Abstract Some diploid strains of Saccharomyces cerev-isiae can grow both as a spherical yeast form and as a filamentous pseudohyphal form. Most yeasts capable offorming pseudohyphae possess a functional FLO8 gene.We show that disrupting the ACE2 transcription factor results in the production of pseudohyphae in a flo8-1 back-ground. Disrupting the CTS1 (chitinase) gene also pro-duces pseudohyphal growth in this background, but at a reduced level. Invasion of solid media by haploid and dip-loid cells is increased in ACE2 disruptions, but the diploidsadhere poorly to the agar. Σ1278b-derived strains, whichgenerally produce pseudohyphae, have about 30-fold lowerchitinase activity than other strains.

Key words Pseudohyphae · Chitin · Ace2 · Swi5 · Cts1

Introduction

Although initially suggested in the late 19th century, it isonly in the last 6 years that it has been demonstrated thatthe yeast Saccharomyces cerevisiae is a dimorphic organ-ism, which can undergo a developmental switch from uni-cellular round cells to a filamentous form (Gimeno et al.1992). Diploid cells when grown on solid medium depletedof nitrogen undergo a change in shape to elongated, ellip-soidal cells, which fail to separate after cell division. Thisresults in the formation of pseudohyphae, which are oftencapable of invading the solid agar medium (Kron et al.1994; Roberts and Fink 1994). The dimorphic switch hasbeen compared to filamentous growth in pathogenic fungi

(Shepherd et al. 1985). In the most common human patho-gen, Candida albicans, transition to a hyphal form has beenassociated with virulence, and may be required for the adherence or penetration of epithelial cells (Cutler 1991).Mutant strains which remain in the yeast form are aviru-lent in a mouse model (Lo et al. 1997).

Many genes involved in the regulation of the pseudo-hyphal transition in S. cerevisiae have been isolated. Mem-bers of the mating-signal transduction pathway (which include homologues of the mammalian MAP kinase pathway), such as Ste20p (PAK), Ste11p (MEKK), Ste7p(MEK) and the transcription factors Ste12p and Tec1p, arerequired for pseudohphal production and for haploid inva-sive growth (Liu et al. 1993; Roberts and Fink 1994; Gavrias et al. 1996; Madhani et al. 1997). A Ste12p homo-logue has been shown to be required in certain conditionsfor hyphal growth in C. albicans (Kohler and Fink 1996;Leberer et al. 1996). The transition in S. cerevisiae also re-quires the GTP-binding proteins Ras2p and Cdc42p, andassociated 14-3-3 proteins (Mösch et al. 1996; Roberts etal. 1997). Over-expression of the transcription factorPHD1 stimulates pseudohyphal growth (Gimeno and Fink1994), while an ancient duplicate, SOK2, inhibits theswitch (Ward et al.1995). A Phd1p/Sok2p homologue fromC. albicans (Efg1p) is also involved in regulating the pro-duction of hyphae (Stoldt et al. 1997). The Tup1 proteinacts as a repressor of filament production in C. albicansand is required for maximal production of pseudohyphaein S. cerevisiae (Braun and Johnson 1997). Targets of thesignalling pathways may include proteins involved in ni-trogen metabolism [Elm4p (Blacketer et al. 1994)], thoserequired for cell polarity and morphogenesis, and for budsite selection (Mösch and Fink 1997).

Many wild and some laboratory strains of S. cerevisiaeare capable of forming pseudohyphae, but others, includ-ing the standard S288C, cannot. In many cases this inabil-ity is due to a mutation in the FLO8 gene, a putative tran-scriptional regulator of FLO1 (Liu et al. 1996). FLO1 en-codes a cell-wall-associated protein and is associated withability of yeast cells to flocculate (Bony et al. 1997). TheFLO11 gene, which also encodes a cell-wall protein and is

Curr Genet (1998) 34: 183–191 © Springer-Verlag 1998

Received: 22 April / 15 June 1998

Lorraine King · Geraldine Butler

Ace2p, a regulator of CTS1 (chitinase) expression, affects pseudohyphal production in Saccharomyces cerevisiae

ORIGINAL PAPER

L. King · G. Butler (½)Department of Biochemistry, University College Dublin, Belfield, Dublin 4, Irelande-mail: gbutler@ucd.ieTel.: +353-1-7061583Fax: +353-1-2837211

Communicated by C. P. Hollenberg

required for pseudohyphal production, is not expressed inS288C (Lo and Dranginis 1998).

The yeast cell wall is responsible for the mechanicalstrength of the cell, yet it undergoes considerable changesthroughout the cell-division cycle and during mating, aswell as in the morphological switch to pseudohyphalgrowth (Klis 1994; Cid et al. 1995). The main componentsof the wall are mannoproteins and β-linked glucans, withchitin, a (1 → 4)-β-D-linked polymer of N-acetylglucos-amine, comprising about 1% of the total (Klis 1994; Cid et al. 1995). Chitin is predominantly found in the mothercell (Roncero et al. 1988) and is localized to the bud scar.It is synthesized by three different enzymes – CSI (encodedby CHS1), CSII (encoded by CHS2) and CSIII (includingthe products of CHS3,CHS4 and CHS5), reviewed in Cidet al. (1995). Transcription of CHS1, CHS2 and CHS3 isregulated in a cell-cycle-dependent manner (Pammer et al.1992). In contrast, there is only a single endochitinase inyeast, encoded by the CTS1 gene (Kuranda and Robbins1987, 1991). CTS1 expression varies throughout the cellcycle, with maximal accumulation of RNA during G1

(Dohrmann et al. 1992). Expression of CTS1 is regulatedby the Ace2p transcription factor, whose subcellular local-ization varies with the cell cycle (Dohrmann et al. 1992).Ace2p enters the nucleus in late M phase, and nuclear en-try is correlated with the expression of CTS1 (Dohrmannet al. 1992; O’Conalláin, Doolin, Taggart, Thornton andButler, submitted). Strains carrying mutations in eitherCTS1 or ACE2 have defects in cell separation, and displaya clumpy phenotype (Kuranda and Robbins 1991; Dohr-mann et al. 1992).

The Ace2 protein is homologous to Swi5p, a zinc-fin-ger protein that is required for transcription of the HO en-donuclease gene (Stillman et al. 1988; Butler and Thiele1991).While both Ace2p and Swi5p are required for max-imal expression of several genes, Ace2p alone regulatesthe expression of CTS1 (Dohrmann et al. 1992, 1996; Piatti et al. 1995; Toone et al. 1995; Bobola et al. 1996;Kovacech et al. 1996; Toyn et al.1997). We show here thatlaboratory strains of S. cerevisiae have varying levels ofexpression of the chitinase enzyme. Disrupting the ACE2gene has profound effects on colony morphology, and in-

184

Table 1 S. cerevisiae strains

Strain Genotype Background/reference

W303-1A MAT a, leu2, ura3, trp1, ade2, his3, flo8-1 W303W303-1B MAT α, leu2, ura3, trp1, ade2, his3, flo8-1 W303 W303-1 a/α, leu2/leu2, ura3/ura3, trp1/trp1, ade2/ade2, his3/his3, flo8-1/flo8-1 W303-1A×W303-1B LKY14 MAT a, leu2, ura3, trp1, ade2, his3,ace2::hisG::URA3, flo8-1 W303-1A/This workLKY15 MAT α, leu2, ura3, trp1, ade2, his3, ace2::hisG::URA3, flo8-1 W303-1B/This work LKY16 a/α, leu2/leu2, ura3/ura3, trp1/trp1, ade2/ade2, his3/his3,ace2::hisG::URA3/ LKY14×LKY15/This work

ace2::hisG::URA3, flo8-1/flo8-1L5684 MAT a, leu2, ura3-52, FLO8 Σ1278b L5487 MAT α, leu2, ura3-52, FLO8 Σ1278b L5791 a/α, leu2/leu2,ura3-52/ura3-52, FLO8/FLO8 Σ1278b LKY17 MAT a, leu2, ura3-52, FLO8,ace2::hisG::URA3 L5684 LKY18 MAT α, leu2, ura3-52, FLO8, ace2::hisG::URA3 L5487 LKY19 a/α, leu2/leu2, ura3-52/ura3-52, FLO8/FLO8,ace2::hisG::URA3/ace2::hisG::URA3 LKY17×LKY18/This work CG378 MAT a, ade5, canR, leu2-3, leu2-112, trp1-289, ura3-52, FLO8 Craig Giroux LKY13 MAT α, ade5, canR, leu2-3, leu2-112, trp1-289, ura3-52, FLO8 MAT α version of CG378/This work LKY104 MAT a, ade5, canR, leu2-3, leu2-112, trp1-289, ura3-52, FLO8, ace2::hisG::URA3 CG378/This work AGY11 a/α, ade5/ade5, canR/canR, leu2-3/leu2-3, leu2-12/leu2-12, trp1-289/trp1-289, CG378×LKY13/This work

ura3-52/ura3-52, FLO8/FLO8H9 MAT α, his6, leu2-3, leu2-112, ura3-52, flo8-1 Alan Hinnebusch LKY98 a/α, leu2-3/leu2-3, leu2-12/leu2-12,ura3-52/ura3-52, FLO8/flo8-1 CG378×H9/This work LKY1 MAT α, his6, leu2::CTS1-lacZ, ura3-52, ace1∆225, flo8-1 H9/This work LKY2 MAT a, his6, leu2::CTS1-lacZ, ura3-52, ace1∆225, flo8-1 MAT a version of LKY1/This work LKY3 a/α, his6/his6, leu2::CTS1-lacZ/leu2::CTS1-lacZ, ura3-52/ura3-52, LKY1×LKY2/This work

ace1∆225/ace1∆225, flo8-1/flo8-1LKY6 MAT α, his6, leu2::CTS1-lacZ, ura3-52,ace1∆225, flo8-1, ace2::hisG LKY1/This work LKY8 MAT a, his6, leu2::CTS1-lacZ, ura3-52, ace1∆225, flo8-1, ace2::hisG MAT a version of LKY6/This work LKY10 a/α, his6/his6, leu2::CTS1-lacZ/leu2::CTS1-lacZ, ura3-52/ura3-52, LKY6×LKY 8/This work

ace1∆225/ace1∆225, flo8-1/flo8-1, ace2::hisG/ace2::hisG LKY99 a/α, leu2-3/leu2-3, leu2-12/leu2-12, ura3-52/ura3-52, LKY104×LKY6

ace2::hisG::URA3/ace2::hisG, FLO8/flo8-1LKY110 MAT α, his6, leu2-3, leu2-112, ura3-52,ace1∆225, flo8-1, cts1::LEU2 H9 (DTY59,

Butler and Thiele, 1991)/This workLKY112 MAT a, his6, leu2-3, leu2-112, ura3-52, ace1∆225, flo8-1, cts1::LEU2 MAT a version of LKY110/Thiswork LKY114 a/α, his6/his6, leu2-3/leu2-3, leu2-112/leu2-112, ura3-52/ura3-52, LKY112×LKY110/This work

ace1∆225/ace1∆225, flo8-1/flo8-1, cts1::LEU2/cts1::LEU2LKY108 a/α, leu2/leu2, ura3-52/ura3-52, FLO8/flo8-1 H9×L5684/This work DTY87 MAT α, his6, leu2-3, leu2-112, ura3-52,ace1∆225, flo8-1, swi5::LEU2 H9 (DTY59, Butler and Thiele 1991) LKY120 MAT a, his6, leu2-3, leu2-112, ura3-52, ace1∆225, flo8-1, swi5::LEU2 MAT a, version of DTY87/This work LKY121 a/α, his6/his6,leu2-3/leu2-3, leu2-112/leu2-112, ura3-52/ura3-52, LKY120×DTY87

creases the production of pseudohyphae in some diploidscarrying a flo8-1 mutation. Haploid cells disrupted forACE2 also have an increased capability for invading solidagar media, while diploid cells invade nitrogen-depletedmedia but have a lower adherence.

Materials and methods

Yeast strains and media. All yeast strains used in this study are shownin Table 1.The ACE2 gene was disrupted using a construct contain-ing a hisG-URA3-hisG cassette at the BamHI site (a gift from D. Thiele, University of Michigan). The URA3 locus was removedby selection on 5-fluoroorotic acid in some strains, but was retainedin others, to remove the need to add uracil to the pseudohyphal plates.Disruptants were confirmed by PCR, using the oligonucleotide prim-ers HISG (5′ TGCTTGCTCTGTGCCATC 3′) derived from the hisG sequence, and OB-15 (5′ CGGTGTTAATACAATCA 3′) de-rived from ACE2. The expected construct gave a product of approx-imately 2.9 kb. The FLO8 status was also monitored by PCR, usingthe primers FLO1 (5′ AATTCATAGAATACAGATTG 3′), FLO2 (5′ TGTCCCAGAATATTTGCC 3′), FLO3 (5′ TGTCCCAGAA-TATTTGCT 3′) and FLO4 (5′ CAACAGCAGTTGCACCA 3′).FLO1 and FLO4 generate a 950-bp fragment in all backgrounds.FLO2 and FLO3 are identical except for the last nucleotide, C inFLO2, which corresponds to the wild-type sequence, and T in FLO3,which is derived from the flo8-1 mutation. A 600-bp fragment is produced from a FLO8 background using FLO1 and FLO2, and froma flo8-1 background using FLO1 and FLO3. To generate isogenic diploids, the mating type of haploid strains was switched using aGAL-HO plasmid (Herskowitz and Jensen 1991). The MAT statusof haploid and diploid cells was confirmed by PCR (Huxley et al.1990). The CTS1 locus was disrupted using a 5.5-kb BamHI/HindIIIfragment from pCT19 (Kuranda and Robbins 1991) which containsa LEU2 insert. Disruptants were confirmed by PCR, using the oligo-

nucleotide primers CTS1-1 (5′ TGGTTCGGTGCAGGATTC 3′) andLEU2-1 (5′ CTTGACCAACGTGGTCAC 3′). The disruptant pro-duces a fragment of 1 kb. The SWI5 gene was disrupted using a LEU2 insertion (from D. Stillman). Some strains carry a CTS1-lacZfusion construct integrated at the LEU2 locus (Dohrmann et al. 1996). SLAHD media was prepared as described (Gimeno et al.1992). Cell invasion was detected by observing colonies before andafter washing under a gentle stream of water, and rubbing with a glassspreader.

Chitin and chitinase assays. Chitin was isolated from 75–100 mg ofwashed cells essentially as described in Bulawa et al. (1986), and as-sayed as described in Reissig et al. (1955). Measurements were madefrom at least three independent experiments. Chitinase was general-ly measured from 10 or 20 µl of culture media from cells grown inYPD, with 40 or 80 µl of the fluorescent substrate 4-methylumbel-liferyl β-D-N,N′,N″-triacetylchitotrioside (Sigma) as described inKuranda and Robbins (1991). For Σ1278b (where noted in text) acrude protein extract was prepared from 1 ml of cells grown in syn-thetic media using glass beads, and 20 µl was assayed. The averageof 3–6 independent measurements was used. Protein concentrationswere determined using a standard protein assay (BioRad laborato-ries).

Photomicroscopy. Colonies were viewed through the bottom of a Petri dish using a Singer MSM microscope, and photographed usingIlford HP5 ISO 400, or Fuji Neopan Professional 400. Cells wereobserved and photographed with a Olympus BX microscope and aPM20 camera attachment.

Results

Disrupting the ACE2 gene increases the production of pseudohyphae

Cells carrying mutations in the chitinase structural gene(CTS1) or its associated transcription factor (ACE2) are de-fective in cell separation, and haploid cells form clumpsattached at the chitin septa (Fig. 1) (Kuranda and Robbins1991; Dohrmann et al. 1992). Because diploid cells bud ina bipolar manner, the presence of an ACE2 disruption re-sults in the production of long chains of cells (Fig. 1). Thisis reminiscent of the pseudohyphal structures produced bysome S. cerevisiae cells in response to low nitrogen con-ditions, although the cells are not elongated. We decidedto test the effect of ACE2 on the generation of pseudohy-phae. Diploid strains derived from the yeast backgroundmost commonly in use in the laboratory (H9, from AlanHinnebusch) do not produce pseudohyphae on low-nitro-gen media (Fig. 2A). Analysis by allele-specific PCR (seeMaterials and methods) showed that this strain carries aflo8-1 mutation, which prevents pseudohyphal productionin yeasts derived from S288C (Liu et al. 1996). However,when the ACE2 gene was disrupted in this background,long chains of cells emanating from diploid colonies wereproduced on low-nitrogen medium (Fig. 2B, C). Thesecells are elongated with a length-to-width ratio >2.0 (for20 cells measured) and therefore closely resemble pseudo-hyphae (Kron et al. 1994). We also examined the effect ofdisrupting ACE2 in other yeast backgrounds, includingW303, CG378 (Craig Giroux) and Σ1278b (Gimeno et al.1992). CG378 is derived from several crosses between

185

Fig. 1A–D Disrupting ace2 causes a defect in cell separation, lead-ing to the production of lines of attached cells in diploid strains. (A)LKY1 (H9, ACE2) (B) LKY6 (H9, ace2) (C) LKY3 (H9, ACE2/ACE2) (D) LKY10 (H9, ace2/ace2)

186

Fig. 2A–L Disrupting ace2 increases the production of pseudohy-phae. Diploid yeast strains were streaked on SLAHD media, and in-cubated at 30°C for 3 days before photography. Colonies were pho-tographed at 20× (A, B, D, I, J, K) or 4× (C, E, F, G, H) magnifica-tion. (A) LKY3 – no pseudohyphae are produced in a H9 background.(B, C) LKY10 ace2/ace2 disruption. (D, E) LKY114 cts1/cts1 disruption. (F) LKY121 swi5/swi5 disruption. (G) L5791

(Σ1278b background) (H) LKY19 ace2/ace2 disruption in a Σ1278bbackground. (I) AGY11 – no pseudohyphae are produced in a CG378background. (J) LKY98 (CG378×H9, ACE2/ACE2) (K) LKY99(CG378×H9, ace2/ace2) (L) L5791 (Σ1278b background,ACE2/ACE2) are streaked on the left hand side of the YPD plate, andLKY19 (Σ1278b background, ace2/ace2 disruption) on the right handside, showing the characteristic lustreless and “fuzzy” appearance

S288C and A364a backgrounds, but has the wild-typeFLO8 gene, as determined by PCR. W303 carries a flo8-1mutation, and does not form pseudohyphae (Liu et al.1996). The Σ1278b (FLO8) background is generally usedto demonstrate pseudohyphal production. Diploids formedfrom W303 or CG378 alone do not produce pseudohyphaein the presence or absence of a functional ACE2 gene(CG378 ACE2 is shown in Fig. 2 I), suggesting that thesestrains carry other defects. However, a diploid formed froma cross between CG378 and H9 does produce pseudohy-phae even in an ACE2 background. Disrupting ACE2 inthis background alters the shape of the colony, but not pseu-dohyphal growth (Fig. 2J, K). The effect in Σ1278b is dif-ficult to determine, as the strain easily undergoes transi-tion to the filamentous form with either a wild-type or adisrupted ACE2 gene. However, in an ACE2 disruptionbackground, all colonies on an agar plate are surroundedwith pseudohyphae, whereas this is not always true with awild-type ACE2 gene (Fig. 2G, H).

As Ace2p is the major regulator of CTS1 expression,the effect of disrupting the CTS1 gene was investigated.Figure 2D, E shows that disrupting CTS1 in a H9 back-ground also results in the production of pseudohyphae, butto a lesser degree than in the isogenic ACE2 disruptionstrains. Both ACE2 and its homologue SWI5 together reg-ulate the expression of a number of genes (see Introduc-tion). However, disrupting SWI5 has no obvious effect onpseudohyphal growth (Fig. 2F).

Disrupting the ACE2 gene in all strains almost com-pletely abolishes the production of chitinase (Table 2;Dohrmann et al. 1992), although remarkably there is nodetectable effect on the levels of chitin (Table 3). TheΣ1278b background has a 25–30-fold lower chitinase ac-tivity than H9 and W303, although diploids have a higheractivity than the corresponding haploids (Table 2). Totalchitin levels are also at least 70% higher in Σ1278b thanin H9 strains (Table 3). Σ1278b possesses a functionalACE2 gene, as a disruption results in an even further re-duction in chitinase activity in diploids and causes defectsin cell separation. The reduction in enzyme activity is adominant phenotype, as diploids derived from crossesbetween Σ1278b and H9 also have low activity (Table 2).

Disrupting the ACE2 gene also has dramatic effects oncolony morphology. The rugged and lustreless colonies de-scribed in ACE2 deletion diploids (Fujita et al. 1994) areparticularly obvious in Σ1278b-derived strains (Fig. 2L),but are also seen in an H9 background carrying either anACE2 or a CTS1 disruption (data not shown).

Disrupting ACE2 affects colony adherence

The production of pseudohyphae is associated with the ability of haploid cells to invade rich agar media (Kron et al. 1994) and diploid cells to invade low nitrogen media(Mösch and Fink 1997). We therefore examined the effectof disrupting ACE2 on cell invasion. Haploid cells derivedfrom the H9 background are not capable of invading YPDmedium, and are completely removed by rinsing the plates

under running water (Fig. 3A, E). Disrupting ACE2 im-proves cell invasion, as the agar is noticably disturbed.However, cells are not retained after washing (Fig. 3B, F).Haploid cells derived from Σ1278b are retained and clearlyinvade the agar (Fig. 3C, G). Disruption of ACE2 increasescell retention (Fig. 3D, H). The effect in diploid strains on low-nitrogen medium is however somewhat different.Again, diploid H9 cells do not invade the agar, and are com-pletely removed after washing (Fig. 3I, H). DisruptingACE2 apparently increases the ability of the cells to invade the media as the agar is clearly disrupted, but veryfew cells (and often none) are retained after washing(Fig. 3J, N). The Σ1278b-derived diploids with a functionalACE2 gene invade the agar and, although some of the col-ony is removed, the pseudohyphae are clearly retained af-ter washing (Fig. 3K, O). In the equivalent strains lackingACE2, the cells again invade (apparent from the distortionof the agar surface), but after washing they are easily re-moved from the pseudohyphal projections at the edge ofthe colony, and are retained only in the centre (Fig. 3L, P).

187

Table 2 Chitinase activities in different S. cerevisiae strains

Strain Background a Chitinase

nmol 4MU/h/ nmol 4 MU/h/D600

b µg×10 c

LKY2 H9 ACE2 30.36 ± 0.27 40.10 ± 3.00 LKY8 H9 ace2 1.34 ± 0.34 0.25 ± 0.06 LKY3 H9 ACE2/ACE2 33.86 ± 1.38 nd LKY10 H9 ace2/ace2 1.55 ± 0.18 nd L5684 Σ1278b ACE2 1.09 ± 0.27 1.90 ± 0.27 LKY17 Σ1278b ace2 0.29 ± 0.00 nd LKY18 Σ1278b ace2 nd 0.08 ± 0.02 L5791 Σ1278b ACE2/ACE2 6.08 ± 0.72 12.50 ± 0.42 LKY19 Σ1278b ace2/ace2 0.41 ± 0.09 0.02 ± 0.01 W303-1A W303 ACE2 25.12 ± 1.01 nd LKY14 W303 ace2 0.36 ± 0.02 nd W303-1 W303 ACE2/ACE2 30.18 ± 0.99 nd LKY16 W303 ace2/ace2 0.98 ± 0.22 nd LKY108 Σ1278b×H9 ACE2/ACE2 5.01 ± 0.53 nd

a The complete genotype is shown in Table 1. LKY17 and LKY18are equivalent, except for mating typeb Activities of secreted chitinase, from cells grown inYPD. The num-bers shown are the average of 3–6 individual measurements,with theassociated standard error. nd = not determined. 4 MU = 4-methyl-umbelliferonec Activities of internal chitinase, from cells grown in SC. Activitiesare generally much lower in SC media, and are multiplied by ten forcomparison

Table 3 Chitin levels are not altered in an ace2 disruption back-ground

Strain Background Chitin levelsµg chitin/100 mg cells a

L5684 Σ1278b ACE2 10.00 ± 0.69 LKY18 Σ1278b ace2 11.44 ± 0.66 LKY1 H9 ACE2 6.70 ± 0.59 LKY6 H9 ace2 6.15 ± 0.12

a The numbers shown are the average of three independent meas-urements with the associated standard error

188

Fig. 3A–P Disrupting ace2 affects cell invasion and adherence.The top panels (A–H) show haploid strains growing on YPD media,and the bottom (I–P) show diploid strains on SLAHD media. Plateswere incubated at 30°C for 3 days before photography at 20× mag-nification. In each case the bottom row of panels (E–H and M–P)show the colonies in (A–D) and (I–L) after washing the plates

under a stream of water. (A, E) LKY1 [H9, ACE2]. (B, F) LKY6[H9, ace2]. (C, G) L5487 [Σ1278b, ACE2]. (D, H) LKY18 [Σ1278b,ace2]. (I, M) LKY3 [H9, ACE2/ACE2]. (J, N) LKY10 [H9, ace2/ace2]. (K, O) L5791 [Σ1278b, ACE2/ACE2]. (L, P) LKY19 [Σ1278b,ace2/ace2]

Discussion

Mutations in CTS1 and its associated transcription factorACE2 cause defects in colony morphology (Fig. 2L) andin cell separation – the cells form clumps which are joinedat the chitin septa (Fig. 1; Kuranda and Robbins 1991;Dohrmann et al. 1992). In diploid strains these unsepar-ated cells form long chains (Fig. 1). Somewhat similarchains (though of elongated cells) are produced by certainyeast strains in response to nitrogen-limiting conditions.This dimorphic form (pseudohyphae) may enable the yeastto forage for nutrients (Kron 1997).

The S. cerevisiae H9 background predominantly usedin these experiments does not normally form pseudohy-phae, presumably because it carries a flo8-1 mutation. Theflo8-1 mutation is common in strains derived from S288C,and may have arisen from selection for non-flocculatingstrains (Kron 1997). Disrupting ACE2 in the H9 back-ground results in “jagged” colonies on all media, but pseu-dohyphal-like projections are clearly produced on low-ni-trogen medium (Fig. 2). In contrast, disrupting ACE2 inthe W303 (flo8-1) or CG378 (FLO8) backgrounds does notconfer the ability to produce pseudohyphae. It has alreadybeen noted that W303 carries mutations other than flo8-1which prevent growth in the filamentous form (Liu et al.1996). CG378, although it has a functional FLO8 gene, ap-parently also carries other recessive mutations since dip-loids formed from a cross between H9 and CG378 readilyproduce pseudohyphae in low-nitrogen media. We havehowever demonstrated that the inability to produce pseu-dohyphae in strains carrying a flo8-1 mutation can be com-pensated by disrupting ACE2 in at least some genetic back-grounds.

Disrupting CTS1 in H9-derived cells also results in theproduction of pseudohyphae, but to a lesser extent than theisogenic ACE2 disruption (Fig. 2E, C). To-date, CTS1 isthe only gene identified which is regulated by Ace2p alone(Dohrmann et al. 1992). Although both Ace2p and Swi5pare required for maximal expression of a number of genes,such as SIC1 (Toyn et al. 1997), EGT2 (Kovacech et al.1996), RME1 (Toone et al. 1995) and ASH1 (Bobola et al.1996), disrupting SWI5 has no effect on pseudohyphalgrowth (Fig. 2F). It is therefore likely that the role of ACE2in the production of pseudohyphae is effected both throughthe regulation of CTS1 and of other genes not yet identi-fied.

It is interesting that the Σ1278b-derived strains are nat-urally low in chitinase activity (Table 2). As many of theassays were conducted using culture media and only 50%of chitinase is secreted (Kuranda and Robbins 1991), it ispossible that this reduction is a defect in secretion, ratherthan in enzyme production. However, a low level of chit-inase activity is also detected using whole-cell extractsfrom Σ1278b yeasts grown in synthetic complete medium,when very little enzyme is secreted. It is unlikely that thiseffect is due to a loss-of-function mutation, as diploidsformed between Σ1278b and H9 also have low chitinaselevels (Table 2). Σ1278b is quite different from most la-

boratory strains, as the background includes a significantcontribution from a heterothallic commercial baking yeast,American Yeast Foam (Kron 1997). There may thereforebe other genetic differences in this background that are re-sponsible for the production of pseudohyphae. Althoughthe possession of a functional FLO8 gene is clearly impor-tant, it is not sufficient – providing FLO8 to W303-derivedstrains does not lead to pseudohyphal production (Liu et al. 1996). Lo and Dragenis (1998) have shown that afunctional FLO11 gene is also required for filamentousgrowth, and expression of FLO11 is detected in Σ1278band S. cerevisae var. diasticus, but not in S288C. Our ob-servation that chitinase activity is lower in Σ1278b strainsis evidence of another difference.

Disrupting ACE2 results in the decreased expression of chitinase in all backgrounds, but does not appreciablyincrease the level of chitin (Table 3). This has also been observed in a CTS1 deletion (Kuranda and Robbins 1991),suggesting that chitinase digestion simply reduces thechain length of chitin, but does not reduce the overallamount. The low level of chitinase production and the highchitin levels in Σ1278b may therefore reflect significantoverall differences in the cell-wall composition of thisstrain.

Pseudohyphal growth is associated with the ability ofhaploid cells to invade agar in rich medium (Roberts andFink 1994) and diploid cells to invade when starved for nitrogen (Mösch and Fink 1997). Many elements of the mitogen-activated protein kinase pathway which regulatemating in haploid cells are also required for pseudohyphalgrowth and invasion (Liu et al. 1993; Roberts and Fink1994). However, the latter two processes can be separated,and mutations have been isolated that affect each individ-ually (Mösch and Fink 1997). We have shown that disrupt-ing ACE2 affects both invasion and pseudohyphal growth.Disrupting SWI5 in the same background has no obviouseffect. Haploid cells invade YPD media to a varying de-gree – H9 ACE2 cells do not invade at all, while Σ1278bACE2 cells are only partially removed from the plate using a glass spreader and a gentle stream of water(Fig. 3E, G). Disrupting ACE2 leads to the perturbation ofthe agar when H9 cells are washed off, suggesting that cellshave invaded, while cell retention is increased in Σ1278bbackgrounds (Fig. 3F, H). Invasion in diploids may be reg-ulated by a somewhat different pathway. The Σ1278b andthe CG378×H9 backgrounds show a significant retentionof cells in solid nitrogen-depleted medium, and this isgreatly reduced in ACE2 disruptions (Σ1278b shown inFig. 3L, P). In all other backgrounds tested, disruptingACE2 causes an increased perturbation of the media, butlittle or no cells are retained (H9 results are shown inFig. 3J, N). A similar effect is seen with H9 cells carryinga CTS1 disruption (data not shown). The agar perturbationsuggests that invasion has taken place but that the cells adhere less well as they are washed from the surface. It isclear that disrupting ACE2 causes dramatic changes in col-ony morphology in diploid cells (Fig. 2L) and affects cell-wall composition in such a manner that adherence to othermaterial is reduced. As adherence is an important feature

189

in fungal pathogens of plants and animals, it is possiblethat drugs that inhibit chitinase activity [such as demeth-ylallosamidin (Sakuda et al. 1990)] may play a role in pre-venting infection.

Acknowledgements We are grateful to Craig Giroux, Gerry Fink,Phillips Robbins, David Stillman and Dennis Thiele for the provi-sion of strains and plasmids, and to Anne McGettrick for perform-ing the chitin assays. This work was supported by Forbairt and theWellcome Trust (038606/Z/93/Z).

References

Blacketer MJ, Madaule P, Myers AM (1994) The Saccharomyces cerevisiae mutation elm4-1 facilitates pseudohyphal differentia-tion and interacts with a deficiency in phosphoribosylpyrophos-phate synthase activity to cause constitutive pseudohyphalgrowth. Mol Cell Biol 14:4671–4681

Bobola N, Jansen R-P, Shin TH (1996) Asymmetric accumulation ofAsh1p in post-anaphase nuclei depends on a myosin and restrictsyeast mating-type switching to mother cells. Cell 84:699–709

Bony M, Thines-Sempoux D, Barre P, Blondin B (1997) Localiza-tion and cell surface anchoring of the Saccharomyces cerevisiaeflocculation protein Flo1p. J Bacteriol 179:4929–4936

Braun BR, Johnson AD (1997) Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science277:105–109

Bulawa CE, Slater M, Cabib E, Au-Young J, Sburlati A, Adair JrWL, Robbins PW (1986) The S. cerevisiae structural gene forchitin synthase is not required for chitin synthesis in vivo. Cell46:213–225

Butler G, Thiele DJ (1991) ACE2, an activator of yeast metalloth-ionein expression which is homologous to SWI5. Mol Cell Biol11:476–485

Cid VJ, Duran A, del Rey F, Snyder MP, Nombela C, Sanchez M(1995) Molecular basis of cell integrity and morphogenesis inSaccharomyces cerevisiae. Microbiol Rev 59:345–386

Cutler JE (1991) Positive virulence factors of Candida albicans. Annu Rev Microbiol 45:187–218

Dohrmann PR, Butler G, Tamai K, Dorland S, Greene JR, Thiele DJ,Stillman DJ (1992) Parallel pathways of gene regulation: homol-ogous regulators SWI5 and ACE2 differentially control transcrip-tion of HO and chitinase. Genes Dev 6:93–104

Dohrmann PR, Voth WP, Stillman DJ (1996) Role of negative regu-lation in promoter specificity of the homologous transcriptionalactivators Ace2p and Swi5p. Mol Cell Biol 16:1746–1758

Fujita A, Oka C, Arikawa Y, Katagi T, Tonouchi A, Kuhara S, Mis-umi Y (1994) A yeast gene necessary for bud-site selection en-codes a protein similar to insulin-degrading enzymes. Nature372:567–570

Gavrias V, Andrianopoulos A, Gimeno CJ, Timberlake WE (1996)Saccharomyces cerevisiae TEC1 is required for pseudohyphalgrowth. Mol Microbiol 19:1255–1263

Gimeno CJ, Fink GR (1994) Induction of pseudohyphal growth byover-expression of PHD1, a Saccharomyces cerevisiae gene re-lated to transcriptional regulators of fungal development. MolCell Biol 14:2100–2112

Gimeno CJ, Ljungdahl PO, Styles CA, Fink GR (1992) Unipolar celldivisions in the yeast S. cerevisiae lead to filamentous growth:regulation by starvation and RAS. Cell 68:1077–1090

Herskowitz I, Jensen RE (1991) Putting the HO gene to work: prac-tical uses for mating-type switching. In: Guthrie C, Fink GR (eds)Guide to yeast genetics and molecular biology. Academic Press,NewYork, pp 132–145

Huxley C, Green ED, Dunham I (1990) Rapid assessment of S. ce-revisiae mating type by PCR. Trends Genet 6:236

Klis FM (1994) Review: cell wall assembly in yeast. Yeast 10:851–869

Kohler JR, Fink GR (1996) Candida albicans strains heterozygousand homozygous for mutations in mitogen-activated protein ki-nase signalling components have defects in hyphal development.Proc Natl Acad Sci USA 93:13223–13228

Kovacech B, Nasmyth K, Schuster T (1996) EGT2 gene transcrip-tion is induced predominantly by Swi5 in Early G1. Mol Cell Biol16:3264–3274

Kron SJ (1997) Filamentous growth in budding yeast. Trends Mi-crobiol 5:450–454

Kron SJ, Styles CA, Fink GR (1994) Symmetric cell division in pseu-dohyphae of the yeast Saccharomyces cerevisiae. Mol Biol Cell5:1003–1022

Kuranda MJ, Robbins PW (1987) Cloning and heterologous expres-sion of glycosidase genes from Saccharomyces cerevisiae. ProcNatl Acad Sci USA 84:2585–2589

Kuranda MJ, Robbins PW (1991) Chitinase is required for cell sep-aration during growth of Saccharomyces cerevisiae. J Biol Chem266:19758–19767

Leberer E, Harcus D, Broadbent ID, Clark KL, Dignard D, Ziegel-bauer K, Schmidt A, Gow NA, Brown AJ, Thomas DY (1996) Sig-nal transduction through homologs of the Ste20p and Ste7p pro-tein kinases can trigger hyphal formation in the pathogenic fungusCandida albicans. Proc Natl Acad Sci USA 93:13217–13222

Liu H, Styles CA, Fink GR (1993) Elements of the yeast pheromoneresponse pathway required for filamentous growth of diploids.Science 262:1741–1744

Liu H, Styles CA, Fink GR (1996) Saccharomyces cerevisiae S288Chas a mutation in FLO8, a gene required for filamentous growth.Genetics 144:967–978

Lo HJ, Kohler JR, DiDomenico B, Loebenberg D, Cacciapuoti A,Fink GR (1997) Nonfilamentous C. albicans mutants are aviru-lent. Cell 90:939–949

Lo WS, Dranginis AM (1998) The cell-surface flocculin Flo11 is re-quired for pseudohyphae formation and invasion by Saccharo-myces cerevisiae. Mol Biol Cell 9:161–171

Madhani HD, Styles CA, Fink GR (1997) MAP kinases with distinctinhibitory functions impart signalling specificity during yeast differentiation. Cell 91:673–684

Mösch H-U, Fink GR (1997) Dissection of filamentous growth bytransposon mutagenesis in Saccharomyces cerevisiae. Genetics145:671–684

Mösch HU, Roberts RL, Fink GR (1996) Ras2 signals via the Cdc42/Ste20/MAPK module to induce filamentous growth in Saccha-romyces cerevisiae. Proc Natl Acad Sci USA 93:5352–5356

Pammer M, Briza P, Ellinger A, Schuster T, Stucka R, Feldman H,Breitenbach M (1992) DIT101(CSD2,CAL1), a cell cycle-regu-lated yeast gene required for synthesis of chitin in cell walls andchitosan in spore cells. Yeast 8:1089–1099

Piatti S, Lengauer C, Nasmyth K (1995) Cdc6 is an unstable protein-whose de novo synthesis in G1 is important for the onset of Sphase and for preventing a “reductional” anaphase in the buddingyeast Saccharomyces cerevisiae. EMBO J 14:3788–3799

Reissig JL, Strominger JL, Leloir LF (1955) A modified colorimet-ric method for the estimation of N-acetylaminosugars. J BiolChem 217:959–966

Roberts RL, Fink GR (1994) Elements of a single MAP kinase cas-cade in Saccharomyces cerevisiae mediate two developmentalprograms in the same cell type: mating and invasive growth.Genes Dev 8:2974–2985

Roberts RL, Mösch H-U, Fink GR (1997) 14-3-3 proteins are essen-tial for RAS/MAPK cascade signalling during pseudohyphal de-velopment in S. cerevisiae. Cell 89:1055–1065

Roncero C, Valdivieso MH, Ribas JC, Duran A (1988) Isolation andcharacterization of Saccharomyces cerevisiae mutants resistantto Calcofluor White. J Bacteriol 170:1945–1949

Sakuda S, Nishimoto Y, Ohi M, Watanabe M, Takayama S, Isogai A,Yamada Y (1990) Effects of demethylallosamidin, a potent yeastchitinase inhibitor, on the cell division of yeast. Agric Biol Chem54:1333–1335

Shepherd MG, Poulter RTM, Sullivan PA (1985) Candida albicans:biology, genetics, and pathogenicity. Annu Rev Microbiol 39:579–614

190

Stillman DJ, Bankier AT, Seddon A, Groenhout EG, Nasmyth KA(1988) Characterization of a transcription factor involved inmother cell-specific transcription of the yeast HO gene. EMBOJ 7:485–494

Stoldt VR, Sonneborn A, Leuker CE, Ernst JF (1997) Efg1p, an ess-ntial regulator of morphogenesis of the human pathogen Candi-da albicans, is a member of the conserved class of bHLH pro-teins regulating morphogenetic processes in fungi. EMBO J16:1982–1991

Toone WM, Johnson, AL, Banks GR, Toyn JH, Stuart D, WittenbergC, Johnston LH (1995) Rme1, a negative regulator of meiosis, isalso a positive activator of G1 cyclin gene expression. EMBO J14:5824–5832

Toyn JH, Johnson AL, Donovan JD, Toone WM, Johnston LH (1997)The Swi5 transcription factor of Saccharomyces cerevisiae has arole in exit from mitosis through induction of the cdk-inhibitorSic1 in telophase. Genetics 145:85–96

Ward MP, Gimeno CJ, Fink GR, Garrett S (1995) SOK2 may regu-late cyclic AMP-dependent protein-kinase stimulated growth andpseudohyphal development by repressing transcription. Mol CellBiol 15:6854–6863

191