Vol. 9, 1007-1014, December 1998 Cell Growth & Differentiation 1007

Activation of the Osteopontin Promoter by the OrphanNuclear Receptor Estrogen Receptor Related a�

Jean-Marc Vanacker,2 Cateline Delmarre,Xiaojia Guo,3 and Vincent LaudetCentre National de Ia Recherche Scientifique UMR 319, Instltut deBiologie de Lille, Institut Pasteur de Ulle, 59019 LilIe, France [C. D.];Centre National de Ia Recherche Scientifique UMR 49, Ecole NormaleSup#{233}rieurede Lyon, 69364 Lyon Cedex 07, France [J-M. V., V. LI;and Department of Biological Sciences, Rutgers University,Piscataway, New Jersey 08855-1059 [X. G.]

Abstract

Estrogen receptor related a (ERRa) is an orphannuclear receptor that is closely related to the estrogenreceptor. It is expressed in a variety of adult andembryonic tissues (in particular, at the onset ofossification), as well as in several osteoblastic celllines. ERRa acts as a site-specific, cell-specifictranscriptional activator. Here, we show that ERRatransactivates the promoter of the mouse osteopontin(OPN) gene, the product of which is a marker of thelate stages of osteoblastic differentiation. This effect iscell specific and is exerted through derivatives of theERRa response element. Overexpression of ERRa inthree different osteoblast-like cell lines results in anelevation of the amount of OPN-corresponding mRNA.Therefore, OPN is a target gene for ERRa, pointing tothe role of the latter in osteoblast differentiation.

IntroductionClassical nuclear receptors are transcription factors, the ac-tivities of which depend on the presence of hydrophobicligands, such as steroids, vitamin D, thyroid hormone, reti-noic acids, and others (1). Nearly all members of the super-

family of nuclear receptors share the same structural fea-tures. Two independent domains are particularly importantand conserved among the receptors. The DNA-binding do-main comprises two zinc fingers and is responsible for the

specific recognition of the target DNA element. The second

critical domain, located in the COOH-terminal part of theprotein, is dedicated to higand-binding activity and contains

a higand-dependent activation function (AF-2) in its extreme

Received 8/19/98; revised 9/29/98; accepted 10/19/98.The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 1 8 U.S.C. Section 1 734 solely to mdi-date this fact.1 This work was performed with the financial support of Centre Nationalde Ia Recherche Scientifique, Association pour Ia Recherche contre leCancer, and Institut Pasteur de Ulle.2 To whom requests for reprints should be addressed, at Centre Nationalde Ia Recherche Scientifique UMR 49, Ecole Normale Sup#{233}rieurede Lyon,46 all#{233}ed’Italie, 69364 Lyon Cedex 07, France. Phone: 33 (0) 4 72 72 8190; Fax: 33 (0) 4 72 72 86 86; E-mail: Jean-Marc.Vanacker@ens-lyon.fr.3 Present address: Department of Pharmacology, Cornell University Med-ical College, New York, NY 10028.

COOH-terminal part. In apparent contradiction to the above-mentioned definition, the superfamily of nuclear receptors

comprises a growing number of factors (the so-called “or-phan” receptors) for which no higand has yet been identifiedand that may act constitutively (i.e. , do not require any higandfor their activity; for review, see Ref. 2). Among the first

orphan receptors cloned, two were identified on the basis of

their sequence similarity to the ER,4 hence referred to as ERRreceptors (3). The expression pattern of ERRI3 (originallynamed ERR-2) is restricted to early embryogenesis (4, 5). Incontrast, ERRt (originally named ERR-i) is expressed during

fetal development in several tissues, including central nerv-ous system, heart, muscle, adipose tissue, and skin (6); atleast a part of this pattern is retained in the adult mouse (3, 7).

We have recently demonstrated the expression of ERRa atthe onset of ossification in the mouse embryo (8). ERRa-corresponding mRNA was also detected at a high level in

osteoblast-like cell lines of rat and human origin, as well as in

normal human bones. We and others (7-9) have shown thatERRa specifically binds to the sequence TCAAGGTCA, anelement bound by the SF-i orphan nuclear receptor (andhence referred to as SFRE; Ref. i 0). The SF-i receptor isimplicated in the regulation of the steroidogenesis cascadeand is essential to male sex determination (1 1). The tran-scriptional control exerted by ERRa seems versatile because

an absence of effect on a single copy of the SFRE has been

reported, together with a repression of retinoic acid induction(7). In previous work, we have demonstrated that transacti-vation through the SFRE is cell specific (8). In particular,ERRa exerts a transcriptional up-regulation in rat osteosar-coma cell line ROS 1 7/2.8. Moreover, the mOPN gene pro-moter is transactivated by ERRa in a dose-dependent man-ner in these cells.

OPN is a noncollagenous protein that has been detected ina variety of noncalcified tissues, such as kidney, skin, neu-roepithehial cells of the inner ear, placenta, and uterus (12).

OPN has also been detected in a variety of human carcino-mas (13). Nevertheless, OPN is most prominently producedby osteoblasts, and is excreted in the extracellular matrix,where it serves as a cell adhesion molecule and contributesto bone remodeling (for review, see Ref. 14). In this respect,OPN is considered a marker of the late stages of osteoblasticdifferentiation (1 5). In addition to its regulation by tumor-

promoting agents, OPN mRNA level has been reported to beregulated by sex steroids, dexamethasone, and vitamin D

(16, 17).

4 The abbreviations used are: ER, estrogen receptor; ERR, ER related;SF-l , steroidogenic factor 1; SFRE, SF-i responsive element; OPN, os-teopontin; mOPN, mouse OPN; EMSA, electrophoresis mobility shift as-say; TFIID, transcription factor lID; E2, estradiol.

A

6

B

5

4C0

U

a

V

3.

Molar excessact. I rep.

El’� 0,5#{149}1

_ 2

.

9-

g 6-

a

Ua

V

3-

1-

2

Cell line R0617/2.8 HEK293 NB-E

Molar excessact. I rep.

El’� 5. 10

ririReporter mCR#{176}�1 pSFFEx3-luc

SF-i in HEK293 cells

1008 Osteopontin and ERR�

Fig. 1 . ERRa is a cell-specificactivator of the OPN promoter. A,effect of ERRa on the OPN pro-motor. The indicated cell lineswere cotransfected with 0.1 p.g ofwild-type OPN-luc plasmid andthe indicated molar excess ofpSG5-ERRa. B, transcriptional of-fects of SF-i . HEK 293 cells werecotransfected with the indicatedconstruct containing the luciferasereporter gene and the indicatedmolar excess of pJ3f�-SF1. InbothA and B, wild-type pSG5 wasadded up to a total 1 �g of DNA.Columns, fold activation over thereporter activity without transacti-vator, representing the average ofthree independent experiments;bats, SD.

Here, we show that stimulation of the OPN promoter by

ERRa is cell specific. ERRa response is mediated by two

SFRE-like sites of in equal contribution. Moreover, one site is

sufficient to confer ERRz inducibility to a heterologous pro-

moter. Furthermore, transient overexpression of ERRcW in

various osteoblast-like cell lines results in up-regulation of

the endogenous OPN promoter. Together, these results de-

fine OPN as a positive target gene of ERRa and point to the

role of this orphan nuclear receptor in osteoblast differenti-

ation.

ResultsERRa Binds to and Activates the OPN Promoter. We

have shown previously that the orphan nuclear receptor

ERRa acts as a cell-specific transcriptional activator of the

SFRE site (8). Moreover, ERRa transactivates the mOPN

promoter in rat osteoblastic cell line ROS 1 7/2.8 cells. Given

these features, and with the aim of further investigating the

effect of ERRa on the mOPN promoter, we performed tran-

sient transfection experiments in various cell lines. As shown

in Fig. 1A, mouse ERRa exerted a dose-dependent activa-

tion of the mOPN promoter driving the luciferase (Luc) re-

porter gene. This effect could be observed not only in ROS17/2.8 but also in human kidney cells HEK 293. In contrast,

human embryonic fibroblasts NB-E did not support ERRe-

driven positive effect on the mOPN promoter. However, this

nuclear receptor is, indeed, expressed upon transient co-

transfection is NB-E cells (8). Moreover, as we have shown,

these cells support ERRa-induced transactivation via a con-

sensus SFRE site. These results suggest that ERRa is a

promoter-specific, cell-specific transactivator.

Given that ERRx and SF-i exert transactivation through

the same DNA element (SFRE; Ref. 1 0), we evaluated the

transcriptional effect of the latter receptor on the mOPN

promoter by cotransfection of HEK 293 cells. As shown in

Fig. 18, SF-i was totally inactive on the mOPN promoter. In

contrast, SF-i transactivated the expression driven by pS-

FREx3-luc (containing a trimer of consensus SFRE in front of

the minimal SV4O promoter) in these cells. This demonstrates

that mOPN promoter transactivation is not a general feature

of SFRE-binding receptors but is rather ERRe specific.

A computer-assisted analysis of the mOPN promoter pre-

dicts the existence of seven SFRE-related sequences on this

promoter, each comprising one or two mutations relative to

the consensus SFRE (see sequences on Fig. 3.4). To identify

the sequence(s) responsible for the ERRe induction, we used

the deletion mutants of the mOPN promoter (18) depicted in

Fig. 2A. Cotransfection of ROS 1 7/2.8 cells with these con-

structs, together with varying amounts of ERRa encoding

plasmid, were performed. As shown in Fig. 2B, deletion of

the first 107 nucleotides (construct p�670-luc) impaired the

transactivating effect of ERRa observed on the original con-

struct (pi�777-Iuc). Further deletion of the mOPN promoter

did not restore the response to the receptor. The extreme 5’

end of construct pz�777-luc, thus, contains sequences criti-

cal for the induction by ERRa.We then tested the binding of ERRe to the individual

putative SFREs present on the mOPN promoter. To this end,we performed competition EMSAs (Fig. 3B) in which in vitro

translated ERRa protein was allowed to bind to the radioac-

tive consensus SFRE. Unlabeled ohigonucleotides wereadded to the reaction mixture. As a control, ERRa binding

S1S2 S3 S4 S5 S6 S7

.. p� p #{149}

p� p S

p � p #{149}

p #{149} r’oti�:. r”eL�I

Ap�777Iuc

pA67Oluc

p�600luc

pM72Iuc

p�352luc

p�\258luc

B

0

>

(1

V

ROS 17/2.8 cells5

4

3

2

Molar excess

act. I rep.

�

-5

_ 10

Fig. 2. Effect of ERRa on deletion mutants of the OPN promoter. A,schematic representation of the deletion constructs used in the experi-ment. Numbering of the deletion mutants corresponds to the extent of 5’sequence retained (relative to the transcription start site). Putative SFREsare abbreviated (S1-S7). #{149},right-oriented putative SFREs. Note that 54contains two overiapping SFREs. 0, left-oriented putative SFREs. Arrows,transcription start sites of the promoters. Sequences of the SFREs aregiven in Fig. 3A. B, cotransfection experiment. ROS 17/2.8 cells werecotransfected with 0.1 �g of the indicated OPN-reporter plasmid and theindicated molar excess of pSG5-ERRa. Columns, fold activation over theindividual OPN activity without transactivator, representing the average ofthree independent experiments; bars, SD.

Cell Growth & Differentiation

irhriiReporter pz�777 pz�670 p�\600 pM72 p�352 p�\258

luc luc luc luc luc luc

was competed out by a homologous consensus oligonucleo-tide (CSFRE) but not by an unrelated one (unr). Using OPN-

SFREs as competitors (sequences given in Fig. 3A), we ob-served that SFRE 1 and, to a weaker extent, SFRE 2 inhibitedthe binding of ERRa to cSFRE. None of the other putative

SFREs (including each of the overlapping SFREs containedin SFRE 4) appeared to exert any competition. This indicates

that ERRa binds to the mOPN promoter via SFRE 1 and 2.

SFRE I Is Necessary to the Activation by ERRa. Todetermine whether SFRE 1 and/or 2 are necessary to the

induction of the mOPN promoter by ERRa, we disrupted

each (or both) of the two sequences in the mOPN promotercontext. We designed oligonucleotides containing mutant

versions of SFRE 1 or SFRE 2 (51 m and S2m, respectively;sequences given in Fig. 4A). The inability of these sequences

to bind ERRe was first checked by competition EMSA. In

vitro translated ERRa was allowed to bind on radioactive

consensus SFRE, and unlabeled oligonucleotides were

added as competitors. Compared to control (cSFRE), oligo-

nucleotides Si m and S2m were unable to inhibit the binding

of ERRa to the SFRE (Fig. 4B).

The mutations comprised in the Sim and S2m oligonu-

cleotides were then individually introduced by PCR into

p�777-luc construct, giving rise to plasmids pSi m-luc and

pS2m-luc, respectively (schematized in Fig. 4C). A combi-

nation of these two mutations was also generated, giving rise

to plasmid pSi mS2m-luc. The complete amplification prod-ucts were sequenced to verify the absence of randomly

introduced mutation by Taq polymerase. After subcloning in

pGL2 basic plasmid, each construct was cotransfected in

ROS 17/2.8 cells with varying amounts of ERRa-encoding

plasmid (Fig. 4D). As a control, plasmid p�777-luc positively

responded to ERRa. In contrast, pS2m-luc showed a marked

reduction in the level of ERRa-induced transactivation rela-

tive to the one achieved with p�777-luc. pSi m-Iuc was

totally unresponsive to ERRa. Consistently, the double mu-

tation present in plasmid pSi mS2m-luc resulted in complete

loss of ERRa-driven transcriptional enhancement. This mdi-cates that SFRE 1 is necessary to mOPN promoter induction

by ERRa. In the wild-type promoter, SFRE 2 may contribute

to this effect, but to a weaker extent.

SFRE I Is Sufficient to Confer ERRa Response. Having

shown that SFRE 1 and SFRE 2 contribute to the maximal

induction of the mOPN promoter by ERRa, we analyzed

whether they are also sufficient. To this end, SFRE 1- and

SFRE 2-containing oligonucleotides were cloned as trimers

in front of the SV4O minimal promoter contained in plasmid

pGL2-PRM, giving rise to plasmids pSlx3-luc and pS2x3-

luc, respectively (schematized in Fig. 5A; cloned sequences

given in “Materials and Methods”). After sequencing, these

constructs or pSFREx3-luc (containing the consensus SFRE

cloned in the same vector) were cotransfected into ROS

1 7/2.8 cells, together with varying amounts of ERRa-encod-

ing plasmid. As shown in Fig. 5B, reporter expression from

pSix3-luc was stimulated by ERRa in a dose-dependent

manner. Nevertheless, the transactivation level achieved

with this construct was lower than that displayed by

pSFREx3-luc. In contrast, pS2x3-luc only supported a mar-

ginal (if any) ERRa-induced enhancement of expression.

These results, consistent with the binding data, demonstratethat SFRE 1 but not SFRE 2 is also sufficient to confer ERRa

responsiveness to a heterologous promoter.

Stimulation of the Endogenous OPN Expression. Wenext assayed the response of the endogenous OPN pro-moter to transient overexpression of ERRa in osteoblast-like

cell lines. To this end, UMR, ROS 17/2.8 rat, or MC3T3

mouse cells were transiently transfected with pSG5-ERRa or

pSG5 alone. After 40 h, RNAs were extracted, retrotrans-cribed, and subjected to semiquantitative PCR with specific

oligonucleotides. The result of such an experiment is pro-

sented in Fig. 6. The transient expression of ERRa was

verified and is displayed (Fig. 6, left). This also indicates thatROS 1 7/2.8 and MC3T3 cells already express ERRa, even inthe absence of transfected receptor. In all three cell lines,

PCR performed with OPN-specific oligonucleotides (Fig. 6,middle) yielded a fragment that is more abundant in pSG5-

ERRa-transfected cells (Lanes +) than in pSG5-transfected

cells (Lanes -). The size difference of the fragments ampli-

BAmOPN promoter #{149}� 0 � 0 #{149}

SIS2 S3 S4 S5 S6

cSFRE TCA AGOTCA

S I TAA AGGTCA

S2 TCA�GGTCA

S3 TCCAGGTCA

S4 I��GGTGA

S4m I TCA AA�JCA lcgact

S4m2 agi ttgTCA IGGTGA

S5 TM AGGCCA

S6 ACAAGGTC1.[

S7 CCA AGGTAA

CE:

n.- i.iv�.P� � -�

C #{149}e� #{149}.��#{149}.�.#{149}e#{248}’-

.. � �

1010 Osteopontin and ERRx

5 J-M. Vanacker, unpublished data.

0S7

Competitor % % cSFRE we. Si 52 53 54 54m1 54m2 55 S6 57

Molarescess % % 10 00 10 100 0 100 10 100 10 100 10 100 10 100 10 00 10 100 10 100 10 100

Fig. 3. Binding of ERRn on putative SFREs of the OPN promoter. A, sequence of the putative SFREs analyzed. A schematic representation of the mOPNpromoter is displayed. Arrow (top), the transcription start site. The sequence of each putative SFRE (abbreviated S1-S7) is shown, with underlined letterspointing to divergence(s) with the consensus SFRE site (cSFRE). Two different versions of the 54 site were further generated (S4m1 and S4m2), each ofwhich destroyed one of the overlapping putative SFREs encompassed in this sequence. B, EMSA. In vitro synthesized ERRs protein was allowed to bindto 32P end-labeled consensus SFRE. Where stated, cold oligonucleotides were added at the indicated molar excess as competitors. unr, unrelatedoligonucleotide used as a negative control. Unprogrammed reticulocyte was used in the far left lane (PSG5). Arrow, the specific SFRE-ERRa complex.nonspecific complexes.

fied in rat and mouse cells was expected from the sequences

of OPN in these two species (1 9). As an internal control, we

used TFIID-specific oligonucleotides (Fig. 6, right). This

yielded an amplification product of comparable intensity

within pSG5- and pSG5-ERRa-transfected cell lines. Goner-ation of an amplified fragment depended on the presence of

retrotranscribed RNAs in the reaction mixture, as judged by

the blank controls used for each oligonucleotide pair (Lanes

B). Together, these indicate that overexpression of ERRa,

brought about by transient transfection, results in the eleva-

tion of the steady-state level of OPN mRNA in three different

osteoblastic cell lines, an effect that is likely due to transac-

tivation of the endogenous OPN promoter by ERRa.

Discussion

Specificity of the ERRa-OPN Relationships. The data pre-sented here establish that the mOPN promoter can be trans-

activated by ERRa. Other promoters have been described in

the literature as responding to this orphan receptor. A down-

regulation of the SV4O major late promoter by ERRa has

been described (20). This effect seems to depend on anestrogen-responsive element and to involve a physical con-

tact with the ER (9). A relationship with the ER was also

emphasized in the case of the lactoferrin promoter, on which

ERRa modulates the transcriptional activation driven by the

ER (21), but was not shown to act independently. On anotherhand, ERRa binds to a discrete sequence on the medium-

chain acyl coenzyme A dehydrogenase gene promoter but

does not activate the expression of this promoter (7). Here,we show a direct binding of ERRa on discrete sites (SFRE5)

embedded in the OPN promoter. One of these sites is both

necessary and sufficient to confer a full positive response toERRa. Because this very site is not a perfect consensus

SFRE, this suggests that ERRa displays a certain flexibilityregarding its binding target. It should be noted that the

oligonucleotides cSFRE and OPN-origmnating SFRE 1 andSFRE 2 bear differences in the sequences flanking the re-sponse element (see “Materials and Methods”). This couldaccount for the differences observed in the affinity of the

oligonucleotides for ERRa and in their response to this re-

ceptor (as suggested by results published in Ref. 7). How-

ever, EMSAs performed with oligonucleotides bearing differ-ences only within the SFRE and not in the flanking sequencesconfirmed the relative affinities of ERRCO for the various near-

consensus SFREs.5 The affinities and response intensities

can, thus, be attributed to differences in the SFRE se-

quences.

Our data thus establish OPN as the first direct positive

target gene of this orphan receptor. Nevertheless, ERRastimulation of OPN transcription is cell specific, consistent

with our previous observations of the effect of ERRa on the

consensus SFRE (8). A simple explanation to this phenom-

enon could involve the existence of a positive factor in the

permissive cells that would be absent in nonpermissive ones.However, NB-E cells support ERRa transactivation on a tn-men of consensus SFRE but not on the OPN promoter. Itmust then be postulated that the ERRa-positive effect ne-

quines different cofacton(s) on the OPN promoter and onconsensus SFRE. Because no evidence is available that a

ligand can specify the DNA target recognized by a nuclear

receptor, this factor is likely to be of peptidic nature. Binding

of ERRa to a given SFRE (consensus on OPN-denived) could,therefore, drive the receptor to adopt a particular conforma-

C

-�--L�1

-�--E�

AcSFRE TCA AGGTCA

BCl)

Competitor � % cSFRE unr. Si Sim S2 S2m

Molar excess % % 10 100 10 100 10 100 10 100 10 100 10 100

V. #{149}��‘�r �

D[�j7I2.8 cells

Molar excess

act. I rep.

�

- to4

2-

C0

c0>

(1C0

0

Aeporter p�777-luc pSim-luc pS2m-luc pSlmS2m-luc

Cell Growth & Differentiation 1011

Si

Sim

52

S2m

TAA AGGTCA

TA� AG�TCA

TCA GGGTCA

TC� AG�TCA

SFFE1 SFFE2

pA777-Iuc U

pSi m-Iuc _� p

pS2m-Wc 0

pSlmS2m-Iuc �

sFral : TAAAGGTcA -0- TA�N3�TCA

SF�2: TCAGGGTCA -0- TC��TCA

Fig. 4. Effect of point mutations of the OPN promoter on the activation by ERRa. A, sequence of the oligonucleotides used in EMSA. Underlined lettersin mutant oligonucleotides indicate the change relative to the mOPN SFRE. B, competitive EMSA. In vitro synthesized ERRa was allowed to bind to 32Pend-labeled consensus SFRE. Where stated, cold oligonucleotides were added at the indicated molar excess as competitors. unr, unrelated oligonucleotideused as a negative control. Unprogrammed reticulocyte was used in the farleft lane (PSG5). Arrow, specific SFRE-ERRa complex. #{176},nonspecific complexes.C, schematic representation of the reporter constructs used in this study. Inactivating mutations in SFRE 1 and SFRE 2 are underlined. Arrow, thetranscription start site. D, cotransfection experiment. The indicated OPN-Iuc constructs were cotransfected in ROS 1 7/2.8 cells, together with the indicatedmolar excess of pSG5-ERRa. Columns, fold activation over the individual reporter activity without transactivator, representing the average of threeindependent experiments; bars, SD.

tion that would, in turn, be recognized by conformation-

specific coactivators.

The tnansactivating effect that we have observed on the

mOPN promoter is not only cell specific but also factorspecific. Indeed, although SF-i enhances transcription

through the SFRE, this receptor is unable to stimulate mOPN

expression. Knowing that SF-i is also a cell-specific tran-

scniption factor (1 1), the experiment was performed in a cell

line in which SF-i is active, as judged by its effect on a tnimer

of SFRE (see Fig. iB). The divergences between the con-sensus SFRE and the ones found on the mOPN promotermay account for the lack of effect of SF-i . Indeed, gel shiftexperiments revealed that SF-i has a weaken affinity forSFRE 1 (the major ERRa-nesponsive site) than ERRa.5 Incontrast, SF-i binds more efficiently to SFRE 2 than does

ERRa. Considering SFRE 1 and SFRE 2 sites together itcould be stated that SF-i displays a affinity for the mOPN

promoter that is similar to that of ERRa. Again, the presence

or absence of a cooperating factor that is both cell andpromoter specific may explain why only one of the twoSFRE-binding factors considered here is active on mOPN

promoter.

ERRa and OPN as Markers of Late Osteoblastic Dif-ferentiation. OPN has been shown to be expressed in a

wide variety of noncalcified organs, such as skin, kidney,

neuroepithelial cells of the inner ear, placenta, breast, and

uterus (1 4). A number of these tissues (placenta, kidney,

breast, and skin) also display ERRa expression, as docu-

mented by us and others (3, 6). The fact that OPN and ERRa

are coexpressed in some cells is in agreement with OPN

being a target of ERRa. Nevertheless, because given tissues

express ERRa and not OPN (and conversely), it clearly ap-

pears that ERRa is neither necessary nor sufficient to induceOPN expression in every tissue. In particular, endogenousOPN expression cannot be induced by simple ERRa over-

expression in HeLa cells (data not shown). In the case ofbone cells, three lines of evidence suggest that OPN is an in

vivo target of ERRa. First, in situ hybridization of the mouse

embryo revealed that both messengers are expressed in the

same spatial and temporal window, i.e. , at the sites of ossi-fication at embryonic day Ei5.5 (ERRa) and Ei6 (OPN; Refs.

8 and 22). Second, during the in vitro differentiation of os-

teoblasts, OPN and ERRa expression appear during the later

B

IROS 17/2.8 cells

Molar excessact. I rep.

El ‘-5- 10

otides upstream of the TATA box (700 nucleotides in thecase of the mOPN). Although the sequence is not published,the rat promoter is thus likely to contain SFRE(s).

A transcriptional activator, Cbfai , has recently been iden-tified that is required for osteoblast differentiation (25). Cbfal

is specifically expressed in the osteoblast cell lineage and

stimulates the expression of several markers of the osteo-blast cell lineage, including OPN. In contrast to Cbfal , but as

well as OPN, ERRa is expressed at the end of osteoblasticdifferentiation. The latter products can, thus, be consideredmarkers of the later stages of this process.

OPN and Estrogens. The effect of E2 on bone develop-mont has long been recognized, as exemplified by postm-

enopausal osteoporosis (26). Nevertheless, the precisemechanisms by which E2 exert its effect on bones is still a

matter of controversy. Indeed, two ERs have been identified.

ERa is only expressed at a low level in bone cells (27, 28).

The recently cloned ER� (29) bears a higher level of expres-sion in osteoblastic cells and during in vitro osteoblastic

differentiation (30) and is, thus, likely to be “bone ER.” Nev-ertheless, an indirect effect of E2 cannot be ruled out. In thisrespect, it is worth noting that the mOPN promoter is, among

other factors, regulated by E2 (1 6). The mOPN promoter

does not contain any obvious estrogen-responsive element,and the E2 responsive site has not been mapped thus far.Because ERRa has been shown to physically interact withERa (9, 21), it could be hypothesized that the E2-positive

effect is mediated by a dimerization between ERa or ERI3 (if

the latter also interacts with ERRa) and ERRa, the latter

acting through DNA binding to the SFRE. More work isrequired to test this hypothesis.

9.

8 ___________________

7

0

a>

0a

�0

0LI.

3

2

Reporter pSFREx3-Iuc pSix3-Iuc pS2x3-luc

Fig. 5. Si site is sufficient to confer ERRo response to a heterologouspromoter. A, schematic representation of the constructs used in thisstudy. Only the SFRE moiety in each sequence is presented. Nucleotidesdiverging from the consensus SFRE sequence are underlined. B, cotrans-fection assay. Si - or S2-contamning plasmids were cotransfected in ROS1 7/2.8 cells together with the indicated molar excess of ERRo-encodingplasmid. Columns, fold activation over the individual OPN activity withouttransactivator, representing the average of three independent experi-ments; bars, SD.

phases.6 Third, transient overexpression of ERRa results inan accumulation of OPN-corresponding mRNA, asjudged bythe semiquantitative reverse transcription-PCR experiments

presented here. In conjunction with the promoter data ex-

posed here, the latter results are likely to be due to a directactivation of the endogenous promoter. Because we consid-

ered different animal species (mouse in the promoter studies;mouse and rat cells for the endogenous promoter response),this statement hypothesizes that ERRa-responsive sites on

the OPN promoter were conserved during evolution. A com-

puter-assisted analysis of the published human (23) and pig(24) versions of the OPN promoter revealed the presence ofSFRE derivatives (closely resembling SFRE 1) -900 nude-

1012 Osteopontin and ERRo

6 J� E. Aubin, personal communication.

ApSFREx3-luc (TCA AGGTCA) x 3

psi x3-luc (TM AGGTCA) x 3

pS2x3-luc (TCA �3GTCA) x 3

Materials and MethodsPlasmid Constructions. Deletions of the mOPN promoter have beendescribed elsewhere (18). Point mutations were introduced in the OPNpromoter by a two-step PCR using standard methods. The 5’ portion ofthe mOPN was amplified using the following oligonucleotides: 5’-CTA-

AGUACAGATAAAGGCCACATGGATAC-3’ and 5’-CTGCTCCAACA-GAGCAACMG-3’ (oligonucleotide A). The 3’ part of the mOPN promoter

was amplified using the following oligonucleotides: 5’-TTCACGTCTCTA-GAGCTCAGTGGAGGCAGG-3’ (Slm) or 5’-GGAGAGGAAlTCGAGCT-CACTGTGTGG1TF-3’ (S2m) and 5’-AAACCCAAGCAAGGATGCUC-3’(oligonudleotide B). The 5’- and 3-corresponding amplicons were used astemplate for a further amplification using oligonudleotides A and B. Am-plification products were subcloned in pCR2.i plasmid (TA-cloning; In-vitrogen), and individual clones were sequenced. Mutated fragments weretransferred into pGL2 basic reporter plasmid (Promega).

For concatemerization, oligonucleotides encompassing the consensusSFRE or SFRE-Iike sitesflanked by BamHI and Bglll recognition sites wereligated in the presence of the two restriction enzymes. Trimers were gel

purified and cloned in the BglII site of plasmid pGL2-PRM (Promega).Individual clones were sequenced to ensure the number of SFRE deriv-

atives and the appropriate head-to-tail orientation, respective to the tran-

scription sense. Sequences of the cloned oligonucleotides (SFRE is un-derlined) were as follows: in pSFREx3-Iuc, 5’-GATCCGGCGATTT-GTCAAGGTCACACAGTA-3’; in pSix3-Iuc, 5’-GATCCACGTCTCTAAAG-

GTCAGTGGAGGCA-3’; and in pS2x3-Iuc, 5’-GATCCGAGGAAUCAG-GGTCACTGTGTGGA-3’.

The pJ3fl-SF1 plasmid was a generous gift of Philippe Berta (Institut de

G#{233}n#{233}tiqueHumaine, Montpellier, France).Cells and Transient Transfectlons. All cell lines were maintained in

DMEM supplemented with 10% FCS. A total of 1o� cells seeded insix-well plates were transfected by 1 �g of total DNA per assay using 4 �.tIof ExGen 500 (Euromedex, Souffelweyersheim, France) under conditions

OPN

UMR � MC3T3

- + - + -

TFHD

UMR il�8 MC3T3

- + - + -

;��; 0�

UMR ;l�!8 MC3T3

- +- +- + B

� 4�

!� �

Cell Growth & Differentiation 1013

Fig. 6. Effect of ERRa on theendogenous OPN promoter. In-dicated osteoblast-like cells weretransiently transfected withpSG5-ERRa plasmid (Lanes +)or with pSG5 vector (Lanes -).

RNAs were extracted 40 h aftertransfection and subjected tosemiquantitative reverse tran-scription-PCR with ERRa-spe-cific (left), OPN-specific (middle),or TFIID-specific (right) primers.Amplification products were sep-arated on an agarose gel. LanesB, blank reactions in which retro-transcribed mixture was omitted.This experiment was repeatedtwice with essentially the sameresults.

Amplified ERRaproduct _____________

Cells

Transfected

ERRa

�ii1:jLI1�L

recommended by the supplier. When necessary, pSG5 plasmid was used

as a carrier. Cells were lysed 48 h after transfection and assayed forluciferase activity.

EMSA. Proteins were produced using rabbit reticulocyte TNT kit (Pro-mega). EMSAs were performed using 40 x 1 o� cpm of 32P end-labeledoligonucleotide probe and 2 pJ of in vitro synthesized proteins. Bindingreactions were performed under conditions described previously (31).

Briefly, proteins were set in a buffer containing 10% glycerol, 10 m�HEPES, 30 mM KCI, 4 mr�i spermidine, 0.1 mt�i EDTA. 0.25 m� DTT, and 1mM Na2HPO4 (pH 7.9). Single-stranded salmon sperm DNA (1 �g) andpoly(dI . dC) (0.4 ;.Lg) were added. Reaction products were run on a 5%native acrylamide gel.

Sequences of the oligonucleotides used as competitors were as fol-lows: cSFRE, AGTGGAGAmGTCAAGGTCACACAGTTAG; Si , GGT-

TCACGTCTCTAAAGGTCAGTGGAGGCA; 52, CAGGAGAGGAATTCAG-

GGTCACTGTGTGGT; 53, TCCATACTGTG1TCCAGGTCAGTTGGGGCA;54, AGGCTAGCCTCAAACTCATGGTGATC1TCCAGA; S4m1 , AGGCTA-GCCTCAAACTCATCGACTTCTTCCAGA; S4m2, AGGCTAGCCAG1TF-

GTCATGGTGATC1TCCAGA; 55, CTAAGTTACAGATAAAGGCCACATG-

GATAC; 56, CAGTAACTAGAAACAAGGTCTCTGTGAGGG; and 57,GGAGGAAACCAGCCAAGGTAAGCCTGCAGA.

RT.PCR. RNAs were extracted 40 h after transfection by the guani-dinium isothiocyanate method. One �tg RNA per sample was retrotrans-cribed with Moloney murine leukemia virus retropolymerase (Life Tech-nologies, Inc.). Two �l of this reaction mixture were subjected to PCR

using 100 ng of OPN-, TFIID-, or ERRx-specific primers. Gold Taq po-lymerase was purchased from Perkin Elmer and used under conditionsrecommended by the supplier. Blank reactions were performed in which

retrotranscribed products were omitted. Amplification products were an-alyzed on an agarose gel. Primers used were: OPN, GTG CCC TCT GAT

CAG GAC AGC and AlT GAC CTC AGA AGA TGA ACT; TFIID, ACA GGA

GCC MG AGT GM GAA and CCA GM ACA A&A ATA AGG AGA; andERRa, CCC TCT TCA TCT AGG ACC AG and 1TG CCT 1TC CCG GGCCCC TI. The PCR procedure used was: 94#{176}C,50 5; 52#{176}C,30 5; 72#{176}C,50s.PCRs were initially set up for 28 cycles. Aliquots of the reaction products

were tested on agarose gel, and two additional cycles were performed.This operation was repeated until signal saturation. Only one of thesesteps is displayed (30 cycles for TFIID and OPN; 36 for ERRo).

AcknowledgmentsWe are indebted to Philippe Berta for the generous gift of the SF-i -

expressing construct, to David T. Denhardt for the gift of mOPN promoter

constructs, and to Chantal Chenu for the gift of MC3T3 and UMR cells. We

thank Edith Bonnelye and Pierre Jurdic for critical reading of the manu-script and Brigitte Fournier for stimulating discussions at the initial stage

of this work.

References1 . Gronemeyer, H., and Laudet, V. Transcription factors 3: nuclear recep-

tors. Protein Profile, 2: 1 1 73-i 308, 1995.

2. Enmark, E., and Gustafsson, J-A. Orphan nuclear receptors: the firsteight years. Mol. Endocrinol., 10: 1293-1307, 1996.

3. Gigu#{232}re,V., Yang, N., Segui, P., and Evans, A. M. Identification of anew class ofsteroid hormone receptors. Nature (Lond.), 331: 91-94, 1988.

4. Pettersson, K., Svensson, K., Mattsson, R., Carlsson, B., Ohlsson, R.,

and Berkenstam, A. Expression of a novel member of estrogen responseelement binding nuclear receptors is restricted to the early stages of

chorion formation during mouse embryogenesis. Mech. Dev., 54: 211-213, 1996.

5. Luo, J., Sladek, R., Bader, J-A., Matthyssen, A., Rossant, J., and

Giguere, V. Placental abnormalities on mouse embryos lacking the orphan

nuclear receptor ERR-p Nature (Lond.), 388: 778-782, 1997.

6. Bonnelye, E., Vanacker, J. M., Spruyt, N., Alric, S., Fournier, B.,Desbiens, x., and Laudet, V. Expression of the estrogen-related receptor1 (ERR-i) orphan receptor during mouse development. Mech. Dev., 65:

7i-85, i997.

7. Sladek, R., Bader, J-A., Matthyssen, A., Rossant, J., and Giguere, V.The orphan nuclear receptor estrogen-related receptor a is a transcrip-

tional regulator of the human medium chain acyl coenzyme A dehydro-

genase gene. Mol. Cell. Biol., 1 7: 5400-5409, 1997.

8. Bonnelye, E., Vanacker, J. M., Dittmar, T., Begue, A., Desbiens, X.,

Denhardt, D. T., Aubin, J. E., Laudet, V., and Foumier, B. The ERR-iorphan receptor is a transcriptional activator expressed during bone de-velopment. Mol. Endocrinol., 11: 905-9i6, 1997.

9. Johnston, S. D., Liu, X., Zuo, F., Eisenbraun, T. L., Wiley, S. R., Fraus,

R. J., and Mertz, J. E. Estrogen-related receptor si functionally binds asa monomer to extended half-site sequences including ones containedwithin estrogen response elements. Mol. Endocrinol., 1 1: 342-352, 1997.

10. Wilson, T. E., Fahmer, T. J., and Milbrandt, J. The orphan receptorNGF1 -B and steroidogenic factor i establish monomer binding as a third

paradigm of nuclear receptor DNA interaction. Mol. Cell. Biol., 13: 5794-5804, i993.

i i . Parker, K. L, and Schimmer, B. P. The roles of the nuclear receptorsteroidogenic factor 1 in endocrine differentiation and development.

Trends Endocrinol. Metab., 7: 203-207, 1996.

12. Nomura, S., Wills, A., J., Edwards, D. R., Heath, J. K., and Hogan,B. L M. Developmental expression of 2ar (osteopontin) and SPARC(osteonectin) RNA as revealed by in situ hybridization. J. Cell. Biol., 106:441-450, 1988.

13. Craig, A. M., Smith, J. H., and Denhardt, D. T. Osteopontin, a trans-formation-associated cell adhesion phosphoprotemn is induced by i 2-0-

1014 Osteopontmn and ERRa

tetradecanoylphorbol i 3-acetate in mouse epidermis. J. Biol. Chem., 264:

9682-9689, 1989.

14. Denhardt, 0. T., and Guo, X. Osteopontin: a protein of many func-

tions. FASEB J., 7: 1475-1482, 1993.

i 5. Aubin, J. E., and Uu, F. The osteoblastic lineage. In: L G. Raisz, G. A.Rodan, and J. P. Belizikian, (eds.), Principle of Bone Biology, pp. 51-67.New York: Academic Press, 1996.

16. Craig, A. M., and Denhardt, D. T. The murine gene encoding secretedphosphoprotein 1 (osteopontln): promoter structure, activity and inductionin vivo by estrogen and progesterone. Gene, 100: 163-17i , 1991.

17. Chen, J., Thomas, H. F., and Sodek, J. Regulation of bone sialopro-tom and osteopontin mRNA expression by dexarnethasone and 1,25

dihydroxyvitamin D3 in rat bone organ cultures. Connec. Tissue Res., 34:

41-51, i996.

18. Guo, X., Zhang, Y. P., Mitchell, D. A., Denhardt, D. T., and Chambers,A. F. Identification of a ras-activated enhancer in the mouse osteopontinpromoter and its interaction with a putative ETS-related transcriptionfactor whose activity correlates with the motastatic potential of the cell.

Mol. Cell. Biol., 15: 476-487, 1995.

19. Miyazaki, Y., Setoguchi, M., Yoshida, S., Higuchi, V., Akizuki, S., andYamamoto, S. The mouse osteopontin gene. Expression in monocyticlineages and complete nucleotide sequence. J. Biol. Chem., 265: 14432-14438, 1990.

20. Wiley, S. R., Kraus, R. J., Zuo, F., Murray, E. E., Loritz, K., and Mertz,J. E. SV4O early-to-late switch involves titration of cellular transcriptionalrepressors. Genes Dev., 7: 2206-22i9, 1993.

21. Yang, N., Shigeta, H., Shi, H., and Tong, C. T. Estrogen-relatedreceptor, hERR1 , modulates estrogen receptor-mediated response of

human lactoferrin gene promoter. J. Biol. Chem., 271: 5795-5804, i996.

22. Somrner, B., Bickel, M., Hofstetter, W., and Wetterwald, A. Expres-sion of matrix protein during the development of mineralized tissues.

Bone, 19: 371-380, 1996.

23. Hijiya, N., Setoguchi, M., Matsuura, K., Higuchi, Y., Akizuki, S., andYamamoto, S. Cloning and characterization of the human osteopontin

gene and its promoter. Biochem. J., 303: 255-262, i994.

24. Zhang, 0., Wrana, J. L, and Sodek, J. Characterization of the pro-

moter region of the porcine opn (osteopontmn, secreted phosphoprotemn 1)gene. Identification of positive and negative regulatory elements and a“silent” second promoter. Eur. J. Biochem., 207: 649-659, i992.

25. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L, and Karsenty, G.Osf2/Cbfal : a transcriptional activator of osteoblast differentiation. Cell,89: 747-754, i997.

26. Turner, R. T., Riggs, B. L, and Spelsberg, T. C. Skeletal effects ofestrogen. Endocr. Rev., 15: 275-300, i994.

27. Kornm, B. S., Torpening, C. M., Benz, D. J., Graeme, K A., Gallegos,A., Korc, M., Greene, G. L, O’MalIey, B. W., and Haussler, M. A. Estrogenbinding, receptor mRNA and biological response in osteoblast-like estee-

sarcoma cells. Science (Washington DC), 241: 81-84, 1988.

28. Eriksen, E. F., Colvard, D. S., Berg, N. J., Graham, M. L, Mann, K G.,Spelsberg, T. C., and Riggs, B. L Evidence of estrogen receptors in

normal human osteoblast-like cells. Science (Washington DC), 241: 84-86, 1988.

29. Kuipor, G. G. J. M., Enmark, E., Pelto-Huikko, M., Nilsson, S., andGustafsson, J-A. Cloning of a novel estrogen receptor expressed in rat

prostate and ovary. Proc. NatI. Acad. Sci. USA, 93: 5925-5930, 1996.

30. Ones, V., Miyaura, C., Ohta, H., Nozawa, S., and Suda, T. Expressionofestrogen receptor p in rat bone. Endocrinology, 138: 4509-4512, 1997.

31 . Vanacker, J. M., Laudet, V., Adelmant, G., St#{233}helin,D., andRornrnelaere, J. Interconnection between thyroid hormone receptor sig-naling pathways and parovirus cytotoxic function. J. Virol., 67: 7668-

7672, 1993.