviable and show over-replication,particularly when DnaA levels are elevated (Kato andKatayama 2001; Camara et al. 2005; Riber et al. 2006;Fujimitsu et al. 2008).

In addition to these negative regulators, the DiaAprotein positively regulates replication initiation. Mu-tants in diaA were isolated as suppressors of mutants indnaA that over-initiate replication. By itself, loss of diaAis not lethal but modestly reduces replication initiationfrequency and average DNA content per cell and altersthe timing and synchrony of initiation (Ishida et al.

1Present address: Oregon Health and Science University, 3181 S. W. SamJackson Park Rd., Portland, OR 97239-3098.

2Corresponding author: Brandeis University, 415 South St., MS029,Waltham, MA 02454-9110. E-mail: [email protected]

Genetics 183: 39–49 (September 2009)

2004). DiaA forms a tetramer and directly interacts withmultiple DnaA molecules and in vitro recruits DnaA tosites in oriC to stimulate open complex formation(Keyamura et al. 2007). It has been proposed that DnaAcooperative binding, especially to low-affinity sites de-pendent on the ATP-bound form of DnaA, may bepromoted by DiaA.

We became interested in SeqA while studying factorsthat promoted survival to chronic exposure to low levelsof replication inhibitors (Sutera and Lovett 2006).Mutants in seqA and dam were sensitive to such agents,such as hydroxyurea and azidothymidine; this sensitivitywas exacerbated under fast-growth conditions duringwhich E. coli has multiple ongoing replication cycles.The sensitivity of seqA mutants to fork damage could besuppressed by two mutations in dnaA that reducedreplication initiation efficiency. This study concludedthat convergence of an unrestrained replication forkonto the site of previous damage was the basis of thissensitivity.

Another mutant similarly sensitive to fork inhibitorswas in the conserved GTPase, obgE (Foti et al. 2005).Hypomorphic alleles of obgE caused by C-terminal inser-tion of a Tn5-EZ transposon or mutation in the GTPasemotif caused sensitivity to replication inhibitors. More-over, these obgE alleles caused more inviability incombination with recA and recB, mutations that blockdouble-strand break repair, especially when confrontedwith agents that slow or block DNA replication forkprogression. We concluded that forks are more vulner-able to breakage or collapse in the obgE mutants. We alsonoted effects of obgE on replication initiation: in min-imal medium, cells defective in obgE or overexpressingobgE had asynchronously initiated more replicationforks than wild-type cells, as deduced by flow cytometry.

Combining mutations in seqA with obgE caused syner-gistic effects on cell viability and DNA damage sensitivity(Foti et al. 2005). A double mutant in seqA and obgEformed extremely small colonies on rich medium andwas much more sensitive, relative to either single mutant,to DNA damage. The phenotype of seqA obgE doublemutants was unstable, and we observed the formation oflarge-colony suppressor variants that arose spontane-ously. In this study, we characterize these suppressormutations and show them to be caused by a single non-lethal deletion in domain II of the replication initiatorprotein DnaA. The phenotypes caused by this allele areconsistent with reduction of replication initiation, prop-erties that are shared by the loss of the positive regulatoryprotein DiaA. This work therefore establishes a role fordomain II in the regulation of replication initiation,potentially in conjunction with DiaA.

MATERIALS AND METHODS

Bacterial strains and media: All strains used in this study(Table 1) are derivations of E. coli K12 and isogenic to MG1655

(Bachmann 1996). P1 vira transduction was used to constructstrains (Miller 1992). Two types of liquid media were used forgrowth: Luria–Bertani (LB) medium (Miller 1992) or 56/2minimal medium (Willetts et al. 1969) with plate mediacontaining 1.5% w/v of agar. Antibiotics were used at finalconcentration of 100 mg/ml ampicillin, 60 mg/ml kanamycin,15 mg/ml tetracycline, and 15 mg/ml chloramphenicol.

Plasmids: Plasmid isolation was done using the GeneEluteplasmid miniprep kit (Sigma Life Science). Plasmid trans-formations were performed by electroporation (Dower et al.1988). Plasmid pSTL377 (His6-DnaA1) was derived from theASKA collection (Kitagawa et al. 2005), and a comparableplasmid expressing His6- dnaAD96-120 was constructed as fol-lows. PCR was performed using pSTL377 as a template withprimers reverse pCA24NDdnaA 59-gacgttgctc gtcactgccgcttgtggcgt ttgcgtcacc-39 and forward pCA24NDdnaA 59-aacgtcccgg ccccggcaga accgacctat cgttctaacg-39. The PCRfragment was cleaned using the Qiaquick PCR purificationkit (Qiagen), ligated using T4 DNA ligase (New EnglandBiolabs), and transformed into MG1655. The resulting con-struct, pSTL378, causes loss of a BsgI site, which was confirmedby restriction digest using BsgI (New England Biolabs).Plasmids expressing DiaA as a biotin-binding domain fusionprotein were constructed using the site-specific recombinationof Gateway Cloning Technology (Invitrogen). PCR was per-formed on MG1655 using diaAB1F 59-ggggacaag tttgtacaaaaaagcaggct tccaagaaag aattaaagct-39 and diaAB2 59-ggggaccactttgtacaaga aagctgggtc ttaatcatcctgg tgagg-39 to produce a diaA1

fragment with attB1 and attB2 regions. The diaA1 fragment wassubjected to a restriction digest with DpnI and cleaned usingthe Qiaquick PCR purification kit to separate the diaA1 PCRproduct from the template. The cleaned diaA1 PCR productwas cloned into the vector pDONR201 via the BP reaction asdescribed in the Gateway Cloning Technology manual (In-vitrogen). The resulting plasmid, pSTL375, was used in the LRreaction with BioEase destination vector pET104.1DEST (In-vitrogen), a vector for an N-terminal fusion to the Klebsiellapneumoniae oxalacetate decarboxylase a-subunit to which bi-otin is covalently bound in vivo. This generated pSTL376,expressing the biotin-binding domain (BBD) as an N-terminalfusion to DiaA under T7 promoter control.

Sequence confirmation: The following primer sets wereused to confirm the sequence of dnaAD96-120: DnaAseq1111r59-tattgtcgatggtgaccagtttttc-39, dnaAseq991f 59-tctaacgtacgtgagctggaagggg-39, dnaAseq811r 59-caacgccgttgatctctttcggata-39,dnaAseq451r 59-ccgccacctggcgagccgccgcgcg-39, and dnaA-seq31f 59-gcccgattgcaggatgagttaccag-39. PCR of DdnaAD96-120was performed by following the amplification method out-lined in the GoTaq Hot Start with Green Buffer with theaddition of adding 0.25 units of the high-fidelity DNA poly-merase Phusion (New England BioLabs). Primers used in theamplification were 61545dnaAGWN1 59-GGGGACAGTT TGTACAAAAA AGCAGGCTTC TATCGACTTT TGTTCGAGTG GAGT-39 and 61546dnaAGWN2 59-GGGGACCACT TTGTACAAGAAAGCTGGT CAAATTTCAT AGGTTTACGA TGACAA-39.Primers DCattL1S 59-TCGCGTTAACGCTAGCATGGATCTC-39 and DCattL2S 59-GTAACATCAG AGATTTTGAG ACAC-39were used to confirm the sequence of pSTL375.

Phenotypic assays: Multiple growth curves were obtainedfor the strains of interest grown in parallel, using aerated flaskcultures and measurement for OD600 with a BioRad Smart-Spec3000 spectrophotometer or in multiwell dishes using aBioScreen C (Oy Growth Curves AB). Values were averagedfor each time point from at least three cultures, allowing thedetermination of doubling times for both 25� and 37�. Platingefficiency of cultures was determined on LB medium supple-mented with AZT (Sigma) at 25 or 50 ng/ml (Foti et al.2005).

40 K. L. Molt et al.

Flow cytometry was used to measure the direct DNA contentper cell and was performed using the PicoGreen stainingmethod previously described (Ferullo et al. 2009). ‘‘Run-out’’conditions included the addition of 300 mg/ml rifampicin and3.2 mg/ml cephalexin to cultures grown to an OD600 of 0.2.Cultures were allowed to grow for an additional 2.5 hr beforeanalysis by flow cytometry using a Becton-Dickinson FACSCa-libur instrument with a 488-nm argon laser. Median DNAcontent was derived using FlowJo software version 6.4.7 fromTreestar.

Pull-down assays for DnaA and DiaA protein binding:Plasmid pSTL376, carrying BBD fusion to DiaA under controlof the T7 promoter, was transformed into BL21(DE3) forprotein expression. Likewise strain MG1655 was transformedwith plasmid pSTL377 (expressing His-tagged DnaA1) orpSTL378 (His-tagged DnaAD), whose expression was con-trolled under the lac promoter. Strains were grown up to anOD600 of 0.6 and then were induced by adding 1 mm IPTG.The cultures were allowed to express for a total of 2 hr ofshaking at 37�. Each culture was then spun down at 4000 rpmat 20� and resuspended 1:100 in Tris–sucrose buffer (50 mmTris 7.5 10% sucrose) and frozen at �20�. Crude cell extracts

were prepared as described (Viswanathan and Lovett 1999)except cells were spun at 17,000 3 g for 15 min.

The binding assay consisted of immobilization of BBD-DiaAon steptavidin beads, followed by application of extractsof His6-DnaA- or His6-DnaAD96-120-expressing cells; boundprotein was detected by Western blotting using an antibodyto the His-tag moiety. One hundred microliters of a 50% slurryof Novagen streptavidin agarose beads were equilibratedthrough three washes with 500 ml of Blank Lysis Buffer[1 mm dithiothreitol (DTT), 200 mm NaCl, 10% w/v ultrapuresucrose, 5 mm Tris, pH 7.5] for each reaction at 4� withrecovery of beads by microcentrifugation at 4900 rpm. Anequal volume of a cleared lysate of BBD-DiaA strain was addedand rotated for 1 hr at 4�. Beads were then gently washed threetimes using 500 ml of high-salt wash buffer (50 mm Tris, pH 7.5,1 m NaCl) and reequilibrated in low-salt wash buffer (50 mmTris, pH 7.5, 150 mm NaCl). For the binding reactions, 90 ml ofHis-tagged DnaA or DnaAD cleared lysate was added to each90 ml of BBD-DiaA-streptavidin beads and rotated for 1 hr at 4�.Samples were washed three times using 500 ml of low-salt washbuffer. The bound protein was eluted by resuspension of 10 mlof beads in 10 ml of 23 FSB [4% sodium dodecyl sulfate (SDS),

TABLE 1

E. coli K-12 strains and plasmids used in this study

Strain (STL) orplasmid (pSTL) Relevant genotype Source or derivation

MG1655 rph-1 E. coli Genetic Stock Center (Bachmann 1996)CAG18433 asnB3057TTn10 rph-1 E. coli Genetic Stock Center (Singer et al. 1989;

Nichols et al. 1998)CAG12072 sfsB203TTn10 rph-1 E. coli Genetic Stock Center (Singer et al. 1989;

Nichols et al. 1998)CAG18499 zid-501T Tn10 rph-1 E. coli Genetic Stock Center (Singer et al. 1989;

Nichols et al. 1998)STL7222 seqADT[FRT cat] rph-1 Sutera and Lovett (2006)STL7742 obgETTn5-EZ rph-1 Foti et al. (2005)STL9122 obgETTn5-EZ seqADT[FRT cat] rph-1 Cmr transductant P1 STL7222 3 STL 7742STL10421 dnaA (oss-1a) obgETTn5-EZ seqADT[FRT cat] rph-1 Large-colony isolate of STL9122STL10422 dnaAD96-120 (oss-2a) obgETTn5-EZ

seqADT[FRT cat] rph-1Large-colony isolate of STL9122

STL10539 zid-502TTn10 obgETTn5-EZ seqADT[FRT cat] rph-1 Tcr transductant P1 CAG18499 3 STL10420,small colony

STL10543 zid-502TTn10 obgETTn5-EZ seqADT[FRT cat] rph-1 Tcr transductant P1 CAG18499 3 STL10421,small colony

STL12648 zid-502TTn10 dnaAD96-120 (oss-1a) obgETTn5-EZseqADT[FRT cat] rph-1

Tcr transductant P1 CAG18499 3 STL10420,large colony

STL12692 dnaAD96-120 zid-501TTn10 F- rph-1 Tcr transductant P1 STL12648 3 MG1655STL12697 seqADT[FRT cat] dnaAD96-120 zid-501TTn10 rph-1 Tcr transductant P1 STL12648 3 STL7222STL12846 diaADT[FRT kan] rph-1 Kmr transductant P1 JW3118

(Baba et al. 2006) 3 MG1655STL12848 seqADT[FRT cat] diaADT[FRT kan] rph-1 Kmr Cmr transductant P1 JW3118

(Baba et al. 2006) 3 STL12692STL12851 dnaAD96-120 zid-501TTn10 diaADT[FRT kan] rph-1 Tcr Kmr transductant P1 STL12842 3 STL12692STL12854 seqADT[FRT cat] dnaAD96-120 zid-501TTn10

diaADT[FRT kan] rph-1Tcr Kmr Cmr transductant P1 STL12842 3 STL12692

pET104.1DEST amp cat BioEaseTM tag InvitrogenpDONOR201 kan cat ccdB InvitrogenpSTL375 kan diaA1 diaA1 in pDONR201pSTL376 amp diaA1 BioEaseTM tag diaA1 in pET104.1DESTpSTL377 cat 6xHis dnaA1 Kitagawa et al. (2005)pSTL378 cat 6xHis dnaAD96-120 Mutant of pSTL377 (this study)

a Genetically mapped and sequenced and identified as dnaAD96-120. Km, kanamycin; Tc, tetracycline; Cm, chloramphenicol.

Role for Nonessential Domain II 41

200 mm DTT, 120 mm Tris, pH 6.8, 0.002% bromophenol blue,10% glycerol]. Additionally, 10 ml of each His6-DnaA1 or His6-DnaAD96-120 lysate was resuspended in 10 ml of 23 FSB to assaysimilarly to determine the amount of input protein for thebinding reactions. As a control, mock-treated BBD-DiaA beadsin which His6-DnaA was not applied were also analyzed. Pro-teins were resolved by SDS–PAGE on 12% acrylamide gels andblotted to PVDF membranes with a mini trans-blot electro-phoretic transfer cell (Biorad), according to the proceduresrecommended by the manufacturer. The detection of His-tagged DnaA proteins followed the QIAexpress detection andassay protocol (Qiagen), using a primary Penta-His antibody, asecondary mouse IgG antibody horseradish-peroxidase conju-gant (GeneTex) and detection by SuperSignal West Picochemiluminescence (Thermo Scientific).

RESULTS

Genetic analysis of spontaneous suppressor muta-tions: Plating of seqADTcat obgETTn5-EZ mutant strainson LB medium at 37� (Foti et al. 2005) showed that thisstrain is extremely poor growing and forms very smallcolonies. (This strain carries a complete deletion of theseqA gene and a C-terminal Tn5 insertion in obgE thatdoes not completely disrupt its essential function but yieldssensitivity to replication inhibitors). However, obviousfast-growing variants were readily apparent in the pop-ulation, indicating that growth under these conditionsselects strongly for such suppressors. We designated thesesuppressors as ‘‘oss,’’ for obgE seqA suppressors, and savedseveral such isolates from independent cultures. WhereasseqA obgE strains had a doubling time of 150 min in LB at37�, oss derivatives had doubling times ranging from 60 to80 min (Table 2); wild-type strains under these conditionsdoubled every 19 min. Flow cytometry showed that theDNA content of the oss-suppressed strains was markedlyreduced relative to nonsuppressed derivatives, suggestingthat the suppressor mutations reduce the efficiency ofDNA replication initiation (Table 2).

To characterize the suppressor mutations genetically,we established conditions under which selection forsuppressors would be diminished. This allowed us toperform genetic crosses under nonselective conditions,after which the presence of the suppressor was deduced

by plating under selective conditions. Mutants in seqAhave been reported to be somewhat cold sensitive forgrowth and more inviable on rich growth medium (Luet al. 1994; von Freiesleben et al. 1994). On LB medium,we found that the double seqA obgE mutant was cold sen-sitive for growth, with very poor colony formation attemperatures ,34� (data not shown), whereas the sup-pressed seqA obgE oss strains formed colonies even at34�. On minimal medium all strains formed colonies,although growth of the seqA obgE strain was strongerat temperatures .34�. Therefore, growth on minimalmedium at 37�–42� relieved selection for suppressors, butthe presence of suppressors could easily be determinedsubsequently at 25�–30� on LB medium, where only seqAobgE oss strains could form robust colonies.

In the first cross, we tested the effect of oss suppressormutations on seqADTcat or obgETTn5-EZ alone. Weintroduced seqA1 or obgE1 by cotransduction with a linkedTn10 insertion in asnB (CAG18433) or sfsB (CAG12072),respectively, in two independent oss derivatives. Selectionfor recombinants was on minimal tetracycline medium at37�; seqA1 was scored by chloramphenicol sensitivity andobgE1 was scored by kanamycin sensitivity. Strains ofgenotype seqADTcat oss formed larger colonies at lowtemperatures than comparable isogenic seqADTcat strains.In contrast, obgETTn5-EZ colonies looked similar whetherthey carried oss or not (data not shown). These resultssuggest that the oss mutations specifically suppress the seqAdeficiency in these strains, which was confirmed anddocumented by the backcrosses described below.

A mutation in dnaA is necessary and sufficient forsuppression of seqA: Because dnaA and seqA mutationsare mutually suppressive (Lu et al. 1994; von Freieslebenet al. 1994; Sutera and Lovett 2006), we performedgenetic crosses to establish whether two independentlyisolated oss mutations mapped near dnaA. We crossedseqA obgE oss strains with a selectable marker, zid-501TTn10, 86% cotransducible with dnaA. P1 transductionswere performed, selecting tetracycline resistance fromP1 grown on the zid-501TTn10 strain (strain CAG18499)and recipients carrying seqA obgE oss-1 or seqA obgE oss-2,with selection on minimal medium with tetracycline at

TABLE 2

SeqA ObgE suppressors and their growth phenotypes in LB at 37�

Strain DescriptionDoubling

timea (min)Median DNAcontent (a.u.)

Colonysize

Temperatureeffects

AZT survival(25 ng/ml)

MG1655 Wild type 19 ND Large — R (1)STL9122 seqA obgE 150 143 Tiny cs S (0.01)STL10421 oss-1 seqA obgE 86 67 Small — R (1)STL10422 oss-2 seqA obgE 86 72 Small — R (1)STL10539 P1 dnaA1 3 oss-1 seqA obgE ND 132 Tiny cs S (0.01)STL10543 P1 dnaA1 3 oss-2 seqA obgE ND 135 Tiny cs S (0.01)

a Doubling time determined with aerobic flask-grown cultures. ND, not determined; cs, cold sensitive for growth; R, resistantwith plating efficiency of 1; S, sensitive with plating efficiency of 0.01.


42�. Isolates from these crosses showed that most trans-ductants became cold sensitive on LB medium at 30�,indicating loss of suppression (Table 2) and inheritanceof oss1. Flow cytometry confirmed that DNA content inthese nonsuppressed transduced derivatives was greaterthan the oss-suppressed original strains. This crosssuggests that the region near dnaA is necessary for seqAsuppression and that the spontaneous suppressor muta-tions could potentially be alleles of this gene.

To determine whether the suppressors resulted frommutations within the dnaA gene, we PCR amplified thislocus from four independent suppressed isolates andsubjected it to DNA sequence determination. As con-trols, four nonsuppressed transductants from the crossabove were also amplified and sequenced. The nonsup-pressed transductants gave the wild-type dnaA sequence.Each of the four oss-suppressed strains carried theidentical mutation, a 75-bp deletion of the dnaA codingregion (Figure 1). This deletion was in-frame, such that25 residues from amino acids 96 to 120 would beremoved from the protein in nonessential domain IIof the DnaA, with other regions intact.

To test whether the dnaA mutation was sufficient tosuppress seqA, we moved the dnaAD96-120 mutation intostrains carrying seqA, using transduction with a linked zid-

501TTn10 tetracycline-resistance marker. These trans-ductants were found to be cold resistant for growth onLB, in contrast to the cold sensitivity for the original seqAstrain (Table 3, Figure 2), confirming that dnaAD96-120alone can suppress seqA.

We tested the ability of the dnaAD96-120 allele tosuppress other phenotypes associated with seqA. Thedoubling time of the dnaAD96-120 seqA strain was sub-stantially diminished relative to dnaA1 seqA strains (Table3); this growth effect was also reflected in colony size onLB medium (Figure 2). Flow cytometry showed that themedian DNA content of seqA strains is reduced bydnaAD96-120, suggesting that it partially reverses the over-replication phenotype of seqA (Figure 3, Table 3). ThednaAD96-120 allele also suppressed the DNA damagesensitivity of the seqA strain, for UV irradiation (data notshown) and to the replication chain terminator, azido-thymidine (Table 3). The suppression of seqA sensitivityby dnaAD96-120 at 25� was virtually complete; at highertemperatures such as 37�, the suppression of AZT sensi-tivity was incomplete, indicating that the dnaAD96-120suppressive effects were somewhat temperature sensitive.

To determine if dnaAD96-120 had effects in the absenceof seqA mutations, the dnaAD96-120 allele was crossed intoseqA1 strains. Such derivatives had wild-type colony

Figure 1.—Map of the DnaA protein and loca-tion of the suppressor allele. The DNA sequenceof the dnaAD96-120, oss suppressor mutation rela-tive to the functional domains of the DnaA pro-tein is shown.

TABLE 3

SeqA suppressors and their phenotypes, with growth in LB at 25� and 37�

Doubling timea (min) Median DNA content (a.u.) AZT survival (50 ng/ml)

Strain Description 25� 37� 25� 37� 25� 37�

MG1655 Wild type 105 51 74 101 0.80 0.18STL7222 seqAD 353 125 140 305 0.00039 0.00038STL12692 dnaAD96-120 118 47 60 60 0.71 0.58STL12697 seqAD dnaAD96-120 127 56 89 85 0.44 0.0025STL12846 diaAD 117 54 64 58 0.83 0.54STL12848 seqAD diaAD 147 73 120 77 0.82 0.0024STL12851 dnaAD96-120 diaAD 109 51 56 68 0.91 0.55STL12854 seqAD dnaAD96-120 diaAD 125 60 84 75 1.1 0.036

a Doubling time determined with microtiter plate grown cultures. a.u., arbitrary units.


morphology (Figure 2) and resistance to AZT (Table 3).Median DNA content in the dnaAD96-120 single mutantwas also somewhat less than wild-type strains, confirmingthat this mutation may reduce initiation efficiency(Table 3, Figure 3). We treated cultures with rifampicinto block replication initiation and cephalexin to blockdivision (so-called ‘‘replication run-out conditions’’);cells complete all replication forks and assume aninteger DNA content, indicative, after flow cytometry,of the number of origins at the time of treatment.Whereas most wild-type strains assumed a 4N and 8Ncontent, dnaAD96-120 strains exhibited a lower DNAcontent after run-out, primarily as 4N (Figure 4). Thissuggests that dnaAD96-120 strains have intrinsically re-duced initiation capacity. We also noted a prominent 6Npeak, suggesting that asynchronous replication is morecommon in this mutant background.

Mutations in DiaA also suppress SeqA: DiaA has beenshown to be a positive regulator of DnaA function inreplication initiation (Ishida et al. 2004). We wonderedwhether loss of diaA would likewise suppress seqA forgrowth defects, over-initiation, and sensitivity to AZT. Inevery respect, loss of DiaA mimicked the effects seen forthe DnaAD mutation: it suppressed the cold sensitivityof seqA, as evident by colony size and doubling time,suppressed the AZT sensitivity, and reduced the over-replication phenotype as revealed by flow cytometry(Figure 3, Figure 4, Table 3). Curiously, like the dnaAD96-120mutation, suppression of the AZT sensitivity of seqA

mutants by loss of diaA was temperature sensitive, withincomplete suppression at 37�. As with dnaAD96-120single mutants, diaA strains had a somewhat lowerDNA content than wild-type strains, as evident incycling and replication ‘‘run-out’’ cultures, indicatinga reduction in replication initiation frequency (Table3, Figure 3, Figure 4). Asynchronous replication, asevident by the 6N peak, was also observed. The doublediaA dnaAD96-120 mutant had virtually identical pheno-typic effects to either single mutant in all phenotypesexcept AZT sensitivity. At 25�, suppression of AZTsensitivity was complete; at 37�, suppression was di-minished and the effects of the two mutations weresomewhat additive on AZT survival, which was very low.

DnaAD96-120 mutants still bind DiaA: DiaA bindsmultivalently to DnaA and is believed to promotecooperative binding of DnaA to lower affinity DNA sitesby recruitment of DnaA. The site of DiaA binding inDnaA has been deduced to be in domain I and/ordomain II (Ishida et al. 2004), the linker region affectedby DnaAD96-120 (Figure 1).

Because the dnaAD96-120 allele could potentially dis-rupt the DiaA-binding site of the protein, we determined,by pull-down experiments, whether the DnaAD96-120 pro-tein retained the ability to interact with DiaA. DiaA wasfused to the BBD, and the fusion protein was expressedin BL21 cells. A cell extract was applied to streptavidinbeads to bind the DiaA fusion protein; these beads werewashed under high-salt conditions to remove other

Figure 2.—Colony morphol-ogy of isogenic dnaA, diaA, andseqA derivatives on LB medium.(Top) Growth at 25�; (bottom)growth at 37�.


Figure 3.—Flow cytomet-ric analysis of DNA contentin dnaA, diaA, and seqA deri-vatives. PicoGreen staininghistograms for cultures ofthe following strainswere grown at 37� in LB me-dium: wild-type MG1655,seqAD STL7222, dnaAD96-120STL12692,dnaAD96-120 seqADSTL12697, diaAD STL12846,diaAD seqAD STL12848, dia-AD dnaAD96-120 STL12851,and diaAD seqAD STL12854.


bound proteins. We expressed His-tagged constructs ofeither DnaA1 or DnaAD96-120 in separate strains. Cellextracts from these were applied to the BBD-DiaA-streptavidin beads and washed with low-salt buffer, andthe bound proteins were resolved by SDS–PAGE. Thepresence of DnaA in the samples was determined byWestern blotting with His6 antibody. DnaA protein wasdetected in the DiaA-bound fraction equally for DnaA1

and for DnaAD96-120 (Figure 5, lanes E and G). As con-trols, we determined that levels of DnaA1 and DnaAD96-120were comparable in the prebound extracts (Figure 5,lanes B and C); no signal was apparent for DiaA beadswhen the His6-DnaA extracts were omitted (Figure 5,lane D). DnaA did not detectably bind mock-treatedbeads with no loaded DiaA (Figure 5, lane H). Theseexperiments indicated that there is no obvious defect inDiaA binding of the DnaAD96-120 protein.

DISCUSSION

DnaA and replication control: The DnaA initiatorprotein controls the timing of bacterial DNA replica-tion. Although DnaA levels appear not to fluctuateduring the cell cycle, the onset of replication isregulated by the ATP-bound state of the protein or itsinteraction with binding sites in oriC (reviewed inMesser 2002; Leonard and Grimwade 2005; Kaguni2006; Katayama 2008). The SeqA protein sequestersthe origin immediately after initiation due to its co-operative binding to hemi-methylated GATC sites,found in abundance near the origin (Campbell andKleckner 1990; Lu et al. 1994; von Freiesleben et al.2000). During this period, DnaA is bound only to itshigh-affinity sites in oriC (sites that bind DnaA in bothATP and ADP forms) and is precluded from binding tolower affinity sites (bound only by ATP-DnaA), whoseoccupancy is necessary for origin firing (Nievera et al.2006). In seqA mutants, DnaA binds prematurely to low-affinity sites (Nievera et al. 2006), with the resultingasynchronous and premature initiation of replication.

Binding of DnaA to low-affinity sites in oriC normallyrequires cooperative interactions with DnaA-boundhigh-affinity sites and is aided by the DiaA protein. DiaAis a tetramer, each with capacity to bind DnaA, therebyaiding cooperative binding interactions and opencomplex formation at oriC by recruitment of multipleDnaA molecules (Keyamura et al. 2007). Mutations indiaA were isolated as suppressors of the over-initiation

Figure 4.—Flow cytometric analysis of DNA content indnaA and diaA derivatives after ‘‘run-out’’ treatment with rifam-picin and cephalexin. PicoGreen staining histograms for cul-tures of the following strains were grown at 37� in LB medium:wild-type MG1655, dnaAD96-120 STL12692, diaAD STL12846,and diaAD dnaAD96-120 STL12851.


phenotype caused by dnaAcos and cause mild defects inreplication initiation synchrony and timing (Ishidaet al. 2004; Keyamura et al. 2007). Inactivation of diaAalso causes poor inheritance of minichromosomes andenhances the lethality of certain conditionally lethaldnaA alleles. These results established DiaA as a positiveregulator of replication initiation, but its connection tobacterial physiology has remained somewhat unclear.

A genetic system sensitive to replication controldefects: Our experiments capitalize on the role ofinitiation control in allowing cells to tolerate damageto the replication forks. In a screen for mutants sensitiveto low levels of the replication inhibitors hydroxyureaand azidothymidine, we identified mutants in Dam andSeqA (Sutera and Lovett 2006). Our analysis sug-gested that the convergence of replication forks ontosites of DNA damage was responsible for this defect:SeqA restrains replication forks so that collision ontodamage is minimized. Spontaneous damage to replica-tion forks most likely explains the poor growth proper-ties of seqA mutants, especially under growth conditionsthat support high initiation capacity.

Our genetic analysis also identified ObgE as a func-tion required for survival of replication inhibition andsuggested that ObgE may control replication fork sta-bility, chromosome organization, or segregation (Fotiet al. 2005, 2007). Viable hypomorphic mutants in obgEwere synthetically lethal with those negating double-strand break repair (Foti et al. 2005) and have modestover-replication and asynchronous replication phenotypes.

A double mutant in obgE and seqA is highly inviable,much more so than the single mutants, and rapidlyaccumulates suppressor mutations (Foti et al. 2005),which we identify here as alleles of dnaA. Although wewere initially surprised to find mutations arising at suchhigh frequencies in an essential gene, our analysissuggests that they consist predominantly of deletionsat short direct repeats in a nonessential region of theprotein, domain II. Short repeated sequences act as hot-spots for mutagenesis (Albertini et al. 1982), explaining

the frequent nature of these spontaneous suppressormutations.

The role of domain II in DnaA function: Previouswork has established the nonessential nature of domainII of DnaA, believed to be a flexible linker region be-tween its oligomerization and DnaB-binding domain Iand ATPase domain III of the protein. Domain II is var-iable in length and even absent among bacterial DnaAs(Messer et al. 1999; Erzberger et al. 2002) and is com-posed of residues 87–134 for E. coli DnaA, with ourspontaneous deletion spanning amino acids 96–120.Although this domain can be deleted without loss ofviability (Messer et al. 1999), our results suggest that thisregion does indeed have a function in E. coli and isrequired for optimal regulation of initiation.

For several phenotypes, the dnaAD96-120 allele stronglyresembles loss of function in the positive regulatoryprotein DiaA. Both mutations substantially suppress theinviability and AZT-sensitive phenotypes conferred byloss of SeqA; both mutations appear to correct the seqAover-replication phenotype to the same extent, asrevealed by excessive DNA content measured by flowcytometry. In otherwise wild-type strains, dnaAD96-120and diaAD cause a modest reduction in DNA content percell, consistent with a reduction in the efficiency, andcause initiation to become asynchronous, with firing ofsome sister origins in the absence of others, as evident bythe 6N peaks in the flow cytometric analysis of DNAcontent after replication ‘‘run-out.’’ For the most part,the combination of dnaAD96-120 and diaAD producesphenotypes identical to either single mutant, suggestinggenetic epistasis; this and the similarity of dnaAD96-120and diaAD suggest that they work through a commonmechanism. However, AZT sensitivity conferred by seqAis suppressed marginally better by double dnaAD96-120diaAD mutations at 37�, confirming that they may haveproperties independent of each other. This could bebecause neither deletion of DnaA domain II nor of DiaAfully negates the activation of DnaA for replicationinitiation.

The domain II deletion in dnaAD96-120 does not alterthe efficiency of DiaA binding, as detected by pull-downexperiments, although we cannot rule out the possibilitythat binding is qualitatively different or affected bycellular conditions not recapitulated in these biochem-ical assays. Previous studies had implicated eitherdomain I or II of DnaA as the site of DiaA binding(Ishida et al. 2004; Keyamura et al. 2007); our resultsnarrow this to domain I and/or to regions at amino acids87–95 or 120–134 of domain II.

DiaA regulation of DnaA: The similarity of DiaA andDnaA domain II defects raises two possibilities. DomainII could be required for DiaA’s function in the regula-tion of DnaA, although it does not appear to be requiredfor binding. Alternatively, both DiaA and DnaA domainII could be independently required for a step in theactivation of DnaA for replication initiation; for exam-

Figure 5.—Pull-down assays for binding of His6-DnaA de-rivatives to BBD-DiaA to stepavidin beads. Samples were ana-lyzed by Western blotting with Anti-His6 antibody. (Lane A)Crude lysate BBD-DiaA alone. (Lane B) Crude lysate of His6-DnaA1 before pulldown. (Lane C) Crude lysate His6-DnaAD96-120 before pulldown. (Lane D) BBD-DiaA-streptavidinbeads with no His-tagged DnaA added. (Lane E) BBD-DiaA-streptavidin beads with bound His6-DnaA1. (Lane F) Proteinstandard. (Lane G) BBD-DiaA-streptavidin beads with boundHis6-DnaAD96-120. (Lane H) His6-DnaA1 added to streptavidinbeads with no BBD-DiaA bound.


ple, both could promote DnaB recruitment by forma-tion of specific DnaA complexes at oriC.

Because of the ability of DiaA to bind multiple DnaAmolecules, it has been assumed to promote DnaAbinding to oriC by a recruitment mechanism, wherebyoccupancy of low-affinity sites, and subsequent activa-tion of initiation, is enhanced by DiaA-bridged interac-tion to DnaA-bound high-affinity sites. It is also possiblethat conformational changes in the DnaA protein,which depend on the integrity of domain II, are alsoassociated with this active configuration. Regions in-volved in DnaB binding include not only domain I ofDnaA, most likely also the site of DiaA binding (seeabove), but also regions of domain III, aa 135–148,adjacent to the domain II linker (Seitz et al. 2000).Therefore the domain II linker could influence thegeometry between two potential sites of DnaB recruit-ment. A model based on the nuclear magnetic reso-nance structure of domain I suggests that head-to-headdimerization of DnaA domain I could reveal a surface tounite DnaB-binding sites in domain I and III (Abe et al.2007). Rotation around the domain II linker would berequired for this domain I interaction on a scaffold ofhead-to-tail DnaA complexes mediated through domainIII interactions, as is suggested by the crystal structure ofdomains III and IV (Erzberger et al. 2002, 2006).

Other more complex scenarios are possible. DnaBbinding to domain I of DnaA may also function tomodulate its interactions with DiaA, potentially releas-ing DiaA in a hand-off mechanism. Alternatively, thednaAD96-120 mutation may influence interaction withother factors such as the architectural proteins FIS andIHF or change the cooperative nature of DnaA binding.Further characterization of the biochemical propertiesof this interesting DnaA mutant should clarify its geneticeffects and the role of domain II in the regulation ofreplication initiation.

We thank Hirotada Mori, Barry Wanner, and the E. coli GeneticStock Center for strains and plasmids. This work was supported byNational Institutes of Health grants RO1 GM051753 and GM079510and a Brandeis University Undergraduate Research Program fellow-ship to K.M.

LITERATURE CITED

Abe, Y., T. Jo, Y. Matsuda, C. Matsunaga, T. Katayama et al.,2007 Structure and function of DnaA N-terminal domains: spe-cific sites and mechanisms in inter-DnaA interaction and in DnaBhelicase loading on oriC. J. Biol. Chem. 282: 17816–17827.

Albertini, A. M., M. Hofer, M. P. Calos and J. H. Miller, 1982 Onthe formation of spontaneous deletions: the importance of shortsequence homologies in the generation of large deletions. Cell29: 319–328.

Baba, T., T. Ara, M. Hasegawa, Y. Takai, Y. Okumura et al.,2006 Construction of Escherichia coli K-12 in-frame, single-geneknockout mutants: the Keio collection. Mol. Syst. Biol. 2:2006.0008.

Bachmann, B. J., 1996 Derivations and genotypes of some mutantderivatives of Escherichia coli K-12, pp. 2460–2488 in Escherichiacoli and Salmonella: Cellular and Molecular Biology, edited by F. C.Neidhardt. ASM Press, Washington, DC.

Camara, J. E., A. M. Breier, T. Brendler, S. Austin, N. R. Cozzarelliet al., 2005 Hda inactivation of DnaA is the predominant mech-anism preventing hyperinitiation of Escherichia coli DNA replica-tion. EMBO Rep. 6: 736–741.

Campbell, J. L., and N. Kleckner, 1990 E. coli oriC and the dnaAgene promoter are sequestered from dam methyltransferase fol-lowing the passage of the chromosomal replication fork. Cell 62:967–979.

Dower, W. J., J. F. Miller and C. W. Ragsdale, 1988 High effi-ciency transformation of E. coli by high voltage electroporation.Nucleic Acids Res. 16: 6127–6145.

Erzberger, J. P., M. M. Pirruccello and J. M. Berger, 2002 Thestructure of bacterial DnaA: implications for general mechanismsunderlying DNA replication initiation. EMBO J. 21: 4763–4773.

Erzberger, J. P., M. L. Mott and J. M. Berger, 2006 Structural ba-sis for ATP-dependent DnaA assembly and replication-origin re-modeling. Nat. Struct. Mol. Biol. 13: 676–683.

Ferullo, D. J., D. L. Cooper, H. R. Moore and S. T. Lovett,2009 Cell cycle synchronization of Escherichia coli using thestringent response, with fluorescence labeling assays for DNAcontent and replication. Methods 48: 8–13.

Foti, J. J., J. Schienda, V. A. Sutera, Jr. and S. T. Lovett, 2005 Abacterial G protein-mediated response to replication arrest. Mol.Cell 17: 549–560.

Foti, J. J., N. S. Persky, D. J. Ferullo and S. T. Lovett,2007 Chromosome segregation control by Escherichia coli ObgEGTPase. Mol. Microbiol. 65: 569–581.

Fujimitsu, K., M. Su’etsugu, Y. Yamaguchi, K. Mazda, N. Fu et al.,2008 Modes of overinitiation, dnaA gene expression, and inhi-bition of cell division in a novel cold-sensitive hda mutant ofEscherichia coli. J. Bacteriol. 190: 5368–5381.

Ishida, T., N. Akimitsu, T. Kashioka, M. Hatano, T. Kubota et al.,2004 DiaA, a novel DnaA-binding protein, ensures the timelyinitiation of Escherichia coli chromosome replication. J. Biol.Chem. 279: 45546–45555.

Kaguni, J. M., 2006 DnaA: controlling the initiation of bacterialDNA replication and more. Annu. Rev. Microbiol. 60: 351–371.

Katayama, T., 2008 Roles for the AAA1 motifs of DnaA in the ini-tiation of DNA replication. Biochem. Soc. Trans. 36: 78.

Kato, J., and T. Katayama, 2001 Hda, a novel DnaA-related pro-tein, regulates the replication cycle in Escherichia coli. EMBO J.20: 4253–4262.

Keyamura, K., N. Fujikawa, T. Ishida, S. Ozaki, M. Su’etsugu et al.,2007 The interaction of DiaA and DnaA regulates the replica-tion cycle in E. coli by directly promoting ATP DnaA-specific ini-tiation complexes. Genes Dev. 21: 2083–2099.

Kitagawa, M., T. Ara, M. Arifuzzaman, T. Ioka-Nakamichi, E.Inamoto et al., 2005 Complete set of ORF clones of Escherichiacoli ASKA library (a complete set of E. coli K-12 ORF archive):unique resources for biological research. DNA Res. 12: 291–299.

Leonard, A. C., and J. E. Grimwade, 2005 Building a bacterial or-isome: emergence of new regulatory features for replication or-igin unwinding. Mol. Microbiol. 55: 978–985.

Lu, M., J. L. Campbell, E. Boye and N. Kleckner, 1994 SeqA: a neg-ative modulator of replication initiation in E. coli. Cell 77: 413–426.

Messer, W., 2002 The bacterial replication initiator DnaA. DnaAand oriC, the bacterial mode to initiate DNA replication. FEMSMicrobiol. Rev. 26: 355–374.

Messer, W., F. Blaesing, J. Majka, J. Nardmann, S. Schaper et al.,1999 Functional domains of DnaA proteins. Biochimie 81:819–825.

Miller, J. H., 1992 A Short Course in Bacterial Genetics. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.

Nichols, B. P., O. Shafiq and V. Meiners, 1998 Sequence analysisof Tn10 insertion sites in a collection of Escherichia coli strainsused for genetic mapping and strain construction. J. Bacteriol.180: 6408–6411.

Nievera, C., J. J. Torgue, J. E. Grimwade and A. C. Leonard,2006 SeqA blocking of DnaA-oriC interactions ensures stagedassembly of the E. coli Pre-RC. Mol. Cell 24: 581–592.

Riber, L., J. A. Olsson, R. B. Jensen, O. Skovgaard, S. Dasguptaet al., 2006 Hda-mediated inactivation of the DnaA proteinand dnaA gene autoregulation act in concert to ensure homeo-static maintenance of the Escherichia coli chromosome. GenesDev. 20: 2121–2134.


Seitz, H., C. Weigel and W. Messer, 2000 The interaction domainsof the DnaA and DnaB replication proteins of Escherichia coli.Mol. Microbiol. 37: 1270–1279.

Singer, M., T. A. Baker, G. Schnitzler, S. M. Deischel, M. Goelet al., 1989 A collection of strains containing genetically linkedalternating antibiotic resistance elements for genetic mapping ofEscherichia coli. Microbiol. Rev. 53: 1–24.

Sutera, V. A., Jr., and S. T. Lovett, 2006 The role of replicationinitiation control in promoting survival of replication fork dam-age. Mol. Microbiol. 60: 229–239.

Viswanathan, M., and S. T. Lovett, 1999 Exonuclease X of Escher-ichia coli. A novel 39-59 DNase and DnaQ superfamily memberinvolved in DNA repair. J. Biol. Chem. 274: 30094–30100.

von Freiesleben, U., K. V. Rasmussen and M. Schaechter,1994 SeqA limits DnaA activity in replication from oriC in Escher-ichia coli. Mol. Microbiol. 14: 763–772.

von Freiesleben, U., M. A. Krekling, F. G. Hansen and A. Lobner-Olesen, 2000 The eclipse period of Escherichia coli. EMBO J. 19:6240–6248.

Willetts, N. S., A. J. Clark and B. Low, 1969 Genetic location ofcertain mutations conferring recombination deficiency in Escher-ichia coli. J. Bacteriol. 97: 244–249.

Communicating editor: D. Leach


a role for nonessential domain ii of initiator protein ... · product from the template. the...

Documents