ac vitari et al. nature 000 , 1-4 (2011) doi:10.1038/nature10005

1

AC Vitari et al. Nature 000, 1-4 (2011) doi:10.1038/nature10005 COP1 deficiency in prostatic epithelium causes hyperplasia, early MPIN, and enhances the effects of PTEN loss.

Upload: cai

Post on 15-Jan-2016

11 views

Category:

Documents

0 download

Report

Download

Tags:

Embed Size (px):

DESCRIPTION

COP1 deficiency in prostatic epithelium causes hyperplasia, early MPIN, and enhances the effects of PTEN loss. AC Vitari et al. Nature 000 , 1-4 (2011) doi:10.1038/nature10005. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: AC Vitari et al. Nature 000 , 1-4 (2011) doi:10.1038/nature10005

AC Vitari et al. Nature 000, 1-4 (2011) doi:10.1038/nature10005

COP1 deficiency in prostatic epithelium causes hyperplasia, early MPIN, and enhances the effects of PTEN loss.

GI Motility online (May 2006) | doi:10.1038/gimo6

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

doi:10.1038/nature12886 Neanderthal from the Altai

doi:10.1038/nature06481 LETTERS

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

doi:10.1038/nature05150 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo48

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Published in Nature Materials (2016) doi:10.1038/nmat4569

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Claudia Virginia Vitari | Le Città Invisibili

DOI: 10.1038/ncomms1280 molecular dynamics of single

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Claudia Virginia Vitari - CV · 2018-07-19 · Claudia Virginia Vitari - CV Claudia Virginia Vitari was born in Turin, Italy in 1978. She studied in Germany at Burg Giebichenstein,

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

GI Motility online (May 2006) | doi:10.1038/gimo31

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

17 September 2009 doi:10.1038/nature08355 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …