Distribution, abundance and analysis of polymorphic microsatellite DNA in Aspetgillus flavipes and Pjdhium ulomum

Marcel Alexander Femandez

A thesis submitted to the Faculty of Graduate Studies

in partial fulfilment of the requirement for the

degree of Doctor of Philosophy.

Department of Microbiology

University of Manitoba

Winnipeg, Manitoba

Naüonal Library Bibliithèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services seMces bibliographiques

395 Wellington Çtreet 395. rue Wellington -ON K 1 A W OtbwaON KtAON4 Canada Canada

The author has granted a non- exclusive licence allowing the National Lïbrary of Canada to reproduce, loan, distrifibute or sell copies of this thesis in microform, paper or electronic folllliits.

The author retains ownership of the copyright in diis thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author' s permission.

L'auteur a accordé une licence non exclusive paxnettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la fome de microfichelnùn, de reproduction sur papier ou sur format électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de ceile-ci ne doivent être imprimés ou autrement reproduits sans son autorisation-

TESE UM[VERSlïY OF MANITOBA

FACULTY OF GRADUATE SWDLES

COPYRIGHT PERMISSION

A Thesis sabrnittd to the Faculty of Graduate Studies of the University of Manitoba in partial fuliillmeat of the rcquinments of the degree of

Permission bas beea granteci to the LLBRARY OF THE UNWERSITY OF bttNITOBA to lend o r seU copies of this thesir, to the NATIONAL LIBRARY OF C A i W A to microfilm thh thesis and to k a d or s e U copies of the Gfm, and to UNIVER!XN MICROFILibE3 to publish an abstract of this thesu

This reproduction or copy of this thesis bas been made availablt by autbority of the copyright orner solely for the purpose of private study and restarcb, and may only b t reproduccd and copid as permitted by copyright bws or with expnss written authoriration from the copyright orner.

ABSTRACT

The objective of this research project was to develop tools for strain

identification in the fungi Pythium ultmum and A s ~ l l u s flavipes- The former

is a well-known plant pathogen, and the latter is important in the pharmaceutid

industry. The principal drive was to identify genetic loci wntaining simple

sequenœ arrays (microsatellites) which could be amplified from nurnerous

isolates to reveal polymorphisms. but the RAPD approach was also used for

Aspergillus tla vipes.

A genomic library of P. ultimum (BR471 ) was screened with d(GT)* and

d(CT)g probes and from the data it was estimated that a d(GT/CA) motif occurs

at least once every 86 kb and that a d(CT/GA) motif ocairs at least every 137 kb

on average. A clone hybridizing to the d(GT)g probe was chosen, and

sequenced to reveal a 200 bp region with five d(GT/CA). motifs interspersed

with unique and repeütive sequenœs. Primers complernentary to flanking

sequences were employed to amplify the regions from afl P. ultimum var.

ultimum isolates tested (25) and from one isolate P. ultimum var. sparangiiferum.

Four other species of Pythium tested did not produœ amplification products.

Many length polymorphisms were detected in the amplification products of al1

isolates tested. Three of these isolates w r e charaderized by sequencing the

polymorphic region. Variance in the number of d(GT/CA) dinucleotides as well

as a deletion extending into the sequence flanking the d(GT/CA) array was

O bserved.

For strain differentiation in Aspergillus flavipes, amplification of genomic

DNA *th single random prirnen (RAPD) produced unique sets of

eledrophoretic profiles for each of the nine isolates of the species. Thirteen

primers were used in the study. The assay was show rot to be very sensitive

to the purity, age or the concentration of template DNA, but it was sensitive to

the temperature profile protocol, Mich cannot be adequately reproduced from

one PCR instrument to another. Reproducible profiles for each isolate showed

extreme polymorphism with very few coincident bands between pairs of isolates

and none shared by al1 nine isolates.

The genome of A. flavipes was investigated using hybridization of a

genomic library w-th four synthetic oligonucleotide probes d(GT)g, d(CT)a,

d(AT)s, and d(GC)s. Results from genomic dot blots showed the existence of

abundant d(GT1CA) and d(CTIGA) simple sequence motifs, but no apparent

d(ATKA) or d(GC/CG). Self hybridization of the later probes may have interfered

with the screening.

Hybridization of the probes to Southem blots of restriction profiles of

genomic DNA revealed that the simple sequence motifs are widely dispersed in

the genorne, that their distribution is highly polymorphic, and that some of them

may be members of repetitive DNA families.

In order to assess the feasibility of using simple sequenœ motifs

as genetic markers in A. flavipes, D M Aagments from library clones Hihich

hybridized to the simple sequence probes d(GTb and d(CT)* were cloned and

iii

sequenced. Primers Ranking the simple sequenœ repeats were synthesized

and used in the polymerase chain reaction for amplification of two d(GT/CA) and

two d(CT1GA) motifs. Sequencing of the polyrnerase chain reaction products

showed that d(GT1CA) and d(CTIGA) loci are polymorphic as a cansequence of

site specific length variation lacated within the dinucleotide repeat. Alignment

of the sequenœs obtained for each locus showad that the flanking regions of

these motifs are highly conserved. Howver, minor difFerences in sequence

homology were identified in the regions flanking the simple sequence motifs. Of

the nine isolates studied, only three produœd a major PCR product. The

ineffediveness of the primer pairs to amplify similar locus among other isolates

may have arisen from differences in the flanking regions-

One micmsatellite locus contained a ~(GTICA)~~J repeat. This repeat

showed the largest degree of length variation in comparison to the other loci

investigated. These results support the hypothesis that long simple sequence

repeats show a greater amount of length variation in contrast to short motifs

M ich show less or none. In another simple sequenœ loci, two d(CT1GA) motifs

w r e found flanking a d(GT1CA) motif. Sequence comparison of this locus to

that in other isolates of A. flavipes showed that polymorphism of a simple

sequenœ motif can include its flanking regions. Usually dinucleotide

polymorphisms are confined to their repeated units, but in this locus the flanking

regions can conhibute to simple sequence polymorphism.

This is the first report of the amplification of simple sequence motifs in a

fungus. The high degree of variation exhibited by these isolated loci

demonstrate the value of simple sequenœs in distinguishing isolates of A.

flavi@es and P. ultimum. The abundance and the amount of information derived

from these types of markers together with the ease by which they can be

identified make them ideal markers for genetic linkage studies, physical

mapping, population studies and varietal identification-

ACKNOWLEDGMENTS

Este trabajo esta dedicado a mi padre Dr. Raul O. Femandez, sin ti est0 no

seria posible, te quiero mucho. Great appreciation to Dr. Gien Klassen M o

provided a creative working environment, tremendous amount of helpful

comments and making this work possible. I also wish to thank the members of

my cornmittee, you have provided important commentary to help accomplish my

research. I thank al1 faculty of the department, you have made me feel very

welwme. Thank you, fellow students and staff, you al1 provided a kind and

wann wrking place. My experience here was most positive, fruitful, and exciting.

TABLE OF CONTENTS

Page

..................................................................................................... ABSTRACT.. ,. i

.............................................................................. ACKNOWLEDGMENTS .... .. .v

........................................................ ......-............-...... TABLE OF CONTENTS ... vi

............................................................................................. LIST OF TABLES. -x

LIST OF FIGURES ............................................................................................ xi

............................................................................. LIST OF ABBREVIATIONS.. xiv

INTRODUCTION ........................-...................................................................... 1

.................................................................................. LITERATURE REVIEW-.. 4

.......................................................................................... Introduction ..-5

.............................................................. Survey of molecular markers. --.7

..................................................... Minisatellites and simple sequenœs 12

Properties of mini and microsatellite DNA sequences .......................... 14

Localization of mini and microsatellites .................................................. 16

Mechanisms accountable for minisatellite and microsatellite

polymorphisms ........................................................................ 1 7

................................................ Arnplified microsatellites.. - 1 8

Functional importance of minisatel lites and simple sequemes.. ........... -21

................................................................................... Telomers.. .21

.............................................................................. Centromeres.. -22

. . Transcn ption.. ..... ., ....................................................................... 22

. . Transcnptional regulation ............................................................ 23

............................................................................ Recombination -23

. . .................................................................................. Replication -24

................................................................... Molewlar markers in Fungi -25

.......................... Classification of the genus Pythium ....A

................................................. Classification of the genus Aspergillim 36

................................................... PCR-amplified microsatellites in fungi 39

............................ MATERIALS AND METHODS ......... .. ... ... .. ................ -40

Pythium ultimum strains ......................................................................... 41

Aspergillus flavipes strains .................................................................... -41

.......................................................... .............. Culture methods ..... -46

.............................................. Genomic DNA extraction and purification -46

RNAse treatment of nucleic acid preparations for RAPDs .................... -48

................................. Oligonucleotides probes and sequencing primers 48

........................................................................... RAPD PCR conditions -51

DNA dot blotting and fixation of DNA to nylon membranes .................... 52

............................................. DNA digestion and elechophoresis ...... .. 52

5' end labeling of oligonucleotides ... ... ............................................ -53

3' end labeling of oligonucleotides probes using

.................................................................................... digoxigenin UT? -53

Southem blotting and hybridizations ..................................................... -54

Construction of the Pythium uîümum and Aspefgillls flavipes

. . ...................................................................................... genomic Iibrary 55

Amplification of the EMBL3 genomic Iibrary .......................................... 59

...................................................... Plating the EMBL3 genomic library -60

EMBL3 genomic library plaque blotting ................................................. 60

. * ................................................................... Selection of positive clones -61

Large scale isolation of phage DNk ...................................................... 62

Subcloning DNA fragments from phage clones into

pBluescript plasmid (Ml3 Ks +) .............................................................. 63

Cloning of PCR products ........................................................................ 65

Purification of plasmid DNA ................................................................... 65

Screening clones with PCR ................................................................... -66

Construction of deletion clones ............................................................. -67

Fragment amplification of simple sequence motifs ................................. 68

......................................... Sequencing cloned PCR products ........... .. -68

Sequencing of PCR products ............ ... ............................................ -69

DNA sequenœ analysis ........................................................................ -71

RESULTS AND DISCUSSION ........................................................................ 73

CHAPTER 1 . Simple Sequence Motifs in P . ultimum ........................... 73

Introduction.. ......................................................... -74

.................................................................. Results -76

............................................................ Discussion -92

CHAPTER 2 . Use of RAPDs to DifFerentiate lsolates of

....................................................................... A . flavipes 97

......................................................... Introduction -98

................................................................ Results -100

......................................... .......... Discussion ....... -114

CHAPTER 3 . Simple Sequence Motifs in A . flavipes ........... ~SSSSSSSSSSSSSSS1 18

Introduction ............... ..... ................................... 119

................................................................. Results 121

Discussion .......................................................... 1 6 7

CONCLUSIONS .............................................................................................. 173

...................................................................................... LITERATURE CITED 180

UST OF TABLES

INTRODUCTION

........ Table 1 : Hybridization based DNA fingerprinting studies in fungi 27

................... Table 2: PCR based DNA fingerprinting studies in fungi 3 0

MATERIALS AND METHODS

Table 3: Strains of Pythium .................................................................. 42

.............................................. Table 4: Strains of Aspergiilus flavipes -45

........................... Table 5: Oligonucleotides and sequencing primers -49

................................... Table 6 . Primers used in RAPDs experirnents -50

........ Table 7: DNA motifs used in sequence analysis of cloned DNA 72

CHAPTER 1

Table 8: Primers for amplification of simple sequenœ motifs .............. -80

Table 9: Sequence analysis of cloned DNA from P . ultimum .............. 81

CHAPTER 2

Table 1 O: Results of working prïmen used in RAPDs

........................................................................... A . flavipes 103

CHAPTER 3

Table 1 1 : Simple sequenœ motifs in S . cemvisiae. ................ .. .. 131

Table 12: Primers for amplification of simple sequence motifs ........... 132

Table 13: Plasmid constnicts of cloned PCR products ............ .. ........ 133

Table 14: Sequence analysis of pdGT1, pdGT2, pdCT1, and

........................................ .................... ...... pdCT2 ... ...... 134

LIST OF FIGURES

CHAPTER 1.

Fig. 1. Restriction digest of lambda DNA clone and

................................................ southern blot analysis.. -84

Fig. 2. Nucleotide sequence of DNA from P. ultimum

containing several d(CA/GT) simple sequence

repeats.. ........................................................................ .û6

Fig- 3. Polyacrylamide gel eledrophoresis of PCR products

.................. ............ from various isolates of P. ultr'rnum ... 88

Fig . 4. Pol yacrylamide gel electrophoresis of PCR products

frorn various isolates of P. ultimurn ............................... 90

Fig. 5. DNA sequence alignment of PCR products from

.............................................. 3 isolates of P. u/timurn,.. -92

CHAPTER 2.

Fig. 6. The effect of old and newly prepared DNA

template from A. flavipes in RAPDs .............................. 104

Fig. 7. The effect of RNAse treated and non-RNAse treated

.................. DNA template from A. flavipes in RAPDs. -1 06

Fig. 8. The effect of concentration of template DNA

from A. flavipes in RAPDs.. ....................................... .1 08

F ig. 9. RAPDs DNA analysis in difFerent isolates of

........... A. flavipes. ,.., .................................................. 1 1 0

Fig. 10. RAPDs DNA analysis in different isolates of

A. flavi,pes. ......-.. S.SS.S..S...SS.S...SSSSS.S....S -....--..-.....-....-..--... 112

CHAPTER 3.

Fig. 11. Autoradiogram genomic dot blot hybridizations with

d(GT)9 and d(CTl9 probes.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -1 35

Fig. 12. RFLP analysis of isolates of A. flsvipes wïth

d(GTI9 and d(CT)9 probes.. . . . . . . . . . . . - - -. -. .. . -. . . . ..---.. -... - -. . . -1 37

Fig. 13. Restriction digests of lambda DNA clones and

hybridizations to d(GVs probe ..............---..--.---.-......... 139

Fig. 14. Restriction digests of lambda DNA clones and

hybridizations to d(CT)s probe,.. .-.-. .... . ... .. . . --..-.. . .--. .-. ... 141

Fig. 15. Plasmid constnicts containing lambda DNA

inserts with simple sequenœ DNA ....... ..... .. ...... ...... 143

Fig. 16. Sequence of plasmid pdGT1 containing d(GTICA)

motif ...... . . ....... ..... .... .... ....... .... . ...... ... .. . ... . . .... . ... . .... ....... .. 145

Fig. 17. Sequenœ of plasmid pdGT2 containing d(GT/CA)

mot if... ... . . . .. ... .-,... . . . . . ..,,. .-.... .. . . . . . . . . .. ... . .. . . . . . . . . . . . . . . . . . . . . . .. . -147

Fig. 18. Sequenœ of plasmid pdCTl containing d(CTIGA)

motif. ... ..... ..... ....... .,...,.. ..,......,....-... ..... ... ...... . ..... .... .... ... 149

Fig. 19. Sequenœ of plasmid pdCT2 containing d(CT1GA)

motif ........................................,..................-.. ................. 151

Fig. 20. PCR amplification of GT1 and GT2 simple sequenœ

motifs in different isolates of A. flavipes and

hybridization to d(GT)9,. ................................................. 1 53

Fig. 21. PCR amplification of CTI and CT2 simple sequence

motifs in different isolates of A. flavipes and

hybridization O d(Cvg .................................................. 1 55

Fig. 22. Plasmid constnicts of cloned PCR products containing

simple sequence motifs ................................................. 157

Fig. 23. DNA sequence alignment of GT1 simple sequence

............................................................................. motifs f 59

Fig. 24. DNA sequenœ alignment of GT2 simple sequence

........................................................................... motifs.,. 161

Fig. 25. DNA sequence alignment of CTI simple sequenœ

........................................................................... motifs.. -1 63

Fig. 26. DNA sequence alignment of CT2 simple sequenœ

.............................................................................. motifs 165

xiv

A

bp

C

CTAB

cm

DNA

dATP

DMSO

dNTP

EDTA

G

9

h

l PTG

kb

L

mg

min

mL

mm

mM

adenine

base pairs

cytosine

hexadecyltrimethyl ammonium bromide

œntimetre

deoxyri bonucleic acid

Z-deoxyadenosine 5'-triphosphate

dimethyl sulfoxide

Zdeoxyribonucleoside 5'4riphosphate

eth y lenediamine-tetra-acetic acid

guanine

gram(s)

hour(s)

isopropylthiogaladoside

kilobase pairs

litre(s)

milligram(s)

minute(s)

millilitre($)

millimetre(s)

mil timolar

nm

PCR

pfu

pmole

RAPD

RFLP

rDNA

RNA

'Pm

SDS

SSC

T

ug

UL

um

UV

v/v

w/v

X-gai

Y

nanomette

polymerase chain reaction

plaque foming unit(s)

pico mole@)

random amplified polymorphic DNA

restriction fragment length polymorphism

ribosomal DNA

ribonucleic acid

revolutions per minute

sodium dodecyl sulfate

sodium saline citrate

thymine

m icrograrn(s)

micro1 itre(s)

m icrometre(s)

ultraviolet

volume/volume

weiçht/volume

5-bromo-4-chloro-Sindol yl-b-D-gaIaÇtoside

Cytosine or Thymine

Introduction

The research presented here describes the isolation and characterization

of DNA molewlar marken in fungi. In partiwlar, the examination of

microsatellite DNA type sequences will be investigated. The organisms used in

these experïments (Pythium ultimum and Aspetgîllus fla vipes) have important

economic and environmental impacts in our environment The research

conducted in this thesis is important for several reasons: (1) To date no research

has been conducted to determine if microsatellite DNA sequences in fungi are

polymorphic; (2) Little evidenœ conœming the behaviour, composition and

abundance of microsatellite DNA sequences have been addressed; (3) and the

analysis of a large groups of fungal isolates using microsatellite DNA markers is

rare.

Only recently has the use of ONA molewlar markers gained much

attention. With the advent of these new molewlar markers, strategies for

investigating the genome of organisms have been developed. New techniques

have helped detennine genome characteristics (Le. quantitation of repetitive

DNA) and assisted in the development of human and mouse genome maps (Dib

et al. 1996). The research presented here is a step towards the understanding of

general characteristics of microsatellite DNA sequences in the genomes of

Pythium ulümum and Aspetgillus flevipes.

The objectives in this thesis are: (1) to isolate microsatelfite DNA

sequences, (2) to examine the polyrnorphic nature of microsatellite ONA, and (3)

to quantify microsatellite DNA sequenœs in P. ulamum and A. flavipes. An

additional related objective will be to examine the use of npid amplified

polymorphic DNA (RAPD) as another approach for differentiating isolates of A.

t7a vipes-

introduction

Examining the relatedness and genetic diversity between or within

different species, populations, and individuals is a main chore for numerous

disciplines of biological science. In the past, classical strategies of assessing

genetic variability such as comparative anatorny, morphology, ernbryology and

physiology have been supplemented with molecular techniques. These

encompass the characterization of chernical constituents (e-g. plant metabolites)

and, most importantly, the analysis of rnacromolecules. Development of

"molecular markers," that are based on polymorphisrns found in proteins or DNA,

has exceedingly simplified the investigation in a variety of disciplines such as

taxonomy, ecology, phylogeny, genetics, and plant and animal breeding

programs. Morphological characters have long been applied to identify

species, famil ies, and genera (Fal wner 1 981, Epplen et al. 1 991 ). Unlike

molecular markers, morphological characters are often firmly influenced by the

environment, and consequently, special breeding programs and experimental

designs are required to distinguish genotypic from phenotypic variation.

For the most part, allozymes have been the molecular markers of choice,

but attention has increasingly œntred on the DNA molecule as a source of

informative polyrnorphisrns. Due to the high information content of the DNA

sequence, sequenœ information can be exploited for the study of genetic

divenity and relatedness arnong organisrns. A wide diversity of techniques to

visualise DNA sequence polyrnorphisms have been developed in the past few

years, and molecular markers have been derived from these techniques.

The temi "DNA fingerprinting" was introduœd by Jeffreys et al. (1985), to

denote a tedinique for the simultaneous detedion of many highly variable DNA

loci by hybridization of particular muitilocus "probesaa to electrophoretically

separated restricted DNA fragments. Several alterations of the basic technique

have appeared and comparable strategies have been developed. Most

importantly, DNA polymorphisms became detectable by use of the polymerase

chain reaction (PCR). Some methods are still tened DNA fingerprinting, but

the tens "DNA profiling," and "DNA typing" are also being used.

There are particular properties which would be generally desirable for a

molecular marker. The following list shows some of the important features for

molecular markers:

1. Highly polymorphic behaviour

2. Codominant inheritance (penits discrimination betwen homo and heterozygotic states in diploid organisms)

3. Repeated occurrence in the genome

4. Even distribution throughout the genome

5. Selectively neutral behaviour (Le. no pleiotropic effects)

6. Easy access

7. Fast and easy assay

8. High reproducibility

9. Cost effective

No molewlar marken are obtainable yet that fulfill al1 of these criteria, but *th

the availability of nurnerous different types of marker systems, most of these

mentioned aiteria can be accomplished (Eppien et al. 1993)

Survey of molecular markers

Protein markers are a frequently used in molecular techniques. The

procedure involves the electrophoretic separation of proteins followed by

specific staining of a distinct protein subclass. While some studies utilize

protein patterns, more than half of protein markers are represented by

allozymes.

Allozyme electrophoresis has been successfully used in many organisms

from bacteria to numerous animal and plant species since the 19608s, and has

been reviewed in detail by May (1992). However, there are a number of

limitations to allozyme studies. With allozymes, a new allele will only be

detected as a polymorphism if a nucleotide substitution is a consequence of an

amino acid substitution, which in its tum affects the eledrophoretic mobility of

the studied molecule.

Polymorphisms at the DNA level may be studied by several means. The

most direct approach is the detemination of the nucleotide sequence of a

defined region and the alignment of this sequence to an orthologous region in

the genome of a similar related organism (Hillis et al. 1990). The informative

analysis of this data Gan be adapted to distinct levels of discriminatory potential

by choosing appropriate regions of the genome. This type of analysis is largely

applied for evaluating medium and long distance relatedness in phylogeny, but

occasionally it is also utilized for population studies (Hoelzel and Green 1992).

The sequencing approach has been extremely facilitated by the advent of

PCR (Saiki et al. 1988), which makes it feasible to isolate homologous DNA

sequences from many organisms. Primen are developed on the basis of

sequence information for conserved parts of the DNA, and the desired target

sequences are arnplified. The PCR produd is sequenœd directly or after

cloning (Hoelzel and Green 1992).

An alternative means for assessing DNA sequence variation is the

analysis of restriction fragment length polymorphisms (RFLPs). Digestion of a

particular DNA molewle with a restriction enzyme results in a reproducible

group of fragments of defined lengths. Point mutations wthin the recognition

sequence of the restriction enzyme utilized as well as insertions or deletions wi-Il

result in a changed pattern of restriction fragments and may bring about a

screenable polymorphism among different genotypes. Hybridization based

fingerprinting, which actually depicts a particular case of RFLP analysis,

involves the digestion of genomic DNA ~ Ï t h restriction enzymes and separation

of the fragments using electrophoresis on a gel. This gel is Southem blotted on

to a membrane and particular fragments are made visible by hybridization with a

labelled probe (Southem 1975). Two primary differenœs exist between the

RFLP techniques and hybridization based fingerprinting: (1 ) DNA fingerprinting

utilizes multilows probes, creating complex banding patterns, whereas RFLP

probes are generally locus specific. (2) DNA fingerprinting is customarily

perfomed with non species-specific probes that identify ubiquitous ocairri-ng

sequences such as minisatellites, whereas RFLP probes are usually species-

specific

RFLP anal ysis of nuclear 0 NA common l y uses s pecies-s pecific probes

which are obtained from a cDNA or genomic Iibrary of the investigated species,

or a close relative. RFLPs have been identified and employed in molecular

marker assisted selection in breeding programs and map based cloning of genes

(Nienhuis et al. 1987, and Tanksley et al. 1989). Additional application areas for

RFLPs are phylogenetic studies and cultivar identification (Gebhardt et al. 1989,

Rajapakse et al. 1992, Debener et al. 1990, Dowling et al. 1990, Song et a'

1 988). In addition to probes generated from cDNA or genomic library clones,

ribosornal DNA (rDNA) (wding regions 18s. 5.8s and 25s) is frequently used as

a source for RFLPs. Sinœ polymorphisms in rDNA are easy to detect due to the

high abundance of these sequences the same probes can often be utilized in

different species because of their conserved coding sequences. Many reports

have shown the use of these sequences as a good source of DNA

polymorphisms (Hamby and Zimmer 1992, Kim and Marby 1991, Leam and

Schaal 1 987, Nybom et al. 1 992, Saghai-Maroof et al. 1 984, Buchko 1 996).

Other studies involving RFLPs make use of mitochondrial DNA (mtDNA)

in animals and chloroplast DNA (cpDNA) in plants. 60th types of DNA are

present in several to hundreds of copies per cell. There are hm principal

approaches for studying RFLPs in cytoplasmic DNA The first is to extract

mtDNA and cpDNA separately from the nuclear DNA (Milligan 1992 and

Tegelstrom 1992). Cytoplasmic DNA is then digested with partiwlar restriction

enzymes and efedrophoresed on agarose or polyacrylamide gels, RFLPs are

then directly detected by ethidium bromide or silver staining. The second

approach is to isolate and digest the total DNA of the organism, followed by

electrophoresis and Southem blotting of the restriction fragments. The

cytoplasmic DNA is then visualized by hybridization with a particular labeled

probe.

The development of molewlar markers based on hybridization usually

involves RFLP analysis. RFLP analysis is largely distinguished from

hybridization based fingerprinting by the type of probe used to reveal

pol ymorphisms (Jeffreys et al. 1 985). These multilows probes are

characterized by more or less regular arrays of tandemly repeated DNA motifs,

as a result, a complex banding pattern is usually produced (Jeffreys et al.

1985).

Two classes of multilows probes are mainly used. The first comprises

cloned DNA fragments or oligonucleotides which are complementary to

"minisatellites" (Le. tandem repeats of a basic motif of about 1 0 to 60 bp)

(Jeffreys et al. i 985). The second is exemplified by oligonucleotide probes

which are mplementary to "simple sequences" (Ta- and Renz 1984) or

"microsatellites" (Litt and Luty 1989)( i.e. tandem repeats of very short motifs,

mostly 1 to 5 bp). With both kinds of probes, a high degree of polyrnorphism

among related genotypes is regularly observed, and has been exploited for

many studies of genome analysis.

With the advent of PCR, numerous variations of the basic PCR strategy

were advanœd (Innis et al. 1990). It became apparent that PCR would also be

useful for the detection of DNA polymorphisms. Initial efforts to reveal DNA

polymorphisms made use of specific primers wmplementary to rewgnized

sequences. These experiments demonstrated that primers wtiich are

complementary to flanking regions of minisatellite and simple sequences loci

produce highly polymorphic amplification products. This kind of polymorphism

has turned out to be partiwlarly useful for studies of population genetics and

human and mouse genome mapping (Dib et aL 1996).

Additional strategies made use of semispecific primers, which are

complernentary to repetitive DNA elements. For human genome analysis, a

plentiful dass of randomly interspersed DNA elements called "Alu repeats" was

used for this purpose, and "AIu-PCR" unveiled considerable levels of

polymorphism (Ledbetter et al. 1990). As an alternative to interspersed repeats,

primers complementary to other repetitive sequence elements were Iikewise

successfully used for the generation of polyrnorphisms. Such sequenœs

encompass intronlexon spliœ junctions (Weining and Langridge 1991 ), tRNA

genes (Welsh and McClelland 1991 ), 5s RNA genes (Kolchinsky et al. 1991 ),

zinc finger protein genes (Unkles et al. 1992), as well as mini and mimsatellites

(Heath et a' 7 993. LiecMeldt et al. 1992, Meyer et a' 1 993a, Meyer et al.

1 993b).

Another approach makes use of one or two short, GC-rich primers of

arbitrary sequence to generate ?CR amplification products from genornic O N k

This technique, which does not need any sequenœ information, was called

random arnplified polymorphic DNA (RAPD) analysis (Williams et al. 1990).

Variations of this technique include the arbitrarily primed polymerase chain

reaction (AP-PCR) (Welsh and McClelland, 1990), and DNA amplification

fingerprinting (DAF) (Caetano-Anolles et al. 1991). As is the case with

minisatell ites and microsatell ites the pol ymorphic nature of the amplified DNA

fragments is paralleled by a polymorphic nomenclature. A common term,

"multiple arbitrary amplicon profiling" (MAAP) has been used to describe the

collective characteristics of al1 these techniques (Caetano-Anolles 1992).

Minisatellites and simple sequences

Repetitive DNA is an intemal elernent of eukaryotic genomes and may be

classified as either tandemly repeated or interspersed. For interspened

repeats. the repeated DNA motifs take place at multiple sites throughout the

genome. Tandem repeats, on the other hand, contain arrays of two to several

thousand basic motifs which are arranged in a head-to-tail fashion. Though this

kind of organization is also exhibited by sorne genes (e-g. the transcription units

for histone and ribosomal RNA), the majority of tandem repeats probably consist

of non-coding DNA (Hentschel and Bimstiel 1981 ).

Tandem repeats rnay be classified according to the length and copy

number of the primary repeated element, as wll as their genomic localization.

Satellite DNA is so called because of its ability to separate from bulk DNA by

buoyant density gradient centrifugation. Satellites wntain many repetitions

(usually between 1000 and more than 100,000 copies) of a basic motif and they

fom very long, frequently heterochromatic (tightty coiled) stretches of DNA

(Yunis and Yasmineh 1971 ). The length of a repeat unit may Vary between 2

and several thousand bp. but repeat units of 100 to 300 bp are most ordinarily

observed. Satellites regularl y occur at few genomic loci.

The term "minisatellites" was coined in 1985 to illustrate another family of

tandemiy organized repeats (Jeffreys et al. 1985). This class of DNA is

composed of shorter motifs (usually I O to 60 bp) and exhibits a lower degree of

repetition at a given locus. Minisatellites may fom "families" with related

sequences and occur at numerous loci in the genome.

Tandem repeats are made up from very short (between 1 and about 5 bp)

motifs have been dubbed "simple sequenœs" by Tautz and Renz (1 984). These

sequenœs have also been referred to as microsatellites (Litt and Luty, 1989).

Other names include, "simple repetitive sequences" or "simple tandem repeats"

(Edwards et al. 1990). Microsatellites ordinarily consist of short motifs, with a

comparatively low degree of repetition, and have a dispersed distribution over

the genome in eukaryotes (Tautz and Renz 1984).

Another tandem repeat vas t e m d "midisatellite" by Nakamura et al.

(1 987). DNA in this arrangement combines typical properties of satellites (Le.

long array of repeats at a single genomic locus) and minisatellites (Le. variable

number of tandemly repeated 40 bp sequenœ).

Properties of mini and microsatellite DNA sequences

A collective property of mini and microsatellite tandem arrays is that

identical or related motifs ocair at multiple genomic sites (Le. these sequences

share the properties of both tandemly repeated as well as interspened DNA).

Moreover, different minisatellites and microsatellites occur frequently

intermingled with each other (Weber 1990, Amour et al. 1990). Together Gth

the accumulation of point mutation wi-thin repeat units, the intemingling of

different types of repeats may wnclude in DNA sequenœs which are cryptically

simple (Tautz et al. 1 986) ( Le. their repeat structure is more or less hidden).

S ince tandem repeats in general, and minisatellite and microsatellite-like

sequences in particular, are characterised by highly fluduating copy numbers of

identical or closely related basic motifs, this class of DNA polymorphism was

called 'VNTR" (variable number of tandem repeats) by Nakamura et al. (1 987).

The existence of tandem repeats containing very short (1 to 6 bp)

sequence motifs was recognised in the early 197Qs (e.g. (TAGG)n repeats in

satellite DNA of a hennit crab) (Skinner et al. 1974). Sinœ then, many studies

have been undertaken on the occurrence and distribution of this kind of DNA in

human, animal, fungal, plant and bacterial genomes (Beckmann and Weber

1992, Greaves and Patient 1985, Hamada et al. 1982, Lagercrantz et al. 1993,

Miklos et al. 1 989, Stall ings et al. 1 991, Tautz and Renz 1984, Tautz et al. 1 986,

Weising et a' 1991 ). The general consequenœ of these studies was that simple

sequences or microsatellites are ubiquitous constituents of most eukaryotic

genomes, Mi le they are scarce or absent in prokaryotes (Gross and Garrard

1986).

The work of Epplen and colleagues (1 986), showad that hybridization

probes complementary to simple sequence motifs can be successfully used in

generating DNA polymorphic markers. While probes used in this oligonucleotide

fingerprinting technique probably recognized microsatellite-like target

sequences, the nature of the detected polymorphisms was not clear. Since

sequenced microsatellites are usually not much longer than about 100 bp, and

the size of the fingerprint fragments detected by simple sequence

oligonucleotide probes ordinarily ranges from 1 kb to more than 10 kb, the

detected polymorphisms are probably not only based only on variable numbers

of microsatellite repeat units. Cloning expenments demonstrated that different

types of simple sequences are customarily intemingled with each other and with

other types of (tandem as ml! as interspersed) repeats (Amour et al. 1989,

Broun and Tanksley 1993, Kaukinen and Varvio 1 992, Zischler et al. 1992). It

remains to be resolved whether the concerted action of a mixture of distinct

classes of repeats or an as yet unkncnm mechanism is responsible for the

development of these polymorphisms.

Levels of polymorphism revealed by DNA fingerpfinting wïth both

minisatellite and simple repetitive oligonucleotide probes rely on several factors:

(1 ) the investigated species, (2) the repeated sequence motif employed, (3) and

the restriction enzyme employed. However, it is not clear which features are

important for a probe to reveal polymorphisms (Sharrna et al. 1994, Weising et

al. 1992, and Zeh et al. 1993).

Locakation of mini and microsatellites

The genomic dispersion of GC-rich minisatellites in humans as wll as in

several birds and mammalian genomes has been studied (Jeffreys et al. 1986,

Wetton et al. 1987, Amour et al. 1989, Wells et al. 1989). Sequence analysis

has show that minisatellite arrays are often intemingled with different types of

repetitive DNA, distinctively with interspersed repeats. In humans, in situ

hybridization unveiled a prevalent localization of minisatellites close to telomeres

(RoyIe et al. 1988, Vergnaud et al. 1991 ). However, such dispersions were not

found in other species (e-g. mouse, Julier et al. 1992, cattle, Georges et al.

1 991 , and tomato, Broun et al. 1 993). The data implied a clustered rather than

dispersed distribution of minisatellites throughout the genome, wïth a propensity

for reg ions that are generally rich in repetitive DNA. Conversel y, microsatellites

appear to be more evenly dispersed throughout eukaryotic genomes. Studies

using m icrosatel lite probes showed that d(GT/CA). repeats are evenly

dispersed throughout the human (Weissenbach et al. 1992), mouse (Dietrich et

ai. 1992), and rice genorne (Wu et al. 1993).

Mechanism that account for minisatellite and microsatellite polymorphism

Minisatellite and microsatellites are customarily characterized by high

meiotic mutation rates, which chiefly conœms the number of repeats. (Jeffteys

et al. 1 988, Jeffreys et ai. 1 990, Kelly et al. 1 989). Interestingl y, mutation rates

are positively correlated with total size of the array, not only in minisatellites but

also in microsatellite sequences (Amour et al. 1992. Gray and Jeffreys 1991,

Caskey et al. 1992, Weber 7990). 60th types of repeats remain invariant for

long periods of time if they cany a few repeated motifs. However, as soon as

the tandem copy number surpasses a certain threshold, the likelihood for further

change is greatly enhanced (Richards and Sutherland, 1992).

The molecular foundation of both minisatellite and simple sequence

variability is still a mater of controversy. Conceivable mechanisms include

replication slippage, transposition, recombinational events, and unequal

exchange between sister chromatids at rnitosis/rneiosis or between homologous

chromosomes at meiosis (Jarrnan and Wells, 1989, Jeffreys et al. 1993, Wolff

et al. 1991 ). The slippage hypothesis implicates slipped-strand mispairhg of the

newly replicated strand during the replication process (Levinson and Gutman

1987). In vifm experiments demonstrate that replication slippage can actually

result in considerable amplification of a given simple sequence repeat

(Sdilotterer and Tautz 1992).

Several lines of evidenœ have lent support to the recombination

hypothesis: (1 ) a collection of minisatellite wre sequenœs share homology

the bacterial rewmbination signal chi (Jeffreys et al. 1985a, Jeffreys et al.

1985b) (2) minisatellite-like sequenœs have been discovered at sites of meiotic

crossing over (Chandley and Mitchell 1988) (3) both minisatellites and

microsatellites a d as recombinational hot spots in transfected mammalian cells

(Wahls et al. 1 990). Taken together, recombinational processes as well as

repl ication slippage may positive1 y contribute to minisatellite and simple

sequence variability. Howver, other unidentified mechanisms rnay also be

involved, particularly in the case of amplification of trinucleotide based

microsatellites associated with some human genetic diseases (Caskey et al.

1992, Richards and Sutherland 1992, Kunkel 1993, Orr et al. 1993. Wang et al.

1 994).

Amplified microsatellites

After the sequences of minisatellite or simple sequence flanking regions

are known. locus-specific primers for DNA amplification using PCR can be

attempted. This approach combines the high infomativeness of minisatellite

and simple sequenœ loci the ease and speed of the PCR technique. The

polymorphic behaviour of an individual, defined minisatellite, or simple sequence

stretch is largely a consequence of its variable number of tandemly repeated

sequence elements. Consequently, amplification of this stretch with flanking

primers should result in a polymorphic, highly informative band derived from an

individual locus. The successful application of this technique was established

for human minisatellites (Boerni-nkle et al. 1989, Hom et al. 1989, Jeffreys et al.

1988), as wll as for simple sequenœ loci (Litt and Luty 1989. Smeets et al.

1989, Tautz 1989, Weber and May 1989). These initial experiments showad

that (1 ) single loci are amplified, resulting in one or hiuo bands depending on the

homo- or heterozygous structure, (2) many different-sized alleles exist in a

population, and the level of heterozygosity is notably high, and (3) these

markers are transmissible in a Mendelian fashion and can be used for linkage

and segregation analysis.

Simple sequenœs have two main advantages over minisatellites in this

kind of analysis. Foremost, they are short (typically 20 to 40 bp) and easy to

amplify. Minisatellite arrays often are too long (i.e. 0.5 to 30 kb) for efficient

amplification (Jeffreys et al. 1988). Second, stretches of simple sequences are

more evenly dispersed over the genome than minisatellites. Weber (1 990)

investigated the infomativeness of microsatell ites of the (GTICA). type. Weber

showed that the level of polymorphism exhibited by PCRamplified

microsatellites rely on the num ber of the "pure" (Le. unintempted), tandeml y

repeated motifs. Below a certain threshold (Le. 12 CAiepeats in this

investigation), the microsatellites were not considerably polymorphic. Above this

threshold, however. the likelihood of pol ymorphism increased with length. In

contrast to RAPDs, in PCR of microsatellites restrictive annealing conditions can

be applied. This ensures high levels of reproducibility, and eliminates problems

regarding cornpetition between primer$ and errors during amplifications in

RAPDs.

These marker techniques which have refined high resolution genetic

maps for human (Weissenbach et al. 1992), and mouse genomes(Love et al.

1990), are mainly based on the use of microsatellite DNA sequences. PCR

amplification of microsatellites has also been successfully utilized for the

anaiysis of plant genomes (Aùkaya et al. 1992, Lagercrantz et al. 1993,

Morgante and Olivieri, 1993, Senior and Heun, 1993, Wu et al. 1 993, Zhao and

Kochert 1993). In the course of these experiments, extensive database research

unveiled that the relative abundance of different microsatellite motifs in plants

and animals dïfFer considerably (Lagercrantz et al. 1993, Morgante and Oliviefi

1993). For example, the d(GT/CA), repeat is one of the most frequently

occurring microsatellites in humans and many mammals (several tens of

thousands of copies) (Beckmann and Weber 1992, Hamada et al. 1982,

Stallings et al. 1991). In contrast, (ATKA). is the rnost common microsatellite in

plants, while d(GT/CA)" is relatively rare (Lagercrantz et al. 1993).

Though the convenience of PCRamplified microsatellites over other

types of markers is promising, there are partiwlar limitations. Most importantly

the identification of an informative microsatellite locus, and identification of

suitable primer sequences is even more wmbenome and expensive than in the

generation of locus-specific pol ymorphic hybridization probes. Another

drawback is that enzymatic amplification of dinucleotide repeats commonly

results in a cluster of bands which are separated from each other by two or more

bp intervals and may cause disaepancy on the actuel sire of the PCR products

produced. The extra bands are thought to be the result of slippage events. This

is thought to occur during DNA replication by the Taq polymerase (Smeets et al.

1 989).

Functional importance of minisatellites and simple sequences

The functionality of minisatellite and simple sequences for eukaryotic

genomes is not well understood. Whereas both types of sequences confonn

with the concept of "selfish DNA (Dwlittle and Sapiema 1980, Orgel and

Crick 1980), their ability to multiply in the absence of counterselective pressure,

probable structural and functional roles, nevertheless have been implicated.

Telomeres

Telomeric repeats, are found at the ends of eukaryotic chromosomes,

and depict a special class of simple sequences. A basic motif of 4 to 10 bp,

which exhibits a marked base asymmetry (one strand is GA-rich and the other

strand is CT-rich), is repeated several hundred to thousand times and foms a

single-stranded 5' overhang at the ends of each chromosome. Telomeres are

created by the action of a specific DNA polymerase named telornerase. Using an

intemal RNA molewle as the template, this enzyme adds additional telomeric

repeat units to the end of existing telorneres. Telomeric sequenœs are a rare

example of simple sequences retaining clearly defined functions: they protect

the chromosomal ends from degradation and fusion process and compensate for

DNA loss due to unfinished replication of chromosomal ends. Functional impact

of telomeric repeats on nuclear architecture is reviewad by Blackburn (1 991 and

1 992).

Centromeres

The majority of diromosomal centromeric regions most Iikely consist of

repeated sequences. The simple repeated element (GGAAT), was recently

described in yeast and human œntromeric regions (Grady et al. 1992). This

repeat displays an unusual DNA conformation and has a elevated affÎnity for

specific nuclear proteins. The discovery of highly reiterated repeats reminiscent

of degenerate telomere sequenœs in plant centromeric regions also propose

that simple repeats may be a general structural component of centromeres

(Richards et al. 1 991 ).

Transcription

With some exceptions (e-g- multigene families, ribosomal and t RNA

genes, transposable elements), repetitive DNA is commonly thought to be

transcriptionally silent. While this is most likely also tnie for the majority of

minisatellites (Swallow et al. 1 987). short stretches of simple sequenœs

(trinucleotide repeats) such as GGT in glycineiich and CCA in proline-rich plant

proteins have been show to be transwïbed (Condit et al. 1986). Simple

sequence motifs have been shom to be transcribed and translated in several

human genetic disorders (Caskey et al. 1992, Richards and Sutherland 1 992).

Except for contributing large nurnbers of identical amino acids within specific

proteins, the functiona! impact of simple sequence transm.ption is as yet

uncertain.

Transcriptional regulation

Minisatellites or simple sequenœs located in DNA wntrol regions are

capable to enhance or diminish the transcription rate of neighbouring genes

(Glaser et al. 1990, Hamada et al. 1994, Lu et a' 1993, Naylor and Clark 1990,

Spandidos and Holmes 1987). For example, poly(CA) was found to enhance the

expression of genes in transfected mammalian cells (Hamada et aL ?984), and

two (CT/GA)n motifs were identified as important stimulating elements of a

Drosophila heat shock gene promoter (Glaser et al. 1990, Lu et al. 1993). A

negative effect on transcription was obsewed by Naylor and Clark (1 990), in

Wich a (GTICA). motif upstream of the promoter region of the rat prolactin gene

abolished transcription of a reporter gene in transfected mammalian cells. In

these experiments, the formation of Z-DNA in the upstream region containing the

(GTICA). motif was attributed ta the inhibition of gene transcription.

Recombination

Minisatellites as well as simple sequenœs (especially (GTICA). repeats)

have been assigned a functional role as recombinational hot spots in humans,

however this view is controversial (Wahls et al. 1990). Research conducted by

Wahls et al. (1990) demonstrated that the insertion of minisatellite sequenœs in

plasmids stimulated recombinational events that allowed the integration of the

plasmid into the genome of wltured human cells. The presence of minisatellite

DNA in a plasmid caused a 13.5 fold increase in the frequency of integration into

the hostos genome wmpared to a plasmid without minisatellites.

Replication

Simple sequence repeats have been discovered at a putative replication

origin in the slime mold Physanrm polyœphalum (Opstelten et al. 1989). This

group put fontvard a general hypothesis in which slippage of simple sequences

may yield locally unpaired areas of DNA that are recognized by replication

initiation factors.

In summary, tvvo main mechanisms have to be examined when showhg

how minisatellite and simple sequences can control cellular processes: (1 ) some

simple sequences (e-g . (GT1CA)n or (CTIGA). type) may exercise their biological

effects by adopting peculiar DNA conformations and thus altemating chromatin

structure (Vogt 1990) and (2) some repeats maybe recognized by regulatory

proteins. Sequence-specific binding of nuclear proteins to minisatellites (Collick

and Jeffreys 1 990, Collins et al. 1 991, Wahls et al. 1 991, Yamazaki et al. 1 992),

and simple repeats (Epplen et al. 1993, Gilmour et al. 1989, Yee et al. 1991 ),

was commonly deteded, either with single or double stranded DNA Taken

together, most minisatellites and simple sequenœs do indeed function selfishly

by having evolveâ strategies which guarantee their genomic survival.

Nevertheless, there is substantial evidence that certain repeats located at

specific genornic positions have acquired one or more of the specific functions

illustrated above.

Molecular markers in Fungi

Fungi are increasingly important for a diversity of industrial purposes, and

numerous species are serious pathogens of plants, domestic animals and

humans. In different areas of research, the precise and unequivocal

identification, discrimination, and characterization of fungal species, races,

isolates, populations and pathotypes is of prime significance. However, this is a

laborious or even unattainable task if the characterization relies only on growth

characteristics, rnorphological, sexual compatibility ,and biochemical criteria.

Molewlar marken have consequently been looked for and a extensive variety of

molewlar techniques are available to study genetic variation within fungi.

These techniques include analysis of allozymes, RFLPs, eledrophoretic

karyotyping, and hybridization-based DNA fingerprinting. Three kinds of DNA

probes have mainly been employed for fingerprinting studies in fungi: (1 ) random

repetitive DNA probes derived from the fungal genome under investigation, (2)

minisatellite probes, often derived form the human or wild type M l 3 phage

genome, and (3) synthetic oligonucleotide probes complementary to simple

repetitive sequences. The majority of these studies in fungi have depended on

cloned genomic probes (Brown et a/. 1 990, Hamer et al. 1989, Kistler et al.

1991 , Scherer and Stevens 19ûû). Microsatellites have extensively been

employed in fingerprinting of fungi (Meyer et al. 1994, Meyer et aL 1992, Meyer

et al- 1993a). The use of RAPDs have also been used in fingerprinting of fungi

(Meyer et al. 1 993a. Meyer et al. 1993b, Schonian et al. 1993).

Examples of fungal species for Hihidi DNA fingerprinting analysis has

been accomplished by hybridization to repetitive DNA probes, in addition to

minisatellites, simple repetitive sequenœs, and probes cloned from genomic

DNA, are listed in Table 1, and examples of fungal species in which DNA

fingerprinting has been accomplished vvith PCR-based rnethods employing

arbitrary primers, together with minisatellite and simple sequence primers, are

listed in Table 2,

Tabfe 1. Fungal species in Hihidi DNA fingerprinting analysis has been perforrned by h ybridization to repetitive DNA probes.

Fungal species Referenœ

Absidia glauca

Alternaria altemata

Arxula adeninivorans

Ascochyta pisi, A. rabiei

Aspergillus amstelodami, A. a wamo~, A. ficuum, A. flavus, A. fumigatus, A. giganteus, A. nidu/ans, A- niger, A. ochraceus, A. repens, A. restnctus, A. teneus, A. versicolor

Beauveria bassiana

Candida albicans, C. glabrata, C. krusei, C. lipolytica, C. parapsilosis, C. stellatoidea. C. tropicalis, C. utilis

Cocholiobolus carbonum, C. hetemstmphus, C. victonae

Colletotnchum coccsides, C. desttucüvum, C. gloeosponoides, CC. graminimla, C. lagenanum, C. lindemuthianum, C. magna, C. orbiculare, C. pisi, C.trifdii

Coptinus comatus

Meyer et al. (1 992)

Adachi et al. (1 993)

Lieckfeldt et al. (1 992) Meyer et al. (1 993)

Bienverth et al. (1 992) Kaemmer et al- (1 992)

Girardin et al. (1 993) Meyer et al- (1 991 ) Meyer et al. (1 992)

Hegedus and Khachatourians (1 993)

Fox et a' (1 989) Hellstein et al. (1 993) Lieckfeldt et al. (1 992) Lieckfeldt et al. (1 993) Wilkinson et al. (1 993)

Rodriguez and Yoder (1 991 )

Braittiwaite et al. (1 989) Correll et al. (1 993) Radriguez and Yoder (1991 )

Weising and Kahl (1 990)

Milgroom et al. (1 992)

Erysri,he gratninis Brown et al. (1 991 )

Fusamm avenareum, F. culmo~m, F. avenaœum, F. graminearum, F. laterifunn, F. spomtrichiella F. oxyspowm, F. poae, F. scirpi,

Hansenula anomala

Leptosphaena maculans

Mucor hiemalis, M. plumbeus, M. racernosus

Mymsphaerella fijienssis, M. graminimla, M. pinodes

Nectna haematococca

Ophiostoma ulmi

Parasitella simplex

Penicillium canescens, P- chrysogenum, P. citreoviride, P. c#rinum, P. aurantiogriseum, P. dupontii, t? expansum, P. glabrum, P. glandicola, P. janthinellum, P. lavendulum, P. minioluteum, P. variabile, P- vïndicatum

Phoma lingam

Phyoomyces blakesleeanus

Phytophthora aïrophthora, P. colocadae, P. hibernalis, P. ilik5s, P. infestans, P. megaspem?a, P. mirabilis, P. phaseoi

Kistler et al. (1 991 ) Manicom et al- (1 987) Meyer et al. (1 992) Monastyrskii et a' (1 990)

Walmsley et al. (1 989)

LieMeldt et al. (1 992) Walmsley et al- (1989)

Meyer et al. (1 992)

Boewinkle et al. (1 989)

Meyer et al. (1 992)

McDonald and Martinez (1 990) and (1 991 )

Rodriguez and Yoder (1991)

Hintr et al. (1 991 )

Meyer et al. (1 992)

Kuhls et al. (1 992) Meyer et al. (1 993) Wei he et al. (1 990)

Rodriguez and Yoder (1991)

Weising and Khal (1 990)

Drenth et al. (1 993) Goodwin et al. (1 989) Rodriguez and Yoder (1 991 Whisson et al. (1 992) SMnger et al. (1 991 )

Puccinia graminis

qrthium mamillatum

Saccharomyces cerevisiae, S- dairensis, S. delbnreckiL S. exiguus, S. fermenta6 S. Muyveri. S. unisponrs

Sclefvünia scler0tiomm

Septosphaen'a turcica

Stachybotrys chartarum

Tnchoâerma hamanum, T. longibranchiatum. T. polyspomm, T. pseudokoningii, T. reesei, K satumisporum, T- vinde

Usfilago maydis

Verticillium lecanii

Zygosacchammyces bailii

Anderson and Pryor (1 992)

Rodriguez and Yoder (1991)

Kunze et al- (1 993) Lieckfeldt et al. (1 992) Walmsley et al, (1 989)

Kohli et a/. (1 992)

Rodriguez and Yoder (1991)

Cooper et al. (1 992)

Meyer et al. (1 992)

LiecMeldt et al. (1 992) Meyer et al. (1 991 ), (1 992) (1 993)

Meyer et al. (1 991 )

Meyer et al. (1 991 )

Varma and Kwbn-Chung (1 992)

Meyer et al. (1 991 ),

Walmsley et al. (1 989)

Table 2. Fungal species in which DNA fïngerprinting has been perfomed with PCR-based methods using arbitrary pnmers, including minisatellite and simple sequenœ primers

Fungal species Reference

Absidia glauca

Acaulospora laevis

Agancus bispotus

Armillan'a bulbosa

Arxula adeninivorans

Ascochjda ra biei

AspergilI'us aculeatus, A. a wamori, A. candidus, A. carbonariusa, A. ellipticus,A. flavus, A. ibetidus, A. fumigatus A. giganteus, A. helicathrk, A. hennebergii, A. heteromorphus, A. intemedius, A. japonicus, A. nanus, A. nidulans, A. niger. A. ochraceus, A. phoenias, A. pulverulentus A- resinctus, A. temus, A. usami, A. ve~~icolor, A. wentii

A ureobasidium pullulans

Candida albicans, C. glabrata, C. guillietmondii C. haemulonü , C. knrsei, CC. lipolytica, C. lusitaniae C. parapsilosis, C. pseudotmpicalis, C. stellatoidea C. tmpicalis, C. utilis

LiecMeldt et al. (1 992) Wostemeyer et a' (1 992)

Wyss and Bonfante (1993)

Khush et al. (1 991 )

Smith et al. (1 992)

Lieckfeldt et al. (1 992) Meyer et al. (1 993)

Kaemmer et al. (1 992)

Girardin et al. (1 993) Meyer et a/. (1 991 ) Meyer et al. (1 992) AufauvreBrown et al. (1 992) Loudon et al. (1 993) Megnegneau et al. (1 993)

Bulat and Mironenko (1 992)

Van der Vlugt-Bennans (1 993)

Bostock et al. (1 993) Caetano-Anolles et al. (1991 Lehmann et al. (1 992) Meyer et al. (1 993) Niesters et al. (1 993) Sullivan et al. (1 993) Jones and Dunkle (1 993)

Colletotnchum acufatum, C. mgaifa, C. gloeosponoides, CC. graminicola, C. kahawae, C. magna, C. onbicuIam

Cronattium quetwum

Cryptococcus albidus, C. laurentii, C. neohmans

Erysiphe graminis

Fusarfum graminearum, F. oxyspomm, F. solani

Gigaspora margatita

Glomus caledonium, G. mosseae, G. versiforme

Gremmeniella abietina

Heterobasidion annosum, H. araucanae

Histoplasma capsulaturn

Hypoxylon truncatum

KIluyverumyœs ftagilis, K, lactis

Lentinula edodes

Correll et a' (1993) Freeman et al- (1 993) Guthrie et al. (1 992) Mills et aL (1992) Vaillancourt and Hanau (1 992)

Meyer et al- (1 993a) Meyer et al- (1 993b) Mitchell et al- (1 993)

Caetano-Anol les et al. (1 993)

McDonald and McDennott (1 993)

Kistler et al. (1 991 )

Wyss and Bonfante (1 993)

Wyss and Bonfante (1 993)

Hamelin et al. (1 993)

Garbelotto et al- (1 993) Fabritius and Karajalainen (1 993)

Strongman and McKay (1 993)

Kersulyte et al. (1 992)

Yoon and Glawe (1 993)

Lieckfeldt et al. (1 993)

Kwan et al. (1 992)

Leptosphaena maculans

Mymsphaerella @ensis, MM. graminimk, M. musimla

Neurospora crassa

Goodwin and Amis (1 993) Wostemeyer et. al. (1 992)

JohansonandJeger (1 993) McDonald and McDemott (1 993)

Williams et al. (1 990) Williams et al. (1 991 )

Parasitella simplex Wostemeyer et al. (1 992)

Penici/Iium aurantiognseum, P. canesœns, Durand et al. (1 993) P. chrysogenurn, P. citreoviride, P- citrinum, Kuhls et al. (1 992) P. dupontii, P. expansum, P. glabnrm, P. glandida, Meyer et al. (1 993a) P. islandicum, P. janthinellum, P. la vendulum, P. minioluteum, P. roqueforfii, P. variabile

Pyrenophora graminea, P. teres Reeves and Ball(1991)

Pythium ultimurn Francis and Clair (1 993)

Rhabdoclrine parken McCutcheon ef al. (1 993)

Rhizodonia solani Duncan et al. (1 993)

Rhodotorula rubra Meyer et al. (1 993b)

Saccharomyces bayanus, S. cerevisiae, Lieckfeldt et al. (1 993) S. delbrueckii, S. diastaticus, S. fermentati, Meyer et al. (1 993a) S. pastorianus, S. willianus

Wyss and Bonfante (1 993)

Suillus granulatus Jacobson et al. (1 993)

Tnchoderrna harnatum, T. hanianum, Lieckfeldt et al. (1 993) T. longibrachiatum T.pseudokoningii, T. mesei, Meyer et al. (1 992b) T. satumispoium, T. vin& Meyer et al. (1 992)

Schlick et al. (1 992a) Schlick et al. (1 992b)

Venturia inaequalis Sierotzki et al. (1 994)

Classification of the genui Pvu,ium

mhium belongs to the class of organisms refened to as the Oomycetes.

Members of this class are mostly aquatic and are thought to be related to the

heterokont algae (Barr 1 992). Cavalier-Smith (1 989) classif ied the Oomyœtes

along with the Hyphochytriomyœtes under the subphylum Pseudomycatina,

phylum Heterokonta, and the kingdom Chromista. Thus, the Oomycetes are not

included in the tnie fungi, Hihich are plaœd in a separate kingdom, Eumycota

(Cavalier-Smith 1 989). The Oomyœtes produce biflagellate zoospores with one

tinsel flagellum directed forward and one whiplash flagellum directed backward.

Their cell walls consist mainly of glucans and they contain cellulose as opposed

to chitin. They are diploid and their sexual reproduction is oogamous and

meiosis is gametangial (Alexopolous and Mims 1979). Aquatic Oomyœtes are

know for their parasitic behaviour on many small animals, algae, water molds,

and other aquatic organisms. Terrestrial forrns of the Oomyœtes are parasites

of plants, passing their entire life cycle in the host However, the production of

zoospores continues to be common, an indication of their aquatic ancestral

traits (Alexopolous and Mims, 1979).

The Oornyœtes are subdivided into six orders; Eurychasmales,

Saprolegniales, Lagenidiales, ihraustochytriales, Labyrinthulales, and

Peronospwales ( S p a w 1976). Of these, the Peronosporales are of great

ewnomic importance due to their destructive nature in plants. Further

classification of the Peronosporales is mainly based on the shape of the

sporangia and sporang iophores. Alexopolous and Mims (1 979) divided this

order into four families; Albuginaceae, Peronosporaœae. Peronophythoraceae,

and the Pythiaceae. Waterhouse (1973) published a key to the Pythiaceae that

included eigM genera; the most cornmon of #ese being Phytophthora and

Pythium. Members of the genus Phytophthora include many important plant

pathogens, such as Phytophthora intèstans, the cause of late blight of

potatoes. The genus Pythium includes more than 120 descrïbed species with

w-de distribution and host ranges (Dick 1 990, Plaats-Niterink 1 981 ). Members

of the genus Pyfhium live in the soi1 saprobically on dead organic matter or

parasitically on the young seedlings of great number of susceptible species of

economic seed plants. Taxonomy of the genus Pythium is mainly based on the

morphological charaders of the reproductive structures, such as zoosporangium

presence, shape, and size, zoospore production, oospore size and wall

thickness, and the number, shape, and orïgin of the antheridia (Plaats-Niterink

1981). Identification of some Pythium species is difficult due to the absence of

certain reproductive structures. Heterothallic species are among these and thus

the opposite mating types must be considered for proper identification. Pythjum

isolates that reproduce only asexually are considered the most diffiwlt to identify

(Plaats-Niterink 1 981 ).

Pythium ultimum is regarded as a major plant pathogen with wrldwide

distribution. It has been isolated throughout the United States (Miller et al. 1957,

McLauglin 1 946, Sprague 1 942) and Canada (Vaartaja and Agnihotti 1 969).

Tahiti (Scott, 1 960), South Ametica (Alvarez-Garcia and Cortes-Monllor 1 971 ),

lceland (Johnson 1971), M c a wager 1931, Ravise and Boccas 1969, Fifani

1 975), Europe (Kouyeas 1 977, Domsh et al. 1 968, Plaats-Niterink 1975, and

Cejp 1 961 ), Japan (Alicbusan et al. 1965) and Australia (Vaartaja and Bumbieris

1 964)-

Pythium ultimum affects a wide variety of plant species, especially in the

seedling stage, causing preemergence and postemergence damping off, root rot,

and l o w r stem rot (reviewed by Hendrix and Campbell 1973). P. uftimum is one

of the most prevalent of Pythium species found in the soi1 (Plaats-Niterink 1981).

In soils where it is predominant, plants not immediatefy killed by the pathogen

can go on to mature, but are likely to experienœ poor root development, stunting

and reduced yields. Reduœd plant vigour has been described as the only

above-ground symptom which may be manifested in crops infected with P.

ultimum (Yuen et al. 1991). Some of the hosts from WiCh P. ultimum has been

isolated are: tulips (Moore and Buddin 1937), sweet potato (Poole 1934), sugar

beet (Gindrat 1976), coffee (Filani 1975). and apple (Bielenin 1976).

Classification of the genus AspergiIIus

Members of the genus Aspetgilfus belong to the group of fungi called the

deuteromycetes, which also includes the genus Penicillum. The deuteromyces

are among the most widely distributed fungi in the world. They are of immense

importance in human affairs and have been studied intensively (Raper and

Fenneli 1965). In their monograph on the genus Aspe~giflus, Raper and Fennell

(1 965) accepted 132 species subdivided into 18 groups. The generic and

species concepts were cirwmsaibed in this monograph and it is still a valuable

source for species identification and is wrrently used today for the classification

of members in this genus.

The Aspergilli have been used for many years by the fermentation

industry for the production of citric acid and other organic acids, and have been

used for centuries in the preparation of soy sauce (Yong and Wood 1974).

Furthemore, Aspeq$lli are capable of utilizing an enormous variety of

substances for food because of the large number of enzymes they produce.

More recently the Aspergilli have been exploited for the production of enzymes

widely used in industry for the manufacture of a variety of materials. A wide

range of secondary metabolites are produced by these fungi, including the

potent carcinogenic aflatoxins. Aflatoxin was deteded in the 1960's when

100,000 or more turkey pullets died in England from a new disease tenned

'Turkey X-disease". The mold producing the powerful toxin was Aspe~gillus

navus and thus the toxin was named aflatoxin (reviewed by Raper and Fennell

1965). As human pathogens, members of the Aspegilli produœ an assembly of

diseases col lect ive1 y k n ~ as aspergilliosis (Rippon 1 974). Asperg illiosis of

the lungs is apparently the most serious of these diseases and is quite common

in birds and various mammals including humans (Rippon 1974).

Aspergillus flavipes was first describecl in 1 91 1 as a species of

Stengmatocysfis (Bainier and Sartory 191 1). Colonies are desaibed as having

colorless to yellowish aen'al mycelium. Conidial heads are desmibed as radiate

to loosely columnar with globose vesicles. One distinguishing characteristic in

classification of the genus Asper@lli is the color of conidia. Because conidia are

produced in such abundance, their color is a predominant feature. Aspergillus

colonies can appear to be black, brown, blue, yellow, or green, with the color

depending on the species and on the medium on which the fungus is growing.

This characteristic is an important feature in the classification of many of the

species associated with this genus. Conidiophores in A. &@es are pale yellow,

smooth, and phialides are biseriate. The teleomorph of A. tlavipes (Fennellia

flavipes) is characterized by numerous small cleistotheicia within such a large

mass of elongate to helical hulle cells (Wiley and Fennell 1973).

The use of non-morphological methods vvhich could be important for

Aspergilllus taxonomy were discussed by Fennell (1 977). In her review, Fennell

discussed important features like cell wall composition, proteins, pyrolysis

products, nucleic acids, amino acid biosynthesis, hydrocarbon metabolism and

inorganic elements, which could aid in the classification of the genus. Of al1

these techniques only the use of enzymes and nucleic acids are still considered

to be relevant for taxonomie purposes today.

With the advent of biochemical and molecular genetic techniques, new

approaches to the detedion and identification of different species of the

Aspergilli have b e n developed. Although A. flavipes is an economically

important fungus which could benefit from DNA fingerprinting to differentiate its

isolates ftom each other, no studies have been cwiducted to help identify and

characterire its DNA for these purposes.

Some of the isolates of A. flavipes in this study are patented due to their

economic value which involves the synthesis of the antidepressant imiprimine.

Imipfimine is still widely used today to treat several obsessive compulsive

disorders such as anorexia nervosa, and hyperactivity in children. Furthemore,

isolates of Aspergillus flavipes have been used to perfom various chemically

diffÏcult steps in organic synthesis, e-g. in the production of anticancer agents,

and insecticides, or in stereospecifïc oxidation of R-(-)glaucine, Davis and

Talaat (1 981 ).

PCR amplifiad microsatellites in fungi

To date no research has been conducted to verify that PCR amplification

of simple sequence DNA (microsatellites) is useful for typing of different strains

of fungi although the abundanœ and types of simple sequenœs has been

reœntly described to some degree in members of the genus A s ~ l l u s .

Although simple sequence DNA has shown important promise as a molecular

marker, the use of microsatellite sequences for DNA fingerprinting has been

addressed only reœntly in fungi.

Materials and Methods

Strains of Pythium ultimum usad in this study

All Pythium ulfimum isolates used in this study were acquired from the

Biosystematics Research Centre, Ottawa, ON, Canada or from the

Centraalbureau voor Schimmelwltures, Baam, Netherlands, and are Iisted in

Table 3.

Strains of Aspergillus tïavipes used in this study

The cultures of A s ~ l f u s flavipes were obtained from Apotex

Fermentation Inc. (Winnipeg, MB, Canada) and were provided on potato

dextrose agar slants. The swrce of these cultures was the American Type

Culture Collection (ATCC, Rockville, MD, USA). The information obtained for

these isolates is summarized in Table 4.

Table 3. Description of Pyfhium isolates used in this study.

P. ultimum. var. ultimum Papaya BR319

P. ultimum, BR406 Alfalfa

P. ultimum. var. ultimum Alfalfa BR41 8

P. ultimum. var. ultimum Soil BR471

P. ultimum BR583 Safflower

P. ultimum. var. ultimum Bean BR600

P. ultimum 8 ~ 6 1 2b Geranium

P. ulfimum. var. ulfimurn Pea BR638

P. ultimum. var. ultimum Pea BR639

P. ultimum. var. ulfimum Cucumber BR640

P. ultimum. var. sporangiifèrum Soil BR650

P. ultimum. var. ultimum unknown BR925

P- ultimum. var. uitimum Lepidiurn sativum CBS398.5 1 (neoty pe)

P. ultirnum. var. ultimum Apple root CBS488.86

California

Quebec

Quebec

Alberta

British Columbia

Ontario

Alberta

Alberta

Alberta

Spain

unknown

Netherlands

Poland

P. uitimum. var- uttimum CBS114.19

P. ultitnum. var- ultimum CBS305.35

P. ultimum. var- ultimum CBS378.34

P. ultimum. var. ulfr'mum CBS730.94

P. ultimum. var. ultimum CBS726.94

P. ultimum. var. ultimum 688728.94

P. ultimum. var. ulfimum CBS729.94

P. ultr'mum, var. ultimum CBS249.28

P, ultimum. var. ultimum CBS264.38

P- ultimum. var. ultimum CBS291.31

P. ultimum. var. ultimum CBS296.37

P. ultimum. var. ultimum CBS656.68

P. anhenomanes BR607

Gymnospenn seedling

Grass root

TiïfblÏum pratense

8eans

VVheat soil muck

VVheat soi1 loam

VVheat soil muck

Sinningia speaisa

Seedling of pinus

Yams

Pea

Lycopetsicon esculenturn

Maize

Pheseolus vulgaris

Netherlands

Nethsrlands

Netherlands

British Columbia

British Columbia

British Columbia

British Columbia

Netherlands

Netherlands

Netherlands

England

Netherlands

Manitoba

Netherlands

Cuwmber British Columbia

P. disimile BR1 60 Wheat Ontario

'Isolates with the "BR" prefix were obtained from the Biosystematics

Research Centre, Ottawa, ON, Canada. lsolates with "CBS'prefix were obtained

from the Centraalbureau voor Schimmelcultures, Baarn, Netherlands.

b Originally identified as P. sp. Type G, but shown to be P. ulomum var.

ultimum (Buchko 1 996).

Table 4. Designation of strain number and ATCC characteristics of isolates of A. flavipes used in this study

Number assigned in ATCC Isolate, Characteristics, Origin this study

ATCC 1030, Produces imiprimine, transformations of sesquiterpene lactone costunolid, produœs didehyroglaucine. Possibly from Thailand.

ATCC 1 1013, ER. Squibb 8 Sons MD 2472, US patent 2768928, produœs imiprimine, transformations of sesquiterpene lactone costunolid.

ATCC 13830, Takeda Pham. Ind. Ltd. Patented

ATCC 16795, Transformations of sesquiterpene lactone costunolid, produces imiprimine, Texas

ATCC 16805, lsolated from soil, Haiti.

ATCC 1681 4, lsolated form dairy products, Minnesota

ATCC 24487, Type culture, Haiti

ATCC 26499, lsolated from bird feces, produces glutamicine (flavipucine), Italy.

ATCC 481 36, lsolated fom grassland soil, North Dakota, USA.

Culture rnethods

From the margin of a vigorous wlture growing on malt extract agar, an

agar plug (approx 5 mm in diameter) was transferred to a 2 L shaker fiask

wntaining 200 mL - peptone yeast extract - glucose medium (PYG) containing 3

g glucose, 1 g peptone, and 1 g Difco yeast extract per litre, and allowed to grow

in shake culture for 2-3 weeks at room temperature for Pyfhium sp. and 1 month

for Aspergilius isolates. Myœlia was then harvested by vacuum filtration ont0

Whatman No. 1 filter paper (Whatman Laboratory Produds, Clinton, NJ),

thoroughly washed with distilled water, and then fieeze dried. Mycelia harvested

from two shaker fiasks (300 mg dry weight) was generally sufficient for DNA

extraction. lsolates used in these investigations and their sources are listed in

Tables 3 and 4.

Genomic DNA extraction and purification

Initially, large scale DNA extraction was employed whereby 4-5 1 L

shaker flasks were harvested and, immediatel y after washing , the mycelium was

extracted by grinding in a prewoled mortar with pestle for 20 min in the

presenœ of liquid nitrogen. A rapid proœdure was developed which also

required less mycelium for extraction of suitable amounts of DNA.

A DNA "mini" preparation proœdure based on the methods of Murray and

Thompson (1 980) and Kim et al. (1 990) was used to extract "polymerase chain

reaction grade" ENA (Saiki et a' 1988). Frozen myceliurn (1 W-200 mg) was

added to sterile Falcon polystyrene conical tubes (Bedon Dickinson Labmre,

Lincoln Park, NJ), each of vuhich contained 4 m l of iœ cold lysis buffer (1 50 mM

NaCI. 50 mM EDTA, 10 mM Tris, pH 7.4), 20 mglmL proteinase K (Sigma, St-

Louis, MO), and 9 g of acid-washed and bakeddry 0.5 mm glass beads (Braun

Melsungen). The mixtures were then vortexed for 2 to 3 min, and an additional 3

mL of lysis buffer was added to each tube. Sodium lauryl sulfate (SOS, Fisher

Scientific, Nepean, ON) was added to a final concentration of 1%, and the tubes

then incubated at 5S°C for at least 1 h. NaCl and hexadecyltrimethyl ammonium

bromide (CTAB. (Sigma Chemical Co., St. Louis, MO) were added to the tubes

to a final concentration of 1 M and 1 % respectively, and the tubes were then

incubated for an additional 30 min at 55OC. Next the glass beads were pelleted

by centrifugation at 2000 rpm for 2 min, and the supernatant transferred

aseptically to sterile 15 mL glass Corex tubes (Canlab, Winnipeg, MB), and the

CTAB-protein complex and SDS w r e removed by tm chlorofomi/isoamyl

alcohol (24:1, V:V) extractions. Approximately 1 00 mg of DNA was recovered

from each culture by precipitation wïth 2.25 volumes of 95% ethanol. This

miniprep method was self contained within separate sterile tubes for each

culture, thus cross contamination by DNA fmm different samples was avoided.

The DNA was redissolved in 150 to 500 uL of TE buffer (10 mM-TrisMCI; 1 mM-

EDTA; pH 7.6) and stored fmzen et -20°C. Although the quality (size range: 20-

40 kb) and yield of the DNA ~ w s somewhat variable, one miniprep procedure

yielded suffident DNA from each sample to carry out genomic RFLP and PCR

analysis.

RNAse treatrnent of nucleic acid preparaüons for RAPDs

Fifty rnicroliter aliquots of the DNA preparation for RAPD analysis was

incubated without or with 0.5 ug of RNAse A (Sigma) in 0.5 uL of RNAse buffer

(1 0 mM Tris-HCI, , 15 mM NaCI, pH 7.5) for 1 h at 20°C. The stock RNAse 0

solution (1 O mg/mL) had been boiled for 15 min to destroy DNAse.

Oligonucleotide probes and PCR primer$

Oligonucleotide primen used for the polymerase chain reaction (PCR)

amplifications and DNA sequencing are show in Table 5. Oligonucleotides

were obtained from the Department of Microbiology, University of Manitoba,

which w r e synthesised with the ?CR-MATE 391 DNA synthesizer (Applied

Biosystems, Foster City, CA). RAPD primers UBC series were purchased from

University of British Columbia, Nucleic Acid-Protein Service Unit n an couver,

BC, Canada) and OP series from Operon Technologies, Inc. (Alameda, CA)

(Table 6).

Table 5. Oligonucleotide probes and sequencing primers.

Name of oligonucleotide Sequence 3-3'

d(GVg probe GTGTGTGTGTGTGTGTGT

d(cT)~ probe

d(AT)o probe

~ ( G C ) S probe

Ml 3 pBluescript T7 primer A A ~ G A C T C A C I C A ~

Ml 3 pBluescript T3 primer ATZ!UCCCCrCACT!AAAG

Table 6. Primers used in PCR reactions for RAPDs

Name of oligonucleotide Sequenœ 5-3'

UBC4 primer

UBC-6 primer

OPC-2 primer

OPC4 primer

OPC-6 primer

OPC-8 primer

OPA-2 primer

OPA-3 primer

OPA-4 primer

OPA-5 primer

OPA-9 primer

OPA-1 O primer

OPA-13 primer

cc-cm

GTrCAGCCGTIC

RAPD PCR conditions

All PCR readions were conducted in a PTC-100 Programmable Thermal

Controller equipped with the hot bonnet fmm MJ Research, Inc., using Taq DNA

polymerase obtained from Promega. Reactions were conducted in 0.5 mL

regular (not thin walled) Eppendorf tubes with no ail added due to the use of the

hot bonnet Most readions were begun in late af€emoon, finished dufing the

night , and then were held at 4OC for up to 10 h before electrophoresis. The

PCR reactions were fun in 50 uL of volume consisting of 34.8 uL of sterïle HPLC

grade water, 5 uL Promega Taq Buffer (IOx), 4.0 uL, 25 mM Mg& (Promega),

final concentration 0.2 mM, wanned to 37OC before adding, 1 .O uL template DNA

(0, 0.1, 0.01, or 0.001 dilution), 1 .O uL primer (60 ng), and 0.2 uL Promega Taq

DNA Polymerase (1 unit). DNA and primer were added separately to the side of

the tube and spun d o m immediately prior to reaction. The reaction protowl was

as follows: 1 :94OC, 45 sec; 2:40°C, 1 min; 3:72OC, 2 min; 4:Repeat 1 -3 for 35

cycles; 5:72OC, 5 min; 6:4*C, hold. Electrophoresis and visualisation was

accomplished using 10 uL of each readion mixture electrophoresed on a 1.5%

agarose gel together w*th the BRL 1 kb ladder of size standards.

Electrophoresis was typically run for 2 h at 75 V. Ethidium bromide was added

to the gel prior to gelling. Photographs of completed gels were taken using a red

filter Ath the gel on a UV transilluminator (Fotodyne Incorporated, Mississauga,

ON). Polaroid 667 film was used.

DNA Dat blotüng and fixation of DNA to nylon membranes

Approximately 1 ug of total genomic DNA (sample listed in Table 4) was

denatured at 1 O°C for 5 min and then quickly chilled on ice. Samples w r e

spotted ~ Ï t h aid of a Pipetrnan (Gilson Pipetrnan P2) ont0 Hybond-N+

(Amersham International, Oakville, ON) membrane allowed to dry at ambient

temperature. DNA was fixed to the membrane using a 310 nm W source,

according to the manufacturer's instructions.

DNA digestion and electrophoresis

Endonuclease digestions were perfoned using enzymes obtained from

Pharrnacia (Canada) Ltd. Dorval, Que. and BRL (Bethesda Research

Laboratories Inc., Gaithersburg, MD), according to the manufacturer's

recommendations. Electrophoresis was camied out in TBE buffer (89 mM Tris,

89 mM boric acid, 2.5 mM EDTA, pH 7.6) on 15 X 20 X 0.4 cm horizontal 0.8 or

1 -2% agarose (Boehringer Mannheim Corporation, Indianapolis, IN) submarine

gels at 75 V/cm for 1 to 4 h. The BRL 1-kb (Bethesda Research Laboratories)

ladder las the molecular weight standard used to estimate fragment size. Gels

were stained for 15 min with ethidium bromide (0.5 mghL in TBE bufFer)

(Sigma) and illuminated with UV (31 0 nm) transilluminator (Fotodyne

Incorporated, Mississauga, ON), and photographed using Polaroid 667 film.

S'-end fabeleû oligonucleotide probes

Oligonucleotide primers were S-end labeled using T4 polynucleotide

kinase (Maniatis et al. 1 989). Synthetic oligonucleotides were synthesized

without a phosphate group at their 5' temini and then labeled by transfer of the

=P ftom [ a l p h a - = ~ ] d ~ ~ ~ . The readions were canied out at 37OC for 30 min and

stopped with 2 uL of 0.5 M EDTA, pH 8.0 (Sigma Chernical Co., St. Louis, MO).

The oligoprobes were then precipitated wïth 2.25 volumes of 95% ethanol and

each redissolved in 50 uL of TE buffer.

3' end labeling of oligonucleotide probes using digoxigenin UTP

lnitially oligonucl eotide probes for studies with P. ultimum were labeled

with [ a ~ p h a - ~ p l d ~ ~ ~ (Dupont, New Research Produds, Boston, MA) (Maniatis

et al. 1982). However, for analysis of A. flavipes, oligonucleotide probes were

developed using the digoxigenin UTP 3'end labeling system kit (Boehringer

Mannheim Corporation, Indianapolis, IN) according to the manufacturef s

instructions. To 100 prnoles of oligonucleotide, 4 uL of tailing buffer (1 M

potassium cacodylate, 125 mM Tris-HCI, 1.25 mglmL bovine serum albumin, pH

6.6), 4 uL of 25 mM CoClz solution, 1 uL of 25 mM DlG-ddUTP and 50 units of

terminal transferase in (0.2 M potassium cacodylate, 1 mM EDTA, 200 mM KCI,

and 0.2 m g h L bovine serum albumin, pH 6.5) were added in a 0.5 mL

microfuge tube. The final volume of the solution was adjusted to 20 uL with

distilled water. The readion mixture was incubated at 37°C for 30 min and then 5

uL of a 0.5 M EDTA solution was added to stop the labeling reaction. The

labeled oligonucleotide solution was then stored at -20°C and 1 uL was used for

hybrïdization readions.

Southem Blotting and Hybridizations

DNA which was digested restriction endonuclease(s) and fun on

agamse gels had been transfened ont0 Hybond-N nylon membranes

(Amersham) according to the manufacturer's instructions. Prehybridization of

the blots was at 42OC for 2 h in 1 M NaCl (Fisher Scientific) and 7 % SDS (Fisher

Scientific) with constant agitation. The probes were then added separately

(boiling was not needed for d(GT)9 and d ( C n probes, but the self annealing

d(Ang and d(GCk probes were boiled for 10 min prior to their addition) to the

hybridization fluid and incubated at specific ternperatures. d(GT)g and d(CT)g

probes were hybridized at 42OC, d(CG)s at 7S°C and d(AT)s at 35OC with slow

and continuous agitation for 12-14 h. d(AQ and d(GC) 9 probes were tested at

several different hybridization and washing temperatures (dom to 1 O°C below

those indicated). Following hybridization, the membrane las washed twice in W

sodium saline citrate (SSC; 0.1 5 M NaCI, 0.01 5 M sodium citrate, pH 7.0) at

room temperature for 5 min each, then three times in 2X SSC and 1 % SDS at

42°C for 30 min with constant shaking. Hybridization buffers containing DIG-

labeled oligonucleotides were stored at 4*C and reused up to 15 times. Blots

were prepared using Hybond-N nylon membrane (Amersham International,

Oakville, ON) according to the manufaduren instructions. Autoradiography

employed Kodak X-Omat RP film with a Dupont Hi-Plus intensifying screen at

-70°C for 4&96 h for radiolabeled probes. To deted DIG labeled

oligonucleotide probes, membranes were washed with 100 mL of washing buffer

(0.1 M maleic acid, 0.1 5 M NaCI, pH 7.0, containing 0.3% vhr Twen 20) for 5

min. The blot was then incubated for 30 min in 100 mL of blocking solution (1 %

blocking reagent, Boehringer Mannheim, 0.1 M maleic acid, 0.1 5 M NaCI, pH

7.0). Subsequently, 20 mL of fresh blocking reagent was added wntaining 2 uL

of a 75 mU/mL of anti-DIG-antibody. The blot was then incubated at room

temperature for 30 min with gentle agitation. The membrane was then washed

tuvice for 15 min with washing buffer and then equilibrated with detedion buffer

( 0.1 M Tris-HCI, 0.1 M NaCI, 50 mM MgCI2, pH 9.5) for 5 min. The membrane

was sealed between tw transparent plastic sheets wntaining 500 uL of

chemiluminescent substrate (1 uL to 500 uL vlv of CDPStar in detedion buffer).

The chemiluminescent buffer was spread evenly over the membrane by gently

applying pressure to the plastic bag containing the blot The membrane was

incubated at 37OC for 10 min and then exposed to Kodak X-Omat RP film from 2

to 60 min at ambient temperatures.

Construction of the Pytnium ultimum and Aspegillus flavipes genornic

li brades

A Lambda EMBL3 genomic libnry was constnided using a cloning kit

(Stratagene, La Jolla, CA) according to the manufacturers recommendations and

Sambrook et al. (1 989) as follows. High molewlar weight genomic DNA was

prepared using a large scale method as described above (Garber and Yoder

1 983). Conditions for partial digestion w*th Mbol (Bethesda Research

Laboratories Inc., Gaithersburg, MD) were established using 5 mg of total

genomic DNA, 0.05 units of endonuclease enzyme, and a series of incubation

times of 1 to 30 min at 37%. A large scale preparation of DNA, partially

digested with Mbol to a size range of 20 kb, was prepared by digesting 300 mg

of DNA 8.5 units of enzyme for 10 min. The reaction was then stopped by

placing on ice and adding 20 mL of 0.5 M EDTA, and the DNA was precipitated

with 2.5 M ammonium acetate (Fisher Scientific) and 2.25 volumes of 95%

ethanol. The DNA sample was redissolved in 250 mL of TE buffer, pH 8.0 and

stored at 4OC.

The isolation of 20 kb fragments was achieved by sucrose gradient

centrifugation as follows: 12 mL of a 1040% sucrose (Fisher Scientific) density

gradient was prepared in a 12.5 mL polyallomer tube (Beduiian Instruments,

Inc., Palo Alto, CA) using STE buffer (1 M NaCI, 20 mM Tris-HCI, pH 8.0, 5mM

EDTA). Then 225 uL of Mbol partially digested DNA were heated at 65OC for 1 O

min, cooled to room temperature and loaded on the sucrose gradient.

Centrifugation was perfomed at 26,000 rpm for 24 h at 20°C, using the SW41 Ti

swinging bucket rotor (Beckman).

Using the Fraction Recovety System (Bechan), approximately 200 uL

fractions were colleded in a sample tray. A sample of 1 O uL from eech third

fraction was mixed with 3 uL of stop solution (6.6% 0.04% bromophenol blue, 20

mM EDTA) and run on 0.4% agarose gel to detemine the inclusive fractions that

contained the 20 kb genomic DNA fragment The chosen fractions were diluted

with TE bufter, pH 8.0, so that the concentration of sucrose ~ w s reduœd to 10%.

The DNA was then precipitated 0.1 5 M sodium aœtate and 2.25 volumes of

95% ethanol, and washed with 70% iœ cold ethanol, Next, the DNA was

dissolved in 10 mL of TE buffer, pH 8.0, from which 1 uL was analysed by

agarose gel electrophoresis for a quality check.

The ligation of 20 kb genomic fragments to EMBW amis was perfomed

along with a control test insert, obtained from Stratagene, La Jolla, CA, in a total

volume of 5 uL. The test reaction included: 1.0 uL of Lambda EMBC3 vector pre-

digested with BamHIIEcoRI (Stratagene), 2.5 uL of 20 kb genomic fragments

(insert), 0.5 uL of 1 OX ligation buffer (0.5 M Tris-HCI, pH 7.6, 100 mM MgCI2,

100 mM dithiothreitol), 0.5 uL of 10 mM of MTP, pH 7.5, 0.5 mL (4 units) of T4

DNA ligase (Phanacia, LKB Biotechnology AB, Uppsala, Sweden). The ligation

reaction was inwbated at 4OC for 20 hl and stopped by heating at 65OC for 15

min, and stored a -20°C before packaging. To check the DNA ligation, g 1 uL

sam~le of Iigated Lambda a n s (EMBL3 + 20 kb insert) was mn on 0.4%

agarose gel, along wïth 1 uL of pre-digested Lambda ans, and luL of 20 kb

genomic fragments (insert).

In vitro packaging of Lambda DNA (genomic DNA-EMBL3 ans ) was

perfonned using Gigapack Il Gold packaging Extract (Stratagene, La Jolla, CA),

according to the manufadurers recommendations as follows. One set of

packaging extract from a -70°C freezer was removed and placed on ice. At the

same time a sonic extract was being t h m . The packaging extract was then

thawed quickly and 2 uL of ligated Lambda DNA were added and the tube was

placed on ice. To the tube, 15 uL of sonic extract w r e added and the contents

were mixed well and spun down quickly. The tube was then incubated at room

temperature for 2 h. 500 uL of phage dilution buffer (0.1 M NaCI, 0.02 M Tris-

HCI, pH 7.4, 0.01 M MgS04) and 20 uL of chloroforrn were added and mixed

gently. The contents wiere then spun briefiy to sediment debris, and the

supematant was stored et 4°C before titration.

A culture of E. cofi host baderium P2392 (Stratagene, La Jolla, CA) w s

grown in LB medium; 0.1 7 M NaCI, 0.5% yeast extract (DIFCO Laboratories,

Detroit, MI), 1 O h tryptone (DIFCO Laboratories, Detroit, Ml), supplemented with

10 mM MgS04 (Fisher Scientific) and 0.2% maltose (BDH; The British Dnig

Houses Ltd, Poole, England). The followïng day, 0.2 mL was subcultured into 10

mL fresh medium and allowed to grow by shaking for 2.5 h at 37OC. The cells

were spun down in a sterile screw capped centrifuge tube at 2000 rpm for I O

min. The supematant was then decanted and the cells were resuspended in 5

mL of sterile 10 mM MgS04. A series of EMBL3 genomic library serial dilutions

(1 O-', loJ, 1 04, 106) were done in 0.5 mL of phage dilution buffer (SM buffer).

Four sterile polypropylene tubes (Fisher Scientific) containing 0.2 mL of bacteria

(P2392) were set up and O. 1 mL of each EMBL3 genomic dilution was added

separately. After mixing by shaking, the tubes were incubated at 37% for 20 min

to allow the bacteriophage particles to adsorb. To the first tube, 3 mL of melted

0.7% NZY top agar (85.5 mM NaCl. 8.1 mM MgS04.7H20, 1 % casein

hydrolysate, 0.5% yeast extract, pH 7.5, 1.5 % agar; DlFCO Laboratories) was

quickly added and the content was immediately poured ont0 a labeled LB plate,

prewanned a 37%. The plate was aMrled gently to ensure an even distribution

of the bacteria and the top agar. The plates were left to stand at room

temperature for 5 min to allow the top agar to harden. They ware then inverted

and inwbated at 37% for 12-16 h to allow plaques to appear and be counted.

Based on the number of plaques in the four plates, the titre of the library, in

ternis of plaque forrning units per mL (pfuImL), was determined.

Amplification of the EMB W genomic library

A sterile tube containing 10 mL of LB broth, supplemented with 0.2Oh

maltose and 10 mM MgS04, was inoculated with a single colony of E. cdi

(P2392) and let grow ovemight shaking at 30°C. A tube containing 1 0 mL

of sterïle LB broth, supplemented with maltose and MgSO., was inoculated with

1 mL of bacteria grown ovemight. and incubated for 3 h by shaking at 37OC. The

bacterial cells w r e then spun dom at 2000 rpm for 10 min, and resuspended in

5 mL of sterile 10 mM MgSO.. Four sterile tubes containing 0.2 mL of plating

bacteria were set up and 100 uL of the genomic library preparation wore added

to each tube. The tubes were inaibated at 37OC for 20 min, and 3 mL of melted

NZY top agar were added to Uie first tube. The content was then poured ont0 a

LB plate and let stand to solidify for 5 min. The same procedure was cam-ed out

with the other three tubes. The plates were inwbated at 37% and plaques

began to appear after 8 h and matured after 12 h. To each plate, 3 mL of SM

bufFer were added and incubated ovemight at 4OC. The supernatant from the

four plates was mllected in a sterile tube and chloroforrn was added to a final

volume of 5%- The phage suspension was shaken for 15 min and the debris

spun down. The supernatant was kept, and hm drops of chlorofom were added.

This amplified library was titred as described previously, and 1 mL aliquots were

stored at 4OC. For long terni storage at -70°C, dimethyl suifoxide (DMSO) (Fisher

Scientific, Fair Lawn, NJ) was added to a final volume of 7%.

Plating the EMBL3 genomic library

To screen the P. ultimum and A. flaviws genomic library for the presence

of simple sequenœ motifs, approximately lo4 plaques ware plated on a 150 mm

diameter petri plate as follows. E, colr P2392 bacterial cells suitable for plating

were prepared as described previously for titration. To a sterile tube containing

0.4 mL P2392 cells, 250 mL of 1/10 genomic library dilution were added. The

tube was then incubated at 37OC for 20 min, and 8 mL of melted NZY top agar

were added, and the tube contents were immediately poured ont0 a 150 mm

diameter agar plate (LB). The plate was incubated at 37% for 12 h and then

stored at 4OC before plaque blotting.

EMBL3 genomic library plaque blotüng

Two 150 mm diameter HybondN membranes were carefully labeled *th

identification marking and date. The first membrane was plaœd on the agar

surface and, using a sterile needle, the edges of the membrane were marked by

piercing through the membrane into the agar. This ensured correct orientation of

plaques. The membrane was removed after 1 min and plaœd, colony side up, on

3hIM paper Matman International Ltd., Maidstone, England) soaked in

denaturing solution (0.4 M NaOH, 0.6 M NaCI). The membrane was left for 7

min, then placed on 3MM paper soaked in neutralizing solution (1 -5 M NaCI, 0.5

M Tris-HCI, 0.001 M Na2EDTA, pH 7.2). The membrane was left for 3 min, then

transferred to fresh 3MM paper soaked in neutralizing solution and left for

another 3 min. The same procedure was perfomed on the second duplicate

membrane, and the two membranes were washed by submerging for 1 min in W

SSC buffer. They were then air dried. colony side up, on 3MM paper. The

membranes were covered wïth Saran Wrap and exposed to UV light (320 nm),

for 2 min, colony side next to a UV transilluminator. They were then stored at

room temperature until ready to use.

Selection of positive clones

After hybridization to specific oligonucleotide probes as described

previously, the blots w r e exposed to Kodak X-OMAT film for 16 h. Positive

clones w r e identified as plaques that hybridized to the probe. Marks on the

autoradiograrns were aligned with the plates. Plaques which hybridized to the

probe were identified. The plaque was picked by using a Pasteur pipette

equipped a nibber bulb. Mild sudion mas applied so that the plaque,

together with the underlying agar, weis drawn into the pipette. The agar plug

containing the plaque was plaœd in a sterile Eppendorf tube containing 0.5 mL

SM b d e r and 3 drops of chlorofom. The agar fragment was let to stand at room

temperature for an hour to allow the phage particles to dif ise out of the agar.

An average plaque yielded 10' to 1 o6 phage particles that could be stored

indefinitely at 4OC without loss of viability. If the plaques wwe not well separated

it was necessary to repeat the screening process to ensure that virions were

derived ftom a single clone.

Large scale isolation of phage DNA

Lambda DNA from phage lysates was purified based on the rapid

biochemical method of Kaslow (1 986) as follows. A tube containing 1 O mL of LB

broth supplemented with 0-2% maltose and 10 mM MgS04 was inoculated with a

single colony of P2392 and let grow ovemight by shaking at 30°C. The next day,

1 mL of bacterial cells was mixed with 1 uL of eluted phage (1 0' to 108 pfulmL)

and 1 mL of 10 mM Mg& and inwbated at 37OC for 20 min. The mixture was

then transferred to 500 mL LB broth, supplemented O.ZOh maltose and 10

mM MgS04, and inwbated at 37OC by shaking for 8 h. Chlorofom was added to

2%. DNAse I and RNAse A (Sigma) were added to 1 mglmL, and solid NaCl was

added to final concentration of 1 M. After incubation at 37OC for 30 min, the

aqueous phase was clarified by centrifugation at 5000 rpm at 4°C for 10 min.

Solid polyethylene glycol (PEG 8000) (Sigma) m s added to 10% wlv and the

cloudy mixture stored at 4'C for at least one hour. The intact phage were

recovered by centrifugation at 5000 rpm at 4OC for 20 min and resuspended in 3

mL of SM buffer. DNAse I and RNAse A were added to 5 mglmL and 100 mglmL,

respedively. After a 30 minute incubation at 3?C, the phage w r e lysed by

adding 300 uL of 10% SDS containing 0.5 M EDTA (pH 8.0), and 20 uL of a

100 mg/mL proteinase K (GIBCO BRL) solution in sterile water and heating the

mixture to 68OC for 30 min. The phage DNA was extracted with equal volumes of

buffer-saturated phenol (Gl BCO BRL), phenollchloroforrn, and then chloroform

(Fisher Scientific), and precipitated by adding 0.5 volume of 5 M ammonium

acetate and 2.25 volumes of 95% ethanol. After storing on iœ for 15 min, the

precipitate was rewvered by centrifugation at 10,000 rpm at 4°C for 15 min. To

the dry pellet. 1.6 mL of HPLC grade &O, 0.4 mL of 4 M NaCl and 2 m l of 13%

PEG were added. The resulting precipitate was colleded &ter incubation on iœ

for 1 h. It was centrifuged at 10.000 rpm for 15 min, rinsed with 70% ethanol,

dried and resuspended in TE bufier to a final concentration of 1 ug/mL.

Subcloning DNA fragments from phage clone into the pBluescript plasmid

(Ml3 Ks +)

BamHl digestion of the phage clone LCA from the P. ultimum BR471

genomic library and four clones (LGT1, LGT2. LCTl , LCT2) from the A. flavipes

Iibrary, revealed that fragments produced were suitable in size to be cloned

into pBluescn'pt Ml3 Ks +. The plasmid wnstnicts wntaining simple sequenœ

inserts from P. ulamum BR471 was designated pLCA and those from A. flavipes,

pGT1, pGT2, pCT1, and pCT2. Various fragment sizes were subcloned into the

pBluesaipt Ks + vector (Stratagene, San Diego, CA) according to the

manufacturer's recommendations and Maniatis et al. (1 989) as follows.

Approximately 1 ug of pM13 plasmid DNA was digested with 5 units of BamHl

endonuclease in a total volume of 1 O uL, by incubating at 37% for 3 h. The

reaction was stopped by heating at 68OC for 15 min. Approximately 1 ug of

phage DNA was completely digested with 5 units of BamHl endonuclease, in a

total volume of 10 uL, by incubating at 37OC for 20 min. The reaction was

stopped by heating et 68OC for 15 min, and the DNA fragments w r e then

precipitated with 0.5 volume of 5 M ammonium acetate and 2.25 volumes of 95Oh

ethanol. The DNA was spun down and the pellet dried by vacuum. To ligate

BamHl fragments and pM13 plasmid vedor, the dried DNA pellet was

resuspended in 5 uL of pM13 pre-digested with BamHI. To the DNA mixture, 1

uL of 1 OX ligase buffer, 1 uL of 10 mM ATP (Sigma), 2 mL of HPLC grade H20,

and T4 ligase (Phamacia), were added to ligate the DNA fragments and the

plasmid. After incubating ovemight at lS°C, the reaction was stopped by heating

at 65°C for 1 5 min. To prepare competent JM109 cells (Stratagene), 0.2 mL of

an ovemight culture of E. coli was added to 10 rnL LB medium supplemented

with 10 mM MgC12. ARer shaking at 37OC for 2.5 h, the cells m e put on iœ for

20 min. They were then centrifuged at 3,000 rpm for 5 min at 4OC, and the pellet

was gently resuspended in 3 mL of 50 rnM CaCI2 and put on ice for another 20

min. The cells w r e again œntrihiged at 3,000 rpm for 5 min and resuspended in

0.5 mL of 50 mM CaCh and put on iœ ready for transformation- In a sterile

Eppendorf tube, 10 uL of ligation mixture were mixed with 200 uL of competent

cells (JMIOS), and put on ice for 15 min. The tube was then transferred to a

42OC water bath and inaibated for 1 min. After 10 min at room temperature, 1 rnL

of prewanned LBMg medium was added, and the mixture inwbated at 37OC for

1 h. The cells were collected by centrifugation and resuspended in 200 uL of LB

medium. LB-Ampicillin (Sigma) plates containing 40 mglmL Xgal (Sigma) and

24 nglmL IPTG (Sigma) were used to select for transformants and recombinants

as described in Sambrook et al. 1989.

Cloning of PCR products

Pfimers used for the amplification of simple sequences in A. flavipes

were designed to have BamHl sites at their ends. The resulting PCR products

were treated with BarnHi and cloned into the BamHl site of the pBluescript Ks+

vector by standard methods. Transfonnants were obtained as descfibed

previously.

Purification of plasmid DNA

Small scale purification of plasmid DNA was carried out using a Magic

Minipreps DNA Purification System (Promega Co., Madison, WI) according to

the manufacturer's recommendations as follows. A 10 mL ovemight culture of E.

ooli was pelleted by centrifuging for 5 min a 3,000 rpm and the cells

resuspended in 200 uL of Cell Resuspension Solution (50 mM Tris-HCI, pH 7.5,

10 mM EDTA, 100 mglmL RNAse A). After transferring the resuspended cells to

a microcentrifuge tube, 200 uL of Cell Lysis Solution (0.2 M NaOH, 1 % SDS)

were added. and the contents wre mixed by inverting the tube several times. To

the clear, lysed cell suspension, 200 uL of neutralizing solution (2-55 M

potassium acetate, pH 4.8) were added and mixed by inverting the tube. After

centrifugation at top speed in a microcentrifuge for 5 min, the cleared

supernatant was decanted to a new microcentrifuge tube. To the tube, 1 mL of

the Magic Minipreps DNA Purification Resin was added and mixed thoroughly.

Using a 3 mL disposable syringe, the DNA solution was fun through a Magic

Minicolumn and purified with 2 mL of Column Wash Solution (200 mM NaCI, 20

mM Tris-HCI, pH 7.5, 5 mM EDTA, Diluted 1 :1 with 95% ethanol). The

Minicolumn m s transferred to a 1.5 mL microcentrifuge tube and spun dom at

top speed for 20 sec to dry the resin. The Minicolumn was again transferred to a

new microcentrifuge tube and 50 uL of TE bMer was added. After 1 min, the

DNA was eluted by spinning the Minicolumn at top speed in a microcentrifuge

tube for 20 sec. The plasmid DNA was then stored at 4OC or -20°C.

Screening clones with PCR

To an Eppendorf tube, 20 uL of phage suspension and 20 uL of a stock

solution containing 2% CTAB and 2 M NaCl were added. The tube was then

inwbated at 55OC for 10 min, and the contents were extracted Mce with equal

volumes of chlorofom. The resulting supernatant contained DNA template that

could be used diredly in PCR amplification as describeci previously.

Recombinant clones were screened using T3 and T7 primers to amplify the

inserts. Southem blotting and hybridization was perfomed with either d(GQ or

d(CTk probes.

Constnicüon of deletion clones

The Erase-a-Base system (Promega) was used to construct deletion

clones of pGT1, pCT1, pCT2, following instructions given by the manufacturer,

minor modifications. In order to ensure that the plasmid DNA used was not

nicked, it was treated with T4 DNA ligase for 2 h at room temperature.

Approximately 5 ug of plasmid DNA was used to generate each set of deletion

clones. To produce a 3' overhang each subclone was digested a specific

restriction endonuclease. pGTl and pGT2 were digested wïth BstM, pCTl was

digested with Kpnl and pCT2 was digested wïth Sstl, this treatment produced a

3' overhang which is resistant to exonuclease III digestion. A 5' protniding end,

which is sensitive to exonuclease III digestion, was created by digestion of pGT1

and pGT2 wïth Xbal, pCT1 w-th EcoRI, and pCT2 with Xbal. Exonuclease III

digestion was perfomed at 3S°C and samples (up to 12) were wllected at 30

sec intervals. AI1 restriction sites used flank the insert and are found in the

multiple doning site region of pBluescript M l 3 Ks +. Deletion clones from each

interval were ligated and transfomed in to E. d i JM109 and screened for the

presenœ of their type of simple sequence using d ( G n or d(CQ probes.

Clones from each deletion time point w r e tested for hybridization to either

d ( G n or d(Cfk. Clones which were the last to hybridize to the simple

sequence probe were seleded and sequenœd with primers developed from the

vedor (T3 or T7).

Fragment amplification of simple sequence motifs

D NA reg ions contain ing specific simple sequence motifs were am pl Aed

using the polyrnerase chain reaction (PCR) (Saiki et a/. 1988) in a reaction

mixture of 100 uL total volume containing the followïng components: 10 uL 1 OX

Taq DNA polyrnerase reaction buffer (Promega Corp., Madison, WI.); 8 uL of

deoxyrïbonucleotide triphosphates (dNTP, Phannacia) mixture (stock

concentration 2.5 mM with final concentration of each dNTP, 200 mM); 1 uL (32

pmole) of each primer; 7 uL template DNA (50-100 ng of DNA); 78.5 uL ultrapure

m e r (HPLC grade, Fisher Scientific); and 0.5 uL (2.5 units) Taq polymerase

(Promega). The reaction mixtures were overlaid with mineraf oil (Paraffin ail,

Fisher Scientific) and subjected to 25-30 cycles in a Perkin Elmer-Cetus DNA

thermal cycler (Norwalk, CT) under the following general temperature conditions:

1 min at 93OC, 1 min at 55OC, and 2 min at 72OC.

Sequencing cloned PCR products

Approxirnately 10 ug of cloned PCR product in p8luescript Ml 3 Ks + were

dried down in an Eppendorf tube and sent to: DNA Technology Unit, Plant

Biotechnology Institute, National Research Council of Canada, Saskatoon,

Saskatchewan, Canada. Cycle sequencing was performed using an automated

ABI prism version 2.1 .O sequencing apparatw. Resolution up to 700 bases was

routinely achieved using either the T3 or T7 pnmers of pBluescrïpt M l 3 Ks +.

Early sequenœ (first 250 bases) was confimed by using standard sequencing

protocols as desu3bed previously.

Sequencing of PCR products

PCR products were purified by eledrophoresis in 0.6-1 % agarose

followed by freeze-squeeze extraction of bands by a method similar to that of

Tautz and Renz (1 983). modified by Hausner ef al. (1 992) as follows. After

staining *th ethidiurn bromide, bands were wt out of the gel and frozen at

-20°C. The gel plug was placed between two layers of parafilm (Amencan

National Can, Greenwich, CT) and gently thawd by steady finger pressure. The

expressed liquid was collected and made up to 1 M NaCl and 1 % CTAB. After

incubation at 55OC for 1 O min, two chlorofomi/isoamyl alcohol (25: 1 vfv)

extractions were done, followed by precipitation of DNA by the addition of 2.25

vol umes of 95Oh ethanol. Double-stranded templates were sequenced by a

method similar to a rapid denaturation-annealing-sequencing (RDAS) technique

suggested by L.E. Pelcher (personal communication), modfied by Hausner et al.

(1992). Approximately 1 ug of lyophilized template DNA w s dissolved in 3 uL of

water and rnixed with 12 uL of tricine buffer (0.6 M tricine (Sigma), 2% NP40

(Sigma), 100 mM MgCh (Fisher Scientific), 4 uL 0.6 N NaOH (Fisher Scientific),

and 5 uL of primer solution). The standard amount of primer was 5 pmol, but this

amount was adjusted to optimize sequencing for each of the primer$ used. The

mixture vms boiled for 3 min and then transfened immediately to an ethanol bath

at -70°C. The mixture was thawed on iœ, and 4 units of Sequenase (0.5 uL)

(United States Biochemical Co., Cleveland, OH) or T i polymerase (P hamacia)

in 4 uL of Sequenase dilution buffer and 1 uL of 100 mM dithiothreitol (Sigma),

and 2 uL of [ a l p h a - = ~ ] d ~ ~ ~ (1 mCi in 100 mL; Dupont) were added. Of this

mixture, 7.1 uL were added to each of the four sequencing temination mixes

prepared as prescribed by the manufacturer for Sequenase (see also Sambrook

et al. 1 989). After incubation for 7 min at 37%. the contents of each tube was

diluted wïth 9 mL of water and precipitation was perfonned by the addition of 51

uL of ethanol(95% ethanol made to 0.12 M sodium acetate). The DNA was

pelleted by centrifugation for 30 min in a tabletop centrifuge, the supernatant

decanted, and the ethanol evaporated by heating the tube in a waterbath. The

pellet was resuspended in TE buffer containing the sequencing stop solution

(Pharmacia) and loaded on the sequencing gels.

Sequencing reaction products w r e separated by electrophoresis using

6% polyacrylamide (polyacrylamide stock solution: 97.5% acrylamide (Bio-Rad

Laboratories, Richmond, CA) and 2.5% N,N'-methylene-bis-acrylamide (Sigma),

and 48% urea (BRL) denaturing gels (Maniatis et al. 1982). The preparation of

gels, including the preparation of the acrylamide solution and the cleaning and

taping of the sequencing gel plates, were as described by Sambrook et al.

(1 989). Two loadings were spaced approximately 2 to 2.5 h apart; this allowed

for determination of 250 to 280 nucleotide stretches. Gels were vacuum dried at

80°C and exposed for 1 4 days to Kodak X-OMAT fi lm at room temperature.

DNA sequence analysis

DNA sequenœ analysis was perforrned on phage cloned DNA Common

knom motifs were screened in the cloned sequenœ using a cornputer program

(Gene Runner version 2.0). The motif and sequence patterns are described in

Table 7.

Table 7. Nucleotide sequence analysis. The follom'ng DNA motifs were used to aid in characterising the cloned DNA sequences from either P. ulamum and A. flavipes

Nucleic Acid Motif' Pattern sequenceb

AP1 BlNOlNG SlTE AP2 BlNDlNG SlTE AP3 BINDING SlTE AP4 BlNDlNG SlTE CPl BlNDlNG SlTE CP2 BlNDlNG SlTE HSTF MAT-ALPHA1 MAT-ALPHA2 N F-1 GLUCOCORTICOID RECEPTOR CCAAT BOX TATA BOX CIEBP CREB GCN4 TARGET SlTE HOMEOBOX PROTN BNDNG SlTE INF-STIMULATED RESPONSE LARIAT CONSENSUS SEQUENCE OCTAMER SEQUENCE POLY-A SIGNAL SRF SPI BlNDlNG SlTE SPLICE JUNCT - DONOR SPLICE JUNCT - ACCEPTOR T CELL ELEMENT PU-BOX TRANSLATIONAL INlT SEQ

CCCCAGGC TGASTCAG GGGTGTGGAAAG YCAGCTGYGG YN(6)RRCCAATCA YAGYN(3)RRCCAATC CNNGAANNTTCNNG TTTCCTAATTAGGAAA TTTCCTTAlTNGGTAA TTGGMN(5)GCCAAT GGTACAN(3)TGTTCT CCAAT TTATA TGTGGAAAG TGACGTCA ATGASTCAT TCAATTAAAT RGGAANNGAAACT YNYTRAY ATITGCAT AATAAA GATGTCCATArrAGGACATC GGGCGG MAGGTRAGT VVYYYVYYYYYNYAGG GGGRlTïMA AAGAGGAAAA RNNMTGG

' Motifs cited in: Benjamin Lewin, Genes V, 1994. Oxford University Press. R: A or G, Y:C or T, M:A or C, K G or T, S:G or C, W A or T, N:A or C or G or T

RESULTS AND DISCUSSION

Chapter 1

Simple Sequence Motifs in Pjtthium ulfimum

INTRODUCTiON

The objective of this study is to identify and characterize a simple

sequenœ motif in P. ulamum BR471. ONA sequence of the microsatellite motif

will be used to show that differentiation of other isolates of P. uIfimum is

possible (Materials and Methods, Table 3). The abundance of d(GT/CA) and

d(CT1GA) type simple sequence and isolation of a simple sequence motif will be

descrïbed. The simple sequence motifwW be characterized and its use as a

polymorphic DNA marker m'Il be addressed by studying its variability in other

isolates of P. ulomum from many different geographical locations.

Simple sequenœs have proved to be a valuable tool in DNA

fingerprinting in rnany organisms. Furthermore, it is a widely accepted technique

which has show great potential in population genetics, inheritance studies,

genome mapping and other uses. No studies have been conducted in the

Oomyœtes to explore if microsatellite sequences are present and can be used

as a source of polymorphic markers. Furtherrnore, there is a large collection of

isolates of P. ultimum from around the w r l d and a simple way to differentiate

these isolates from one another is needed (Materials and Methods, Table. 3).

Since isolates of P. ulomum are so closely related it is difficult to distinguish

them using techniques such as RFLP (Martin 1989). A simple molecular

technique, such as PCR, -Id be of great importance to easily differentiate

these isolates.

This study m'Il show how one simple sequenœ array will be used as a

genetic marker to distinguish isolates of Pythium ulfimum. Furthemore, this

study provided the impetus to study microsatellite DNA sequences in a more

econornically important organism. namely Aspergillus flavipes.

RESULTS

Screening the P. uIfimum library with d ( G n and d(CTb

The abundance of d(GT1CA) and d(CT1GA) simple sequence in P.

ultimum 8R471 was estimated by screening approximately 200 plaques of a

genomic library with d(GT)B and d(CT)p radio-labeled oligonucleotide probes.

Results from these data suggest that d(GT1CA) simple sequenœ is more

abundant than the d(CT1GA) type. Forty-three signals indicative of hybridization

to d(GT)s and 27 for d(CT)9 demonstrate the abundance for these types of

simple sequence in P. ultimum BR471. The genome size of P. ulomum has not

yet been deterrnined but that of P sylvafrcum, a species cansidered to be

relatively closely related to P. ulfimum, has been estimated to be approximately

37 Mbp, although meiotic instability makes this estirnate somewhat uncertain

(Martin, 1995). If it is assumed that P. ultimum has a similar genome size, and

further that each library clone has an insert averaging 20 kb, then the 200

plaques screened represent about 10% of one genome. Therefore, the

estimated number of plaques per genome wu ld be 430 and 270 for d(GT/CA)s

and d(CT1GAk respectively. This would suggest that if the simple sequences

are evenly dispened, a d(GT1CA) motif occurs at least once every 86 kb (430

copies) and a d(CT/GA) motif every 137 kb (270 copies).

Cloning and characterization of simple sequence DNA

One plaque from the genomic library which showed strong signal

hybridization to the d(GT/CA) probe was seleded. DNA from this clone

designated LCA (lambda DNA containing d(CAIGT) type repeats) was extracted

and digested with BamHl restriction endonuclease (Fig. 1 ). Southem blotting

was perforrned on this restriction digest and the DNA fragment which hybridized

most strongly to the d(GTk probe (1 -01 kb) was purified and subcloned into the

BamHI site of pBluescript Ml 3 Ks +; this subclone was designated as pLCA

DNA sequencing was perfomied on this subclone using the T7 primer. and a

cluster of d(CA1GT) simple sequence motifs was found within the first 400 bp

adjacent to the TI primer site of pBluescript Ml 3. This cluster included the

foiiowing five motifs: d(CA/GT)41 d(CA/GT)* (CK)2(CA/GT)5. d(CAIGT)Ii.

d(CAGT)sl and d(CAIGT)6 (Fig. 2). Furthemore, 3 additional repeated

sequences were identified in this region (Fig. 2, boxed areas). These larger

repeats of 6 bp fall into the category of minisatellite DNA, due to their longer

repeated structure. However, s ine these sequences are not adjacent to each

other it is unlikely that they behave as minisatellite DNA and display length

polymorphisms-

Amplification of a simple sequence motif and sequence comparisons of

simiiar regions from different isolates and species of Pythium

To test whether the region containing d(GT/CA) repeats displayed length

polyrnorphisms, primers were construded flanking the simple sequence repeats

(Fig - 2 and Table 8). These primers (Table. 8) were used in the PCR in an

attempt to amplify similar regions in different isolates of P. ulamum and in other

species of Pythium (Fig. 3 and 4). Results from polyaaylamide gel

electrophoresis indicate that the d(CNGT) motif can be amplified from isolates

of P. ultimum and not from severai other species of Pythium. Amplification from

CBS730.94 (Fig. 4 4 lane 9) is weak, but the expected bands are present.

Attempted amplification for P. inegulare BR486 (Fig. 48, lane 1) did yield a faint

band at less than 200 bp, but it m s not similar to the products obtained from P.

ultimum- In several instances more than one band appeared in each lane,

probably due to slippage during amplification (Murray et al. 1993). The most

prominent bands from P. ulfrmum isolates BR600 BR406, and BR471 w r e cut

out of the gel and the DNA sequenœd. DRerenœs were noted in the central

region involving the d(CA/GT)ll and the d(CA/GT)s motifs. In isolate BR600, the

differenœ was the expansion of the d(CA/GT)ll to C~(CAIGT)~~, but for BR406

the region between d(CA/GT)li and ~(CAIGT)S was entirely missing

reduction of d(CNGT)ll to d(CA/GT), and the d(CA/GT)5 to a single d(CA/GT)

dinucleotide (Fig. 5).

Sequence analysis of cloned ONA from P. ulfimum BR471

A search of nucleotide motifs was perfomed on the DNA sequence from

P. ultimum BR471. Four transiational initiation sequences were located in the

sequenœ (Table 9). The DNA sequenœ was also used to screen for similar

sequences found in GenBank, but no homologies were revealed other than

homology to other d(CA/GT) dinucleotide motifs.

Stability of simple sequence m o m

The identified d(CA/GT) mot l in P. ulomum BR471 was used to study its

stability in the routinely propagated isolate BR600. lsolate BR600 was

propagated in 10 cm petri plates wntaining nuttient media and incubated at two

temperatures (1 5OC and 28OC). Every other day, after the cwnplete surface of

the medium was covered by growth, a smafl peripheral portion was removed

and subcultured on another petri plate. After growth for 3,129 h at 28% and

2,567 h at 1 5OC the genomic DNA was isolated from these cultures.

The simple sequence reg ion described earlier was amplified from genomic DNA

isolated from both cultures. Polyacrylamide gel electrophoresis did not reveal

any changes in the length of the simple sequence region as compared with

BR600 that had not been propagated for a long time period (data not shown).

Apparently, the d(CA/GT) motifs in P. ultimum do not expand or contract

significantly under these conditions, and could be considered to be relatively

stable.

Table 8. Primers used for amplification of d(CAIGT) motifs in isolates of P. ultirnum.

Primer namem Sequence S to 3

FCA RCA

a F:foward primer, R:reverse primer.

Table 9. Sequenœ analysis of pLCA

DNA Sequence Motif #Sites Nucleotide Position 5-3' pattern

Translation Init Seq

'Nucleotide pattern in Fig. 2, corresponding to its complement (CCATNNC).

Fig. 1. Restriction digest with BamHl of lambda DNA clone (LCA1) (lane 1 ),

and southem blot analysis to detemine which bands hybridize to the d(GT)9

probe (lane 2).

Fig. 2. Nucleotide sequenœ of DNA from P. ultimum BR471 containing severaf

d(CA1GT) simple sequence repeats. Simple sequenœs are indicated in bold

font. Arrows above sequences indicate location of primen used in PCR to

amplify the region containing the simple sequence motifs. Boxed areas indicate

a separate repeated motif observed in thb region.

Fig. 3. Polyacrylamide gel electrophoresis of PCR products from various

isolates of Pythium: Amw indicate molecular weight standards (based on the

BRL 1 kb ladder). Lanes 1 to 1 1, P- ultimum var. ultimum and P. ultimum var.

sporangiiferum isolates: 1:BR319,2:BR418, 3:BR47lI4:8R583 5BR600,

6:BR612, 7:8R638, 8:BR639, 9:BR640, and 1 O:BR65O (P. u. var.

sporangiiferum); 1 1 :BR925. Lanes 1 2 to 14, 1 2: P. coloraturn BR483, 1 3: P.

arrhenomanes BR607 and 1 4: P.dissimile BR1 60.

Fig. 4. Polyacrylamide gel eledrophoresis of PCR products from various

isolates of P. ultimum var. ultimum and one isolate of P. inegulate. Arrows

indicate molewlar weight standards, (based on the BRL 1 kb ladder). A: Lanes

1 to 14, 1 :CBS656.58:, 2:CBS296.37, 3:CBS291.31, 4:CBS264.38,

5:CBS249.28, 6CBS729.94, 7:CBS728.94, 8:CBS726.94, 9:CBS730.94,

1 O:CBS378.34, 1 1 :CBS305.35, 12:CBS114,19, 1 3:CBS488.86, and

14:CBS398.51. B: Lanes 1 to 7, 1 :BR4û6, 2:BR612, 3:BR600, 4:BR406,

5:BR471, 6:pLCA clone containing simple sequence insert from BR471.

7:Lambda DNA (LCA) containing simple sequence from BR471.

Fig. 5. DNA sequence alignment of PCR produds frorn 3 isolates of P. ultimum

var. ultimum: BR471, BR406, and BR600. Dashed lines indicate missing

nucleotides. The d(CA/GT) simple sequenœ motifs are indicated in bold font.

DISCUSSION

The search for microsatellite DNA sequenœs in P. ultimum, done by

probing the genomic library of P. ulomum BR471 with d(GT)o and d(CT)9

revealed that d(GT1CA) and d(CT1GA) motifs are present Although the

abundance of either type of these simple sequences was quite similar, a

predominance of d(GT1CA) over d(CT1AG) was obsenred- These results show

similarity to data obtained from organisms such as humans, maize, rice, yeast,

and Aspergillus Ilavipes (Lagercrantz et al. 1993, and this study ). This is the first

report of simpfe sequence motifs in any species of Pyfhium, or any other

mernber of the Oomycetes, and results obtained from screening the genomic

library indicate that the abundance of microsatellite sequences is similar to that

found in other eukaryotes.

To investigate the structure of simple sequence motifs and to see whether

they could be the source of polymorphisms useful in strain typing, a cloning and

sequencing project was done to isolate a d(CAIG1) amy from P. ultimum

BR471 - A lambda library clone (LCA) was identified by rneans of a (GT)s probe,

and a 1 kb BamHl fragment was subcloned for further characterization. Several

other BamHI fragments from LCA were also recognized by the probe (Fig. 1 ).

This indicates that the approximately 20 kb insert contains more d(CA/GT)

arrays than those locatted in the 1 kb fragment, and suggests that the calculation

of d(CA/GT) array abundance presented earlier represents a minimum estimate,

and that the adual ftequency of d(CA/GT) arrays may be several times higher

than that estimated-

Sequencing of the subclone (pLCA) resulted in the identification of

sequences that wu ld hybridize to the simple sequence probe, but instead of a

single array of d(CNGT) repeats, five separated short arrays w r e observed,

one of them an imperfect repeat (d(CAIGT)2 (CK)~(CA/GT)S) (Fig. 2). Simple

sequence motifs larger than 10 bp have been shown to be more polymorphic

than those under a length threshold of 8 to 10 bp (Weber and May 1989). Under

this size, microsatellite motifs are usually less likely to display length

polymorphisms (Weber and May 1986). A 6 bp minisatellite-type sequence

(GCACAA) was located intenpersed in the region containing the five d(CA/GT)

repeats. Minisatellite sequenœs are usually larger than 5 bp in length, and are

arranged in a tandem array (Jeffreys et al. 1985). The 6 nucleotide repeat found

in this region, were not tandemly arranged and should probably not be termed

minisatellite type sequences. However, it is important to note that these short

motifs are comrnon in other eukaryotic genomes, and microsatellite motifs are

usually found fianking minisatellite sequences. Furalemore, it is thought that

minisatellite sequences are produœd from microsatellite motifs, as the result of

recombination events (Wright 1994). The DNA sequenœ from P. ultimum

BR471 was utilized to search for homologies in the GenBank and EMBL DNA

sequence databases. No homologies were identified with the sequence from P.

ultimum. A search of wll established DNA motifs identified 4 translational

initiation sites (Table 9). The presence of these motifs may suggest that this

region of DNA could be transcribed and translated into a protein component,

howaver, additional transcriptional motifs would need to be identified to further

support this observation.

The main reason for the investigation of a simple sequence in Pythium

was the possibility that it would be a hypervariable region yielding

polymorphisms suitable for strain typing. With this in mind, primers annealing to

regions fianking the simple sequence arrays in P. ultimum BR471 w r e designed

and tested on a collection of P. ultimum var. ultr'mum strains, on one isolate of P.

ultimum var. sporangiiferum, and on several isolates from different species of

Pythium. Abundant amplification product was obtained from al1 but one P.

ultimum isolates (exception: lane 9. Fig. 4A) but not from other species of

Pyfhium. It appears that regions flanking the simple sequence region are highly

consewed across the species, but not in other species of Pythium.

PCR products generated from the amplification of the d(CAIGT)

microsatellite produced more than one band in several instances (Fig. 3 and Fig.

4A, 48). These additional bands have been previously identified and attributed

to slippage of 2 bp increments of the Taq DNA polymerase during the

amplification of tandem repeats (Murray et al. 1 993, Weber and May 1 989,

Ginot et a1.1996). These artifacts appearing as socallad "shadow bands" are

often co-amplified very efkiently and if the artifad is produœd during the eady

cycles of the PCR it can dominate the total yield of amplification products

(Murray et al. 1993). Another reason for the generation of additional bands rnay

be that there are other sites nearby to which the primers bind.

Companson of sequences from mhium ulamum isolates BR600. BR406

and BR471 revealed several interesting features. The sequenœ of the BR406

PCR pmdud revealed that a 22 bp stretch of DNA (d(CAIGT)ll to d(CNGT)5)

was missing. The deletion of flanking DNA in a microsatellite motif is unusual

since simple sequenœ length polyrnorphisms are generally wnfined to the

microsatellite DNA motif and not their flanking regions (Pardue et a' 1987,

Weber and May 1989). The event notiœd here may indicate that sequences

flanking microsatellite amys are prone to deletions. An examination of the

sequence of the PCR product generated in BR600 reveals an additional

d(CAIGT) dinucleotide compared to BR471. The expansion noticed between

BR471 and BR600 is typical of dinucleotide repeats, however, shorter

dinucleotide motifs are less likely to show a high degree of length variation as

compared to larger dinucleotide motifs containing 30 or more repeats (Pardue et

al. 1987, Weber and May 1989).

In summary. we have identified a polyrnorphic simple sequence region in

the genorne of P. ultimum var. ultimum BR471 Hihich can be amplified by the

?CR reaction in d i f rent isolates of P. ultlmum. Martin (1 989), attempted to

distinguish isolates of P. ullimum using mitochondrial DNA RFLP analysis.

Attempts to dinerentiate isolates of P. ulamum using this technique were mostly

ineffedive, with few observable polyrnorphisms. Martin wncluded that the

elaboration of a more seledive market was needed to help differentiate isolates

of Mhiurn and that mitochondrial DNA RFLP analysis does not yield sufficient

amounts of polymorphism to distinguish the isolates used in his study. The

results presented here demonstrate the usefulness a d(CA/GT) microsatellite

motif identified in P. ulamum BR471 as a genomic lows for dÏfferentiating

isolates of both varieties P. ultr'mum.

Chapter 2

Use of RAPDs to Differenüate Isolates of Aspergillus flavipes

INTRODUCTION

The aim in this study was to develop an approach to DNA fingerprinting of

isolates of Aspergillus flavipes that wu ld produce a unique and reproducible

pattern for each isolate. A secondary objective was the compilation of primers

useful for RAPD (Random Amplification of Polymorphic DNA) amplification of

each isolate and the refinement of the RAPD protocal for this particular

organism.

Specifically, the objective was to apply the RAPD technique to the

fingerprinting of a diverse collection of 9 isolates of A. flavipes (Table 2). An

approach to molecular typing of Aspergillus strains was developed by adapting

the Random Amplification of Polymorphic DNA (RAPD) method for this purpose.

The RAPD method has gained much reœnt interest as a way of generating

genetic markers in many organisms such as plants and fungi. The main

advantage of RAPD compared to microsatellites is the ease ~ Ï t h which new

polymorphic markers can be generated.

Genomic DNA was prepared from 9 isolates of A. flavipes, and d e r

removal of RNA, polymerase chah reaction (PCR) amplifications were done

using commercially available primers with random primer sequenœs (10 mers).

The protocol was developed by investigation of the effect of the amount of

template DNA , RNAse treatment of the DNA preparation, number of PCR

cycles, and other variables. Primer sets were screened and those producing the

most visible and diverse profiles of bands were chosen for the study.

Reproducibility of the profiles was assessed by side-by-side amplification

of the independently prepared DNA samples from the same isolate. This was

done for each isolate in this study.

lsolates of A. flavipes were reœived from Apotex Fermentation Inc. Some

of these strains are currently patented and aid in the production of several

important biological wmpounds. These compounds include: imiprimine, an

antidepressant (Hufford et al. 1981 ), sesquiterpene lactone, an anticancer drug

(Clark et al. 1978), flavipucine, an antibiotic (Findlay and Kwan 1972), and

chrysanthernic acid, a biodegradable insecticide (Miski and Davis 1988).

FurViennore. certain strains have helped in the organic synthesis of biological

compounds (Davis and Talaat 1981 ) e.g. transformations of arternisnic acid for

the treatment of dnig resistant malaria (Elmarakby et al. 1988). They have also

been shown to produce penicillin (Foster and Karow 1944, (Table 4).

RESULTS

Reproducibility

The main problem with the use of RAPDs is the frequently reported la&

of reproducibility of profiles. The most probable rationale is the critical

dependence of the amplification events on the temperature profile of the

instrument used. If more than one sample is amplified in the same fun and Vien

the results wmpared, this variable should be eliminated. To test reproducibility,

two independent DNA preparations from the same inowlum were prepared and

the DNA of each sample amplified in the same fun, Le. the cells were grown on

difierant days, and the DNA prepared on different days, but the amplifications

were done at the same time, in the same machine. The reproducibility results for

A. flavipes in general are good, the profiles are reproduced satisfactorily and

the technique should be adequate for comparing a test sample against a

referenœ sample when both have been amplified in the same run. Nine isolates

of A. flavipes (Fig. 6) were amplified with 8 different primers. lsolates were from

very diverse sources (Materials and Methods Table 4). Each isolate had a

unique set of profiles, and very few coïncident bands wuld be seen.

Effect of RNAse treatment

Figure 7 shows the consequence when a DNA sample is amplified before

and after RNAse treatment. The profiles resemble each other, but the RNAse

treated samples produce more intense higher molecular weight bands M i l e the

non-RNAse treated samples have low molecular weight bands that can not be

seen in the RNAse treated sarnples. In Iight of this, samples were routinely

treated with RNAse prior to amplification.

Effect of template amount

To detennine the amount of template DNA to use for primer screening ,

each DNA sample was amplifiecl with UBC4, using four dilutions: 0, 0.1. 0.01,

and 0.001. Representative results for hnio different DNA samples may be seen in

Figure 8. At O dilution (1 uL of the DNA sample used in the 50 uL assay)

usually no amplification products were obtained. At higher dilutions useful

profiles were usually obtained and these profiles w r e comparable even though

there was a 100-fold difference in the amount of template. As can be seen in

figure 8, most discrepancies are in the intensities of the faint bands. The 0.01

dilution was routinely preferred as the template for screening of the primers.

Background Amplification

Sometimes amplification products are observed in controls to which no

template had been added (data not shown). Presumably the template for such

amplifications would be trace contaminating DNA in the reaction mix.

The bands produced were unrelated to those produced in the presence of

template DNA, furthemore, spurious bands were never observed alongside the

bands produced from added template. A significant failure rate in performing

amplifications was obsenred. Occasionally, entire sets w l d show no products,

but then they would petforni well Wen repeated. These failures were attributed

to human emr, but they indicate that a high level of consistency and care is

required Men perfoming RAPD amplifications.

RAPD amplifications

Nine isolates of A. flaMpes were amplifed with 13 different primen (Fig. 9

and 10). lsolates were from very diverse sources, and some had no information

available conceming there origin (Table 4). The unique set of profiles, few

coincident bands generated and the failure of several isolates to generate bands

fith primers (Table 1 O) indicate the isolates of A. flavipes may be relatively

distantly related. A possible explanation for the many differenœs between the

isolates could be their diverse geographic origins. Consequently the various

strains of A. tlavipes may have developed different genome organizations with

respect to the RAPD primer sites tested here. Table 10 summarizes the data

obtained from the RAPD method (Fig. 9 and Fig. IO). The data obtained in

Table 10 show that UBC-6 and OPA-5 do not produce RAPD products in isolates

1,2, and 3, furthemore, these isolates produœd fewer RAPD products than

isolates 4,5,6,7,8,9. RAPD primers, OPC-2 and 0PA4 and OPA-13, generated

RAPD products in al1 isolates of A. flavipes. Isolates 4, 5, 6 and 7 produced

RAPD produds al1 the primers tested, furthemnwe, these isolates shared

more coincidental bands than other isolates of A. flavipes.

Table 10. Results of working primers used in RAPD experiments. 0: successfbl bnght bands, O: successful faint bands, .: unsuccessful

Primer lsolate of A. flavipes

Fig. 6. The effect of old (two months) and freshly prepared DNA template from

A. flavipes #4 in RAPDs. Two independently prepared samples of DNA from A.

flavipes #4 (N=new, O=old) were amplified wVth 8 primers and electrophoresed

side by side.

Fig. 7. The effect of RNAse treated and non-RNAse treated DNA template from

A. flavipes in RAPDs. A. flavipes #8 DNA was amplified before and after

treatment of the preparation with RNAse, using 6 prirners and then

electrophoresed side by side. N=non-RNAsed, R=RNAsed.

OPC-2 OPC-5 OPC-8 OPA-2 OPA-3 OPA-5 N R N R N R N R N R N R

Fig. 8. The effect of concentration of template DNA from A. flavipes in RAPDs.

Amplification of A. flavipes #6 with primer UBC4: lanes: 1, 2, 3, 4. Amplification

of A. flavipes #7 with primer UBC4: lanes 4, 5, 6, 7. Dilution factors: lanes 1

and 5; 0, lanes 2 and 6; 111 O, lanes 3 and 7; 111 00, lanes 4 and 8; 111 000.

Fig. 9. Agarose gel electrophoresis of isolates of DNA from isolates of A.

flavipes that were amplified with different RAPD primen. The isolates of A.

flavipes are indicated above each iane in the gel (isolates 1,2,3,4,5.6,7,8, and

9). L: BRL 1 Kb ladder size standards. RAPD primers utilized are Iisted above

lanes in the gel: UBC4, OPC-2, OPA-13. OPC-5, OPA-2, and OPA-3.

Fig. I O . Agarose gel electrophoresis of isolates of DNA from isolates of A.

flavipes that were amplified with different RAPD primers. The isolates of A.

flavipes are indicated above each lane in the gel (isolates 1,2,3,4,5,6,7,8, and

9). L: BRL 1 Kb ladder sire standards. RAPD primers utilized are listed above

lanes in the gel: OPA4,OPA-9, OPA-IO, OPC4, OPC-û, and UBC4.

DISCUSSION

The principal objective of this research was to develop an approach to the

DNA fingerprinting of Aspergillus isolates which could be applied to the problem

of identifying industrially important strains. The rnethod that was judged to be

most Iikely to yield different genetic profiles between closely related isolates,

and that wbuld be practical to apply to large numbers of isolates, was the

Randorn Amplification of Polymorphic DNA (RAPD) method developed by

Williams et al. (1 990).

The RAPD rnethod has gained much attention due to its ease of

application in the generation of DNA polymorphisms. Another important

consideration in the use of RAPDs is that no sequence information is needed for

primer selection. Other methods, especially RFLP (Restriction Fragment Length

Polymorphisms) were also considered, but M e n RAPDs were observed to give

satisfactory results, these w r e set aside. Efforts were likewise made to use the

simple sequences d(GT)9 and d(CT)g as primers, in hope that PCR amplicons

would possibly be generated. These efforts were not fruitful, however, the use

of d(GTk and d(cT)~ as primers has proven to be a valuable source of

polymorphisms in typing of other species of Aspergi/lus (Meyer et al. 1993,

Belkum et al. 1993).

It is crucial to the success of the RAPD rnethod that the profiles can be

consistently produced and that they are reproducible. The two main variables

that might be expected to interfere with reproducibility are the amount of

template DNA in the assay, and the purity of the DNA preparation.

This study showad that the assay was not very sensitive to the amount of

template within certain limits, and that the presence or absence of large amounts

of RNA did not significantly affect the profiles produced. The number of cycles

of amplification beyond 35 was also not significant (data not shown). It was also

shown that DNA prepared from independent cultures of the same isolate gave

virtually identical results as long as amplification was done on the same

instrument at the same time. Attempts at using a different machine (Perkin

Elmer-Cetus) resulted in non-reproducibility of profiles. For application of the

method to specific identification problems, it was important that test

amplifications and reference amplifications be fun at the same time, in the same

instrument. Another important factor which proved crucial in performing the

RAPD technique is the care in handling and setting up of the PCR reactions. It

was noticed that controls which aintained no DNA generated RAPO produds

which were visible during agarose gel electrophoresis. Thus extreme care and

caution is paramount Hihile perfoming these reactions, since additional bands

could generate inconsistent results. To circumvent problems associated with

contamination, DNA samples wwe prepared under laminar fiow and filtered

pipette tips w r e routinely used to inhibit aerosol foming in the barre1 of the

pipette.

This study has show that it is relatively easy to find a set of random

prirners that will amplify genornic DNA from isolates of A. tlavipes- Furthemiore,

complex profiles of bands were produced. The sets of profiles provided unique

and reproducible fingerprints for each isolate Wied, and thus the developed

approach is suitable for identification of strains for the purpose of patenting or

strain sewrity measures.

Although each isolate produced a unique profile, sorne band coincidences

w r e found in this study. There are two main implications flowing from this

finding. The first is that as isolates are more and more closely related, band

coincidences should increase, and the resolution of the method should also

decrease. Thus, for very closely related isolates, such as those in strain

lineages produœd during stain improvement, the rnethod rnight not be able to

find differences. On the other hand, the presence of coincident bands rnight

make it possible to develop species-specific marken. If a band occun in al1

isolates of a species, it could be isolated and used as a diagnostic probe for

prelirninary species assignment. This wu ld be extremely useful in situations

where the species identity of an isolate is in doubt,

In sumrnary, the profiles obtained wre higbly feproducible; differences

were mainly in the intensity of minor bands. Furaiemore, the RAPD method

represents a quick and reliable tool for establishing the amount of genetic

variability in strains of A. flavipes. Fingerprints wnsisting of 13 profiles for each

isolate were generated and compared. Each isolate was found to be unique wïth

respect to the other isolates in the study. For A. flavipes very few coincidenœs

were observed. The uniqueness for each set of profiles that was achieved in

this study indicates that the approach developed here wïll be useful for

identification of strains for the purposes of patenting, culture sewrity, and also

possible in the process of keeping track of strains during strain improvement

wrk.

In the next chapter the use of a recently developed method for DNA

fingerprinting be described, namely, microsatellite DNA analysis.

Microsatellite DNA sequences have been shown to be very useful tool in

applications of DNA fingerprinting. To amplement data produœd by RAPDs,

microsatellite DNA analysis be employed as another useful tool to further

distinguish isolates of A. flavipes.

Chapter 3

Simple Sequence Motifs in AsperglIus flavipes

INTRODUCTION

The aim in this study is to estimate the abundance of different types of

simple sequences in A. flavrpes and to investigate the feasibility of using simple

sequences for DNA fingerprïnting of strains. The abundanœ of d(GT/CA) and

d(CT/GA) microsatellite DNA in A. flavipes will be wmpared to that contained in

the complete nucleotide sequence of Sacchammyces œrwisiae, which has

been currently made available on the lntemet (Virtual Genome Center,

University of Minnesota). Studies of simple sequenœs in P. ultimum showed

that they can be the source of polymorphic markers to differentiate many

isolates. Thus, the same approach developed for P. ultimum wilf be attempted

A. flavipes. Investigations will be conduded into the different types of

simple sequenœ motifs and their polymorphic behavior in different isolates of A.

flavipes.

The isolates of A. flavipes utilized in this study include ones that are

patented or are economically important for production of many biological

cornpounds (as described previously). One important compound produœd from

A. flavipes is imiprimine. lmiprimine is commonly used today for treatment of

symptoms of depression and obsessive-compulsive disorders.

The development and identification of molecular markers based on

microsatellite DNA sequenceo is becoming a important method for strain

verificationfidentification, and an aid for the identification of desirable traits.

Today, many plant and animal breeding programs incorporate microsatellite

DNA markers to help identify and select desirable genetic traits (Biosystems

Reporter, Perkin-Elmer, 1 996).

RESULTS

Presence of simple sequence in the genomes of isolates of A. flavipes

The presenœ of simple sequence in the genomes of 9 isolates of A.

flavipes was determined by genomic dot blots probed with DIG-lsbeled d(GTl9,

d(CTk, d(AT)g and d(GC)9 oligonucleotides (Fig. 1 1 A,B.C, D). Approximately 1

ug of genomic ONA from each isolate was applied to the membrane as a target

for the probe. The same amount of pBluesaipt Ml 3 Ks + plasmid DNA was

spotted on each membrane as a negative control (under lane 1, Fig. 11

A,B,C,D). The positive control spot for d(GTI9 hybridization (under lane 1, Fig.

11A) consisted of about 1 ug of cloned DNA fom P. u l ~ m known to contain

abundant d(GT1CA) motifs (pLCA, Fig. 2). For the d(CT)g hybridization (under

lane 1, Fig. 1 1 B) the plasmid pCT1 was used as a positive control due to the

high amount of d(CT1AG) simple sequence (Fig. 18). For the d(AT)s and d(GCk

hybridizations (under lane 1, Fig. 1 1A and 1 7 B respectively), 60 pg of d(AQ

and d(GC)s were applied to the hm membranes respectively. Oark spots

indicative of hybridization to the oligonucleotide probes were observed for al1 the

positive wntrols, but the degree of intensity for d(AT)@ and d(GCl9 was much

less than that for the other probes (under lane 1, Fig. 1 l A and 1 18). A possible

reason for the lower intensity for d(AT)@ and d(GCk will be addresseci in the

discussion section of this chapter. Examination of the dot bfots which w r e

probed with d(GT)@ and d ( C n probas reveals a significant difference in the

intensities of the spots among the isolates (Fig. 1 1 A and1 1 8). The differenœ

betwaen the intensities for each isolate may reflect that the number of d(GT1CA)

and d(CT1GA) motifs are different, a finding which supports the notion that these

sequences are polyrnorphic.

Estimation of the abundance of simple sequence motifs in A. flavipes

The genomic library constnided from A. ffavipes (ATCC No.16795) was

plated, and approximately 2000 plaques were observed. Plaque Iifts were

hybridized to d(GT)o, d(Cn, d(AT)9 and d(GC)g probes, producing

approximately 800 and 600 signals for d(GT)s and d(CT)@ respectively, and no

detectable signals for d(AT)s and d(GClg were observed (data not show).

Although attempts w r e made to resolve the problems associated with using

d ( A n and d(GCI9 probes by varying the hybridization temperature, and

stringency during blot washes were made, no observable hybndization was

noticed with these probes.

The abundance of d(GT1CA) and d(CT1GA) can only be estimated

because the genome size of A. flavipes is not knowri. If it is assumed that the

genome size is similar to that of A. neer, 38 Mbp (Keller et al. 1992), and that

the average size of the library inserts is 20 kb, the 2000 plaques screened

represent about 1 genome, and the numbers of d(GT1CA) and d(CT1GA) motifs

per genome are at least 800 and 600 respecüvely. The abundanœ of these

motifs wwld be greater if more than one simple sequenœ motif ocwrred in any

of the 20kb library inserts. If microsatellite motifs are evenly dispemed

throughout the genome of A. flavipes it can be inferred that a d(GT1CA) motif

ocwrs about once every 47 kb and a d(CT/GA) motif, once every 63 kb.

Abundance of GTs Cf, AT and OC type microsatellites sequences in

the genome of Sacchammyces cerevisiae

The Virtual Genome Center database penited easy access to search this

for simple sequenœ motifs in S. œrevisiae. A search was conducted using the

S. œrevisiae database for homology to 9,8,7,and 6 bp repeats for d(GT/CA),

d(CT/GA), and d(ATlTA) motifs, and 9,8,7, 6, 5, and 4 bp repeats for d(GC1CG)

motifs. The number of matches to each locus was determined and tabulated in

Table 11. The results from the search indicate that d(ATiTA) is the most

abundant type of simple sequence followed by d(GTICA), d(CT1GA) and

d(GC1CG).

Southem blot analysis of nine ATCC isolates of A. flavipes

In order to confin that d(GT/CA) and d(CT1GA) motifs are interspersed in

the genome and to show that their distribution is polymorphic within the species,

genomic DNA from eight different isolates of A. flavipes was digested with

BamHI, agarose gel electmphoresed, Southem blotted, and probed with either

d(GTI9 (Fig. 124 or d(CT)9 probe (Fig. 128). In each lane (lanes 1 to 9. Fig.

12A and 128) numerous bands appear. The positions of these bands indicate

that d(GT1CA) and d(CT/GA) motifs are dispersed in the genomes of each strain

of A. flavi's. Furthemore, the presenœ of several prominent bands in most

profiles rnay also suggest that some of the simple sequenœ motifs may be

present in the fom of a repetitive gene family.

Cornparison of the profiles for each strain (lanes 1 to 9, Fig 12A and 128)

fails to reveal any sirnilar patterns of bands or even any obviously coincident

bands that are widely shared. This observation suggests that BamHl sites are

highly polymorphic in A. tlavipes, and probing of genomic digests with abundant

interspersed elements such as d(GT)@ or d(CT)o is successful in exhibiting such

polymorphisms.

Isolation of simple sequences

Four lambda clones were isolated by hybridization of d(GT)g and d(CT)g

probes to the genomic library of A. flavipes ATCC 16795. Two lambda clones

which hybridized to the d(GT)o probe w r e named LGTI, LGT2 and two lambda

clones that hybridized to the d(CT)g probe were named LCTI, and LCT2. The

DNA from each lambda clone was isolated, treated with the endonuclease

BamHI, and obsented by agarose gel electrophoresis (fane 1, Fig. 13A, 138 and

fane 1, Fig. 14A, 14%). The agarose gels containing the DNA fragments were

Southem blotted and hybridized with d ( G n (lane 2, Fig. 1 3A, 138) and d(CT)g

probes (lane 2, Fig. 144 148). In figure 148, lane 2, an additional faint

hybridization signal is noticed above the 5.0 kb signal. Although no visible band

is seen in the agarose gel the faint signal may be due to partially restrided

lambda DNA Mich can cause a smeanng effed and the appearanœ of

additional bands. Lambda DNA fragments which hybridized to the oligo probes

(d(GT)B and d(CT)@) were purified and subcloned into the BamHl site of

pBluescript Ml 3 Ks + and designated pGT1, pGT2, pCT1, and pCT2 (Fig. 15).

Localization of simple sequence

To detemine the sequenœ and location of the simple sequenœ motifs in

each lambda subclone, deletion cloning was performed. Deletion cloning

involves the directional deletion of nucleotides in a particular DNA fragment.

Approximately 10 different clones for each subclone (pGT1, pGT2, pCT1, and

pCT2) had an increasing number of nucleotides removed from their insert. Each

of the clones were tested for hybrïdization to either d(GT)s or d(CT)s probes.

Clones which failed to hybridize to either of the probes were discarded and the

last one in the ordered series of deletions Mich still was able to hybridize was

sequenced. The nucleotide sequence of each deletion clone is given in Figures:

16:(pdGT1), 1 7:(pdGT2) ,18:(pdCT1), 19:(pdCT2) and the location of primers

and simple sequence regions are indicated. In deletion clone pdGT1, a

d(GT/CA)- motif was identified, in pdGT2 a d(GT/CA)s (AîT)(T/A)(GT/CA)s and

a d(GA/CT)s motif, in pdCT1 a d(CTIGA)17 motif and in deletion clone pdCT2 a

CTiich sequenœ was identified. In order to study the feasibility of microsatellite

DNA as a polymorphic marker in isolates of A. flavipes, primers were designed

to amplify each simple sequence motif identified in isolate M. Primers were

based on DNA sequenœ flanking the simple sequence motifs (pdGT1, pdGT2,

pdCT1, pdCT2). (Figs. 16,17,18,19 and Table 12)

Amplification of simple sequence motifs

PCR was utilized to amplify four simple sequence motifs identified from

isolate #4 in eight different isolates of A. flavipes (Table 4). The PCR products

obtained from each amplification reaction were analyzed by agarose gel

eledrophoresis (Fig. 20A and Fig. ZIA). The expected produds were obtained

from isolate ATCC 16795 (our #4), and similar products were obtained in DNO of

the other isolates: ATCC 1 101 3 (#2) and ATCC 141 36 (#9). Faint bands were

obtained *th some of the other isolates (lane 1,5,6 Fig. 20A and lane 1 Fig.

21A) and some isolates did not amplify at all. Attempts were made to Vary the

PCR conditions, however, no prominent bands w r e observed for isolates #l ,

#3, #5, #6, #7,and #8.

Southem blotting of the agarose gel (Fig. 20A and 21 6 ) and probing with

d(GT)9 (Fig. 208) and d ( C n (Fig. 21 8) showed that only isolates #2, #4, and

#9 produced intense hybridization signals. In lane 2, figure 204 a PCR product

was visible, but the hybridization signal to the d(GT)s probe was absent (lane 2,

Fig. 208). This suggested the absence of the d(GT1CA) motif in isolate #2. In

another instance, isolate ül produced a faint band (lane 1 Fig. 21 B), but no

hybridization to the d ( G n probe was obsenred at that position (lane 1 Fig. 20A).

The PCR products from each amplification (isolates #2, W, and #9) were

subcloned into the BemHl site of pBluescript Ml 3 Ks + (Fig. 22). Plasmid

constnids containing PCR products inserts were named according to the strain

of A flavipes and the motif cloned, Table 1 3.

Cloned PCR products, pAf2GTI. pAf4GT1, pAfQGT1, pAfZGT2,

pAf4GT2, pAf9GT2, pAQCT1, pAf4CT1, pAfSCT1, pAf2CT2, pAf4CT2, pAf9CT2

were sequenœd and aligned respect to the motif amplified (GT1, GT2, CTl ,

or CT2). Alignment of the GT1 motifs (pAf2GT1, pAf4GT1, pAf9GT1 Fig. 23)

revealed numerous differences in the lengths of the d(GT1CA) arrays. An

d(GTICA)* anay in isolate #4 (pAf4GT1) in isolate #2 the array was decreased

to a d(GTICA)5 and in #9 to a d(GTlCA)=. The sequenœs flanking the arrays

in the three isolates w r e mostly homologous, with isolate #2 differing at 1

position, and isolate #4 at 4 positions (Fig. 23 boxed nucleotides).

Alignment of sequenœs from the GT2 locus (pAf2GT2, pAf4GT2,

pAf9GT2 Fig. 24) showed few polymorphisms in the simple sequence anay,

wi-th isolates #Pl and #9, having the same d(GT/CA)8 (AfT)(T/A)(GT)3 motif.

However, in isolate #2, the simple sequence array had been changed to

d(GTICA)e(GAICT)4. Examination of the flanking reg ion revealed that the

d(GT/CA) motif is embedded in a d(GNCT)-rich region, starting at position 69

and ending at position 183. The shortening of the array in isolate #2 is

accompanied by the generation of more d(GA/CT) repeats in place of the

d(GT1CA) repeats. Presumably, this conversion of d(GT1CA) to d(GAICT) is due

to the proximity of the d(GA/CT) arrays on both sides of the d(GT1CA) repeat

region. As with the other aligned locus GT1 (pAQGTf, pAf4GT1, pAf9GT1) the

fianking regions were mostly homologous with isolate #Z, differing at 5 positions

and isolate #9 at 1 position (Fig. 24, boxed nudeotides). In addition to the main

d(GT1CA) array a d(GA/CT). repeat (starting at position 172) was obsewed in

isolate #4 and #9 with isolate #2 having a d(GAICT)= . Thus, 2 different types of

motifs (d(GT/CA) and d(CT1GA)) in the cloned fragment from LGT2 displayed

length polymorphisms.

In the alignment sequences from the CTI locus (pAf2CT1, pAf4CT1,

pAf9CT1 Fig. 25) showed a nurnber of short d(CT/GA) arrays (starting at

positions 21 ?and 292) surrounding the larger d(CT/GA) (position 231-280) array.

Polymorphism is confined to the main d(CT/GA) array with isolate #2 having a

d(CTGA)21 repeat, isolate #4 a d(CT/GA)17, and isolate #9 a d(CTIGA)lr repeat

In addition, isolate #2 and #4 have a gap of 4 nucleotides starting at position

114. The flanking regions of the main d(CT1GA) array are highly homologous

with isolate #9 having only one difierence and isolate #9 having 3 differences

(Fig. 25, boxed nucleotides).

The alignment of sequences from the CT2 locus (pAf2CT2, pAf4CT2,

pAfSCT2 Fig. 26) reveals an abundance of very short CT arrays scattered

throughout the sequence, with the longest array (positions 96-1 07) consisting of

a d(CT/GA)s motif in isolate #2 and a d(CT/GA)5 in isolates #4 and #S. The three

sequences are highly hornologous, with isolate #2 differing at 3 positions (not

counting the main CT array), and isolate #4 at 2 positions and isolate #9 at 1

position (Fig. 26. boxed nucleotides). lsolate #S and iK4 have a 2 nucleotide gap

starting position 106, and isolate #9 with a gap starting at position 264. Cytosine

(C) and thymine (T) nucleotides represent 7356 of the total nucleotide

composition of the amplified region. The evidence fiom this data suggests that

limited polymorphism is associated *th these type of simple sequence

organization. Though this type of region is knociun as ayptic simple sequence, it

may be the remnant of a perfect simple sequenœ repeat (Tautz 19û6). The

occurrence of cryptic simple sequenœ has been thought to anse by point

mutations and DNA slippage events during replication which result in a disnipted

and less organized dinucleotide repeat structure (Tautz 1986).

Using the primen developed in these studies, PCR reactions were

wnducted using DNA fmm A. terreus ATCC 20542, and A. ve~sicolor ATCC

1 1730 (data not show). Attempts at arnplifying similar motifs from other species

using the primers designed for A. flavipes were unsuccessful. Thus the primers

used in these experiments may be spea'es-specific for certain isolates of A.

flavipes. although they do not amplify al1 isolates.

DNA sequence analysis of plasmid constructs of DNA from A. flevipes #4

The DNA sequenœ from pdGT1, pdGT2, pdCT1, and pdCT2 were used

to scxeen GenBank and EMBL (European Moleailar Biology Laboratory)

databases using the BlRCH (Biological Research Cornputer Hierarchy) program

at the University of Manitoba. The search did not reveal any significant

homologies to known DNA sequences. Although homology was found to simple

sequenœs, the fianking regions of the microsatellite motifs in A. flavipes were

rot homologous to the sequences in aie database search. To investigate if the

DNA sequence obtained from the various clones (pdGTi ,pdGT2, pdCT1 and

pdCT2) contained known DNA motifs, a search was perfomed using a database

of well established DNA motifis (Table 7). The search revealed open reading

frames neœssary for the sequences to be tramai-bed. Furthemore, lariat

motifs which were detected could represent RNA editing functions for these

sequences (introkexon splicing of mRNA, Benjamin Lewin, Genes V, 1994)

(Table 13).

Table 11. Abundance of various nucleotide motifs in the genome of S. cerevisiae

Motif Number of loci

d(GT1CA)g 92 d(GT1CA)s 114 d(GT/CA)7 1 47 d(GT1CA)e +195 Total .................................................................. -548

d(CT1GA)g 30 d(CT/GA)a 37 d(CTIGA)7 49 d(CTIGAl6 +a Total ................................................................... 180

d(ATKA)g 572 d(ATKA)s 769 d(ATKA)i 1022 d(ATKA)e +1384 Total.. ...................................................... .., ........ .3702

d(GC1CG)s O d(GC/CG)e O d(GCICG), O d(GClCG)6 O d(GC1CG)s 3 d(GC1CG)d +36 Total.. .................................................................. -39

Table 12. List of primers developed ftom sequenœ analysis to amplify simple sequence motifs in A. flavipes. . .

Name of primer. 5' to 3 DNA sequenceb

FpGTl primer

RpGTl primer

FpGT2 primer

RpGT2 primer GCATCCGCATrCCCCCRGTGTGATCCCAGAAC

FpCT1 primer

RpCT1 primer

FpCT2 primer

RpCT2 primer GCATCCCGRTrCCATCCRA~TCCAAXdLTGC

a R:reverse primer, F:foward primer. All were derived ftom sequence analysis of

A. flavipes clones pGT1, pGT2, pCT1, pCT2.

All primers vvere constnicted with 2 adjacent BamHl sites (GGATCCGGATCC)

at the 5' end.

Table 13. Name designation of cloned PCR products from isolates of A. falvi's.

- -

Name of clone Strain of A. flavipes PCR motif cloned

Table 14. Sequenœ analysis of pdGT1, pdGT2. pdCT1, and pdCT2

DNA Sequence Motif #Sites Nucleotide Position 9-3' pattern

pGTl sequence analysis TATA Box Lafiat Consensus Seq Translation lnit Seq

pGT2 sequence analysis Lariat Consensus Seq CCAAT Box Translation lnit Seq

pCT1 sequence analysis CCAAT Box Lariat Consensus Seq TATA Box

pCT2 sequence analysis CCAAT Box TATA Box Translation lnit Seq

TATA 502 YNYTRAY 439 RNNMTGG 12/1531195

YNYTRAY 541 CCAAT 9/587 RNNMTGG 232

CCAAT 326 YNYTRAY 55/193 TATA 2913111 13

CCAAT 6741681 TATA 2661563 RNNMTGG 881

Fig. 11. Autoradiogram of genomic DNA dot blots with 9 isolates of A. flavipes.

Hybridization was conducted 4 different oligonucleotide probes. A:d(GT)s,

B I~(CT)~ , C:d(AT)g and 0:d(GC)9. Lane number corresponds to the isolate

number (Table 4). Negative and positive controls are single spots in lane 1 of

each blot.

Fig. 12. RFLP analysis of 9 isolates of A. flavipes. Genomic DNA was digested

with BamHl and electrophoresed on 0.7% agarose gel. Hybridizations are with

A:d(GT)9 or B:d(CT)s DIG-labeled oligonucleotide probes. Lane numbers

correspond to isolate number (Table 4).

Fig. 13. Restriction digests and Southem blotting of lambda DNA clones. A:

lane 1, LGTl restriction digest and lane 2, Southem blot hybridization. 6: lane

1, LGT2 restriction digest and lane 2, Southem blot hybridization. Blots were

probed wïth d(GTb DIG-labeled oligonucleotide. Hybridization signals indicate

which band from the agarose gel hybridizes to the probe.

Fig. 14. Restriction digests and Southem blotting of lambda DNA clones. A:

lane 1, LCTI restriction digest and lane 2, southem blot analysis. 6: lane 1,

LCT2 restriction digest and lane 2, Southem blot analysis. Blots were probed

with d(CT)s DlG-labeled oligonucleotide. Hybridization signals indicate which

band from the agarose gel hybridizes to the probe.

Fig. 15. Restriction digests with BamHl of cloned lambda DNA fragments in

pBluescricpt Ks (+). Lane 1 :pGTl , 2:pGT2, 3:pCTI, and 4:pCT2.

Fig. 16. Nucleotide sequence of plasmid pdGT1, from A. flavipes #4. A

d(GTk simple sequenœ repeat is indicated in bold font. Arrows indicate

primer sequences chosen for PCR reactions in order to amplify the region

containing the simple sequence motif.

GAGAACACTAAGCAT TCCGAGTGGCAAGCGACGTAACCACGCTAAAAAAA CCCGATCGTCCACGCGTGAAGCGACCGAATCTGGATCGAAGGATCATCCC AGTGCAGGCGAAGAGGGTGTTTTGTTGATGCTATCTGGACCCAGGGTTTC CCCATCGGTGGATTCTGACAGGTACTGCGGTACCGGCGGTGATTTGTCCC TGGGACGGGCGTACCTTAACGGCGTGGGATGCGCCCTCTTGGGAGGCATT

CCTGTGTCGGCCCCTCGTACTACCCGTCCCGGCAGTCAGAGTCGTACTCG ATCCTCTTGGGAGAGAGGGAGAGAGCGCGACAGAGACCGAGAGAACTGGC - TATATTTGGCGG-3 '

Fig. 17. Nucleotide sequence of plasmid pdGT2, from A. flavipes #4. A

d(GT)&T(GTh simple sequenœ repeat is indicated in bold font Amiws indicate

primer sequences chosen for PCR readions in order to amplify the region

containing the simple sequence motif.

CGAGGGTGAATTCGAGGGTTTCCAGACAGTGGTTTTTTGGGAGAGATAGGCC A TGAAGGCGCTGAGGGTGTAGGGGGCGGGTGCCGTGTTGGCGAGCACCTCA TCGAGGGAGGGACGCATGGGGGCAGAACGCGCCCGGCGGGACGGTCAGACT GAGTGGCCGGGGGTCGGGACGGTCCATGTCGTCGTCCGACTCGGAGTCGGA

C

ATGCCAGAAGAGAAGCGGGGGGTGCAGGGTTTTCTTTTTGAGCATCGCGGT CGGG TGGGGAGTGAGAGGGGGGAGAGAG TGGG TG T A TGAGCGTGAGAGGG T

GAGAGAGT-TGGTGGTGT TGCTGCCTGTCACCAGGCGGAGG ACGAGAGTTTCGGAAGA TCGGTGGGAGTCAAGGGGCCGATCGGGGGGCGTG GGGACAAAGAAGGGATTCGTCGGATTGGCGCGCCTAAAGATAGGATCCT-3 '

Fig. 18. Nucleotide sequenœ of plasmid pdCT4, from A. flavipes #4. A

d(CT)i7 bp simple sequence repeat is indicated in bold font. Arows indicate

primer sequences chosen for PCR reactions in order to amplify the region

containing the simple sequence motif.

TCAAAAGCGTCTGGAACAGCGGCGATGGTTTCCCCTGGGTCTTCCCGTCTG ATCCGACTGTATATCTCGGGCGACCTGCCTCGAGGGTGGCGATCGCACTT~ GCTACCAAGTGCGGATACATTGCGGACGGCCGAAAGTCAAAACGCGTGTCG GAATCGATTGACTTTTTGCAGAGTTTGMTTTGGGGGCAGTTTTCTCATGA TGAGCGCGGGGAGGCGAACGACATACTTGGTGCAGGGATGGCGGCACGGTG TGGCATTTCCGCTGCGGATTGGACTGCGATTGATAAGGGCCTCACTCTCCA CTCTCCCTCTCTCCACTGCACTrCTCTCTCTCTCTrCTrC~TrCTCTICTCTCIY3 TCZGCTCTTCAACACCACACTCTCTCGTCCACACTCCTTCCACCCACACC CT TCCCGGTACGTACAGGCACCCCCCGGCCTGATTCATCCGCACGGCCAGG

Fig. 19. Nucleotide sequence of plasmid pdCT2. from A. flavipes #4. A d(CT)

rich simple sequenœ area is indicated in bold font. Arrows indicate primer

sequences chosen for PCR reactions in order to amplify the region containing

the simple sequence motif.

TGACGCCTAGGGGAGCACAGCTGATATCGGACGGCGAATCCGGATGGTGGC CACCGGCGCAGGCTGGAGGGATAGGGGTGTGTCCCATCCGATCGGGATTCC GCGTCTGCACGAGAAAGTCGCCGTGGCCGCTGCATGGCGATGGGATGGTCA TCATCGAGGGGATTTATGGTGGCACACTGGACCCTGGAGAGACCGTGTGGG TGGTTCGAT TATAAGGCGAGGATACCCATCTGGTCCAGTGCGTAGATACTC TTCTGGCGGACTGTACAGTACGGACTGACTGTACCGGTTG~TGCCCCTCG TCCCTCGTCTGACTGACACTCGTCTTTTCTTCTGTCGTTCCTCTCGACTTC

CGCCCCTCCCAAGATCGATCTCCACTCCGAACCAACGGTGGGTTCTTAATC TA TACTCAGGGCTGCTCTCCCACCATCTTCCTGTGGGCGAATGTCGCCTGT ATCACTTTTGCGCCCACCCTCTT TTACGCTGTCTCTATCTTGTGATCTTTT

TCATCGAGTCTCAAGCATGCCAACCATCCTACTGCCCTCGTCGGCCGCCGC CTTTGCGCCGCGGTCCTCGCCCAACGTGGTGCTGAGCACCCGCATCGAGCC CTGGCTCACGGCCACCCTCAAGCGAGTCAACCGGGTGAAGCGACCTCTCAA TAATGTCTCCCAGCACACCCGCTGTCTGACCGAGACCCTCTCCTCGCCCAA

Fig. 20. PCR amplification of d(GT/CA) type simple sequence motifs in 9

different isolates of A. tlavi's. Lanes 1 to 9 use primers to arnplify the GT1 motif

or the GT2 motif (underlined). A: Agarose gel electrophoresis of PCR products.

B: hybridization to d(GT)8 DIG-labeled oligonucleotide probe. Lanes 1 to 9

correspond to isolate numbers of A. flavipes (Table 4).

GTl Matif GT2 Mutif

Fig. 21. PCR amplification of d(CT1GA) type simple sequence motifs in 9

different isolates of A. flavipes- Lanes 1 to 9 use primers to amplify the CTl motif

or the CT2 motif (underlined). A: Agarose gel electrophoresis of PCR produds.

B: hybridization to d(GTk DIG-labeled oligonucleotide probe. Lanes 1 to 9

correspond to isolate numbers of A. flavipes (Table 4).

Fig. 22. Restriction digests wi-th BamHl of plasmid constnicts wntaining cloned

PCR products. Lane, 1 :pAf2GTl1 2:pAf4GTl, 3:pAf9GT1, 4:pAf2GT2,

5:pAf4GT2, 6:pAf9GT2, 7:pAf2CT1, 8:pAf4CTIt 9:pAf9CTl1 1 O:pAf2CT2,

1 tpAf4CT2, 12:pAf9CT2.

Fig. 23. DNA sequence alignment of cloned PCR products from pAf2GT1.

pAf4GT1, pAf9GT1. Dashed regions (-) indicate missing nucleotides. boxed

nucleotides indicate substitutions observed in campansons to the other two

sequences. and nucleotides in bold case indicate simple sequenœ motifs.

10 20 30 4 0 50 pAf2GTZ 5 ' -GTGAAGCGAC CGAATCTGGA TCGAAGGATC ATCCCAGTGC AGGCGAAGAG pAf4GT1 5 ' -GTGAAGCGAC CGAATCTGGA TCGAAGGATC ATCCCAGTGC AGGCGAAGAG pAfSGTf 5 '-GTGAAGCGAC CGAATCTGGA TCGAAGGATC ATCCCAGTGC AGGCGAAGAG

60 70 80 90 100 GGTGTTTTGT TGATGCTATC TGGACCCAGG GTTTCCCCATC GGTGGATTC GGTGTTTTGT TGATGCTATC TGGACCCAGG GTTTCCCCATC GGTGGATTC GGTGTTTTGT TGATGCTATC TGGACCCAGG GTTTCCCCATC GGTGGATTC

110 120 130 1 4 0 150 TGACAGGTAC TGCGGTACCG GCGGTGATTTG TCCCTGGGAC GGGCGTACC TGACAGGTAC TGCGGTACCG GCGGTGATTTG TCCCTGGGAC GGGCGTACC TGACAGGTAC TGCGGTACCG GCGGTGATTTG TCCCTGGGAC GGGCGTACC

1 60 1 70 180 190 200 TTAACGGCGT GGGATGCGCC CTCTTGGGAGG CATTGTGTGT GTGT---O- T TAACGGCGT GGGATGCGCC CTCT TGGGAGG CATTGTGTGT GTGTGTGTG TTAACGGCGT GGGATGCGCC CCCTTGGGAGG CATTGTGTGT GZGTGTCTG

2 60 2 70 280 290 300 ---------- ----- ACTGG GTACATCATCC CCTCCCTAGG TCGGCCCCT TL;TYITOTET W T A C T G G GTACATCATCC C C T C C C ~ TCGGCCCCT ~ ~ - - - - - - - ---O- ACTGG GTACATCATCC CCTCCCTAGG TCGGCCCCT

CGTACTACCC GTCCCGGCAGT C-GTCGTA ~ C G A T @ ' C TTGGGAGAG CGTACTACCC GTCCCGGCAGT CAGAGTCGTA GTCGATCGTC TTGGGAGAG

360 3 70 380 386 AGGGAGAGAG CGCGACAGAGA CCGAGAGAAC TGGCTA-3 ' AGGGAGAGAG CGCGACAGAGA CCGAGAGAAC TGGCTA-3 ' AGGGAGAGAG CGCGACAGAGA CCGAGAGAAC TGGCTA-3 '

Fig. 24. DNA sequenœ alignment of cloned PCR products from pAf2GT2,

pAf4GT2, pAf9GT2. Dashed regions (-) indicate missing nucleotides, boxed

nucleotides indicate substitutions observed in compafisons to the other tvvo

sequences, and nucleotides in bold case indicate simple sequence motifs.

10 20 30 40 50 pAfZGT25 ' - GGGAGTGTGA TGCCAGAAGA GAAGCGGGGG GTGCAGGGTT TTETTTTTGA - pAf4GT25 ' - GGGAGTGTGA TGCCAGAAGA GAAGCGGGGG GTGCAGGGTT TTGTTTTTGA p A f 9 G T 2 5 ' - GGGAGTGTGA TGCCAGAAGA GAAGCGGGGG GTGCAGGGTT TTGTTTTTGA

GCATCGCGGT CGGGTGGGGA GTGAGAGGGG GGAGAGAGTG GGTGTATGAG GCATCGCGGT CGGGTGGGGA GTGAGAGGGG GGAGAGAGTG GGTGTATGAG

110 120 130 140, 150 CGTGAGAGGG TGTGAGAGAG AGA- -----A f GAGAGAfGAG CGTGAGAGGG TGTGAGAGAG AGAGTGTGTG W G T G T A T-TGTGAG CGTGAGAGGG TGTGAGAGAG AGAGZGTGTG PGZGZGTOTA TGTGZ'GTGAG

TATGAGAGAG TGAGAGAGAG T- --AATGGTGG TGTTGCTGCC TATGAGAGAG TGAGAGAGAG T- AGAATGGTGG TGTTGCTGCC

210 220 230 240 250 TGTCACCAGG CGGAGGACGA GAGTTTCGGA A A T C G G T ~ AGTCAAGGGG

;-I

TGTCACCAGG CGGAGGACGA GAGTTTCGGA AATCGGTGGG AGTCAAGGGG TGTCACCAGG CGGAGGACGA GAGTTTCGGA AATCGGTGGG AGTCAAGGGG

CCGATCGGGG GGCGTGGGGA CAAAGAAGGG ATTCTCGGAT TGG-3 ' CGGATCGGGG GGCGTGGGGA CAAAGAAGGG ATTCTCGGAT TGG-3 '

Fig. 25. DNA sequence alignment of cloned PCR products from pAf2CT1,

pAf4CT1, pAf9CT1. Dashed regions (-) indicate missing nucleotides, boxed

nucleotides indicate substitutions observed in cornparisons to the other tvuo

sequences, and nucleotides in bold case indicate simple sequence motifs.

10 20 30 p A f Z C T 1 5 ' -TGCTACCAAG TGCGGATACA TTGCGGACGG p A f 4 C T l S ' -TGCTACCAAG TGCGGATACA TTGCGGACGG p A f 9 C T l S ' -TGCTACCAAG TGCGGATACA TTGCGGACGG

60 70 80

40 50 CCGAAAGTCA AA-CACGCGT CCGAAAGTCA AAACACGCGT CCGAAAGTCA AA-CACGCGT

90 100 GAATTTGGGG GCAGTTTTCT GAATTTGGGG GCAGTTTTCT GAATTTGGGG GCAGTTTTCT

GTCGGAATCG ATTGACTTTT TGCAGAGTTT GTCGGAATCG GTCGGAATCG

ATTGACTTTT TGCAGAGTTT ATTGACTTTT TGCAGAGTTT

110 CATGATG* CATGATGAGC CATGATGAGC

120 130 WC---- GGG AGGCGAACGA 140 150

CATACTTGGT GCAGGGATGG CATACTTGGT GCAGGGATGG CATACTTGGT ~AGGGATGG

GCG---- GGG AGGCGAACGA GCGTGCGGGG AGGCGAACGA

170 180 TGGCATTTCC GCTGCGGATT

190 200 GGACTGCGAT TGATAAGGGC GGACTGCGAT TGATAAGGGC GGACTGCGAT TGATAAGGGC

1 60 CGGCACGGTG CGGCACGGTG TGGCATTTCC GCTGCGGATT CGGCACGGTG TGGCATTTCC GCTGCGGATT

210 CTGACTCTCC ACTCTCCCTCT CTCCACTGC CTGACTCTCC CTGACTCTCC

ACTCTCCCTCT CTCCACTGC

290 300 TCAACACCAC ACTCTCTCGT TCAACACCAC ACTCTCTCGT TCAACACCAC ACTCTCTCGT

310 CCACACTCCT CCACACTCCT CCACACTCCT

Fig. 26. DNA sequence alignment of cloned PCR products from pAf2CT2,

pAf4CT2, pAfSCT2. Dashed regions (-) indicate missing nucleotides, boxed

nucleotides indicate substitutions obsewed in cornparisons to the other hAlo

sequences, and nucleotides in bold case indicate simple sequence motifs.

10 20 pAf2CT2 5 ' CTGTACAGTA CGGACTGACT pAf4CT2 5 ' CTGTACAGTA CGGACTGACT pAf9CT2 5 ' CTGTACAGTA CGGACTGACT

TGACTGACAC TGACTGACAC

CCTTTTTTCT CCTTTTTTCT

210 CCTCCCAGGA C C T C C C C ~ A CCTCCCAGGA

260 ACTCAGGGCT ACFCAGGGCT ACTCAGGGCT

31 O CACTTTTGCG CACTTTTGCG CACTT TTGCG

3 60 TTCGCATATT TTCGCATATT TTCGCATATT

TCGTCTTTTC TCGTCTTTTC TCGTCTTT TC

320 CCCACCCTCT CCCACCCTCT CCCACCCTCT

30 40 GTACCGGTTG GCTGCCCCTC GTACCGGTTG GCTGCCCCTC GTACCGGTTG GCTGCCCCTC

80 90 TTCTGTCGTT CCTCTC~CT TTCTGTCGTT CCTCTCGACT TTCTGTCGTT C-CGACT

CGTTTCTTCTC CGTTTCTTCTC

230 CTCCGAACCAA CTCCGAACCAA CTCCGAACCAA

280 CATCTTCCTGT CATCZTTCCTGT CATCTTCCTGT

330 TTTACGCTGTC TTTACGCTGTC TTTACGCTGTC

J I U J I &

GGATATTGGA T-3' GGATATTGGA T-3 ' GGATATTGGA T-3'

CGGTGGGTT CGGTGGGTT CGGTGGGTT

290 GGGCGAATGT GGGCGAATGT GGGCGAATGT

340 TCTATCTTGT TCTATCTTGT TiCTATCTTGT

50 GTCCCTCGTC GTCCCTCGTC GTCCCTCGTC

100 TCCACCTCTC TCCACCTCTC TCCACCTCTC

150 CTCCCCTCCGA CTCCCTCCGA CTCCCTCCGA

200 CGCGTTCGCC CGCGT TCGCC CGCGTTCGCC

250 CTTAATCTAT CTTAATCTAT

300 CGCCTGGAT

CGCCTGGAT

350 GATCTTTTC GATCTTTTC GATCTT TTC

DISCUSSION

Four main discoveries ernerge frorn the experiments reported here. First,

hybridization of d ( G n and d ( C n probes to genomic DNA dot blots (Fig. 1A

and 1 B) of nine isolates of A. flavipes showed that d(GT1CA) and d(CT/GA)

motifs are present in their genomes. DifFerences in intensities of hybridization

signals may support the notion that d(GT/CA) and d(CT/GA) arrays are

hypervariable. Attempts to identify the presence of d(ATKA) and d(GC/CG)

motifs by hybridization with d(AT)g and d(GC)g probes were unsuccessful.

Similar results have been reported previously and have been attributed to the

self annealing of these types of oligonucleotide probes (Lagercrantz et al- 1993).

In an attempt to cirwmvent this problem, the strigency conditions during

hybridization and blot washing were changed so that d(ATKA) and d(GC1CG) - motifs could be identified, but no visible hybridization signals to genomic DNA

were observed.

Second, screening a genomic library of A. tlavipes isolate #rl (ATCC

19795) d(GT)s and d(CT)@ probes showed that the number of d(GT/CA)

motifs is predominant over d(CT/GA) repeats. Abundance between these hm

types of repeats in A. flavipes was found similar to that of S. cemvisiae (Table

1 1). Early work on the amount of simple sequence in S. cemvisiae amved at

the estimate that d(GT1CA) is about 30 times more abundant than d(CTIAG)

(Lagercrantz et al. 1993). These estimates were obtained by slot blot

hybridizations using d(GT)lo and d(CT)ro probes. ln cornparison to Lageraantz's

wo* results of the database search presented for yeast indicate that d(GT/CA)

is about 3 tintes more abundant Vian the d(CT1GA) simple sequence (Table 11 ).

Furthemore, d(AT/AT) is the most abundant type of microsatellite followed by

d(GT/CA), d(CT1GA) and d(GC/CG) respectively. In contrast to fungi, studies in

plants, (rapeseed, wheat and Norway spnice), show that d(CT/GA) is more

abundant than d(GT/CA) motifs (Lagercrantz et al. 1993).

Third, RFLP studies using (GT)* and (CTk probes showed the high

degree of polymorphism that exist in d(CT/GA) and d(CT/GA) motifs (Fig. 12).

Few are shared behiueen the isolates. If this high degree of polymorphisrn is

attributed to simple sequenœs, it suggests that BamHl sites are highly

polymorphic and that probing of genomic digests abundant interspersed

elements such as d(GT)s or d(CT)9 can be successful in demonstrating these

polymorphisms. Furtheme, the appearance of prominent hybridization bands

may indicate the presence of repetitive gene families of simple sequence motifs.

Similar data using simple sequences as probes in RFLP analysis was obtained

for the filamentous fungi Trichodema, Penicillium, Atxula, Candida, Phoma and

different species of Aspergillus (A. niger, A. furnigaius, A. temus, A flavus, A.

niduans) (Meyer el al. 1991, Lieadeldt et el. 1992). Results obtained by Meyer

(1 991 )and Lieckfeldt (1 992) also showed the usefulness of simple sequences in

RFLP studies to bnng more transparency into various taxonomic problems,

especially at the level of related species and strains.

Fourth, no previous research in the fbngi has demonstrated the use of

PCR-amplified microsatellite for strain identification. Although data obtained

from amplified microsatellites in other organisms show that these sequences are

useful as molewlar markers, no research has been conduded in fungi.

Al ignment of microsatell ite loci (GTI , GT2, CT1, CT2) in isoiates #2, #4, and #9

demonstrates that simple sequenœ arrays are hypervariable. However, many

isolates (#il #3, #5, #6, #7, #û) did not amplify these loci. The problem of

selective amplification among isolates #2, X4 and #9 can be attributed to

variation in sequences flanking the simple sequenœ motifs. In some instances

gaps and substitutions were noticed in the alignments in the loci studied (Fig.

23. 24, 25, and 26). Although these differences rnay have inhibited the primers

from amplifying a partiwlar locus (isolates 11, #3, #SI #6, #7, and #û, Fig. 20

and 21), attempts to Vary the annealing temperatures during PCR were not

successful to arnplify the microsatellite loci in these isolates. To assist in

understanding why only some of the isolates generated PCR products.

biochemical characteristics were compared among the isolates (Table 4).

lsolates #2, and #4 produœ imiprimine and transfomi sesquiterpene lactone

constunolide. but #1 produœs imiprimine too and does not generate a PCR-

amplified product. It would be interesting to know if isolate #9 shared any other

specific characteristic with #2 and #4. Although RFLP and RAPD analysis of

the isolates showed few common banding patterns, many similarities may have

grouped the three isolates vuhich amplified the simple sequenœ loci. It is

diffiwlt however, to asses an additional cornmon factor be-n the isolates

which may help explain the selective amplification of the simple sequenœ motifs

in isolates #2, #4, and #9.

The largest locus was a d(GTICA)* bp repeat in isolate #4 (Fig. 16).

Repeats of this sire are rare and none have previously been reported in fungi.

Furthemore, this locus proved to be the most polyrnorphic, with isolate #2

containing a d(GT/CA)s array and isolate #9 containing a

d(GTICA)28(NT)(OTICA). array. In the GT2 locus, the tnincation of a d(GT1CA)

array and the concomitant increase in an adjacent d(AGKC) dinucleotide repeat

in pAf2GT2 (Fig. 24) is observed. This type of apparent transformation of a

simple sequence into another has not previously been reported. Thus. simple

sequences may allow another type of variability, the conversion of one

microsatel lite to another,

In pdCT1 a d(CT/GA)17 bp array in isolate #4 was identified (Fig. 1 8).

This locus, as with pdGTl (Fig. 16), showed a similar degree of length

polymorphism. When the CT1 loci were aligned, isolate #2 the contained a

d(CTIGA)21 motif and isolate #9 a d(CT/GA),8 .

In contrast to the pure microsatellite motifs identified, a cryptic simple

sequenœ was also identified (isolate #4, Fig. 19). A CTiich array of dispersed

d(CTIGA) dinucleotieds was amplified in isolates #2, #4, #9 and the sequences

aligned. Little variation in length was observed, but a d(CTIGA)s array identified

in #2 wes reduœd to a d(CTIGAls in isolates #4 and #9 (Fig. 26).

Attempts were made to amplify the microsatellite motifs in other species of

Aspergillus. Using the primers developed in these studies, PCR readions w r e

conducted using DNA from A. temus ATCC 20542, and A. vemicofor ATCC

1 1730. No PCR produds were generated using DNA from these species of

Aspergillus. These results may indicate that the primers developed from isolate

#4 are specific for certain isolates of A. flavipes.

The reason for microsatellite sequenœ instability has remained a matter

of discussion. However, in vif10 studies have show that slipped-strand

mispairing of the newly replicated strand during the replication proœss may

result in a change in the number of tandem arrays (Tautr 1986), although no

example of this occurrence has been demonstrated in vivo for fungi. Results

shown here indicate that a DNA slippage event may have brought about an

increase and decrease in DNA simple sequence length. Furthemore, the

generation of different motifs may arise by the expansion of sequenœs flanking

certain motifs. As in the case we have illustrated, part of the d(GTICA) motif of

pAf2GT2 has been removed and an adjacent d(GA/CT) array has been

expanded (Fig. 24).

In summary, several polymorphic simple sequenœ regions have been

identified in the genome of A- flav@es #4, and these regions can be arnplified in

different isolates of A. flaijoes. DNA sequenœ analysis of the simple sequenœ

loci revealed different patterns of simple sequenœ. Alignment of sequenœs

from isolates #2, #4 and #9 showed that varying amounts of simple sequence

for each locus (GTl . GT2 or CTl ) was produœd (Fig. 23,24, and 25). These

studies show the potential of using microsatellite DNA sequenœs to identify

different isolates of A. flavipes.

CONCLUSIONS

The objective of this wwk was to identify hypervariable DNA sequences

in A s ~ l l u s flavipes and Pythium uitïmum. Hypervariable DNA sequences

were used to differentiate isolates of P. ultimum and A. flavipes- Emphasis was

given to microsatellite DNA as a source of hypervariable DNA and its use as a

molecular marker, Research also focused on the abundance, and distribution of

different types of microsatellite DNA present in the genomes of these fungi. In

addition to these studies, the RAPD (random amplified polymorphic DNA)

approach was utilized to dmerentiate isolates of A. flavi,pes.

Studies first focused on P. ultimum because a microsatellite motif had

been previously discovered (Belkhiri 1996) and many isolates of this fungus

were availabie. To detennine the abundance of d(GT1CA) and d(CT1GA)

microsatellite arrays, a genomic library w s wnstnicted and probed wi d(GT)g

and d(CTl9 oligonucleotides. Results from probing the genomic library (P.

ultimum 8R471) indicated that d(GT/CA) arrays w r e more abundant than

d(CT1GA) arrays. To detemine whether d(GT1CA) microsatellite motifs are

polymorphic a Iibrary clone which hybridized to the d(GT)g probe was subcloned

and sequenœd. The DNA sequenœ revealed a number of d(GT/CA) motifs.

with the largest being a d(GT/CA)ll. Oligonudeotides flanking the motifs m r e

synthesized and used as primen in the PCR (polymerase chain reaction)

reaction to amplify this array in different isolates of P. uitimum. This locus was

successfully amplifid in al1 25 isolates of P. ulümum. Different size PCR

produds wre obsewed for most isolates. In addition, the primen did not

generate PCR products from several other species. To detemine if the

d(CAIGT)rl locus was responsible for the generation of PCR products with

different sizes, several PCR products were cloned and sequenced. Alignment of

the sequenœs showed that PCR site differences resulted from changes in the

number of d(GT/CA) repeats in the d(GT/CA)t locus M i l e the regions flanking

this motif were unchanged. The significance of these studies is Wfold: (1 ) this

is the first method involving the use of microsatellite DNA sequences for

differentiating isolates of P. ullimum, (2) P. ultimum is an important plant

pathogen and the use of a species-specific markers can aid in detemination of a

causative infective agent.

Having established a method for the isolation and characterization of

microsatellite sequenœs in P- u/tÏmum, sirniIar studies w r e undertaken with A.

flavipes. However, first the RAPD (rapid amplified polymorphic DNA) technique

was tried because it had been shown to be a simple and inexpensive way to

generate polymorphisms as an aid in fingerprinting isolates of many organisms.

A. flavipes is a pharmaceutically important fungus capable of producing

numerous compounds, and also an important aid for studying metabolisrn of

various compounds (Elmarakby et al. 1987). At the present time no information

on the use of DNA markers is available for this fungus. The results generated by

the use of RAPDs showed unique profiles for each isolate. The procedure was

optimized and the variables studied in order to achieve reproducibility. Hovuever,

the conditions and methodology to generate specific RAPD profiles for each

isolate of A. ffaMpes were important factors in the successful application of Mis

technique. The studies presented show that the RAPD technique is an

inexpensive way to generate pol ymorphisms and the technique proved highl y

successful in differentiating al1 isolates of A. flevipes studied.

Although the RAPD method is promising, its use is not almys

successful, and as shown in this work, it requires stringent conditions for

reproducible results to be achieved, especially the temperature profile. PCR

amplified microsatellite loci on the other hand, have been show to be easily

reproduœd, and require less stringent conditions than RAPDs do. Furthemore.

microsatellite loci might be a more definitive source of polymorphisrns since they

involve the amplification of a specific locus which is highly variable (Weber

I W O ) . Wth this in mind we first detemined whether microsatellite motifs were

present in the genome of A. flavipes, and then set about to investigate if these

sequenœs are suitable as polymorphic markers for strain identification.

The abundance of d(GT1CA) and d(CT1GA) motifs was detemined.

Results show that d(GT/CA) arrays are more abundant Vian d(CT1GA) arrays.

The abundanœ of each of these motifs was also detemined for yeast from the

available complete genome sequenœ. These results also indicate that

d(GT1CA) arrays are more abundant than d(CTIGA) arrays. These results. in

conjundion with the data obtained from P. ulamum, show that d(GT1CA) motifs

are more abundant than d(CT/GA) motifs in these three species. However. in

yeast. the most abundant simple sequenœ w s d(TA/Al) and the least

abundant was d(GC/CG). Attempts to detennine the abundanœ of these latter

motifs in P. ultimum and A, flavipes w r e unsuccessful due to problems

associated with using d ( A n and d(GC)g probes.

To investigate the use of microsatellite DNA for differentiating isolates of

A. flavipes, four simple sequence loci were isolated fram strain #4 (ATCC

16795). T w loci containing d(GT/CA) motifs (GTl and GT2) and two loci

containing d(CT/GA) motifs (CT1 and CT2) were cloned and sequenœd.

Oligonucleotides flanking these motifs were synthesized and used as primen in

the PCR readion to amplify these loci in different isolates of A. flavipes (Table

4). Only an additional tvvo isolates (#2, and #9) together with #4 produced PCR

product. Each microsatellite locus was sequenced and aligned. Length

polymorphisms corresponding to simple sequence regions were obsewed in loci

GTI , GT2, and CT1. Of particular interest was the isolation of a d(GT/CA)a

motif (pdGT1, Fig. 16). This locus showed the greatest length variation among

the 4 loci discovered (GT1 ,GT2,CTl ,CT2). Another interesting observation was

the apparent conversion of a d(CT/GA) repeat into a d(CT/GA) repeat in isolate

#2 (pAf2GT2, Fig. 24). In addition to the pure unintempted microsatellite loci, a

cryptic simple sequence (locus CTZ) (pdCT2, F ig. 19) was isolated. This motif

showad little polymorphism M e n the sequenœ was aligned with that of isolates

#2 and #9 ( pAf2CT2, pAf4CT2, pAf9CT2, Fig. 26). The reg ions fianking al1 of

these loci w r e homologous. howver, and in some loci several gaps were

noticed. The presenœ of gaps flanking the microsatellite arrays in the other

isolates (#i ,#3, #5, #6, #7, #8) may be the reason M y these loci did not

produœ a PCR product.

The significance of these studies is twofold. First, very little information

conceming the use of simple sequence polymorphisms or abundance of simple

sequenœ loci is available for fungi. Second, identification and classification of

lower eukaryotes, as well as filamentous fungi, has proven to be very dificuit

M e n based exclusively on differences in rnorphology, growth characteristics or

biochemical markers. Especially in the case of imperfed fungi, the number of

useful phenotypic traits is finite. DNA fingerprinting methods used in this

research could be helpful tools in overcoming these problems.

Nearly all research in DNA fingerprinting œnten on the hurnan and

animal models and only more recently on plant and fungal systems. These

models are of primary economic interest, and they serve as examples for

investigation of ather eukaryotes. Microsatellite sequences. RAPD, RFLP, and

PCR based DNA fingerprinting techniques have only recently been employed in

DNA fingerprinting of lower eukaryotes such as fungi. Not only do these types

of fingerprinting techniques aid in differentiating isolates of a partiwlar

organism. they have also recently been used (microsatellite DNA fingerprinting),

to Klentify and assist in explaining the causative agent in many human genetic

diseases such as Fragile-X syndrome and Huntington's disease, which are

attributed to simple sequenœ instabilities (Caskey et al. 1 992). In conclusion,

the use of microsatellite DNA sequenœs to detemine abundanœ and as a

source of molewlar markers, extends ouf knowledge of important diagnostic

tools for strain identification in fungi. F utthemore, the presence, abundance,

and the polymorphic behaviour of simple sequences contributes to out cuvent

understanding of the organkation and qualities of the genomes of fungi.

Adachi, Y., H. Watanabe, K. Tanabe, N. Doke, S. Nishimura, and T. Tsuge. 1993. Nuclear ribosomal DNA as a probe for genetic variability in the Japanese pear pathotype of Alfernana alfernafa. Appl. Environ. Micro biol. 59: 3 1 97-3205.

Akkaya, M.S., A A Bhagwat, and P.C. Cregan. 1992. Length polymorphisms of simple sequence repeat DNA in soybean. Genetics 1 32: 1 1 31 -1 1 39.

Alexopolous, C. J., and C. W. Mirns. 1979. Subdivision Dipiornastigomycotina, class Oomycetes. ln lntroductory mycology. 3d ed. John Wiley, New York pp. 145-1 88.

Alicbusan. R-V., T. Ichaitani, and M. Takahashi. 1965. Ecologic and taxonomie studies on Pythium ultimum and other microorganisms in rhizosphere. Bull. Univ. Osaka. Pr& Ser. B. 16:59-64.

Alvarez-Garcia, L.A., and A Cortes-Monllor. 1971. CamRaca, a Pythium soft rot of Xanthosoma and Colocasia spp. in Puerto Rico. J. Agric. Univ. P. Rico 55: 78-84,

Anderson, P. A., and A J. Pryor. 1992. DNA restriction fragment length polymorphisms in the wheat stem nist fungus, Puccinia graminis tdiu.. Theor. Appl. Genet. 83:715-719.

Amour, J.A.L., 2. Wong, V. Wilson, N.J. Royle, and AJ. Jeffreys. 1989. Sequences flanking the repeat arrays of human minisatellites: association with tandem and dispened repeat elements. Nucl. Acids Res. 73:4925- 4935.

Amour, J.A L., S. Povey, S. Jererniah, and A J. Jeffreys. 1 990. Systematic cloning of human minisatellites from ordered wsmid libraries. Genomics 8:501-512.

Amour, J.A.L., M. Crosier, and AJ. Jeffreys. 1992. Human minisatellite alleles detectabls only after PCR amplification. Genomics 1 2: 1 16-1 24.

Aufauvre-Brown, A., J. Cohen, and D.W. Holden. 1992. Use of randornly ampiifid polymoiphic DNA markers to distinguish isolates of Aspergillus fumigatus. J. Clin. Microbiol. 30:2991-2993.

Bainier, G., and A Sartory. 191 1. Etude dune espece nouvelle de Sten;gmatocystr~~ Setigmatocysüs flavipes. Bull. Soc. Mycol. France 27: 90-97.

Ban, D.J. 1992. Evolution and kingdoms of organisms from the perspective of a mycologist Mycologia 84:l-11.

Beckmann, J.S., and J.L. Weber. 1992. Survey of human and rat microsatellites. Genomics l2:627-63f.

Belkhiri, A., 1996. Organization and evolution of ribosomal RNA gene families in the genes of P. ultimum. University of Manitoba. Ph-D Thesis. p. 127.

Belkum, A, G.V, Quint, B.E. DePauw, W.J.G. Melchers, and J.F. Meis- 1 993. Typing of Aspe@/lus species and Aspegil~us fumigatus isolates by interrepeat polymerase chain readion. J. Clin. Micro. 3 1 :2502-2505.

Bielenin, A, 2. Borecki, and D.F. Milikan. 1976. Identification of Pythium ulamum in the collar rot of apple. Phytopathology 66: 127-1 29.

Biewrth, S., G. Kahl, F. Weigand. and K Weising. 1992. Oligonucleotide fingerpfinting of plant and fwigal genomes: a cornparison of radioactive, wlorigenic and cherniluminescent detection methods. Eledrophoresis 1 3: 1 1 5-1 20.

Biosystems Reporter. 1996. Perkin Elmer Applied Biosystems Division. 27:6-7.

Blackburn, E. H., 1 991 . Structure and function of telomers. Nature 350569-573-

Blackburn, E.H., 1992. Telornerases. Annu. Rev. Biochem. 61 : 1 13-1 29.

BoenMnkle, E., W. Xiong, E. Fourest, and L. Chan. 1989. Rapid typing of tandemly repeated hypervariable loci by the polymerase chain readion: application to the apo-protein B 3hypewariable region. Proc. Natl. Acal. Sci. U.S.A. 86:212-216.

Borromeo, ES., R.J. Nelson. J.M. Bonman, and H. Leung. 1993. Genetic differentiation among isolates of Pyriculatia infecting rice and weed hosts, Phytopatholog y 53:393-399.

Bostod<. A., M.N. Khattak, R. MatViews, and J. Burnie. 1993. Comparison of PCR fingerprinting , by random amplification of polyrnorphic DNA, with other molecular typing methods of Candida albicans. JJ. Genet. Micmbiol. 139:2179-2184.

Braithwaite, KS. and J.M. Manners. 1 989. Human hypervariable minisatellite probes deted DNA polymorphisms in the fungus CoIJetotrichum gloeosponoide~~ Cun: Genet. 1 6:473-475.

Broun, P., and S.D. Tanksley. 1993. Characterization of tomato DNA clones with sequenœ similarity to human minisatellites 33.6 and 33.15. Plant Mol. Biol. 23:231-242.

Brown. J-KM., M. ODell, C.G. Simpson, and M.S. Wolfe. 1990. The use of DNA polymorphisms to test hypotheses about a population of Eysiphe graminis f. sp. ho- Plant Pathol. 39:391-401.

Brown, J-KM. AC. Jessop, and H.N. Rezanoor. 1991. Genetic unifomiity in barley and its powdery mildew pathogen. Proc. R. Soc. London B. 246:83- 90.

Buchko, J. 1996. Polymorphisms and heterogeneity of mitochondrial and ribosomal DNA in Pythium ultimum. Ph.D Thesis. University of Manitoba. Canada.

Bulat, S. A, and N.V. Mironenko. 1992 Polymorphisms of yeast-like fungus Aureobasidium pullulans (De Bary) revealed by universally primed polymerase chain reaction species divergence state. Genetica 28: 1 9-30.

Caetano-Anolles, G., 8.J. Bassam, and P.M. Gresshoff. 1991- DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. Biotechonology 91553.557.

Caetano-Anolles, G., B.J. Bassam, and P.M. Gresshoff. 1992. DNA fingerprinting-MAAPing out a RAPD redefinition. Biotechnology 10:937.

Caskey, C.T., A. Pizzuti, Y.H. Fu, R.G. Fenwïck, and D.L. Nelson. 1992. Triplet repeat mutations in human diseases. Science 256:784-789.

Cavalier-Smith. T. 1989. The kingdom Chromista. In the Chromophyte algae: problems and perspectives. Edited by J-C. Green, B.S.C. Leadbeater, and W.L. Diver. Systematics Assoc. Special Vol. No. 38. Clarendon Press, Oxford. pp. 381 -407.

Cejp, K. 1961. Fungus diseases of dahlias in Czechoslovakia. Ceska. Mykol. 1 5: 169-1 79.

C handley, AC., and AR. Mitchell. 1 988. Hypervariable minisatellite reg ions are sites for crossingover at meiosis in man. Cytogenet. Cell Genet. 48: 1 52- 1 55.

Clark, A. M., and C. D. HuRord. 1 978. Microbial transformations of the sesquiterpene ladone costunolide. J. C. S. Perkin 1 30223028.

Clarke, D.C., and M. Christensen. 1 980. The soi1 microfungal community of a South Dakota grassland. Can. J. Bot. 59: 1 950-1 960.

Collick, A, and AJ. Jeffreys. 1990. Detection of a novel minisatellite-specific DNA binding protein. Nucl. Acids Res. 18:625629.

Collick, A, MG. Dunn, and A J. Jeffreys. 1991. Minisatellite binding protein Msbpl is a sequenœ-specific single-stranded DNA-binding protein. Nucl. Acids Res, 19:6399-6404.

Condit, CM., and RB. Meagher. 1986. A gene encoding a novel gylcineiich stfudural protein of petunia. Nature 323: 1 78-1 84.

Cooper, CR., B.J. Breslin, D.M. Dixon, and I.F. Salkin. 1992. DNA typing of isolates associated with the 1988 sporotrichosis epidemic. J. Clin. Microbiol. 30:1631-1635.

Correll, J.C., 0.0. Rhoads, and J-C. Guerber. 1993. Examination of mitochondrial DNA restriction fragment length polymorphisms, DNA fingerprints, and randomiy amplified polyrnorphic DNA of Colletottichum orWcui'are. Pytopathology 83: 1 199-1 2O4.

Davis, P. J. and R. E. Talaat. 1981. Miwobiological systems in organic synthesis: Preparative-scale resolution of (R,S)-glaucine by Fusarium solani and stereospecific oxidation of R-(-)Claucine by Aspergillus flavipes. Appl. Environ. Miaobiol. 41 : 1243-1 247.

Debener, T., R. Salamini, and C. Gebhardt. l99O. Phylogeny of wild and wltivated Solanum species based on nuclear restriction fragment length polymorphisms (RFLPs). Theor. Appl. Genet. 79:360-368.

Dib, C., S. Faure, C. Fizames, D. Samson, N. Drouot, A Vignal, P. Millasseau, S. Marc, J. Hazan, E. Seboun, M. Lathrop, G. Gyapay, J. Morissette, and J. Weissenbach. 1996. A comprehensive genetic map of the human genome based on 5246 microsatellites. Nature 380: 1 52-1 54.

Di&, M.W. I W O . Keys to Pythiurn. M.W. Dia, Reading, UK pp. 144.

Dietrich, W., H. Katz, S.E. Lincoln, H A . Shin, J. Friedman, N.C. Dracopoli, and €.S. Lander. 1992. A genetic map of the mouse suitable for typing intraspeafic crosses. Genetics 1 31 1423447.

Doolittle, W.F., and C. Sapienza. 1980. Selfish genes, the phenotype paradigm and genome evolution. Nature 284:6Ol803.

Domsch, KH., W. Gams, and E. Weber. 1968. Der Einfiubverschiedener Vorfnichte auf das Bodenpilzspektmm in Weizenfelder. D. Pflranhr. Bodenk 1 1 9:134-149.

Doudrick, R.L., W.L. Naœ, CD. Nelson, G A Snow, and R.C. Hamelin. 1993. Detection of ONApolymorphisms in a single urediniospore-derived culture of Cronartium quercumm f. sp. fusfirme. Phytopathology 83:388392.

Dowling, T C , C. Mortiz, and J.O. Palmer. 1990. Nucleic acids II: restriction site analysis, in Molecular Systematics, Hillis, D.M. and Mortiz, C., Eds. Sinauer Associates, Sunderland. MA. pp. 25031 7.

Drenth, A, S.B. Goodwin, W.E. Fry, and L.C. Davidse. 1993. Genetic diversity of Phytophthora inf&sfans in the Netherlands revealed by DNA polyrnorphisms. Phytopathology 83: 1 087-1 092.

Durand, N., P. Raymond, and M. Fevre. 1993. Randomly amplified polyrnorphic DNAs assess rewmbination following an induœd parasexual cycle in Penicillium roquefodii. Curr. Genet. 24:417420.

Edwards, A, A Civitello, H.A Hammond, and C.T. Caskey. 1991. DNA typing and genetic mapping with tfimeric and tetrameric tandem repeats. Am J. Hum Genet. 49:746-756.

Elmarakby, S. A., F. S. El-Feraly, H. N. Elsohly, E. O. Croorn, and C. D. Hufford. 1 988. Microbiological transformations of artemisinic acid. Phytodiem. 2713089-3091.

Epplen, J.T., 1991. Oligonucleotide fingerprinting using simple repeat motifs: a convenient, ubiquitously applicable method to detect hypervariability for multiple purposes. DNA Fingerprinting: Approaches and Applications, Burke, T., Dolf, G., Jeffreys, A. J., and Wolff, R., Eds., Birkhauser, Basel, pp. 5049.

Epplen, C., G. Melmer, 1. Siedlaack, F.W. Schwaiger, W. Maueler, and J.T. Epplen. 1993. On the essence of "meaningless" simple repetitive DNA in eukaryote genomes. DNA fingerprinting: State of the Science, Pena, S.D.J., Charkaborty, R., Epplen, J.T., and Jeffreys, A J., Eds., Birkhauser, Basel, pp.2945.

Fabritius, AL., and R. Karajalainen. 1993. Variation in Hetembasidion annosum detected by random amplified polyrnorphic DNAs. Eur. J. For. Pathol. 23:193-200.

Falconer, D.S. 1 981. Introduction to Quantitative Genetics, Longman, New York,

Fennell, 0. I. 1 977. Aspergillus taxonomy in "Genetics and physiology of Aspergill~s.~." Smith J.L. Ed. Academic press London p. 1-21

Filani, C.A. 1975. The occurrence and prevention of root and stem rot of coffee seedlings in Nigeria. PI. Dis. Reptr. 59: 137-1 39.

Findlay, J.A and D. Kwan. 1972. Synthesis of a flavipucine reduction product. J. C. S. Perkin 1 2962-2074.

Foster, J. W. and E. O. Karow. 1944. Microbiological aspects of penicillin. J. Bact. 49: 1 9-29.

Fox, B.C., H.L.T. Mobley, and J-C. Wade. 1989. The use of a DNA probe for epidemiological studies of candidiasis in immunocomprimised hosts. J. Infect. Dis. 1 59:488-494.

Francis, D.M., and D - k St. Clair. 1993. Outcrossing in the hornothallic oomycete, Pyfhium ultimum detected 4 t h molecular markers. Curr. Genet. 24: 1 00-1 06.

Reeman, S., M. Pham, and R.J. Rodriguez 1993. Molecular genotyping of Colletotnchum species based on arbitrarily primed PCR, A+T rich DNA, and nuclear DNA analyses. Exp. Mywl. 1 7:309-322.

Garbelotto, M., T.D. Bruns, and F.W. Cobb. 1993. Differentiation of intersterility groups and geographic provenances among isolates of Heterobasidion annosum detected by random ampl ified pol ymorphic DNA assays. Can. J. Bot, 71 565.569.

Garber, R.C., and O. C, Yoder. 1983. Isolation of DNA ftom filamentous fungi and separation into nuclear, mitochondrial, ribosomal, and plasmid components. Anal. Biochem. 135:416422.

Gebhardt, C., C. Blomendahl, V. Schaditschabel, T. Debner, F. Salamini, and E. Ritter. 19û9. Identification of 2n breeding lines and 4n varieties of potato (Solanum tugerosum ssp. tubemsum) with RFLP-fingerprints. Theor. Appl. Genet. 78: 16-22.

Georges, M., k Gunawardana, D.W. Threadigill, M. Lathrop, 1. Alsaker, A Mishra, L.L. Sargeant, A Schoeberlein, M.R. Steele, C. Teny, D.S. Threadgill, X Zhao, T. Holm, R. Fries, and J.E. Womack. 1991. Characterization of a set of variable number of tandem repeat markers conserved in Bovidae- Genomics 1 1 24-33.

Gilmour, D.S., H.G. Thomas, and S.C.R. Elgin. 1989. Dmsophila nuclear proteins bind to region of altemating C and 1 residues in gene promoters. Science 245: 1487-1 490.

Gindrat, D. 1 976. Components in unbleached commercial chitin stimulate Fythium ultimum in sugar beet spemosphere. Phytopathology 66:312- 16.

Ginot, F., 1. Bordelais, S. Nguyen, B. Gyapay. 1996. Correction of some genotyping enors in automated fluorescent microsatellite analysis by enzyrnatic removal of one base overhangs. Nucl. Acids Res. 24540-541.

Girardin, H., J.P. Latge, T. Sn'kantha, B. MOKOW, and D.R. Soll. 1993. Development of DNA probes for fingerprinting Aspergillus fumigatus. J . Clin. Microbiol. 31 :1547-1554.

Glaser, R.L., G.H. Thomas, E. Siegfried, S.C.R. Elgin, and J.T. Lis. 1990. Optimal heat-induœd expression of the Drosophila hsp26 gene requires a promoter sequenœ containing (CT)J(GA). repeats. J. Mol. Biol. 22 1 :75 1 - 761.

Goodwin, P. H., and S. L. Annis. 1991. Rapid identification of genetic variation and pathotype of Leptosphaeria maculans by random amplified polymorphic DNA assay. Appl. Environ. Microbio f . 57:2482-2486.

Goodwin, P.H., B.C. Kirkpatirck, and J.M. Duniway. 1989. Cloned DNA probes for identification of Phytophthora parasitica. Phytopathology 79:716-721.

Grady, D.L., R - L Ratliff, D.L. Robinson, E.C. McCanlies, L. Meyne, and R.K Moyzis. 1992. Highly consend repetitive DNA sequences are present at human œntromeres. Proc. Natl. A d . Sci. U.S.A. 89: 1695-1 699.

Gray, I.C., and A. J. Jeffreys. 1991. Evolutionary transience of hypervariable minisatellites in man and the primates. Proc. R. Soc. London Ser. 6 2431241 -253.

Greaves, D.R., and R.D. Patient. 1985. (AT). is an intersperseci repeat in the Xenopus genome. EMBO J. 4:2617-2626.

Gross, D.S., and W.T. Garrard. 1986. The ubiquitous potential 2-foming sequenœ of eukaryotes, (dT-dG). (dC-dA).. is not detectable in the genomes of eubacteria, archaebacteria, or mitochondria. Mol. Cell. Biol. 61301 0-301 3.

Guthrie, P.AI., C.\N Magill, R.A Frederiksen, and G.N. Odvody. 1992. Random amplified polymorphic DNA markers: a system for identifying and differentiating isolates of Colletotnchum graminkola. P hytopatholog y 82~832-835.

Hamada, H., MG. Petrino, and T. Kakunaga. 1982. A novel repeated element with 2-DNA-foming potential is widely found in evolutionary diverse eukaryotic genome. Proc. Natl. Acad. Sci. U. S.A 79:64654469.

Hamada, H., M. Seidaman, B.H. Howard, and C.M. Gorman. 1984. Enhanced gene expression by the poly(dT4G) poly(dC-dA) sequenœ. Mol. Cell. B io l. 412622-2630.

Hamby, KR., and E.A. Zimmer. 1992. Ribosomal RNA as a phylogenetic tool in plant systematics. Molewlar Systematics in Plants. Soltis, P.S. Soltis, D.E. and Doyle, J.J. Eds. Chapman and Hall, New York, pp. 50-91.

Hamer, J-C., L. FanaIl, M.J. Orbach, B. Valent, and F.G. Chumley. 1989. Host species-specific consewation of a family of repeated DNA sequences in the genome of a fungal plant pathogen. Proc. Natl. Acad. Sci. US.A 8619981 -9985.

Hausner, G., G.G. Eyolfsdottir, J. Reid, and G. R. Klassen. 1992. TW additional species of the genus Tbgninia. Can. J. Bot. 70:124-134.

Heath, D.D., G.K Iwama, and R.H. Devlin. 1993. PCR primed with VNTR core sequences yields species specific patterns and hypervariable probes. Nucl. Acids Res. 21 :5782-5785.

Hegedus, D.D., and Û.G. Khachatourians. 1993. Construction of cloned DNA probes for the specific detection of the entomophathogenic fungus Beauvena bassMna in grasshopper. J. Invertebr. Pathol. 62:233-240.

Hellstein, J., H. WawterHugart, P. Fotos, J. Schmid, and D.R. Soll. 1993. Genetic similarity and phenotypic diversity of communal and pathogenic strains of Candida albicans isolates from the oral cavity. J. Clin. Microbiol. 31 :3190-3199.

Hendrix, F.F. Jr., and W.A Campbell. 1973. Pythium as plant pathogens. Annu. Rev. Phytopathology 1 1 :77-98.

Hillis, D M , k Larson, S-K Davis, and E.A Zimmer. 1990. Nucleic acids III: sequencing. Molewlar Systematics, Hillis, D.M. and Moritz, C. Eds. Sinauer Associates, Sunderland, MA. pp. 31 8-370.

Hintz, W.E., R.S. Jeng, M.M. Hubbes, and P-A Horgen. 1991. Identification of t hree populations of Ophiostoma ulmi (aggressive subgrou p) by mitocbondrial DNA restriction-site mapping and nuclear DNA fingerprinting. Exp. Mywl. 1 5:316-325.

Hoelzel, AR., and A. Green. 1992. Analysis of population-level variation by sequencing PCRsmplifieâ DNA, in Molecular Genetic Analysis of Populations: A practical approach. Hoelzel, A-R., Ed. IRL Press, Odord. pp. 159-1 88.

Hom, P., B. Richards, ICW. Klinger. I9W. Amplifications of a highly polymorphic VNTR segment by the polymerase chain reaction. Nucl. Acids Res. 17:2140.

Hufford, C.D., GA. Capiton, AM. Clark, and J.K Baker. 1980. Metabolism of imiprimine by microorganisms. J. Pham. Sci. 70: 1 51 -1 55.

Innis, M.A. D.H. Gelfand, J.J. Sninsky, and T.J. White, Eas. 1990. PCR Protocols, A Guide to Methods and Applications. Academic Press, San Diego.

Jacobsen, KM., O.K. Miller, and B. J. Turner. 1 993. Randomly amplified polymorphic DNA markers are superior to somatic incompatibility tests for discriminating genotypes in natural populations of the ectornycorrhizal fungus Suillus granulatus. froc. Natl. Acad. Sci. U.S.A. 90:9159-9163.

Jarman, A.P., and R.A. Wells. 1989. Hypervariable minisatellites: recombinators or innocent bystanders? TIGS. 5367-371.

Jeffreys, A J., V. Wilson, and S. L. Thein. 1 985a. Hypervariable "minisatell ite" regions in human DNA. Nature 314:67-73.

Jeffreys, AJ., V. Wilson, and S.L. Thein. 1985b. Indevidual-specific 'Yingerprints" of human DNA Nature 316:76-79

Jeffreys, AJ., V. Wilson, S.L. Thein, D. J. Weaaierall, and 8.A-J. Ponder. 1986. DNA 'Yingerprints" and segregation analysis of multiple markets in human pedigrees. Am. J. Hum. Genet. 39: 1 1-24.

Jeffreys, A J., N. J. Royle, V. Wilson. and Z Wong. 1 988a. Spontaneous mutation rates to new length alleles at tandem-repetitive hypervariable loci in human DNA Nature 332:278-281.

Jeffreys, AJ., V. Wilson, R. Neumann, and J. Keyte. 1988b. Amplification of human minisatellites by the polyrnerase chain reaction: towards DNA fingerprinting of single cells. Nucl. Acids Res. 16: 1 0053-1 0071 .

Jefireys, A J., R. Neumann, and V. Wilson 1990. Repeat unit sequence variation minisatellites: a novel source of DNA polymorphism for studying variation and mutation by single molecule analysis. Cell60:4734û5.

Jeffreys, k J., D.G. Monddon, K Tamaki, D.L. Neil, J.AL Amour, A. Macleod, A Collick, M. Allen, and M. Jobling. 1993. Minisatellite variant repeat mapping: application to DNA typing and mutation analysis. DNA Fingerprinting: Sate of the Science. Pena, S.D. J., Chakraborty, R., Epplen, J.T. and Jeffreys, kJ.. Eds. Birkhauser, Basel. pp. 125-139.

Johanson, A., and M.J. Jeger. 1 993. Use of PCR for detection of Mycosphaerella fiîensis and M. musimla, the causal agents of Sigatoka leaf spots in banana and plantain. Mywl. Res. 97:670674.

Johnson, T. W., Jr. 1 971 . Aquatic fungi of Iceland: biflagellate species. Acta. Nat. lslandica 23: 1 40.

Jones, M. J., and L.D. Dunkle. 1993. Analysis of Cochliobolus carbonum races by PCR amplification with arbitrary and gene-specific primers. Ph ytopathology 83366-370.

Julier, C., B. De Gouyon, M. Georges, J.L. Guenet, Y. Nakamura, and P. Avner. 1 990. Minisatellite linkage maps in the mouse by cross-hybridization wïth human probes containing tandem repeats. Proc. Natl. Acad. Sci. U.S.A- 87:45854589.

Kaemmer, O., J. Ramser, M. Schon, F. Weigand, M.C. Saxena, AJ. Diesel, G. Kahl, and K. Weising. 1992. DNA fingerprinting of fungal genomes: a case studey with A m h y t a rab&- DNA Polymorphisms in Eukaryotic Genomes. Kahl, O., Appelhans , H., Komph, J., and Driesel, AJ. Eds., Biotech-Forum 1 O, Adv. Mol. Genet. 5, Huthig Verlag, Heidelberg. pp. 255-270.

Kaslow, D.C. 1986. A rapid biochemical method for puming lambda DNA from phage lysates. Nucl. Acids Res. 14:6767.

Kaukinen, J., and S.L. Varvio. 1992. Artiodactyl retmtransposons: association with microsatellites and use in SINEmorph detection by PCR Nucl. Acids Res. 20:2955-2958.

Kelly, R., G. Bulfield, A Collick, M. Gibbs, and AJ. Jeffreys. 1989. Charaderkation of a highly unstable mouse minisatellite locus: evidence for somatic mutation during early development Genomics 5:844456.

Keller, N.P., T E Cleveland, and D. Bhatnagar. 1992. Variable electrophoretic karyotypes of memben of Aspergllus Section FIavi Curr. Genetics 21 1371 -375.

Kersulyte, O., J. Woods, E- Keath, W.€. Goldman, and D-E- Berg- 1992. D iversity among cl inical isolates of Histoplasma capsulatum detected by polymerase chain reaction with arbitrary primers. J. Bacteriol. 1 74:7075- 7097.

Khush, R-S., L. Morgan, E. Becker, and M. Wadi. 1991. Use of the polymerase chain reaction (PCR) in A. Bisponrs breeding programs. Genetics and Breeding of Agarîws, Van Griensven, L.J.L.D. Ed., Pudoc, Wageningen. pp. 73-80.

Kim, KJ., and T.J. Mabry. 1991. Phylogenetic and evolutionary implications of nuclear ri bosomal DNA variation in dwarf dandelions (Kngia, Lactuceae, Asteraceae). P. Syst. Evol. 177:53-69.

Kim, W. K, W. Mauthe, G. Hausner, and G. R. Klassen. 1990. lsolation of high molecular wight DNA and double stranded RNAs from fungi. Can. J. Bot- 68: 1 898-1 902.

Kistler, H.C., E.A Momol, and U. Benny. 1 991. Repetitive genomic sequences for determining relatedness among strains of Fusarium oxysporum. Phytopathology 81 :331-336.

Kohli, Y., R.A.A. Morrall, J.B. Anderson and L-M. Kohn. 1992. Local and trans- Canadian colonal distribution of Sclerotinia sderotio~um on canola. Phytopathology. 82:875880.

Kolchinsky, A., M. Kolesnikova, and E. Ananiev. 1991. "Portraying" of plant genomes using polymerase chain reaction amplification of ribosomal5S genes. Genme 34: lO28lO3l.

Kouyeas, H. 1977. Pjdhium species from Ireland. Scient Prm. R. Dublin Soc. Ser. A 6:3745.

Kuhls, K, A Batko, E. Lieckfeldt, W. Meyer, and T. Borner. 1992. DNA fingerprinting and PCR- two of the molecular methods used for identification and classification of the genus Penicillium. First European Conferenœ on Fungal Genetics, Nottingham, Aug. 20-23. Abstract Pll19.

Kunze, G., 1. Kunze, A Bamer, and R. Schulz 1993. Classification of Sacchammyœs cemvisae strains by genetical and biochemical methods. Monatsschr. Brauwissenschaft 4:i 32-1 36.

Kwan, H.S., S.W. Chiu, KM. Pang, and S.C. Cheng. 1992. Strain typing in Lentinula edodes by polymerase chain reaction. Exp. Mywl. 16:163- 166.

Lagercrantz. U., H. Ellegren, and L. Andersson. 1993. The abundance of various polymorphic microsatellite motifs df ien between plants and vertebrates. Nucl. Acids Res. 21 : 1 1 1 1 -1 1 1 5.

Leam, G. H., and B.A. Schaal. 1987. Population subdivision for ribosomal DNA repeat variants in Ckmatis fremontii. Evolution 41 :433438.

Ledbetter, S.A., D.L. Nelson, S.T. Warren, and D.H. Ledbetter. 1990. Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequenœ polymerase chain reaction. Genomics 614759481.

Levinson, G., and G A Gutman. l987a. Slipped-strand mispairing: a major mechanism for DNA sequenœ evolution. Mol. Biol. Evol. 4:203-221.

Levinson. G., and G A Gutman. 1 987b. High frequencies of short frameshifts in poly-CAITG tandem repeats borne by bacteriophage M l 3 in Eschenchia coli K-12. Nucl. Acids. Res. 1 55323-5338.

Lieckfeldt, E., K Kuhls, W. Meyer, and T. Borner. l992a. Detection of DNA polymorphisms in fungi by genomic and PCR fingerprinting, First European Conference on Fungal Genetics. Nottingham, Aug. 20-23. Abstract P l 108.

Lieckfeldt, E., W. Meyer, K. Kuhls, and T. Borner. 1992b. Characteriration of filamentous fungi and yeast by DNA fingerprinting and random amplified polyrnorphic DNA Belg. J. Bot. t25:226-233.

Lieckfeldt, E., W. Meyer, and T. Borner. 1993. Rapid identification and differentiation of yeast by DNA and PCR fingerprinting. J. Basic. Microbiol. 33:413-426.

Litt, M., and J.A Luty. 1989. A hypervariable microsatellite revealed by in vitro amplification of a dinudeotide repeat within the cardiac muscle actin gene. Am. J. Hum. Genet 44397401.

Loudon, KW., J.P. Bumie, AP. Coke. and R.C. Matthews. 1993. Application of polymerase chain reaction to fingerprinting A s ~ l l u s fumigatus by random amplification of polymorphic D N k J. Clin. Miaobiol. 30:1117- 1121.

Love,

Lu, Q

J.M., AM. Knight, M.A McAleer and J.A. Todd. 1990. Towards construction of high resolution map of the mouse genome using PCR- analyzed microsatellites. Nucl. Acids Res. l8:41234130.

, L.L Wallrath, H. Granok, and S.C.R. Elgin. 1993. (CT).(GA). repeats and heat shock elements have distinct roles in chromatin structure and transm-ptional activation of the Drosophùa hsp26 gene. Mol. Cell. Biol. 1 32802-281 4.

Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molewlar cloning: A faboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

Maniwrn, B.Q.. A Bar-Joseph, A. Rosner, H. Vigodsky-Haas, and J.M. Kotze. 1987. Potential applications of random DNA probes and restriction fragment length polymorphisms in the taxonomy of Fusath. P hytopathology 77:669472.

Martin, F. 1994. Meiotic instability of Pythium sylvaticum as demonstrated by inheritance of nuclear marken and karyotype analysis. Genetics 1 39: 1 233-1 246

May, B., 1992. Starch gel electrophoresis of allozymes. Molewlar Genetic Analysis of Populations: A practical approach. Hoelzel, AR., Ed. IRL Press, Oxford. pp. 1-27.

McCutdieon, T.L., and G.C. Carroll. 1993. Genotypic diversity in populations of a fungal endophyte from doug tas fir. Mycologia 85: 1 80-1 û6.

McDonald, B.A., and J.P. Martinez 1990. Restriction fragment length polymorphisms in Septona tMiu occur at a high frequenœy. Curr. Genet. 1 7: 1 33-1 38.

McDonald, BA, and J.P. Martinez 1991. DNA fingerprinting of the plant pathogenic fungus Mycusphaerella graminide (anamorph Septoriâ trita'. Exp. MYCOI. 1 5: 1 46-1 58.

McDonald, B.A. and J.M. McOemott 1993. Population genetics of pathogenic fungi. BioScience 43:311319.

McLauglin, J.H. 1 946. Vegetable seed treatrnent for Oklahoma. Bull. Okla. Agrïc. Exp. Stn. B 239:24.

Megnegneau, B., F. Debts, and F.F. Hoekstra. 1993. Genetic variability of DNA fingerprints in VKee species of Swan. Heredity 6473-80.

Meyer, M., A J. Shaw, and J. J. Doyle. 1 993. Anal ysis of genetic variation within and between population of Soopelophila cafaracfae using RAPDs and isozyme patterns. Am. J. Bot 80(Suppl.): 165.

Meyer, W., A Koch, C. Niemann, B. Beyemann, J.T. Epplen and T. Bomer. 1991. Differentiation of species and strains among filamentous fungi by DNA fingerprinting. Cun: Genet. 1 9:239-242.

Meyer, W., E. Lieckfeldt, T. Kayser, P. Numberg, J.T. Epplen, and T. Borner. 1992a. Fingerprinting fungal genomes with phage M l 3 DNA and oligonudeotide probes specific for simple repetitive DNA sequences. DNA Polymorphisms in Eukarytotic Genomes. Khal. G., Appelhans, H., Komph, J., and Driesel, M., Eds. Biotech-Forum 10, Adv Mol. Genet 5, Huthig Verlag, Heidelberg. pp. 241 -253.

Meyer, W., E. Lieckfeldt, J. Wostemeyer, and T. Bomer. 1 992b. Re- classification of some species of the Trichodema aggregate by RFLP- fingerprinting and arbitrarily prïmed PCR First European Conferenœ on Fungal Genetics. Nottingham. Aug . 20-23. Abstract P 1 /M.

Meyer, W., E. LiecMeldt, J. Wostermeyer, and T. Borner. 1992c. DNA fingerprinting for d flerentiating aggressivity groups of the rapeseed pathogen Leptosphaerïa maculans. Mycol. Res. 36:651857.

Meyer, W., E. Lieckfeldt, K Kuhls, E.Z. Reedaman, T. Bomer, and T.G. Mitchell. 1 993a. DNA- and PCR-fingerprinting (RAPD) in fungi. DNA fingerprinting: State of the Science, Pena. S.D.J., Chakraborty, R., Epplen, J.T., and Jeffreys, A.J. Eds., Birkhauser, Basel. pp. 31 1-320.

Meyer, W., TG. Mitchell, E.Z. Freedman, And R. Vilgalys. 1993b. Hybridization probes for conventional DNA fingerprinting can be used as single primen in the PCR to distinguish strains of Cryptoodccus neolbnnens. J. Clin. Microbiol. 31 2274-2280.

Miklos, G.L.G., KI. Matthaei, and KC. Reed. 1989. Occurrence of the (GATA), sequences in vertebrate and invertebrate genomes. Chromosoma 98:194-200.

Milgroom, M. G., S.E. Lipari, and W.A. Powll. 1992. DNA fingerprinting and analysis of population stucture in the chestnut blight fungus. C~yphonectria parasitica. Genetics 1 31 :297-306.

Miller, J.H. JE. Giddens, and A A Forster. 1 957. A Survey of fungi of forests and cu ltivated soils of Georg ia. Mycologia 49:779-808.

Milligan, B.G. 1 992. Plant DNA isolation. Molecular Genetic Analysis of Populations: A Practkal Approach, Hoelzel, AR., Ed., IRL Press, Oxford. pp. 59-88.

Mills, P.R.. S. Sreenivasaprasad, and A.E. Brown. 1992. Detedion and d ifferentiation of Co/Ietotrichum gloeosponoides isolates using P C R. FEMS Microbiol. Lett. 98: 1 37-1 44.

Miski, M., and P. J. Davis. 1988. Microbiologically catalyzed enantio- and diastereoselective oxidation of chrysanthemol stereoisomers to chrysanthernic acids. Appl. Enviro. Micro. 542268-2272-

Mitchell, T.G., E.Z. Freedman, W. Meyer, T.J. White, and J.W. Taylor. 1993. PCR identification of Cryptococcus neofinnans. Diagnostic Molewlar Microbiology. Persing, D.H., Tenover, F.C., Smith, TF., and White, T.J., Eds. Arnerican Society for Microbiology, Washington, DC. pp. 431 436.

Monastyrskii, O.A. D.N. Ruban, O.N. Tokarskaya, end AP. Ryskov. 1990. DNA fingerprinting of some Fusanum isolates differentiated toxicogenically, Genetika 26:374-377.

Moore, W.C., and W. Buddin. 1937. A new disease of tulip caused by species of Fythium. Ann. Appl. Biol. 24:752-761.

Morgante, M., and AM. Olivieri. 1993. PCR-amplified microsatellites as markers in plant genetics. Plant J. 3:175-182.

Murray, E. P., and W. F. Thompson. 1980. Rapid isolation of high moleailar weight DNA Nucl. Acids Res. 8:43214325.

Murray, V., C. Monchauvin, and P.R. England. 1993. The determination of the sequenœs present in the shadow bands of a dinucleotide repeat PCR. Nucl. Acids Res. 21 :2395-2398.

Nakamura, Y., C. Julier, R. Wolff, T. Holm, P. O'Connell, M. Leppeft, and R. White. 1987. Charaderkation of a human "midisatellite" sequenœ. Nucl- Acids Res. 1 5:2537-2547.

Nakamura, Y., M. Leppert, P. O'Connell, R. WoifF, T. Holm, M. Culver, C. Martin, E. Fujimoto, M. Hoff, E. Kumlin, and R. White. 1987. Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235:516-522.

Naylor, L.H., and E.M. Clark. 1990. d(TG). d(CA)" sequences upstream of the rat pmlactin gene fom Z-DNA and inhibit gene transcription. Nucl. Acids Res. 1 8: 1 595-1 601 .

Nienhuis, J., T. Helentjaris, M. Slocum, B. Ruggero, and A Schaefer. 1987. Restriction fragment length polymorphism analysis of loci associated with insect resistanœ in tomato. Crop Sci. 27:797-803.

Niesters. H.G.M., W.H.F. Goessens, J.F.M.G. Meis, and W.G.V. Quint 1993. Rapid, polymerase chain readion-based identification assays for Candida species. J. Clin. Microbiol. 31 :904-910.

Nybom, H., S. Gardiner, and C.J. Simon. 1992. RFLPs obtained from an rDNA probe and detected with enhanced chemiluminescenœ in apples. Sci. Hortic. 27: 355-356.

Opstelten, R.J.G., J.M.F. Clement, and F. Wanka. 1989. Direct repeats at nuclear matrix-associated DNA regions and their putative control fundion in the replicatirtg eukarytotic genome. C hromosoma 98:422427.

Orgel, L.E., and F.H.C. Crick 1980. Selfish DNA: the ultimate parasite. Nature 84:604-607.

Orr, H. T., M. Chung, S. Banfi, T. J. Kwiakowski Jr., A Servadio, A. L. Beaudet, A. E. McCall, L. A Duvick, L. R. W. Ranum, and H. Y. Zogbi. 1993. Expansion of an unstable Mnucleotide CAG repeat in spinocerebellar ataxia type 1. Nat. Genet. 4:221-226.

Palmer, J.D. 1 985. Comparative organization of chloroplast genomes. Annu. Rev. Genet, 1 9:325-354.

Pardue, ML., K. Lowenhaupt, A Rich, and A. Nordheim. 1987. (dC-dA)n-(dG4T). sequenœs have evolutionarily conserved chromosomal locations in Dmsophila with implications for roles in chromosome structure and function. EMBO J. 6: 1 781 .

Plaats-Niterink, AJ. Van der. 1975. Species of Pythium in the Netherlands. Neth. J. PI- Path. 81:22-37.

Plaats-Niterink, AJ. Van der. 1981. Monograph of the genus Pythium. Studies in Mycology, Centraalbureau voor Schimmelwltures, Baam. 21 : 1 -242.

Poole, R.F. 1934. Sweet potato ring rot caused by Pythium ultimum. Phytopathology 60:393-394.

Rajapakse. S., M. Hubbard, J.W. Kelly, AG. Abbott, and R.E. Ballard. 1992. Identification of rose cultivars by restriction fragment length polymorphism. Sci. Hortic. 52:237-245.

Raper, KB., and D.I. Fennell. 1965. Raper K.B., Fennell D.I., (eds). The Genus Aspergllus. The Williams and Wilkins Co., Baltimore.

Ravise, A, and B. Boccas. 1 969. Premeire liste annotee del Pythiaœes parasites des pantes wltivees au Congo. Cah. La Moke 7:4149.

Reeves, J.C., and S.F.L. Ball. 1 991. Preliminary results on the identification of Pyrenophora species using DNA polymorphisms amplified fonn arbitrary primers. Plant Vafieties Seeds 4: 1 85-1 89.

Richards, E.J., H.M. Goodman, and F.M. Ausubel. 1991. The œntromere reg ion of ArabidopsiS thalr'ana chrommosome 1 wntains telomere-similar sequences. Nucl. Acids Res. 1 9:335 1 -3357.

Richards, R.I., and GR. Sutherland. 1992. Dynamic mutations: a new class of mutations causing human disease. Cell. 70:709-712.

Rodriguez, R.J., and O C . Yoder. 1991. A family of conserved repetitive DNA elements for the fungal plant pathogen Gomerella angulaa (Colletotrichum lindemuthianum). Exp. Myw 1. 1 5:232-242.

Royle, N.J., RE. Carlson, Z Wong, and AJ. Jeffreys. 1988. Clustering of hypervariable minisatellites in the proteminal regions of human autosomes. Genomics 3:352-360.

Rippon. J.W. 1974. Medical Mycology. W.B. Saunders Co. Philadelphia. pp. 587.

Saghai-Maroof, MA, KM. Soliman, R.A Jorgensen, and R.W. Allard. 1984. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. U.S.A. 81 :8014-8018.

Saiki, R-K, D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Ham, KB. Mullis and H A Erlich. 1 988. Primer-directed enzymatic amplification of DNA wïth a thermostable DNA polymerase. Nature 239:487497.

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Second edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York

Scherer, S., and 0-A Stevens. 1988. A Candida albicans dispersed, repeated gene family and its epideomiologic applications. Proc. Natl. Acad. Sci. U-SA. 85:1452-1456.

Schlick, A, W. Meyer, E. Lieckfeldt, T. Borner, and K Messner. 1992. PCR, the method of choice for patent-strain-charaderization. First European Conference on Fungal Genetics. Nottingham. Aug. 20-23. Abstract P2f01.

Schlotterer, C., and O. Tau& 1992. Slippage synthesis of simple seuquence DNA Nucl. Acids Res. 20:211-215.

Schonian, G., O. Meusel, H.J. Tietr, W. Meyer, Y. Graser, 1. Tausch, W. Presber, and G.T. Mitchel 1. 1 993. Identification of clinical strains of Candida albicans by DNA fingerprinting with the polymerase chain reaction. Mycoses. 30: 1 71 -1 79.

Scott, W. W. 960. A study of some soil-inhabiting phywmycetes from Haiti. Virginia J. Sci. 239-24.

Senior, M.L., and M. Heun. 1993. Mapping maire microsatellites and polymerase chain reaction confirmation of the targeted repeats using a C l primer. Genome 36:883-889.

Sharrna, P.C., P. Winter, T. Bunger, B. Huttel, F. Weigand, K Weising, and G. Kahl. 1994. Abundance and polymorphisms of di, tri, and tetranucleotide tandem repeats in chickpea. Theor. Appl. Genet. 90:SO- 96.

Sierotzki, H., M. Eggenschwiler, J. McDermott, and C. Gessler. 1994. Specific virulence of isolates of Venturia inaequalis on "susceptible" apple cultivars. 1994. Nor. J. Agri. Sci. Supp. l7:83-93.

Skinner, D. M., W.G. Beattie, and F.R. Blattner. 1974. The repeat sequeme of a hennit vab satellite deoxyribonucfeic acid is (-T-A-GC-). x (-A-TG-C)n. Biochemistry 1 3:39303937.

Smeets, H.J.M., H.G. Bninner, H.H. Ropers, and B. Meringa. 1989. Use of variable simple sequenœ motifs as genetic markers: application to study of myotonic dystrophy. Hum. Genet 83:245-251.

Smith, M.L., J.N. Bruhn, and J.B. Anderson. 1992. The fungus Armillana buthsa is among the largest and oldest living organisrns. Nature 356:428-431.

Song, KM., T C Osbom, and P.H. Williams, 1988. Brassica taxonomy based on nuclear restriction fragment length polyrnorphisms (RFLP). Theor. App. Genet, 75:784-794.

Southem, E.M., 1975. Detection of specific sequences among DNA fragments separated by gel eledraphoresis. J. Mol. Biol- 98:503-517.

Spandidos, D A , and L. Holmes 1987. Transcriptional enhancer activity in the variable tandem repeat DNA sequenœ downstream of the human Ha-ras1 gene, FEBS Le& 21 8:41-46.

Sparrow, F.K 1976. The present status of classification of biflagellate fungi. In Reœnt advances in aquatic mywlogy. Edited by E.B.G. Jones. John Wiley, New York, pp. 21 3-222.

Sprague, R. 1942. Soybean diseases in western North Dakota. PI. Dis. Reptr. 26:382.

Stallingsl R.L., AF. Ford, O. Nelson, D.C. Tomey, C.E. Hildebrand, and R.K. Moyzis. 1 991 - Evolution and distribution of (GT), repetitive sequences in mammalian genornes. Genomics 10:807-815.

Stringer, S. L., S. Hong, O. Giuntoli, and J.S. Stringer, 1991. Repeated DNA in Pneumocystis carinii. J. Clin. Microbiol. 29: 1 1 94-1 201 .

Strongman, 0. B., and R.M. MacKay. 1 993. Discrimination between Hirsuella longi~l la var. longicolla and Himutella Iongrcdla var. cornuta using random amplified polyrnorphic DNA fingerprinting. Mycologia 85:65-70.

Sullivan, D., D. Bennett, M. Henman, P. Anmod, S. Flint, F. Mulchay, D. Shanley and D. Coleman. 1993. Oligonucleotide fingerprinting of isolates of Candida species other than C. albicans and atypical CandMa species form human immunodeficiency vims-positive and AIDS patients. J. Clin. Microbiol. 31 :2124-2133.

Swallow, DM., S. Gendler, B. Griffiths, G. Comey, J. Taylor-Papadimitriou, and M.E. BramwelI. 1987. The human tumour-associated epithelial mucins are coded by and expressed hypervariable gene locus PUM. Nature 328:82-64.

Tanksley, D.D., N.D. Young, AH. Paterson and M.W. Bonierbale. 1989. RÇLP mapping on plant breeding: new tools for an old science. Biotechnology 7:257-264.

Tautz, D. 1989. Hypervatiability of simple sequenœs as a general source for polymorphic DNA markers. Nucl, Acids Res. 17:6463-6471.

Tautz, D., and M. Renr 1984. Simple sequenœs are ubiquitous repetitive components of eukaryotic genornes. Nucl. Acids Res. l2:41274l38.

Tautz, D., M. Ti&, and GA- Dover. 1 986. Cryptic similarity in DNA is a major source of genetic variation. Nature 322652456.

Tegelstrom, H., 1992. Detedion of mitochondrial DNA fragments, in Molecular Genetic Analysis of Populations: A Practical Approach, Hoelzel, A.R., Ed., IRL Press, O>dord pp. 89-1 14.

Unkles, S.E., J.M. Duncan and J. R. Kinghom. 1992. Zincfingerprinting for Phytophthora species-DlF markers. Curt, Genet. 2231 7-31 8.

Vaartaja, O., and V.P. Agnihorti. 1969. Interaction of nutrients and four antifungal antibiotics in their effects on Pythium species in vitro and in soil. PI. Soil 30:49-61.

Vaartaja, O., and M. Bumbieris. 1964, Abundance of Pythium species in nursery soils in south Australia. Aust. J. Biol. Sci. 17:43645.

Vaillancourt, 1. J., and R. M. Hanau. 1 992. Genetic and morphological com pansons of Glomerella ( Colletottrihum) isolates from rnaize and from sorghum. Exp. Mycol. 16:219-229.

Van der Vugt-Berrnans, C. J.B., B.F. Brandwagt, J. W. Van'tKlooster, LAM. Wagemakers, and Van Kan J.AL. 1993. Genetic variation and segregation of DNA pdymorphisms in Bdrytis unema. Mycol. Res. 1 O: 1 193-1 200.

Vanna, A, and K J. Kwon-Chung. 1992. DNA probe typing of Cryptococcus neoamans. J. Clin. Microbiol. 30:296û-2967.

Vergnaud, G.. D. Mariat, F. Apiu. A Aurias, M. Lathrop, and V. Lauthisr. 1991. The use of synthetic tandem repeats to isolate new VNTR loci: doning of a human hypermutable sequence. Genomics 1 1 : 1 35-1 44.

Vogt, P., 1990. Potential genetic functions of tandem repeated DNA seuqenœ blocks in the human genorne are based on a highly consewed '%hromatin folding code". Hum. Genet. -336.

Wager, V.A 1931. Diseases of plants in South Afnca due to members of the Pythiaceae. Bull. Dep. Agnc. For. Un. S. Afr. 1 O5:1+3.

Wahls, W.P., L.J. Wallace, and P. D. Moore. 1 990. Hypervariable nimisatellite DNA is a hotspot for homologous rembination in human cells. Cell 60:95-103.

Wahls. W.P., G. Swenson, and P.D. Moore. 1991. Two hypervafiable minisatellite DNA binding proteins. Nucl. Acids Res. 1 9:32693274.

Wang, Y. H., S. Arnirhaeri, S. Kang, R 0. Wells. and J. O. Griffith. 1994. Preferential nucleosome assembly at DNA triplet repeats from the myotonic dystrophy gene. Science 265669471.

Walmsley, R.M., B. M. Wilkinson, and T.H. Kong. 1989. Geneticfingerprinting for yeasts. Biotechnology 7: 1 1 68-1 1 70.

Waterhouse, G.M. 1973. Peronosporales. In The Fungi. Vol WB. Edited by G.C. Ainsworth, F.K. Sparrow, and A S. Sussman. Academic Press. New York, pp. 165-1 83.

Weber, J.L. 1990. Infomiativeness of human (6-dA),, x (dG4T)n pol ymorphisms. Genomics 7:524-530.

Weber. J.L., and P.€. May. 1989. Abundant class of human DNA polymorphisms which can be typed using the polyrnerase chain reaction. A. J. Hum. Genet. 44:388-396.

Weihe, A, C. Niemann, L. Liecldeldt, W. Meyer, and T. Borner. 1990. An improved hybridization procedure for DNA fingerprïnting with bacteriophage Ml 3 as a probe. Fingerpn'nt News 2:9-10.

Weining, S., and P. Langridge. 1991. Identification and mapping of polyrnorphisms in cereals based on the polymerase chah reaction. Theor. Appl. Genet. 82:2O9-216.

Weising, K., and G. Kahl. 1990. Plant DNA fingerprinting with radioactive and digoxigenated oligonucleotide probes cornplementary to simple repetitive DNA sequenœs. Eledrophoresis 12:159-169.

Weising, K, D. Kaemmer, F. Weigand, J.T. Epplen, and G. Kahl. 1992. Oligonucleotide fingerprinting reveals various probe-dependent levels of inforrnativeness in aiickpea (Cicer aMnum). Genome 35:436-442.

Wells, R A , P. Green, and S.T. Reeders. 1989. Simultaneous genetic mapping of multiple human minisatellite sequences using DNA fingerprinting . Genomics 5:761-772.

Welsh. J.. and M. McClelland. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucl. Acids Res. 1 8:7213-7218.

Welsh, J., and M. McClelland. 1991. Genomic fingerprints produœd by PCR with consensus tRNA gene primers. Nucl. Acids Res. 19:861-866.

Wetton, J.H., R.E. Crter, D.T. Parkin, and D. Walter. 1987. Demographic study of a wild house spanow population by DNA fingerprinting. Nature 327: 1 47-1 49.

Whisson, S C , D.J. Maclean, J.M. Mamers, and J.AG. InMn. 1992. Genetic relatonships among Australian and North Arnerican isolates of Phytophthora megaspenna f. sp. glycinea assessed by muticopy DNA probes. P hytopahtology 82:863-868.

Wiley, B. J., and D. 1. Fennell. 1973. Asocarps of Aspe@lus tromatoides, A. niveus and A. flavipes. Mycolog ia 65752-760.

Wilkinson, B.M., L. Morris, D.J. Adams, E.G.V. Evans, C. J.N. Lacey and R.M. Walmsley. 1 992. A new, sensitive polynucleotide probe for distinguishing Candida albicans strains and its use with a computer assisted archiving and pattern cornparison system. J. Med. Vet. Mycol. 30: 123-1 31 .

Williams, J G K , AR. Kublik, KJ. Livak, J.A Rafalski, and S.V. Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucl. Acids Res. l8:62316235.

Williams, J.G.K, AR. Kublik, J.A. Rafalski, and S.V. Tingey. 1990. Genetic analysis with RAPD markers. More Gene Manipulations in Fungi. Bennett, J.W., and Lasure, L.L. Eds., Academic Press, San Diego pp. 4431 439.

Wolff, R., Y. Nakamura, S. Odelberg, R Shiang, R. White. 1991. Generation of varïability at UNTR loci in human DNA DNA Fingerprïnting: Approaches and Applications, Burke, T., Dolf, G., Jeffreys, A J. and Wolff, R., Eds. Birkhauser, Basel. pp. 20-38.

Wostemeyer, J., C. Schager, M. Kellner, and M. Weisfeld. 1992. DNA polymorphisms deteded by random primer dependent PCR as a powemil tool for molecular diagnostics of plant pathogenic fungi. In DNA Polymorphisms in Eukaryotic Genomes. Kahl, G.. Applenhans, H., Komph, J., and Driesel, AJ., Eds. Biotech-Forum 10, Adv. Mol. Genet. ., 5. Huthig Verlag, Heidelberg. pp.227-240.

Wright, J. M. 1 994. Mutation at VNTRs: Are minisatellites the evolutionary progeny of microsatel lites. Genorne 37: 345-347.

Wu, K-S., and S.D. Tanksley. 1 993. Abundance, polymorphism and genetic mapping of microsatellites in rice. Mol. Gen. Genet 241 225.235.

Wyss, P., and P. Bonfante. 1993. Amplification of genomic DNA of arbuscular mycorrhizal (AM) fungi by PCR using short arbitrary primers. Mycol. Res. 97:13Sl-l3S7.

Yamazaki, H., S. Nomoto, Y. Mishima, and R. Kominami. 1992. A 35-kOa protein binding to a cytosine-rich strand of hypervariable minisatellite DNA J. Biol. Chem. 26711231 1-12316.

Yee, HA, A-KC. Wong, J.H. Vande Sande, and J.B. Rattner. 1991. Identificaton of novel single-stranded d(TC)n binding proteins in several mamanlian species, Nucl. Acids Res. 1 9:949-953.

Yong, F.M., and B.J.B. Wood. 1974. Miaobiology and Biochemistry of Soy Sauce Fermentation. Adv. Appl. Microbiol. 17:525-536.

Yoon, C.-S., and D.A. Glawe. 1993. Association of random amplified pol ymorphic DNA marken with stromatal type in Hypoxy/on tmncatum sensu Miller. Mycologia 85369-380.

Yuen, GY., M.N. Sctiroth, AR. Weinhold, and J.G. Hancodc 1991. E m s of soi1 fumigation with methyl bromide and chloropicrin on root health and yield of strawberry. Plant Dis. 75Al6-420.

Yunis, J. J., and W.G. Yasmineh. 1 97 1. Heterazhromatin, satellite DNA, and cell hrnction. Science 1 74: 1200.

Zeh, D.W., C.A. May, M.A Cofftoth, and E. Bemiingham. 1993. Mbol and Macroaithica - quality of DNA fingerprints is strongly enzymedependent in an insect (Co/eoptera). Mol. Ecol. 2:61-63.

Zhao. X, and G. Kochert, 1993. Phylogenetic distribution and genetic mapping of a (GGC)" microsatellite from rice (Oryza sativa L.). Plant Mol. Biol. 21 :607-614.

Zischler, H., C. Kammerbauer, R. Studer, KH. Crreschik, and J.T. Epplen. 1992. Dissecting (CAC)d(GTG)5 multilows fingerprints from man into individual louis-specific, hypervariable components. Genomics 1 3:983-990.