active motif’s epigenetics products & services brochure · 2019-01-22 · active motif’s...
TRANSCRIPT
![Page 1: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/1.jpg)
epigenetics
ChIPHistonesDNA MethylationSample PreparationEpigenetic ServicesAntibodies
products & services Enabling Epigenetics Research
www.activemotif.com
![Page 2: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/2.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com
Antibodies for Epigenetic Research ...................................................1
Chromatin Immunoprecipitation ChIP Products Overview ..................................................................4 Introduction to ChIP Products ......................................................5 Sonication Products ...........................................................................6 ChIP-IT® Express Shearing Kit ........................................................7 ChIP-IT® Express Enzymatic Shearing Kit ..................................7 ChIP-IT® Fixation Buffer ...................................................................7 Dounce Homogenizers .....................................................................7 ChIP-IT® Express Enzymatic ............................................................8 ChIP-IT® Express ..................................................................................9 ChIP-IT® High Sensitivity ............................................................... 10 ChIP-IT® qPCR Analysis Kit ............................................................ 10 ChIP-IT® ChIP-Seq ............................................................................. 11 ChIP-IT® PBMC ................................................................................... 12 ChIP-IT® FFPE .......................................................................................13 ChIP-IT® FFPE Chromatin Preparation Kit ................................13 Ready-to-Use ChIP Columns ....................................................... 14 ChIP-IT® Protein G Magnetic Beads .......................................... 14 Re-ChIP-IT® .......................................................................................... 15 ChIP-IT® Express HT ......................................................................... 16 RNA ChIP-IT® ...................................................................................... 17 RNA ChIP-IT® Control Kit – Human .......................................... 17 ChIP Control qPCR Primer Sets .................................................. 18 ChIP Accessory Kits and Reagents ............................................. 19 ChIP-IT® Control Kits ....................................................................... 19 Ready-to-ChIP Chromatin ............................................................. 19 Bridging Antibody for Mouse IgG ............................................. 19 Chromatin IP DNA Purification Kit ........................................... 20
Histone Peptide Array MODified™ Histone Peptide Array ............................................. 21 MODified™ Array Labeling Kit ...................................................... 21 MODified™ Protein Domain Binding Kit ................................. 22
Histone Modification ELISAs Histone H3 mono-, di- & trimethyl Lys4 ELISAs ..................23 Histone H3 acetyl, di- & trimethyl Lys9 ELISAs ....................23 Histone H3 phospho Ser10 ELISA ...............................................23 Histone H3 acetyl Lys14 ELISA .....................................................23 Histone H3 mono- & trimethyl Lys27 ELISAs ........................23 Histone H3 phospho Ser28 ELISA ..............................................23 Total Histone H3 ELISA ...................................................................23
Histone Purification Histone Purification Kit ................................................................. 24 Histone Purification Mini Kit ....................................................... 24 Histone Purification Microplate Kit .......................................... 24
Histone H3 PTM Multiplex Assay .................................................... 26
Reagents for Drug Discovery Overview ............................................................................................. 27
Recombinant Proteins Histones & Modified Histones ................................................... 28 Biotinylated Histones ..................................................................... 28 Histone Acetyltransferases & Deacetylases ......................... 28 Histone Methyltransferases & Demethylases ...................... 28 Bromodomains .................................................................................. 29 Transcription Factors ...................................................................... 29 DNA Methylation ............................................................................ 29 Ubiquitination ................................................................................... 29 Protein Kinases .................................................................................. 29
Small Molecule Compounds Inhibitors & Activators ................................................................... 30
Histone Acetylation & Deacetylation HAT Assay Kit (Fluorescent) ...........................................................31 HDAC Assay Kits (Fluorescent & Colorimetric) .....................31 Recombinant p300 protein, catalytic domain .......................31 Recombinant GCN5 protein, active ...........................................31
Histone Demethylation Histone Demethylase Assay (Fluorescent) .............................32 Recombinant LSD1 / KDM1A protein, active .........................32
Chromatin Assembly (in vitro) Chromatin Assembly Kit ................................................................33 HeLa Core Histones .........................................................................33 Nucleosome Assembly Control DNA ......................................33
NOMe-Seq .................................................................................................. 34
DNA Methylation Activity & Enrichment DNA Methylation / Demethylation Overview ....................35 Hydroxymethyl Collector™ .......................................................... 36 hMeDIP Assay & 5-hmC antibodies ..........................................37 MethylCollector™ Ultra.................................................................. 38 MeDIP Assay & 5-mC antibodies ............................................... 39 HypoMethylCollector™ .................................................................40 Bisulfite Conversion Kit .................................................................. 41 DNMT Activity / Inhibition Assay ............................................ 42
Methylated DNA Standards and Controls Methylated DNA Standard Kit ....................................................43 Fully Methylated Jurkat DNA .......................................................43 Jurkat genomic DNA ........................................................................43
5-Hydroxymethylcytosine Enzymes Recombinant Tet1 protein, active ............................................. 44 PvuRts1I restriction enzyme ........................................................ 44 b-Glucosyltransferase enzyme ................................................... 44
5-Formylcytosine (5-fC) & 5-Carboxylcytosine (5-caC) ......... 45
Epigenetic Services ................................................................................. 46
LightSwitch™ Luciferase Reporter Assays .....................................48
Table of ConTenTs
![Page 3: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/3.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 1
anTibodies
Antibodies for Epigenetic Researchhighly characterized antibodies to study epigenetics and gene regulation
At Active Motif, we are committed to providing the high-est quality antibodies for studying chromatin biology and epigenomics. We offer a wide range of antibodies specific for epigenetic modifications, chromatin modifiers and transcription factors. Our staff scientists use an established validation pro-
gram to qualify the suitability of our antibodies for use in vari-ous applications, such as chromatin immunoprecipitation (ChIP), ChIP-Seq, MeDIP, Western blot and immunofluorescence. For a complete list of available antibodies, please visit us at www.activemotif.com/abs.
The aCTive MoTif anTibody differenCe
• Quality first – we’d rather fail than sacrifice quality
• Highly validated – stringently tested in multiple applications
• Consistent – we minimize lot-to-lot variability
• Convenient – most antibodies are available in sample sizesAbbreviated lists of the antibodies we offer for various research areas are shown on the next 2 pages. For complete, up-to-date lists of antibodies available in each category, please visit the links below.
Histone & Histone Modifications www.activemotif.com/hismodabs Chromatin Associated Proteins www.activemotif.com/chromabs Transcription Factors www.activemotif.com/tfabs Nuclear Receptors www.activemotif.com/nrabs Stem Cell Biology www.activemotif.com/stemcellabs
F I G U R E 2 :Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3 pAb (Catalog No. 39161) specificity.
Histone H3K9me3 pAb
0
20
40
60
80
120
100
140
H3K9me3
H3K27me3
H3R2me2s
H3R2me2a
H3K4acH3K4me2
H3R8me2s
H3K4me3
H3K4me1
H3R2me2a
Spec
ificit
y Fa
ctor
F I G U R E 1 :ChIP-Seq data from control and estrogen-treated MCF-7 chromatin using anti-bodies against RNA pol II CTD phospho Ser2 (Catalog No. 61083) and against the estrogen-inducible transcription factor SRC3.
Estrogen
Estrogen
Control
Control
SRC3ChIP-Seq
Pol IIChIP-Seq
{{
RET
42,880,000 42,900,000 42,920,000 42,940,000q11.21
Not every antibody is suitable for ChIPOne of the greatest challenges for epigenetic-based research has been the lack of antibodies displaying the proper specificity that have been validated for use in techniques such as ChIP and
ChIP-Seq. The problem has been compounded by numerous antibody suppliers who do not manufacture or test the anti-bodies they sell, and who sell them to one another and then to researchers. Developing and manufacturing histone-specific antibodies is challenging because histones have multiple post-translational modifications along their “tail” portion involved in gene regulation and disease. Effective antibodies must clearly differentiate between these multiple, subtle variances and also be able to perform in demanding epigenetic techniques.
At Active Motif, we manufacture and rigorously test our histone antibodies in-house to ensure their quality and performance. We are the only company to test the specificity of our histone modification antibodies using our ground-breaking MODified™ Histone Peptide Array (Figure 2; see page 21).
5-caC 5-mC DAPI
![Page 4: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/4.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com2
anTibodies
Description Applications Cat. No.
HISTONES & HISTONE MODIFICATIONSHistone H1 pAb IF, WB 39707
Histone H2A pAb ChIP, WB 39235
Histone H2AT120ph pAb DB, WB 39391
Histone H2AS129ph pAb ChIP, DB, IF, IP, WB 39271
Histone macroH2A1.1 pAb IF, IHC, WB 39871
Histone macroH2A2 pAb IF, IHC, WB 39873
Histone H2A.X pAb IF, WB 39689
Histone H2A.XS139ph pAb DB, IF, WB 39117
Histone H2A.Z pAb ChIP, DB, WB 39943
Histone H2B pAb ChIP, WB 39237
Histone H2BK5ac pAb ChIP, ChC, ChS, DB, WB 39123
Histone H2BS14ph mAb IF, IP, WB 61011
Histone H2BK120ac pAb ChIP, ChC, ChS, DB, WB 39119
Histone H2BK120ub1 mAb ChIP, WB 39623
Histone H3 mAb ChIP, IF, IP, TRF, WB 39763
Histone H3, C-terminal pAb ChIP, ELISA, IP, WB 39163
Histone H3ac (pan-acetyl) pAb ChIP, DB, IP, WB 39139
Histone H3K4me1 pAb ChIP, ChC, ChS, DB, ELISA, IF, IP, WB 39297
Histone H3K4me2 pAb ChIP, ChC, ChS, DB, ELISA, IP, WB 39141
Histone H3K4me3 pAb ChIP, ChC, ChS, DB, ELISA, IF, IP, WB 39159
Histone H3R8me2a pAb DB, WB 39651
Histone H3K9ac pAb ChIP, ChC, ChS, DB, WB 39137
Histone H3K9me1 mAb ChIP, DB, IP, WB 39681
Histone H3K9me2 mAb ChIP, DB, IF, IP, TRF, WB 39683
Histone H3K9me3 pAb ChIP, ChC, ChS, DB, ELISA, IF, IP, WB 39161
Histone H3S10ph pAb ChIP, DB, IF, WB 39253
Histone H3K14ac pAb ChIP, ChC, ChS, DB, ELISA, IP, WB 39599
Histone H3R17me2a pAb DB, WB 39709
Histone H3K18ac pAb ChIP, ChC, ChS, DB, IF, IP, WB 39755
Histone H3K27ac pAb ChIP, ChC, ChS, DB, IF, IP, WB 39133
Histone H3K27me1 pAb DB, IF, WB 39377
Histone H3K27me2 pAb ChIP, DB, IF, WB 39245
Histone H3K27me3 pAb ChIP, ChC, ChS, DB, IF, IP, WB 39155
Histone H3S28ph mAb ELISA, IF, WB 39098
Histone H3K36ac pAb ChIP, ChC, ChS, DB, IF, WB 39379
Histone H3K36me2 pAb ChIP, ChC, ChS, DB, IF, IP, WB 39255
Histone H3K36me3 pAb ChIP, ChC, ChS, DB, IP, WB 61101
Histone H3T45ph pAb DB, WB 39737
Histone H3K56ac pAb ChIP, ChC, ChS, DB, WB 39281
Histone H3K56me1 pAb DB, WB 39273
Histone H3K79me1 pAb ChIP, DB, WB 39145
Histone H3K79me2 pAb ChIP, ChC, ChS, DB, WB 39143
Histone H4 pAb ChIP, IP, WB 61299
Histone H4ac (pan-acetyl) pAb ChIP, DB, IF, WB 39243
Histone H4R3me2a pAb DB, WB 39705
Histone H4K5ac pAb ChIP, DB, WB 39699
Histone H4K12ac pAb ChIP, ChC, ChS, DB, IF, WB 39165
Histone H4K16ac pAb ChIP, DB, IP, WB 39167
Description Applications Cat. No.
Histone H4K20me1 mAb IF, WB 39727
Histone H4K20me2 pAb ChIP, IF, WB 39173
DNA METHYLATION3-Methylcytosine (3-mC) pAb DB 61111
5-Carboxylcytosine (5-caC) pAb DB, IF 61225
5-Formylcytosine (5-fC) pAb DB, IF 61223
5-Hydroxymethylcytosine (5-hmC) mAb DB, hMeDIP 39999
5-Hydroxymethylcytosine (5-hmC) pAb DB, IF, IHC, hMeDIP 39769
5-Methylcytosine (5-mC) mAb DB, FACS, IHC, IP, MeDIP 39649
5-Methylcytosine (5-mC) pAb DB, IP, MeDIP 61255
DNMT1 mAb ChIP, IHC, IP, WB 39204
DNMT2 pAb WB 39205
DNMT3A mAb ChIP, IF, IHC, WB 39206
DNMT3B mAb ChIP, IF, IP, WB 39207
DNMT3L pAb WB 39907
MBD1 pAb WB 39857
MBD2 pAb WB 39547
MBD3 mAb WB 39216
MBD4 pAb WB 39217
MeCP2 mAb ChIP, IF, IHC, IP, WB 61285
Uhrf1 mAb IF, IHC, IP, WB 61341
CHROMATIN MODIFIERSBRD3 pAb ChIP, ChS, WB 61489
BRD4 pAb ChIP, IP, WB 39909
CARM1 pAb WB 39251
CGBP pAb WB 39203
DOT1L pAb WB 39953
EZH2 mAb ChIP, IF, IP 39875
EZH2 pAb ChIP, ChC, ChS, WB 39901
EZH2 phospho Thr345 pAb DB, WB 61241
GCN5 mAb ELISA, IF, WB 39975
HDAC1 mAb ChIP, IF, IHC, IP, WB 39531
HDAC2 mAb ChIP, IF, IHC, IP, WB 39533
HDAC3 pAb ChIP, WB 40968
HDAC5 pAb ChIP, WB 40970
HDAC6 pAb ChIP, WB 40971
JARID1C / KDM5C pAb ChIP, IP, WB 39229
Jhd2 pAb WB 39263
JMJD2A mAb WB 39815
JMJD2D pAb WB 39247
LSD1 / KDM1A pAb ChIP, ChC, ChS, IP, WB 39186
MLL / HRX pAb ChIP, IP, WB 61295
MLL / HRX mAb ChIP, IP, WB 39829
MMSET / WHSC1 mAb ChIP, ChC, ChS, IF, IP, WB 39879
PARP-1 N-terminal pAb ChIP, IHC, IP, WB 39559
PARP-2 pAb ChIP, IP, WB 39743
PRMT5 pAb WB 61001
![Page 5: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/5.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 3
anTibodies
Description Applications Cat. No.
PRMT6 pAb WB 61003
SIRT1 mAb IF, IP, WB 39353
SIRT2 pAb IF, IP, WB 61043
SIRT6 pAb WB 39911
SUV39H1 mAb ChIP, IP, WB 39785
CHROMATIN REMODELERSAiolos pAb IF, IP, WB 39293
Boris / CTCFL pAb WB 39851
CHD1 pAb ChIP, WB 39729
CHD2 pAb WB 39363
CTCF pAb ChIP, ChC, ChS, IP, WB 61311
HIRA mAb WB 39557
HMG-2 pAb WB 39029
HMGA2 / HMGI-C pAb WB 61041
HP1a mAb ChIP, ELISA, ICC, IF, IHC 39977
HP1b mAb ELISA, IF, IHC, IP, WB 39979
HP1g mAb ELISA, ICC, IF, IHC, IP, WB 39981
Rsf1 pAb IF, IP, WB 39579
SMARCA2 / BRM mAb ChIP, IF, WB 39805
SMARCA4 / BRG1 mAb IF, WB 39807SATB1 pAb WB 39839
STEM CELLS5-Carboxylcytosine (5-caC) pAb DB, IF 61225
5-Formylcytosine (5-fC) pAb DB, IF 61223
5-Hydroxymethylcytosine (5-hmC) mAb DB, hMeDIP 39999
5-Hydroxymethylcytosine (5-hmC) pAb DB, IF, IHC, hMeDIP 39769
5-Methylcytosine (5-mC) pAb DB, IP, MeDIP 61255
Ago1/2/3 mAb ChIP, IF, IHC, IP, WB 39937
Dicer mAb WB 39817
EED mAb ChIP, ChC, ChS, IHC, WB 61203
EZH2 pAb ChIP, ChC, ChS, WB 39901
KLF4 pAb WB 39745
LIN28A pAb ICC, IF, WB 61191
c-Myc pAb (65 kDa form) WB 39012
Nanog pAb ICC, IF, WB 61419
NKX2.5 pAb WB 61267
Notch1 mAb WB 61147
Notch3 mAb WB 61149
Oct-4 pAb ICC, IF, WB 39811
Ring1B mAb ChIP, ChC, ChS, IF, IP, WB 39663
Sox2 pAb ChIP, IF, IHC, IP, WB 39823
Sp1 pAb ChIP, IP, WB 39058
Suz12 pAb ChIP, IP, WB 39357
YY1 pAb ChIP, IP, WB 39071
Description Applications Cat. No.
CANCER5-Methylcytosine (5-mC) pAb DB, IP, MeDIP 61255
BRD4 pAb ChIP, IP, WB 39909
CHD1 pAb ChIP, WB 39729
DOT1L pAb WB 39953
EZH2 mAb ChIP, IF, IP 39875
EZH2 pAb ChIP, ChC, ChS, WB 39901
HDAC2 mAb ChIP, IF, IHC, IP, WB 39533
HDAC6 pAb ChIP, WB 40971
Histone H3K4me2 pAb ChIP, ChC, ChS, DB, ELISA, IP, WB 39141
Histone H3K4me3 pAb ChIP, ChC, ChS, DB, ELISA, IF, IP, WB 39159
Histone H3K27me3 pAb ChIP, ChC, ChS, DB, IF, IP, WB 39155
Histone H3K36me2 pAb ChIP, ChC, ChS, DB, IF, IP, WB 39255
Histone H3K79me2 pAb ChIP, ChC, ChS, DB, WB 39143
JARID1C / KDM5C pAb ChIP, IP, WB 39229
LSD1 / KDM1A pAb ChIP, ChC, ChS, IP, WB 39186
MLL / HRX mAb ChIP, IP, WB 39829
MMSET / WHSC1 mAb ChIP, ChC, ChS, IF, IP, WB 39879
MOZ pAb WB 39867
c-Myc pAb (65 kDa form) WB 39012
PARP-1 N-terminal pAb ChIP, IHC, IP, WB 39559
PHF8 pAb WB 39711
SIRT1 mAb IF, IP, WB 39353
SIRT2 pAb IF, IP, WB 61043
ZEB1 pAb WB 61119
POLYCOMBBMI-1 mAb ChIP, IP 39993
CBX8 pAb WB 61237
EED mAb ChIP, ChC, ChS, IHC, WB 61203
EZH2 mAb ChIP, IF, IP 39875
EZH2 pAb ChIP, ChC, ChS, WB 39901
PCL2 mAb WB 61153
Phc1 mAb IF, IP, WB 39723
Phc2 mAb ChIP, IF, IP 39661
Ring1B mAb ChIP, ChC, ChS, IF, IP, WB 39663
Suz12 mAb ChIP, IF, IHC, IP 39877Suz12 pAb ChIP, IP, WB 39357
ChIP Chromatin immunoprecipitation
ChC ChIP-chipChS ChIP-SeqDB Dot blotICC ImmunocytochemistryIF Immunofluorescence
IHC ImmunohistochemistryIP ImmunoprecipitationMeDIP Methyl DNA
immunoprecipitationTRF Time-resolved FRETWB Western blot
Applications Key
The antibodies shown above are only a small sample of the over 700 antibodies currently offered. For a complete, up-to-date list of all antibodies available, please visit www.activemotif.com/abs.
![Page 6: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/6.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com4
Products to Streamline the ChIP Assay Workflow
ChiP ProduCTs overview
Chromatin Preparation
Chromatin ImmunoprecipitationChIP Antibodies• ChIP & ChIP-Seq
validated antibodies• ChIP Antibody
Validation Services• MODified™ Histone
Peptide Array
ChIP Kits• ChIP-IT® Express• ChIP-IT® High Sensitivity• ChIP-IT® ChIP-Seq• ChIP-IT® FFPE• ChIP-IT® PBMC• Re-ChIP-IT®• RNA ChIP-IT®
Protein G Beads• Protein G Agarose Columns• Protein G Magnetic Beads
Chromatin Shearing• EpiShear™ Sonicators• ChIP-IT® Sonication &
Enzymatic Shearing Kits• Dounce Homogenizers
Pre-Made Chromatin• Ready-to-ChIP Chromatin
ChIP DNA Clean-up• Chromatin IP
DNA Purification Kit
PCR Analysis• ChIP-IT® Control Kits
qPCR Analysis• ChIP-IT® qPCR Analysis Kit• ChIP Control qPCR Primer Sets
Epigenetic Services• FactorPath™, TranscriptionPath™ and
HistonePath™ ChIP-Seq & ChIP-chip
Downstream Analysis
Cycle
DRx
n
Gene Regulation Services• Custom Cloning and Mutagenesis• Pathway Screening• Sequence Variant Assays
Luciferase Reporter Assays• LightSwitch™ Promoter Reporter
GoClone™ Collections• LightSwitch™ Stable Cell Lines• LightSwitch™ Luciferase Assays
Functional Validation
PromoterReporter Vector
Promoter Luciferase
Promoter response in vivo
Lightsignal
![Page 7: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/7.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 5
Active Motif offers a complete selection of validated reagents, instruments and kits to help streamline each step of the ChIP as-say workflow (see opposite page). Whether you are performing ChIP for the first time or are an expert in need of a specialized
ChIP protocol and reagents, Active Motif has the right products to meet your needs. Provided below are brief descriptions of our ChIP-IT® Kits and ChIP products to help guide you in deter-mining which ones are best suited for your specific application.
ChiP ProduCTs
Find the Right ChIP Products to Suit Your Specific Needs
Need ChIP results in a hurry?ChIP-IT Express was the first ChIP kit to use magnetic beads, which yield lower background and streamline the ChIP proto-col by eliminating many steps required in conventional agarose bead-based protocols. Washing and elution steps are also faster because centrifugation is replaced by magnetic pull-down. The result is higher sensitivity, a reduction in the input sample amount to 100,000 cells per assay, and a condensed protocol that can be completed in 1 day. ChIP-IT Express has a proven track record of success with over 500 publications and counting.
Transcription Factor ChIPPerforming ChIP analysis of transcription factors presents a challenge because of their low abundance in cells and their low or transient affinity to chromatin. ChIP-IT High Sensitivity was specifically designed to perform ChIP analysis of transcription factors or similar low-abundance targets. Although the protocol is lengthier than magnetic bead methods, like ChIP-IT Express, a much higher level of sensitivity is achieved using the ChIP-IT High Sensitivity Kit. This extreme sensitivity also makes the kit ideal for performing ChIP with low-affinity antibodies or with limited amounts of sample. As little as 1,000 cell equivalents for highly abundant target proteins, or 50,000 for low abundance proteins, can be used for each ChIP reaction. To achieve this level of sensitivity, the kit employs specialized protein G agarose beads and optimized reagents to minimize non-specific binding. Filtration-based washes improve capture efficiency and consistency. The kit also includes DNA purification components to streamline sample preparation for downstream analysis.
Ready-to-use ChIP columnsGot your own ChIP protocol? For researchers who routinely perform ChIP with their own opti-mized protocols, Active Motif offers pre-packed, ready-to-use, low background Protein G Agarose Columns. These columns contain the same high-affinity protein G agarose beads included in the ChIP-IT High Sensitivity Kit (above). The columns offer a faster solution to centrifugation and magnetic separation methods, and result in better yield and reproducibility between samples because no material is lost.
No sonicator? No problem!ChIP-IT Express Enzymatic was the first kit to offer the option of shearing chromatin by enzymatic digestion instead of by sonication. This user-friendly kit is identical to ChIP-IT Express with the exception of its chromatin preparation reagents. Preparation of chromatin by enzymatic shearing simplifies op-timization of fragment size, and the mild enzymatic treatment preserves chromatin and epitope integrity. Enzymatic shearing is a great choice for users who do not routinely perform ChIP and either do not own a sonicator or are not proficient in its use.
Study two binding events on the same DNA locusRe-ChIP-IT takes advantage of the same magnetic-bead based ChIP method developed for ChIP-IT Express. However, Re-ChIP-IT was designed for sequential ChIP, in which two ChIP reactions using different antibodies are performed in series on the same sample. This makes it possible to simultaneously assay for two unique binding events at the same genomic region of interest.
Sonication products for more consistent shearingFor those who want to use sonication to achieve more consis-tent results from chromatin preparation, Active Motif offers both the EpiShear™ Probe Sonicator for direct sonication of samples and the Q800R® Sonicator for multi-sample prepara-tion of chromatin. These are the same sonicators that our own ChIP Assay Experts™ routinely use to prepare chromatin for ChIP.
ChIP to study non-coding RNA interactionsNon-coding RNAs play important roles in chromatin structure and transcriptional silencing. RNA ChIP-IT uses our magnetic-bead based ChIP method to enable the study of RNA-protein interactions in chromatin. All components are optimized to recover RNA from ChIP for downstream analysis.
Headed straight into Next Generation Sequencing?ChIP-IT ChIP-Seq is designed for performing ChIP-Seq analysis on the Illumina® sequencing platforms. It combines the ChIP-IT High Sensitivity Kit (left), the ChIP-IT qPCR Analysis Kit for validation of ChIP DNA (see page 10), and a set of library construction reagents suitable for the preparation of 10 Next Generation sequencing libraries.
![Page 8: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/8.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com6
ChiP saMPle PreParaTion insTruMenTs
Sonication Productsreproducible sample preparation ensures consistent results
Precise probe positioning enhances reproducibilityThe EpiShear Cooled Sonication Platform used in combination with the EpiShear Probe Sonicator greatly increases reproduc-ibility between samples by enabling you to precisely position the depth of the microtip probe in your sample. The platform allows for precise recreation of parameters for optimal depth settings. The platform is mounted inside a sound enclosure and includes a Tube Cooler (available for microfuge, 15 ml and 50 ml tubes) to keep the sample cold during sonication. For more information, please visit www.activemotif.com/platform.
Great results start with reliable sample preparation. Whether you are preparing chromatin for ChIP or DNA for methylation studies and Next Generation sequencing, Active Motif’s EpiShear™ Probe
Sonicator, Cooled Sonication Platform and Q800R Sonicator® provide reproducible sonication conditions to ensure better consistency between sample preparations and experiments.
Experience the versatility of probe sonicationThe EpiShear Probe Sonicator (Figure 1) is ideal for shearing chromatin, DNA and RNA, or for cell disruption and homog-enization. With a variety of microtip probe sizes available, you can process samples rang-ing from 200 µl to 50 ml. In addition, the EpiShear Probe Sonicator offers adjustable amplitude, adjustable pulse and a programmable timer to allow modification of sonication conditions to determine the optimal settings for your sample and application. Each unit is supplied with a 1/8" microtip probe and is backed by a two-year warranty. For more information, visit www.activemotif.com/probe.
Product Cat. No.
EpiShear™ Probe Sonicator 53051
EpiShear™ 5/64" (2 mm) Sonicator Probe 53056
EpiShear™ 1/4" (6.4 mm) Sonicator Probe 56057
EpiShear™ Cooled Sonication Platform 53080
Sound Enclosure 53060
Support Stand / Converter Clamp 53054
Q800R Sonicator® 53062
Eliminate variability with multi-sample processingDirect sonication is problematic and time-consuming for high-throughput processing or for processing small sample volumes where a probe causes foaming or aerosolization. The Q800R Sonicator utilizes a high-intensity ultrasonic horn for indirect high-throughput sonication of chromatin, DNA and other biological, pharmaceutical and industrial sample types. The unit contains an 8-sample tube holder that accommodates up to eight samples simultaneously (50 µl - 1.2 ml sample per vial) in sealed 1.5 ml polysty-rene tubes to prevent cross-contamination and foaming. The sam-ples are continuously rotated during process-ing to further reduce sample variability. The unit also includes a fully programmable, digitally controlled generator, a compact sound enclosure to house the ultrasonic cup horn and water bath, and a chiller for continuous cooling of the samples (Figure 2). For more information, please visit www.activemotif.com/q800r.
Control IgG Control IgG
EpiShear Probe Q800R Sonicator
RNA pol II RNA pol II
% D
NA
Reco
vere
d
0.000%
0.020%
0.040%
0.060%
0.008%
0.100%
0.140%
0.120%
0.160%
0.180%
F I G U R E 3 :HeLa chromatin was sheared with the EpiShear Probe and Q800R Sonicators and analyzed by ChIP using the ChIP-IT® Express Kit (Catalog No. 53008, see page 9).
F I G U R E 1 :The EpiShear Probe Sonicator.
F I G U R E 2 :The Q800R Sonicator.
![Page 9: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/9.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 7
ChiP saMPle PreParaTion KiTs
ChIP-IT® Express Shearing Kitsoptimize your shearing before starting ChIP
Chromatin preparation from different cell and tissue types can be challenging. Conditions must often be optimized for each specific sample type, causing you to burn quickly through kit reagents. To address this issue, Active Motif offers our ChIP-IT
Express Shearing Kits, which contain the same chromatin prepara-tion components found in our ChIP-IT Express Kits in quantities sufficient to optimize the sonication or enzymatic shearing con-ditions prior to preparing chromatin from your samples for ChIP.
Dounce homogenization improves chromatin yieldWhen preparing sheared chromatin samples, efficient cell lysis is critical to ensure the highest yields and most consistent results. Whether you are performing sonication or enzymatic shearing, we strongly recommend the use of a Dounce Homogenizer, which shears the cell mem-brane without disrupting the nuclei. Active Motif’s Dounce Homogenizers are available in 1 ml and 15 ml sizes for small and large sample preparations, and they include both a tight and loose pestle, enabling you to select the appropriate degree of cell disruption (Figure 2).
F I G U R E 2 :Dounce homogenizer, tight & loose pestle.
Product Format Cat. No.
ChIP-IT® Express Shearing 10 rxns 53032
ChIP-IT® Express Enzymatic Shearing 10 rxns 53035
ChIP-IT® Fixation Buffer 3 ml 53038
Dounce Homogenizer 1 ml15 ml
4040140415
Reagents to optimize shearing by sonicationThe first step in successful ChIP is shearing the chromatin into 200-1000 bp fragments. This can be difficult when using sonication where conditions have to be highly optimized to produce the correct frequency and amplitude of ultrasonic pulses to achieve the correct fragment size. Despite the chal-lenges, the advantage of sonication is that it produces more consistent preparation of sheared chromatin. For research-ers using sonication for chromatin preparation who are either performing chromatin immunoprecipitations in high volume or are optimizing shearing conditions, the ChIP-IT Shearing Kit provides the identical components for chromatin preparation from our ChIP-IT Express Kit (page 9) to ensure you do not run out of reagents. The ChIP-IT Shearing Kit can be used with Active Motif’s EpiShear Probe Sonicator (page 6) to prepare your chromatin samples for use with our ChIP-IT Express Kits (Figure 1A) as well as with other ChIP methods.
Sonication-free shearing with enzymatic digestionNo sonicator? No problem! Not everybody owns a sonicator or wishes to become proficient in its use. For new users, issues such as emulsification and overheating make it difficult to optimize sonication. Because sonication can be challenging, and even intimidating, Active Motif has developed an extremely user-friendly method to shear chromatin for ChIP by enzymatic digestion. The ChIP-IT Enzymatic Shearing Kit uses a propri-etary Enzymatic Shearing Cocktail that quickly and gently shears DNA (Figure 1B) while preserving its integrity and modifications. Because enzymatic shearing is solely time and temperature de-pendent, the issues associated with sonication are eliminated.
Our optimized ChIP-IT Fixation Buffer can be used in the form-aldehyde cross-linking step of chromatin fixation to reduce pH effects and improve consistency of sample preparation.
F I G U R E 1 :Sheared chromatin prepared using either (A) the ChIP-IT Express Shearing Kit and the EpiShear Probe Sonicator or (B) the ChIP-IT Express Enzymatic Shearing Kit.
What’s in the box?The ChIP-IT Shearing and Enzymatic Shearing Kits contain sufficient shearing components to make 10 chromatin preparations from three 15 cm plates (4.5 x 107 cells); each chromatin preparation will yield enough material to perform approximately 6 ChIP reactions.
![Page 10: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/10.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com8
ChIP-IT® Express Enzymaticno sonicator? no problem with our enzymatic ChIP kit
The biggest obstacle to initiating your first ChIP experiment is the requirement of sonication equipment for chromatin prepara-tion. In response, Active Motif developed the first sonication-free ChIP kit. The ChIP-IT Express Enzymatic Kit uses a propri-
etary enzymatic digestion method to simplify the DNA shearing step of our highly popular 1-day ChIP-IT Express protocol, making it easier than ever to get started on your first ChIP. For complete details, please visit us at www.activemotif.com/chipitexpress.
ChIP without sonicationChromatin shearing is most commonly done by sonication. However, many laboratories are not equipped with sonicators; sonication can also be challenging to optimize, making it intimidating for first-time users. Because of this, Active Motif developed the ChIP-IT Express Enzymatic Kit, the first sonica-tion-free ChIP kit. It provides a robust, user-friendly method for targeted gene enrichment by utilizing enzymatic digestion, rather than traditional sonication, to shear chromatin in prepara-tion for ChIP. The enzymatic method is designed for simplicity to give even the most inexperienced ChIP user the ability to prepare chromatin and perform ChIP.
soniCaTion-free ChiP
ChiP-iT exPress enzyMaTiC advanTages
• No sonication required
• User-friendly protocol
• Simplifies optimization of fragment size
• Mild enzyme treatment preserves modifications
• Perform ChIP in just 1 day
How does it work? The ChIP-IT Express Enzymatic Kit uses a proprietary Enzymatic Shearing Cocktail and Digestion Buffer that quickly shears chromatin into 200-1000 bp fragments (see page 7, Figure 1B). Because enzymatic shearing is solely time and temperature dependent, problems associated with sonication, such as over-heating and emulsification, are eliminated. Enzymatic shearing is not only simpler, but it also makes it easier to optimize shearing conditions and get more reproducible DNA fragmentation from sample to sample, improving your ChIP results.
The components and protocol for ChIP are identical to those found in our highly popular ChIP-IT Express Kit (page 9), which utilizes magnetic beads to provide an extremely streamlined and efficient method to perform ChIP analysis in just 1 day.
What’s in the box?ChIP-IT Express Enzymatic Kits provide sufficient components to perform 25 ChIP reactions. Sufficient shearing reagents are included to perform 2 shearing optimizations and then make 5 preparations of sheared chromatin from three 15 cm plates (4.5 x 107 cells); each of these chromatin preparations yield enough material to perform approximately 6 ChIP reactions.
Complementary products• We recommend that you use a ChIP-IT Control Kit (page 19)
appropriate for your sample type, as the use of controls can help with troubleshooting, interpreting your results and vali-dating antibodies for use in ChIP.
• If you need to shear more chromatin, the stand-alone ChIP-IT Express Shearing Kit (page 7) provides reagents to perform and optimize the shearing portion of the protocol.
• Validated ChIP Control qPCR primer sets (page 18) are also available for use as positive and negative controls for many of the more common ChIP targets.
Product Format Cat. No.
ChIP-IT® Express Enzymatic 25 rxns 53009
![Page 11: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/11.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 9
Product Format Cat. No.
ChIP-IT® Express 25 rxns 53008
why use ChiP-iT exPress?• Complete Solution – includes all necessary components
for performing ChIP
• Get results in just 1 day – 4-hour immunoprecipitation and easy-to-follow streamlined protocol
• No need to optimize – Reagents and protocols are already optimized for superior sensitivity
• Ideal for abundant proteins or validated antibodies
• Sensitive – as few as 100,000 cells needed per ChIP reaction
Single day ChIPFor those who want to achieve robust, reproducible results from ChIP but do not want the hassle of optimizing reagents and conditions, we have the solution. Active Motif’s ChIP-IT Express Kits provide a complete set of highly optimized reagents and protocols to perform ChIP. The ChIP-IT Express method (Figure 1) improves on traditional ChIP by reducing or eliminating several time-consuming steps. These kits utilize protein G magnetic beads, which have much lower background binding than traditional agarose beads. This reduced background has made it possible to eliminate some of the steps required in more conventional protocols like pre-clearing and blocking. Washing is much easier because the spin steps have been replaced by rapid magnetic pull-down. Collectively, all of the improvements included in ChIP-IT Express give you the capabil-ity to perform your reactions in PCR tubes with a multi-channel pipettor, which reduces your effort and improves consistency.
Conventional ChIP requires at least two million cells as starting material, which can be labor-intensive to obtain and problemat-ic with some cell lines. ChIP-IT Express Kits have been optimized to provide superior target gene enrichment using minimal sample input. The kits can routinely produce excellent results with chromatin prepared from as few as 100,000 cells.
F I G U R E 1 :Schematic of chromatin immunoprecipitation using ChIP-IT Express.
Cross-link protein to DNA in living cells with formaldehyde.
Break open cells and shear DNA by Sonication or Enzymatic Shearing.
Reverse cross-links, digest withProteinase K, then stop reaction.
DNA is ready for analysis.
Elute chromatin, pellet beadswith magnet and transfer
supernatant to a fresh tube.
Add primary antibody of interest.
Capture antibody-boundprotein/DNA complexes and wash using Magnetic Beads.
F I G U R E 2 :The ChIP-IT Express Kit was used to perform ChIP using MCF-7 chromatin and Histone H3K4me3 antibody (Catalog No. 39915). qPCR analysis of enriched DNA using Negative Control Primer Set 1 (Catalog No. 71001), primers specific to a gene desert and Positive Control Primer Set GAPDH-2 (Catalog No. 71006) show enrich-ment of H3K4me3 at GAPDH promoters but not at gene deserts, as expected.
0
100
200
300
400
500
600
Bind
ing e
vent
s det
ecte
d pe
r 100
0 ce
lls
Negative Primer Set 1
NegativeGene Desert
Positive Primer SetGAPDH-2
ChIP-IT® Expressmagnetic beads make ChIP fast, easy & more reproducible
Active Motif’s ChIP-IT Express Kit provides a highly optimized and streamlined method that enables users to perform ChIP analysis in just 1 day. The kit was the first to utilize magnetic beads for faster and more efficient sample processing, reduced background and minimal sample loss. This results in superior
sensitivity and reproducibility as compared to traditional ChIP methods. Successful ChIP results are routinely achieved with chromatin starting from as few as 100,000 cells. Learn why ChIP-IT Express is the most published ChIP kit on the market. For more information, visit www.activemotif.com/chipitexpress.
ChiP wiTh soniCaTion
![Page 12: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/12.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com10
perform ChIP on low abundance transcription factor targetsChIP-IT® High Sensitivity
TransCriPTion faCTor ChiP
Performing ChIP on low abundance transcription factors is technically challenging. Active Motif’s ChIP-IT High Sensitivity Kit is designed to provide superior sensitivity through the use of optimized reagents that minimize sample loss and reduce background. This enables successful detection of transcription
factor targets from as few as 50,000 cell equivalents, or as few as 1,000 cell equivalents when working with higher abundance targets. The ChIP-IT High Sensitivity method has been validated with successful performance in qPCR and ChIP-Seq applications using hundreds of samples and antibodies.
Benefits of ChIP-IT High SensitivityThe ChIP-IT High Sensitivity Kit utilizes specially formulated buffers for preparation of high-quality chromatin from minimal amounts of cells or tissue. During the immunoprecipitation reaction, low-background protein G agarose beads and an antibody blocker are used to reduce non-specific binding. Specialized ChIP buffers are designed to enhance enrichment and reduce the presence of non-specific DNA. ChIP filtration columns are used for faster, easier and more consistent capture and wash steps. The result is a kit that is capable of delivering both higher signals and reduced background levels as compared with other commercially available ChIP kits (Figure 1). These features enable you to perform successful ChIP reactions on low abundance transcription factors, or starting with limited sample material or antibodies with low-affinity to their targets. The high quality ChIP-enriched DNA is ready for use in down-stream applications such as ChIP-Seq, ChIP-chip and qPCR.
Product Format Cat. No.
ChIP-IT® High Sensitivity 16 rxns 53040
ChIP-IT® qPCR Analysis Kit 10 rxns 53029
ChiP-iT high sensiTiviTy advanTages
• Ideal for ChIP on low abundance transcription factors
• Optimized reagents minimize background signal
• Sensitive enrichment from as little as 1,000 cell equivalents per immunoprecipitation reaction
• Extensively tested across multiple sample types and anti-bodies with proven performance for ChIP-Seq & qPCR
ChIP Kits Targeting Low Abundance Transcription Factors
0
10
20
30
Neg Ctrlprimers
ESRRAprimers
Neg Ctrlprimers
ESRRAprimers
Neg Ctrlprimers
ESRRAprimers
Neg Ctrlprimers
ESRRAprimers
ChIP-IT® HS Competitor M Competitor I Competitor D
Bind
ing
even
ts d
etec
ted
/ 1,0
00 ce
lls
NCOA2 antibodyNeg Ctrl IgG
No enrichment
High background
Non-specific binding
F I G U R E 1 :ChIP-IT High Sensitivity is the only ChIP kit to successfully enrich for low abundance transcription factor proteins while minimizing background signal.
F I G U R E 2 :ChIP-Seq data showing peaks from transcriptional co-factor NCOA2 in the promoters of two genes. ChIP was performed using the ChIP-IT High Sensitivity Kit, confirmed with the ChIP-IT qPCR Analysis Kit and followed by sequencing on the Illumina Next-Gen sequencing platform.
Have confidence in your ChIP-SeqBefore investing time and money into expensive Next Genera-tion sequencing, it is recommended to validate the quality of your ChIP-enriched DNA. Using our years of experience with testing hundreds of samples and antibodies, Active Motif has developed the ChIP-IT qPCR Analysis Kit, which can be used in combination with the ChIP-IT High Sensitivity Kit to confirm the quality of the ChIP-enriched DNA.
The ChIP-IT qPCR Analysis Kit includes DNA standards and con-trol primer sets with recommendations for data interpretation to evaluate the success of the ChIP reactions. Following these recommendations will enable you to verify that the ChIP DNA is suitable for sequencing. To learn more about the ChIP-IT qPCR analysis Kit, please visit www.activemotif.com/qPCRanalysis.
![Page 13: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/13.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 11
ChIP-IT® ChIP-Seqstreamlined genome-wide ChIP workflow for Next Generation sequencing
ChiP-seq
The combination of ChIP with genome-wide analysis using Next Generation sequencing (ChIP-Seq) is a powerful approach that can provide insights into gene regulation, the impact of chromatin modifications on gene expression and signaling path-way mechanisms. The ChIP method enriches for protein-DNA
complexes using an antibody against a protein of interest. Oligo-nucleotide adapters are then ligated to the ChIP-enriched DNA before the size-selected library is amplified and purified for use in Next Generation sequencing. Analysis of the sequencing data will identify the global binding sites for the protein of interest.
ChIP for Next Generation sequencingActive Motif’s ChIP-IT ChIP-Seq Kit provides proven reagents, streamlined protocols and validation controls to ensure suc-cessful ChIP-Seq using the Illumina® sequencing platforms. The assay utilizes a highly consistent and robust chromatin immunoprecipitation and purification procedure that is sensi-tive enough for use with challenging antibodies and transcrip-tion factors. The kit also includes Active Motif’s ChIP-IT qPCR Analysis Kit which was developed based on our years of experi-ence testing hundreds of samples and antibodies to establish guidelines to validate the quality of the ChIP DNA. The kit also includes a set of library construction reagents suitable for the preparation of ten Next-Gen sequencing libraries* (Diagram 1).
Product Format Cat. No.
ChIP-IT® ChIP-Seq 10 libraries 53041
F I G U R E 1 :ChIP-IT ChIP-Seq was performed using a Histone H3K4me3 pAb (Catalog No. 39159) on mouse livers. The data shows the presence of H3K4me3 at the transcription start sites of several Zfp genes.
whaT’s in The box?• Optimized protocol and buffers to perform ChIP starting
from fresh or frozen cells or tissues
• Purification reagents to clean up ChIP-enriched DNA
• ChIP-IT qPCR Analysis Kit to confirm the quality of the ChIP-enriched DNA prior to sequencing
• Library construction reagents and protocol for the preparation of ten NGS libraries * Adapter sequences to generate single end, paired end or barcoded libraries are not
included in the kit and must be purchased separately.
D I AG R A M 1 :Flow chart of the ChIP-IT ChIP-Seq method.
![Page 14: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/14.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com12
PbMC ChiP
ChIP-IT® PBMC
For researchers working with primary cells who want to do ChIP, PBMCs make it difficult to extract quality chromatin because they resist lysis under conditions normally suitable for other cell types. Active Motif’s ChIP-IT PBMC Kit offers a complete
solution for ChIP including specialized reagents and protocols to enable the extraction of high-quality chromatin from PBMCs and integrated components and protocols for ChIP and DNA purifi-cation from our highly popular ChIP-IT High Sensitivity Kit.
The challenge of performing ChIP on PBMCsPBMCs, such as lymphocytes (T cells, B cells & NK cells), dendritic cells and monocytes are a critical component of the peripheral immune system. These primary cells serve as popular model systems for various clinical applications and in studies of immunology, infectious disease and cancer.
However, for researchers who want to perform ChIP and ChIP-Seq analysis, extracting quality chromatin from these notoriously difficult-to-lyse cells presents a challenge. Active Motif leveraged its years of experience working with these difficult-to-lyse cell types into devel-oping a kit to finally enable researchers to perform the entire ChIP workflow, from sample preparation to DNA purification, using PBMCs as the starting material.
H3K9ac ChIP on CD8+ T cells
0
100
200
300
400
500
600
Negative Primer Set 1
Positive Primer SetACTB-2
Positive Primer SetGAPDH-2
Bind
ing
even
ts d
etec
ted
per 1
000
cells
T cell population 1T cell population 2
ChIP-IT PBMC: a complete solution for ChIPActive Motif’s ChIP-IT PBMC Kit offers a complete solution for performing chromatin immunoprecipitation from myeloid and lymphoid cells. The kit includes specially formulated reagents and protocols to enable extraction of high-quality chromatin from difficult-to-lyse PBMCs. Also included in the kit are components and protocols for performing ChIP and DNA purification from our highly popular ChIP-IT High Sensitivity Kit (page 10). These components are designed to work with limited sample amounts to significantly reduce background and sample loss. Combined, these reagents help you achieve better ChIP data by improving sensitivity and consistency so you get the best results from chromatin enrichment of your PBMC-extracted chromatin.
What’s in the box?The ChIP-IT PBMC Kit contains all the necessary reagents to perform 16 chromatin preparation reactions and 16 ChIP reac-tions. It is recommended to start with a minimum of 1 x 107 cells for chromatin preparation. DNA purification reagents are also provided for clean-up of eluted DNA for downstream applica-tions. For highly sensitive applications such as Next Generation sequencing, the ChIP-IT qPCR Analysis Kit (page 10) is recom-mended to evaluate the quality of the ChIP-enriched DNA.
F I G U R E 2 :ChIP-Seq data for Histone H3K4me2 antibody (Catalog No. 39141) using chromatin from mouse primary T cells. ChIP was performed using the ChIP-IT PBMC Kit, confirmed with the ChIP-IT qPCR Analysis Kit and followed by sequencing on the Illumina Next-Gen sequencing platform.
Product Format Cat. No.
ChIP-IT® PBMC 16 rxns 53042
ChIP-IT® qPCR Analysis Kit 10 rxns 53029
F I G U R E 1 :ChIP-IT PBMC was used to perform ChIP using H3K9ac antibody and chromatin from CD8+ T cells. The data shows H3K9ac enrichment at ACTB and GAPDH promoters.
complete solution for ChIP from B and T cells
![Page 15: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/15.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 13
perform ChIP on FFPE samplesChIP-IT® FFPE
Active Motif has a long history of innovation in chromatin immunoprecipitation assays. Active Motif has leveraged its expertise with high sensitivity ChIP to develop the first com-mercially available kit to perform ChIP from FFPE samples for
use in Next Generation sequencing. The ChIP-IT FFPE Chromatin Preparation Kit and the ChIP-IT FFPE Kit are first-of-their-kind products that enable extraction and ChIP analysis of chromatin from FFPE histological slides or sections from tissue blocks.
Perform ChIP on FFPE samples for NGSFormalin-fixed paraffin-embedded (FFPE) tissue serves as the gold standard for the preservation of pathology samples. These samples harbor valuable information about the epigenetic state of normal vs. diseased tissues that can be used in disease, diagnostic and biomarker discovery research. Traditionally, it has not been possible to perform ChIP on FFPE samples because it is difficult to extract high-quality chromatin from such limited material. In addition, the formalin fixation process often causes degradation and loss of antigenicity. Active Motif’s ChIP-IT FFPE Chromatin Preparation Kit enables chromatin extraction from FFPE samples to use in conjunction with our ChIP-IT FFPE Kit for chromatin immunoprecipitation to generate high quality ChIP-enriched DNA for downstream analysis by qPCR or Next Generation sequencing (Figure 1).
Enrich for low or high abundance targetsActive Motif’s ChIP-IT FFPE Kit is the only ChIP kit available that can enrich for ChIP DNA from both low abundance targets (transcription factors) or high abundance targets (histones) us-ing FFPE starting material. Other ChIP kits do not provide the level of sensitivity and minimal background that are required for specific enrichment from such compromised and limited starting material. The ChIP-IT FFPE Kit includes components for performing the ChIP reaction and a positive control antibody to validate success of the procedure. It is designed to be used in conjunction with our ChIP-IT FFPE Chromatin Preparation Kit that provides components for the chromatin extraction procedure.
Product Format Cat. No.
ChIP-IT® FFPE 16 rxns 53045
ChIP-IT® FFPE Chromatin Preparation Kit 5 rxns 53030
ChIP-IT® qPCR Analysis Kit 10 rxns 53029
Prepare chromatin from virtually any FFPE sample typeTo perform chromatin extraction from FFPE samples requires the use of the our ChIP-IT FFPE Chromatin Preparation Kit. This kit provides optimized reagents and a comprehensive protocol to extract ChIP-grade chromatin from preserved human, mouse or rat samples. These include reagents for removal of paraffin, hydration of FFPE samples, chromatin shearing and purification, along with DNA standards and primer sets as controls to assess chromatin quality. Table 1 lists examples of the sample material we have successfully validated with the ChIP-IT FFPE Chromatin Preparation method. While the quality of the extracted chromatin is dependent upon fixation and storage conditions, we have successfully extracted ChIP-grade chromatin from normal and tumor human colon FFPE blocks that were stored over 10 years under less than ideal conditions.
ffPe ChiP
FFPE sample Sample used per chromatin prep
Human colon Tissue block – five 20 µm sections
Human kidney Tissue block – twenty-five 20 µm sections
Human lung Tissue block – two 20 µm sections
Rat whole brain 5 slides – two 5 µm sections per slide
Rat hippocampus 25 slides – two 5 µm sections per slide
TA B L E 1 :Examples of FFPE samples successfully used with the ChIP-IT FFPE Kit.
F I G U R E 1 :Histone H3K4me3 ChIP-IT FFPE ChIP-Seq results from normal and tumor FFPE colon samples, and YY1 ChIP-Seq from a normal FFPE colon sample.
YY1 ChIPNormalColon
H3K4me3 ChIPNormalColon
H3K4me3 ChIPTumorColon
![Page 16: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/16.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com14
improve the quality and consistency of your own ChIP protocolReady-to-Use ChIP Columns
Active Motif’s Protein G Agarose Columns provide the perfect solution for labs that routinely perform ChIP that want to im-prove the quality and consistency of their own optimized ChIP protocol. The columns’ protein G agarose beads are specifically
formulated to strongly bind IgG and reduce non-specific binding during incubation of your ChIP reaction. For wash steps, the col-umn filtration method provides a faster alternative to centrifu-gation and prevents any sample loss for better reproducibility.
Protein G Agarose ColumnsActive Motif’s ready-to-use Protein G Agarose Columns contain the same high-affinity protein G agarose beads included in our highly popular ChIP-IT® High Sensitivity Kit (page 10). The beads have been spe-cifically engineered to bind IgG with high affinity and eliminate non-specific binding, making them a better option for ChIP than traditional agarose or protein G mag-netic beads. The protein G agarose beads supplied in each column have a binding capacity of 10 µg IgG/µl bead and can be adapted to work with any ChIP protocol.
Prevent sample loss and improve reproducibility of your own optimized ChIP protocolThe beads have been pre-washed and loaded into filtration columns. Simply add the ChIP reaction to the columns and use the cap to seal. The incubation and wash steps are all performed on the column, which streamlines the process and prevents the loss of any material. This provides a faster solu-tion than centrifugation or magnetic separation methods, and results in better reproducibility between samples.
In addition to ChIP, the Protein G Agarose Columns can also be used for co-immunoprecipitation (Co-IP) experiments. The columns have been validated using Active Motif’s Nuclear Com-plex Co-IP Kit (Catalog No. 54001), where the strong binding affinity and reduced background of the protein G agarose make these columns an ideal tool for antibody capture during Co-IP. For more information, visit www.activemotif.com/protein-g.
What’s in the box?Protein G Agarose Columns contain 30 µl of protein G agarose beads per column and have a binding capacity of 10 µg IgG/µl bead. They are available in pack sizes of 5 or 30 columns.
Product Format Cat. No.
Protein G Agarose Columns 30 rxns5 rxns
5303953037
ChIP-IT® Fixation Buffer 3 ml 53038
ChIP-IT® Protein G Magnetic Beads 25 rxns 53014
ProTein g ColuMn advanTages
• Ready-to-use – the beads have been pre-washed and loaded into the column
• No pre-blocking needed – the protein G agarose beads have been engineered to eliminate non-specific binding
• Eliminate sample loss – the column ensures complete retention of the beads to prevent sample loss
• Versatile – use them for both ChIP and Co-IP experiments
ChIP-IT® Protein G Magnetic BeadsFor researchers looking to use a magnetic pull-down protocol to reduce background, speed up processing time and decrease sample loss, Active Motif offers the ChIP-IT Protein G Magnetic Beads. These are the same Protein G magnetic beads that are included in the ChIP-IT® Express Kits (pages 8-9) that enable ChIP to be performed in just 1 day.
Complementary products• Active Motif’s ChIP-IT Fixation Buffer is available as a stand-
alone reagent. This specially formulated buffer is used during the formaldehyde fixation step of chromatin preparation. Its use provides more consistent ChIP results by helping to eliminate pH effects during chromatin preparation.
• For co-immunoprecipitation, the Nuclear Complex Co-IP Kit (Catalog No. 54001) provides high quality reagents for both nuclear extract preparation and immunoprecipitation. The use of Protein G Agarose Columns in conjunction with the kit improves the efficiency of the capture of the IP complex.
ChiP ColuMns & MagneTiC beads
![Page 17: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/17.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 15
Re-ChIP-IT®analyze co-occupation of a locus with sequential ChIP
sequenTial ChiP
Cross-link protein to DNA in living cells with formaldehyde
Reverse protein/DNA cross-links, treat with
Proteinase K, and purify DNA
Break open cells and shear DNA
Add second primary antibody of interest
Collect antibody-boundprotein/DNA complexes using
Magnetic Beads
Add first primary antibody of interest
Collect antibody-boundprotein/DNA complexes using
Magnetic Beads
Analyze purified DNA
F I G U R E 1 :Schematic representation of the Re-ChIP-IT procedure.
F I G U R E 2 :Sequential chromatin immunoprecipitation performed using Re-ChIP-IT.
Sequential ChIP kit to analyze protein co-localization at genomic lociDNA regulatory elements direct changes in gene expression through their varied combination of interactions with transcrip-tion factors, cofactors and post-translational histone modifica-tions. Re-ChIP enables you to perform sequential chromatin immunoprecipitations using different antibodies in series on the same sample (Figure 1). This enables the analysis of the in vivo co-localization of two proteins and/or histone modifications that converge at the same genomic region of interest.
Sequential ChIP was technically challenging and difficult, until now. Active Motif’s Re-ChIP-IT Kit has adapted the ChIP-IT Express protocol for this technique to provide highly optimized reagents and a streamlined protocol, making it fast and easy to perform sequential ChIP (Figure 2). For complete information, visit www.activemotif.com/rechipit.
What’s in the box?The Re-ChIP-IT Kit provides sufficient reagents, buffers, columns and beads to perform 25 Re-ChIP reactions and PCR buffer/DNA loading dye to analyze Re-ChIP-enriched DNA by endpoint or qPCR. The Re-ChIP-IT Kit does not include the shearing components. However, ChIP-IT Express Shearing Kits (page 7), which provide the components needed to perform the shearing portion of the protocol, can be purchased separately.
Product Format Cat. No.
Re-ChIP-IT® 25 rxns 53016
Active Motif’s Re-ChIP-IT Kit provides a simple, fast and robust method to analyze in vivo co-occupation of epigenetic modifi-cations, transcription factors and regulatory proteins at the same DNA regulatory sequence. The method integrates protocols and
reagents from our ground breaking ChIP-IT Express Kits into a sequential ChIP protocol, providing researchers with the fastest, most convenient method to assay two proteins or distinct histone modifications at the same genomic region of interest.
Complementary productsRe-ChIP DNA can be analyzed downstream using our ChIP Control qPCR Primer Sets for use as positive and negative controls for many of the more common ChIP targets (page 18), as well as with our ChIP-IT Control Kits (page 19).
![Page 18: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/18.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com16
ChIP-IT® Express HTthe speed and efficiency of ChIP-IT Express in a convenient 96-well format
F I G U R E 2 :ChIP was performed on HeLa chromatin with ChIP-IT Express HT. Data shows PCR analysis results us-ing primers specific for GAPDH. Lanes 1-4: RNA pol II antibody. Lanes 5-8: Mouse IgG negative control. Lane 9: no DNA control. Lane 10: input DNA control.
F I G U R E 1 :With the efficient plate-based protocol of ChIP-IT Express HT, you can process up to 96 ChIP reactions at a time for true high-throughput ChIP.
high-ThroughPuT ChiP
High-throughput ChIP for conducting large-scale disease genomics studiesPerforming chromatin immunoprecipitation followed by high-throughput sequencing to study the effects of DNA-protein interactions or epigenetic marks on gene expression has become the gold standard. However, for researchers who need to perform ChIP analysis at a large scale to look at the influence of genetic variation or disease states across large cohorts, efficiency and reproducibility can be a challenge. That is why Active Motif developed ChIP-IT Express HT. The kit combines the speed and efficiency developed in the creation of our ground breaking magnetic bead-based ChIP-IT Express Kits with a 96-well plate-based format, enabling the rapid and efficient processing of a large number of ChIP reactions. Now it is possible to perform the time-saving ChIP-IT Express protocol in high throughput (Figures 1 & 2), with everything optimized to the level and quality you have come to expect from Active Motif’s ChIP-IT Express line of products.
Product Format Cat. No.
ChIP-IT® Express HT 96 rxns 53018
106 842 95 731
For researchers conducting large-scale ChIP studies to character-ize disease genomics, simplicity, speed, and reproducibility are of the utmost importance. To meet these needs, Active Motif adapted its highly popular ChIP-IT Express magnetic bead-based
protocol to a 96-well plate format to develop the ChIP-IT Express HT Kit. Now the simplicity, speed and reproducibility of ChIP-IT Express is available in a high-throughput format to enrich DNA for use in downstream ChIP-chip and ChIP-Seq analysis.
How does it work?The ChIP-IT Express HT Kit contains sufficient components to perform 96 ChIP reactions. The included LSV (Low Sample Vol-ume) Protein G-coated magnetic beads are provided ready-to-use. These beads have a high binding capacity for IgG, enabling them to be utilized in smaller volumes that reduce non-specific binding. Because of this lower non-specific binding, magnetic beads require fewer washing steps than agarose beads, and it is not necessary to pre-clear the chromatin. The magnetic beads are readily pelleted with commercially available 96-well magnetic stands. Magnetic beads pellet much more quickly than agarose beads, which are pelleted by centrifugation. This pelleting method also makes it easy to remove buffers without disturb-ing the beads, so washing can be performed using multi-channel pipettors. This dramatically reduces hands-on time and ensures sample-to-sample consistency. The LSV Protein G coated mag-netic beads are also optimized for use in the small sample size of a microplate well. The overall effect is a more efficient and streamlined protocol for faster, more reproducible ChIP results. To learn more, visit www.activemotif.com/htchip.
What’s in the box?The ChIP-IT Express HT Kit contains magnetic beads, purification columns, ChIP Buffers, reagents for immunoprecipitation, and a 96-well microplate and capstrips. Sufficient components are provided to perform 96 ChIP reactions. The ChIP-IT Express HT Kit does not include the shearing components found in the ChIP-IT Express Kits.
Complementary productsChIP-IT Express HT is compatible with chromatin prepared using our enzymatic or sonication-based shearing kits (page 7) for chromatin preparation, as well as with our ChIP-IT Control Kits (page 19).
![Page 19: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/19.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 17
The RNA ChIP-IT methodThe RNA ChIP-IT Kit offers a quick, reliable and user-friendly RNA-optimized method to perform ChIP for functional stud-ies of in vivo RNA associations with chromatin. In contrast to RNA immunoprecipitation (RIP) techniques designed to study RNA-protein associations with nuclear or cytoplasmic proteins in ribonucleoprotein (RNP) complexes, the RNA ChIP-IT method is specifically designed to isolate and identify RNAs associated with protein in a chromatin context (Figure 1).
RNA ChIP-IT uses a modified ChIP protocol that is optimized for extraction of endogenous chromatin, removal of DNA contaminants and preservation of RNA integrity. The protocol is simple and straightforward. Formaldehyde fixation is used to cross-link RNA to bound proteins. Chromatin shearing is com-bined with DNase treatment to yield DNA-free RNA-protein complexes that are then immunoprecipitated using antibodies specific to protein target(s) of interest. Cross-linking is reversed and RNA is recovered and treated a second time with DNase to ensure the absence of DNA. This generates a highly clean enriched RNA-ChIP sample for downstream analysis to ensure your results are attributable to RNA alone. For complete information, visit www.activemotif.com/rnachip.
Optimized RNA-ChIPActive Motif adapted the highly efficient magnetic bead-based protocol used in its ChIP-IT Express Kits to develop the first-of-its kind kit for RNA-ChIP. The RNA ChIP-IT Kit is specifically formulated for optimal immunoprecipitation and recovery of chromatin-associated non-coding RNA for downstream identifi-cation by various methods including qPCR. Because it utilizes a similar magnetic bead protocol to ChIP-IT Express, the kit offers the added advantages of ease of use, improved sensitivity, and reduced time and effort.
Product Format Cat. No.
RNA ChIP-IT® 25 rxns 53024
RNA ChIP-IT® Control Kit – Human 5 rxns 53025
0
0.4
0.8
1.2
% in
put r
ecov
ery
Suz12 Normal Rabbit IgG
lincSFPQ locus
1.6
2.0
F I G U R E 1 :The RNA ChIP-IT Kit was used on DNase I-treated HeLa chromatin with Suz12 antibody (Catalog No. 39357) and Normal Rabbit IgG control. Amplification plot (top) and % input recovery (bottom) data generated from RT qPCR analysis using primers for the lincRNA SFPQ locus show a 141-fold enrichment of the lincSFPQ region with Suz12 antibody.
rna ChiP-iT advanTages
• Specifically tailored to study chromatin-associated RNA
• Designed to remove DNA while maintaining RNA integrity
• Step-by-step protocols for fixation, sonication and immunoprecipitation of chromatin, all optimized for RNA preservation
• Includes all RNase and protease inhibitors at precise concentrations
• Separate control kit available with positive and negative control antibodies, and primers for the lincSFPQ locus
RNA ChIP-IT®for the study of RNA interactions with chromatin
rna ChroMaTin iMMunoPreCiPiTaTion
Nucleic acids purified from chromatin are 2-5% RNA. However, we are just beginning to unravel the role of non-coding RNAs in orchestrating chromatin architecture and gene expression. For example, long non-coding RNAs (lncRNAs) typically associated
with silent chromatin are now known to play a role in mainte-nance of active chromatin. Active Motif used its ChIP expertise to develop a unique RNA ChIP assay specifically designed to en-able researchers to study RNA associations in a chromatin context.
![Page 20: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/20.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com18
ChIP Control qPCR Primer Setsvalidated qPCR primers for use as ChIP controls
ChiP ConTrol PriMer seTs
Active Motif offers a large variety of qPCR primer sets for use as positive and negative controls for many of the more common ChIP targets. Use of our primer sets will save you the time and effort required to design, synthesize and test your own species/
gene-specific control primers. Each primer set has been tested in multiple cell lines for various proteins or histone modifications, and proven to work in both qPCR and endpoint PCR. They are also used routinely by our own Epigenetic Services division.
help, Active Motif provides species-specific qPCR primer sets validated for human and mouse (see below) as well as for rat, zebrafish, Drosophila and budding yeast. For an up-to-date list of all available qPCR primer sets, visit www.activemotif.com/qpcr.
Description Gene Control for Cat. No.
HUMAN
Negative Control Primer Set 1 Gene desert on chromosome 12Transcription factors, LSD1, RNA pol II, 5-mC (MeDIP), H3K9ac, H3K14ac, H3K27ac, H3K4me1, H3K4me2, H3K4me3, H3K36me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac
71001
Negative Control Primer Set 2 Gene desert on chromosome 4Transcription factors, RNA pol II, 5-mC (MeDIP), H3K9ac, H3K14ac, H3K27ac, H3K4me1, H3K4me2, H3K4me3, H3K36me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac
71002
Negative Control Primer Set 3 ACTB promoter H3K27me3, EZH2 71023
Positive Control Primer Set ACTB-1 ACTB intron 3 RNA pol II phospho Ser2, H3K36me3 71003
Positive Control Primer Set GAPDH-1 GAPDH intron 7 RNA pol II phospho Ser2, H3K36me3 71004
Positive Control Primer Set ACTB-2 ACTB promoterH3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, HDAC1, LSD1, Total RNA pol II, RNA pol II phospho Ser5
71005
Positive Control Primer Set GAPDH-2 GAPDH intron 1H3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, Total RNA pol II, RNA pol II phospho Ser5
71006
Positive Control Primer Set MYT1 MYT1 promoter H3K27me3, EZH2 71007
Positive Control Primer Set CCND2 CCND2 promoter H3K27me3, EZH2, Suz12 71008
Positive Control Primer Set ZC3H13 ZC3H13 exon 8 5-mC (MeDIP) 71009Positive Control Primer Set GEMIN4 Region 3́ of GEMIN4 5-mC (MeDIP) 71010
MOUSE
Negative Control Primer Set 1 Gene desert on chromosome 6Transcription factors, LSD1, RNA pol II, 5-mC (MeDIP), H3K9ac, H3K14ac, H3K27ac, H3K4me1, H3K4me2, H3K4me3, H3K36me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac
71011
Negative Control Primer Set 2 Gene desert on chromosome 17Transcription factors, LSD1, RNA pol II, 5-mC (MeDIP), H3K9ac, H3K14ac, H3K27ac, H3K4me1, H3K4me2, H3K4me3, H3K36me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac
71012
Negative Control Primer Set 3 Actb promoter H3K27me3, EZH2 71013
Negative Control Primer Set 4 Gapdh promoter H3K27me3, EZH2 71014
Positive Control Primer Set Actb-1 Actb intron 3 RNA pol II phospho Ser2, H3K36me3 71015
Positive Control Primer Set Gapdh-1 Gapdh intron 2 RNA pol II phospho Ser2, H3K36me3 71016
Positive Control Primer Set Actb-2 Actb promoterH3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, HDAC1, LSD1, Total RNA pol II, RNA pol II phospho Ser5
71017
Positive Control Primer Set Gapdh-2 Gapdh promoterH3K9ac, H3K14ac, H3K4me2, H3K4me3, H4K5ac, H4K8ac, H4K12ac, H4K16ac, Total RNA pol II, RNA pol II phospho Ser5
71018
Positive Control Primer Set Hoxc10 Hoxc10 intron 1 H3K27me3, EZH2 71019
Positive Control Primer Set Pax-2 Region 5́ to Pax-2 H3K27me3, EZH2 71020
Positive Control Primer Set Grik3 Grik3 intron 8 5-mC (MeDIP) 71021Positive Control Primer Set Zc3h13 Zc3h13 exon 10 5-mC (MeDIP) 71022
Positive & negative controls for common ChIP targetsDesigning primer sets for use as positive & negative ChIP controls can be difficult because the sites for transcription factor binding and epigenetic modifications vary from species to species. To
![Page 21: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/21.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 19
tools for better chromatin IP resultsChIP Accessory Kits and Reagents
ChiP aCCessories
F I G U R E 1 :ChIP was performed on Ready-to-ChIP HeLa Chromatin (Cat. No. 53015) with RNA pol II mouse mAb (Cat. No. 39097) alone or with the Bridging Antibody for Mouse IgG (Cat. No. 53017). Use of Bridging Antibody improves ChIP results.
0
100
200
300
400
500
600
RNA pol II mAb alone
Fold
Enric
hmen
t
550
4 162
RNA pol II mAb & Bridging Ab
Bridging Abalone
IgG alone
ChIP-IT® Control KitsAs ChIP is a DNA enrichment, not a purification, ChIPs are unavoidably contaminated with non-specific chromatin. This can lead to false positive PCR products that make data inter-pretation difficult. To solve this problem, Active Motif offers species-specific (human, mouse and rat) control kits for real-time or endpoint PCR to confirm the successful execution of the chromatin preparation and immunoprecipitation procedures and to assess the quality of your antibody and PCR reactions.
ChIP-IT Control qPCR Kits enable you to assess the quality and success of your ChIP procedure by real-time PCR analysis. They include a positive control RNA pol II antibody, a Bridging Antibody to enhance the binding affinity of mouse monoclonal antibodies, a negative control IgG antibody to assess non-spe-cific binding, and species-specific positive and negative control qPCR primers. The positive control primers detect ChIP enrich-ment of RNA pol II-DNA interactions at actively transcribed promoter regions, enabling you to assess the success or failure of your ChIP procedure. The negative control primers detect DNA sequences within “gene deserts” that lack any structural genes and, therefore, are devoid of RNA pol II interactions with DNA regulatory sequences. These primers serve to establish baseline non-specific enrichment so you can determine background binding levels within the same ChIP reaction.
ChIP-IT Control Kits are designed for assessment of your ChIP procedure by endpoint PCR. Each kit provides positive and negative control antibodies, a Bridging Antibody and a positive control PCR primer set. Unlike the ChIP-IT Control qPCR Kits, negative control primers are not included with the endpoint PCR control kits. A convenient PCR buffer/DNA loading dye is also included to make your PCR reactions gel-ready straight out of the thermocycler.
For details and a complete, up-to-date list of all available ChIP control products, visit www.activemotif.com/chipcontrols.
Ready-to-ChIP ChromatinReady-to-ChIP Chromatin is offered from a number of ENCODE cell lines that have been optimally sheared by sonication and validated in ChIP as a control or test sample. As a result, you can more easily validate your own antibodies and primer sets. The chromatin can be used with all of the ChIP-IT Express Kits and controls, so you can be certain that the only variable in validating a new antibody for ChIP is the antibody itself. For details, please visit www.activemotif.com/chipready.
Enhance ChIP and IP when using mouse antibodiesLow antibody binding can greatly reduce the quality of ChIP results. For improved ChIP when using mouse IgG antibodies, Active Motif offers the Bridging Antibody for Mouse IgG. This anti-mouse IgG binds with high affinity to both mouse primary IgG antibody and protein G-conjugated beads. As this greatly increases capture efficiency, ChIP results are markedly improved (Figure 1); Bridging Antibody also improves standard IP and Co-IP.
The permutations in ChIP experiments are numerous. We’ve been listening to your feedback for more than 10 years now and understand that, for example, you must often optimize sonication conditions before performing ChIP. Or, you may
be unsure of your chromatin quality, or the suitability of your antibody or primers for use in ChIP. To make your ChIP experi-ments more successful, we offer a line of accessories designed to make it easier to troubleshoot and validate your ChIP results.
Product Format Cat. No.
Ready-to-ChIP HeLa Chromatin 10 rxns 53015
Ready-to-ChIP Hep G2 Chromatin 10 rxns 53019
Ready-to-ChIP K-562 Chromatin 10 rxns 53020
Ready-to-ChIP NIH/3T3 Chromatin 10 rxns 53021
Bridging Antibody for Mouse IgG 500 µg 53017
![Page 22: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/22.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com20
Chromatin IP DNA Purification Kitrapid, simplified purification of your ChIP DNA samples
F I G U R E 2 :The Chromatin IP DNA Purification Kit enables efficient recovery of DNA fragments as small as 50 base pairs. DNA molecular weight markers (10 base pair ladder) were purified with the Chromatin IP DNA Purification Kit, run on a 5% agarose gel and stained with ethidium bromide to visualize the recovered DNA fragments.
Lane 1: DNA not purified.Lane 2: DNA after purification.
DNA that is larger than 50 base pairs is repre-sented equally in the purified and non-purified DNA samples. DNA fragments that are smaller than 50 base pairs (bracket) are not efficiently purified, and thus are not represented in the purified DNA sample (Lane 2, bracket).
F I G U R E 1 :The DNA Purification Binding Buffer has a pH indicator dye so the pH of the solution can be easily determined.
dna PurifiCaTion
Rapid method for use with many sample typesOnce your ChIP experiments are complete, DNA purification can be started immediately. The Chromatin IP DNA Purifica-tion Kit is compatible with samples from all of Active Motif’s ChIP-IT® Kits, or from any standard chromatin IP kit or pro-cedure. You can use your choice of mechanical or enzymatic shearing of chromatin, and either agarose or magnetic beads for upstream ChIP. The entire procedure takes only five to ten minutes, depending upon the number of samples to purify. The kit can also be used to purify methylated DNA samples en-riched using other Active Motif kits, including MethylCollector™ Ultra, HypoMethylCollector™, and the hMeDIP and MeDIP Kits. The Chromatin IP DNA Purification Kit is designed for use with a microcentrifuge for sample processing, but can also be used with a vacuum manifold.
Suitable for use in Next Generation sequencingThe purified DNA is suitable for use in many downstream analysis techniques, including PCR (endpoint & quantitative), microarray analysis & Next Generation sequencing. DNA can be successfully recovered from ChIP performed with as few as 10,000 cells. Depending upon the amount of chromatin used in ChIP, DNA recovery will range from 100 ng to 1 µg. The Chromatin IP DNA Purification Kit enables 85-100% recovery of DNA frag-ments greater than 50 base pairs in length (Figure 2); this is ideal for ChIP experiments as they usually require chromatin that has been sheared to 200-1500 bp.
How does it work?After your ChIP is complete, the ChIP DNA samples are mixed with the kit’s DNA Purification Binding Buffer. Because binding to the included purification columns is pH dependent, the Binding Buffer contains a convenient pH indicator dye (Figure 1). This enables you to see the pH of your samples before apply-ing them to the columns, helping ensure successful purification of your ChIP DNA. After binding, the DNA on the column is washed and then eluted using the included Elution Buffer.
Product Format Cat. No.
Chromatin IP DNA Purification Kit 50 rxns 58002
ChIP combined with genome-wide analysis can yield tremendous amounts of information about the distribution of transcription factors and epigenetic modifications. But many downstream analysis techniques require DNA that is free of contaminants
present in an eluted ChIP sample. Active Motif’s Chromatin IP DNA Purification Kit enables you to quickly clean up your ChIP DNA in preparation for analysis, without the need for labor-intensive, time-consuming phenol/chloroform extractions.
ChroMaTin iP dna PurifiCaTion KiT advanTages
• 85-100% recovery of purified DNA
• Start with as few as 10,000 cells
• Enables recovery of DNA fragments as small as 50 bp
• Use with Active Motif or other manufacturer’s ChIP kits
• Can also be used to purify DNA from our hMeDIP, MeDIP, MethylCollector Ultra & HypoMethylCollector Kits prior to MeDIP-Seq or qPCR
21
100 bp
50 bp
![Page 23: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/23.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 21
hisTone PePTide array
MODified™ Histone Peptide Array
Active Motif’s MODified Histone Peptide Array enables screen-ing of the binding specificity and cross-reactivity of antibodies or proteins to histone modifications using a simple Western blot-like detection method. Multiple modifications are repre-
sented on each peptide to enable studies of contextual effects of nearby modifications. The array features the most extensive coverage of histone modifications available from a commercial array for the most accurate assessment of cross-reactivity.
broadest coverage of modifications for screening of binding specificity
MODified Histone Peptide ArrayThe MODified Histone Peptide Array* is a valuable research tool that can be used to screen antibodies, proteins and enzymes for interactions with histones and their post-translational modi-fications. Each array contains 384 different histone modification combinations in duplicate. Modifications include acetylation, methylation, phosphorylation and citrullination on the N-terminal tails of histones H2A, H2B, H3 and H4.
This unique histone array contains up to four modifications per 19mer peptide to study not only individual modifications, but also to determine if the presence of neighboring modifica-tions alter site recognition and binding. The MODified Histone Peptide Array can be used to screen antibodies for cross-reac-tivity, as in Figure 1, or to study protein and enzyme interactions (page 22). The simple array protocol works like a Western blot. Either ECL-based or colorimetric detection systems can be used. The image is then captured using film or a CCD camera.
MODified Array Labeling KitFor a complete solution, the MODified™ Array Labeling Kit contains the buffers and reagents needed for easy labeling and chemiluminescent detection of the MODified Histone Peptide Array. The MODified Array Labeling Kit contains blocking buf-fer, wash buffer, rabbit and mouse HRP-conjugated antibodies and ECL reagents for chemiluminescent detection. For added convenience, a positive control c-Myc antibody is included to recognize the array’s control c-Myc tag. Sufficient reagents are provided for the detection of five MODified Histone Arrays.
Free software for analysisActive Motif’s Array Analyze Software is a free program de-signed for use with the MODified Histone Peptide Array. This PC-compatible software analyzes the spot intensities from the MODified array and generates a graphical analysis of the histone modification interactions (Figure 1). Information about spot intensity, averages and errors can be saved in Excel-compatible files. For added convenience, up to three individual modifica-tions can be displayed in superposition to the experimental data, enabling better visualization of neighboring effects.
F I G U R E 1 :The MODified Histone Peptide Array was used with the MODified Array Labeling Kit to screen Active Motif’s Histone H3K9me3 pAb (Catalog No. 39161) for cross-reactivity.
Histone H3K9me3 pAb
0
20
40
60
80
120
100
140
H3K9me3
H3K27me3
H3R2me2s
H3R2me2a
H3K4acH3K4me2
H3R8me2s
H3K4me3
H3K4me1
H3R2me2a
Spec
ificit
y Fa
ctor
Product Format Cat. No.
MODified™ Histone Peptide Array 1 array 5 arrays
13001 13005
MODified™ Array Labeling Kit 5 rxns 13006
Modified array advanTages
• Most extensive coverage – 59 histone modifications represented in 384 unique combinations
• Study neighboring effects – each peptide contains up to four modification combinations, enabling analysis of the effects of neighboring modifications
• Detects like a Western blot – fast and easy to use; works with either ECL-based or colorimetric detection
To learn more about the MODified Histone Peptide Arrays, MODified Array Labeling Kit, or to download the free Array Analyze Software, please visit www.activemotif.com/modified.
* CelluSpots™ arrays are manufactured under license by INTAVIS Bioanalytical Instruments AG and sold through Active Motif as MODified™ Histone Peptide Array.
![Page 24: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/24.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com22
hisTone PePTide array
screen protein domains for reactivity with histone modificationsMODified™ Protein Domain Binding Kit
Histone modifications are recognized and bound by specific proteins termed “writers”, “readers” and “erasers”. These pro-teins contain highly conserved binding domains, including bromodomains, chromodomains and Tudor domains (Table 1),
that mediate interactions with histones. Active Motif’s MODified Protein Domain Binding Kit is designed to be used with Active Motif’s MODified Histone Peptide Array to screen protein domains for interactions with histones and their modifications.
Product Format Cat. No.
MODified™ Protein Domain Binding Kit 5 rxns 13007
Domain Binding Site Function Examples
Bromo Acetylated lysine residues
Regulates chromatin structure and gene expression as part of HATs or chromatin remodeling factors
TAFII250,
PCAF, GCN5
Chromo Methylated lysine residues
Associated with the assembly of protein complexes on chromatin
HP1b, MPP8, CHD1
Tudor Methylated lysine or arginine residues
It may be involved in RNA binding, DNA damage response and chromatin modification
JMJD2A, 53BP1, SMN
MBT Methylated lysine residues
Unknown, but MBT often appears as repeats in proteins associated with transcriptional repression
L(3)MBTL, CGI-72
How does it work?The MODified Protein Domain Binding Kit contains optimized buffers and reagents to analyze binding of His-tagged protein domains to histone modifications using the MODified Histone Peptide Array (page 21). Also included are reagents for chemiluminescent detection for imaging and analysis of the binding events using Active Motif’s free Array Analyze Software.
The simple assay works like a Western blot. The array is incubated in blocking buffer. Then, your His-tagged protein domain of interest is added to the array followed by detection via an anti-His6-tag antibody and an HRP-conjugated secondary antibody. ECL detection is used to produce a chemiluminescent signal that is captured using a CCD camera or film (Figure 1A). The array image is then analyzed using the Array Analyze Software (page 21) program to quantify each spot’s intensity and to determine how the presence or absence of neighboring modifications affect binding of the protein domain to a given modification of interest. For example, JMJD2A binding at H3K27me3 is not impacted by modifications at R26, but is greatly inhibited by the co-occurrence of S28ph (Figure 1B).
What’s in the box?The MODified Protein Domain Binding Kit contains interaction buffer, wash buffer, anti-His6-tag antibody, HRP-conjugated secondary antibody and ECL reagents for chemiluminescent detection. For added convenience, His-tagged recombinant G9a protein, which is a known histone methyltransferase that targets lysine 9 on Histone H3, is included for use as a positive control.
Sufficient components are provided to perform up to 5 reac-tions. MODified Histone Peptide Arrays are not included in the MODified Protein Domain Binding Kit; arrays must be purchased separately. See page 21 for details and ordering information.
TA B L E 1 :Examples of common protein domains and their binding specificity and function.
F I G U R E 1 :Shown are (A) a representative image of a developed MODified Peptide Array and (B) data produced by the Array Analyze Software to analyze the binding specifici-ties of the JMJD2A protein domain to various histone modifications using the MODified Protein Domain Binding Kit and the Modified Histone Array.
Binding Specificity of JMJD2A
0
0.2
0.4
0.6
0.8
1.0
H4 unm
odH4 K
20me3
H4 K16a
cH4 K
12ac
H4 K16a
c K20
me3
H4 K12a
c K16a
c K20
me3H3 u
nmod
H3 K27m
e3H3 R
26me2
sH3 R
26me2
aH3 R
26Citr
H3 R26
me2s K
27me3
H3 R26
me2a K
27me3
H3 R26
Citr K27m
e3
H3 K27m
e3 S2
8ph
H3 R26
me2s K
27me3
S28p
h
H3 R26
me2a K
27me3
S28p
h
MODified™ Array Peptide Identity
Aver
age
Inte
nsity
Addition of S28ph inhibits binding
Addition of modifications at R26have little effect on binding at K27me3
Single K27me3modification
A
B
![Page 25: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/25.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 23
hisTone ModifiCaTion quanTiTaTion
Histone Modification ELISAsmeasure global cellular changes in histone modifications
Active Motif’s Histone Modification ELISA Kits provide a sensi-tive, high-throughput method for quantifying global changes in the level of specific histone modifications, such as lysine methylation and acetylation, or phosphorylation of serine.
Active Motif has applied our histone modification antibody expertise to identify optimal antibody pairs for the detection of specific histone modifications and provided them in a simple sandwich ELISA format for your convenience and ease of use.
Assay cellular response by quantifying changes in the levels of specific histone modificationsFor researchers who want to determine the effects of com-pound treatment, disease state or other conditions on a spe-cific epigenetic modification, the Histone Modification ELISA Kits provide a simple-to-use high throughput assay for this purpose. The highly sensitive assay enables researchers to evalu-ate small changes in the levels of specific histone modifications from purified core histones (see page 24), or histones isolated by acid extraction.
How does it work?These easy-to use kits are sandwich ELISAs that utilize a capture antibody against histone H3 and a detecting antibody specific to the modification of interest. Assays are available for various acetyl, methyl and phosphoryl histone modifications as well as for Total Histone H3. An HRP-conjugated secondary antibody and developing solutions provide a sensitive colorimetric read-out in less than 3 hours. The assay is performed in a convenient 96-stripwell plate, enabling low or high throughput screening.
hisTone ModifiCaTion elisa advanTages
• Sensitive – works with purified core histones or acid extracted samples (Figure 1)
• Fast – assay can be completed in less than 3 hours
• Scalable – stripwell plates enable screening of 1 to 96 samples in a single experiment
• Quantitation controls – recombinant methylated and acetylated histones are included for quantitation of samples
• Colorimetric detection – results are easily quantified by spectrophotometry at 450 nm
F I G U R E 1 :The Histone H3 trimethyl Lys27 ELISA was used to assay H3K27me3 levels in purified HeLa core histones and HeLa acid extract. Control Recombinant Histone H3K27me3 protein provided in the kit was assayed as a reference standard curve.
Histone H3 Trimethyl Lys27 ELISA
0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
0 3.125 6.25 12.5 25 50 100 125 250 5,000 10,000
Recombinant Histone H3 trimethyl Lys27 protein (provided positive control)
Purified CoreHistones
HeLa Acid
Sample (ng/well)
Extract
His
tone
H3
trim
ethy
l Lys
27 (O
D 4
50nm
)
Recombinant histone controls enable quantitationEach kit includes validated modification-specific recombinant protein controls synthesized using Active Motif’s patented tech- nology. The methylated and acetylated recombinant histone controls can be used to generate a standard curve to quantify the amount of modified histone in each sample (Figure 1). The Total Histone H3 ELISA can be used to normalize the amount of histone modification in your samples when run in parallel with the methylated or acetylated Histone ELISAs. Untreated and paclitaxel-treated acid extracts are provided in the phosphorylated Histone ELISAs to serve as qualitative controls.
For an up-to-date list of available Histone Modification ELISAs, please visit www.activemotif.com/hiselisa.
Product Format Cat. No.
Histone H3 monomethyl Lys4 ELISA 96 rxns 53101
Histone H3 dimethyl Lys4 ELISA 96 rxns 53112
Histone H3 trimethyl Lys4 ELISA 96 rxns 53113
Histone H3 acetyl Lys9 ELISA 96 rxns 53114
Histone H3 dimethyl Lys9 ELISA 96 rxns 53108
Histone H3 trimethyl Lys9 ELISA 96 rxns 53109
Histone H3 phospho Ser10 ELISA 96 rxns 53111
Histone H3 acetyl Lys14 ELISA 96 rxns 53115
Histone H3 monomethyl Lys27 ELISA 96 rxns 53104
Histone H3 trimethyl Lys27 ELISA 96 rxns 53106
Histone H3 phospho Ser28 ELISA 96 rxns 53100
Total Histone H3 ELISA 96 rxns 53110
![Page 26: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/26.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com24
hisTone PurifiCaTion
Histone Purification Kitsobtain the purest core histones samples for analysis
Achieving the best results is highly reliant on the quality of your input samples. Active Motif’s Histone Purification Kits provide researchers with the ability to obtain the purest, highest quality histones from virtually any cell or tissue sample for use in down-
stream analysis. We are the only company to offer a method for purification of core histones. Our proprietary technique yields the highest quality samples by improving purity and preserving native modifications better than crude acid extraction methods.
How does it work?Active Motif’s Histone Purification, Histone Purification Mini and Histone Purification Microplate Kits are the only commer-cially available assays for isolating purified core histones. The assays were designed to overcome the limitations of crude acid extraction methods for isolation of core histones. Our Histone Purification Kits use a unique purification resin and a series of proprietary elution buffers to isolate extremely pure fractions of histones from any cell or tissue sample. The results are im-proved yields, purity, and preservation of modifications above what is achievable with crude acid extraction. Purification of histones eliminates contaminating acid-insoluble cellular proteins that are left behind with standard acid extraction protocols. Removal of these impurities prevents additional enzymatic alterations to histone modifications, ensuring you have the highest quality histone samples for use in your downstream analysis (Figure 1).
Better substrate for downstream assaysPurified histones are ready for downstream analysis with Active Motif’s collection of histone modification antibodies (pages 2-3), or they can be used as substrates in functional assays, such as Active Motif’s Histone Modification ELISAs (page 23) and Chromatin Assembly Kit (page 33).
Which kit is right for you?Active Motif’s Histone Purification Kits are available in multiple formats so you can choose the one that best fits the needs of your assay. Use Table 1 below to determine which kit is right for you. To learn more, please visit www.activemotif.com/histonepur.
F I G U R E 1 :Acetyl, methyl & phosphoryl post-translational modifications are preserved as well or better with Histone Purification compared to acid precipitation methods.
Acetylation
Methylation
Phosphorylation
Kit Application Format Elution Capacity Purifications
Histone Purification Kit
• Low throughput
• Large sample quantities
Gravity Flow Separate H2A/H2B & H3/H4 fractions 0.5-2.5 mg 10
Spin Column H2A, H2B, H3 & H4 in a single fraction 0.5-2.5 mg 10
Histone Purification Mini Kit
• Medium throughput
• Mid-range sample quantities
Mini Spin Column H2A, H2B, H3 & H4 in a single fraction 0.1-0.5 mg 20
Histone Purification Microplate Kit
• High throughput
• Low sample quantities96 Stripwell Plate
Spin ColumnH2A, H2B, H3 & H4 in a single fraction < 0.48 mg 96
TA B L E 1 :Specifications for Active Motif’s Histone Purification Kits.
![Page 27: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/27.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 25
hisTone PurifiCaTion
which kit format best suits your histone purification needs?Histone Purification Kits, cont.
hisTone PurifiCaTion MeThod advanTages
• Exclusivity – only commercial kits available for histone purification
• Quality – enhanced histone purity and preservation of histone modifications
• Scalability – 3 throughput formats available to suit your needs
• Flexibility – works with cell or tissue samples
Histone Purification Kits for quality sample prepImprove the consistency and reliability of your analysis of histones and their post-translational modifications by using purified histone samples. Our proprietary histone purification method is available in three different format options to suit the throughput needs of your downstream analysis.
Histone Purification KitThe Histone Purification Kit enables you to isolate core histones from any cell culture or tissue sample. It was designed for larger sample amounts; the kit contains 10 columns, each with a capacity of 0.5-2.5 mg. Two options are available for purification – the core histones may be purified using the convenient spin column format as one total population containing H2A, H2B, H3 and H4, or further purified into separate fractions of H2A/H2B dimers and H3/H4 tetramers by using the efficient gravity flow protocol (Figure 1).
Product Format Cat. No.
Histone Purification Kit 10 rxns 40025
Histone Purification Mini Kit 20 rxns 40026
Histone Purification Microplate Kit 96 rxns 40027
Histone Purification Mini KitThe Histone Purification Mini Kit offers the same proprietary purification protocol as the original Histone Purification Kit, but was designed to process smaller samples. It uses a more conve-nient mini spin column-based format, each with a capacity of 0.1-0.5 mg. This kit enables 20 purifications and allows for extrac-tion of the core histones as one total population. However, unlike the original kit, the Mini Kit cannot be used to separate histones into discrete H2A/H2B and H3/H4 fractions.
Histone Purification Microplate KitThe Histone Purification Microplate Kit offers the same propri-etary purification protocol as the original Histone Purification Kit, but uses a convenient plate-based format for high-throughput processing of small sample volumes. This kit is ideal for research-ers with limited starting material or who are seeking a method to readily transition their samples to downstream 96-well plate-based screening or profiling assays, such as our Histone Modifi-cation ELISAs (Figure 2, page 23) and Luminex® Histone H3 PTM Multiplex Assays (page 26). Similar to the Mini Kit, the Histone Purification Microplate Kit purifies core histones as one total (H2A, H2B, H3 and H4) population; it cannot fractionate the histones into discrete H2A/H2B and H3/H4 fractions.
F I G U R E 1 :SDS-PAGE of histone fractions purified using the Histone Purification Kit.
Total Histone H3 ELISA
0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
40 20 10 5 2.5 1.25 .625 BlankAM Mini Kit
AM Microplate Kit
Crude Extraction
OD
450
nm
Recombinant H3 protein (ng/well)
F I G U R E 2 :Active Motif’s Histone Purification Mini and Microplate kits show improved histone yield over crude acid extraction as measured using the Total Histone H3 ELISA Kit (Cat. No. 53110, page 23).
![Page 28: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/28.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com26
MulTiPlex hisTone analysis
screen histone H3 post-translational modifications in multiplexHistone H3 PTM Multiplex Assay
Active Motif partnered with Luminex®, the industry leader in mul-tiplexing, to develop the Histone H3 PTM Multiplex Assay, the first epigenetic assay with multiplexing capability for high-throughput analysis of histone modifications. The assay is designed for use
with MAGPIX®, Luminex® 200™ or FLEXMAP 3D® instruments and can be completed in only 3 hours. Now it is possible to get more histone data using smaller sample amounts, in less time and at a lower cost than traditional methods, such as Western blot or IF.
How does it work?Active Motif’s Histone H3 PTM Multiplex Assay comes in a con-venient 96-well plate-based format for high-throughput screen-ing. It requires only nanogram sample amounts of either purified histones (learn about our Histone Purification Microplate Kit on page 25) or crude acid extracts, and is configured as a sandwich “ELISA” that takes place on a bead. Histones are captured us-ing fluorescent-labeled magnetic beads that are conjugated to antibodies recognizing specific post-translational modifications (PTMs) in histone tails. Each bead emits a unique fluorescent signal to enable the multiplexing of multiple analytes within the same sample. A biotinylated H3 C-terminal antibody is used to capture histones. Streptavidin-phycoerythrin is then added to bind the biotinylated antibody to provide a signal of the binding events (Figure 1). The Luminex instrument then deciphers both the identity of the bead and the number of binding events.
Streptavidin-phycoerythrin
BiotinylatedHistone H3 Ab
Histone containing apost-translational
modification (PTM)
PTM Antibody-conjugated bead
Ac
H3
SA-PE
Biotin
Me3
H3H3
SA-PE
Biotin
SA-PE
Biotin
P
F I G U R E 1 :Schematic of the Histone H3 PTM Multiplex Assay.
Simultaneously screen specific & off-target effectsThe Histone H3 PTM Multiplex assay is ideal for high through-put screening of changes in histone modification levels of clinical samples or compounds treatments for disease or drug discovery research. The multiplexing ability of the assay means that you can simultaneously analyze specific effects, off-target effects and unaffected targets all in a single well (Figure 2).
Post-screening, individual histone modifications can be analyzed using our Histone Modification ELISAs (page 23).
Specific Effects
No Effect
Off-target Effects
F I G U R E 2 :The Histone H3 PTM Multiplex Assay enables simultaneous analysis of increased histone acetylation, as well as off-target effects and unaffected tar-gets in HeLa cells occurring in response to SAHA-mediated HDAC inhibition.
whaT do i need for The assay?
• The Histone H3 PTM Multiplex Kit (Catalog No. 33115) contains buffers and reagents for performing the assay.
• Ab-conjugated Beads for the individual PTMs are sold separately to enable customizing of target selection. For an up-to-date list of available PTM targets, visit us at www.activemotif.com/luminex.
• Inclusion of Histone H3 Total Ab-conjugated Beads (Catalog No. 33116) in your multiplex enables you to normalize values and compare relative amounts of PTMs across samples.
Product Format Cat. No.
Histone PTM Multiplex Kit 96 rxns 33115
![Page 29: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/29.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 27
reagenTs for drug disCovery
Drug discovery and development programs focused on epigenetics have attracted much attention and investment in recent years. This is driven by the potential to develop novel therapeutic strategies that can reverse transcriptional and epigenetic abnor-
malities. Active Motif is a leading provider of innovative technol-ogies for epigenetics and gene regulation research. Our assays, reagents and services can be easily integrated into your research to streamline the drug discovery workflow.
Tools to Streamline Epigenetic Drug Research
Biologically relevant assay substratesThe outcome of your in vitro biochemical assays are vastly improved when the system mimics actual cellular biology. To provide you the best choice of substrate for use in your assay, Active Motif offers over 60 different recombinant full-length modified H3 and H4 histones that are engineered using pat-ented technology to have structural and functional similarity to their native counterparts. These can be used as stand-alone substrates or assembled along with recombinant H2A and H2B to generate nucleosomes and oligonucleosomes. By choosing the most biologically relevant substrate, you can ensure the most accurate results.
To analyze epigenetic modifications or protein interactions in a chromatin context, Active Motif’s Chromatin Assembly Kit pro-vides an end-to-end solution for designing your own chromatin. The technique involves an ATP-dependent process to produce a chromatin substrate that mimics native in vivo chromatin structure. The assembled chromatin is ready to use in down-stream assays such as in vitro transcription assays, chromatin immunoprecipitation and enzyme activity assays.
Assay-ready proteins, enzymes and domainsThere is no need to waste valuable time and resources generating proteins for assay development. With Active Motif’s compre-hensive portfolio of over 300 purified assay-ready recombinant proteins – including transcription factors, histones, DNA and histone modifying enzymes, and bromodomains – you are sure to find what you need to develop more efficient assays for your drug discovery and development program.
Assays for enzymatic activityActive Motif offers a variety of robust, sensitive, high-through-put assays for quick and easy screening and profiling of cellular changes in the activity of histone modifying enzymes. These include our HAT Assay Kit to measure the activity of histone acetylases, the HDAC Assay Kits to analyze histone deacetylase activity and our Histone Demethylase Assay to analyze the lysine demethylase activity of LSD1.
Small molecule inhibitors and activatorsActive Motif has an expanding collection of small molecule compounds that target epigenetic modifiers of DNA methylation and chromatin remodeling for use in lead genera-tion and assay development. These include targets to DNA Methyltransferases (DNMTs), Histone Acetyltransferases (HATs), Histone Deacetylases (HDACs), Histone Methyltransferases (HMTs), Histone Demethylases (HDMs), and bromodomains.
Choosing the correct histone substrate for assay development is key to achieving the best results. Opinion leaders in epigenetics recognize the power of reconstituting recombinant chromatin for creating biologically relevant substrates.
WHICH HISTONE SUBSTRATE IS RIGHT FOR YOUR ASSAY?
![Page 30: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/30.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com28
reCoMbinanT ProTeins
Description Expressed In Format Cat. No.
HISTONES & MODIFIED HISTONESHistone H2A E. coli 50 µg 31251
Histone H2A.Z Synthetic 25 µg 31293
Histone H2B E. coli 50 µg 31252
Histone H3 (C110A) E. coli 100 µg 31207
Histone H3 pan-acetyl Synthetic 25 µg 31289
Histone H3T3ph E. coli 25 µg 31274
Histone H3K4ac E. coli 25 µg 31275
Histone H3K4me1 E. coli 50 µg 31208
Histone H3K4me2 E. coli 50 µg 31209
Histone H3K4me3 E. coli 50 µg 31210
Histone H3K9ac E. coli 25 µg 31253
Histone H3K9me1 E. coli 50 µg 31211
Histone H3K9me2 E. coli 50 µg 31212
Histone H3K9me3 E. coli 50 µg 31213
Histone H3S10ph E. coli 25 µg 31272
Histone H3K14ac E. coli 25 µg 31254
Histone H3K14me2 E. coli 50 µg 31257
Histone H3K18ac E. coli 25 µg 31273
Histone H3K18me3 E. coli 50 µg 31261
Histone H3K23ac E. coli 25 µg 31255
Histone H3K23me3 E. coli 50 µg 31264
Histone H3K27ac Synthetic 25 µg 31290
Histone H3K27me1 E. coli 50 µg 31214
Histone H3K27me2 E. coli 50 µg 31215
Histone H3K27me3 E. coli 50 µg 31216
Histone H3K36me1 E. coli 50 µg 31217
Histone H3K36me2 E. coli 50 µg 31218
Histone H3K36me3 E. coli 50 µg 31219
Histone H3K79me1 E. coli 50 µg 31220
Histone H3K79me2 E. coli 50 µg 31221
Histone H3K79me3 E. coli 50 µg 31222
Histone H4 E. coli 50 µg 31223
Histone H4R3me2a Synthetic 25 µg 31291
Histone H4K5me1 E. coli 50 µg 31265
Histone H4K5me2 E. coli 50 µg 31266
Histone H4K16ac Synthetic 25 µg 31292
Histone H4K16me1 E. coli 50 µg 31268
Histone H4K20me1 E. coli 50 µg 31224
Histone H4K20me2 E. coli 50 µg 31225
Histone H4K20me3 E. coli 50 µg 31226
BIOTINYLATED HISTONESHistone H3 biotinylated E. coli 25 µg 31271
Histone H3K4me1 biotinylated E. coli 25 µg 31284
Histone H3K4me2 biotinylated E. coli 25 µg 31283
Histone H3K4me3 biotinylated E. coli 25 µg 31282
Histone H3K9me1 biotinylated E. coli 25 µg 31286
Histone H3K9me3 biotinylated E. coli 25 µg 31285
Description Expressed In Format Cat. No.
HISTONE ACETYLTRANSFERASES & DEACETYLASESHDAC1 protein Baculovirus 25 µg 31342
HDAC2 protein Baculovirus 25 µg 31343
HDAC3 complex Baculovirus 50 µg 31349
HDAC6 protein E. coli 10 µg 31346
HDAC7 protein Baculovirus 10 µg 31352
p300 protein Baculovirus 4 µg 31124
p300 protein, catalytic domain Baculovirus 5 µg 31205
SIRT1 protein E. coli 10 µg 31340
SIRT6 protein E. coli 25 µg 31336
HISTONE METHYLTRANSFERASES & DEMETHYLASESCARM1 protein Baculovirus 10 µg 31347
EZH2 protein complex Baculovirus 25 µg 31337
G9a protein Baculovirus 20 µg 31410
G9a-SET protein E. coli 20 µg 31425
GCN5 protein E. coli 5 µg 31204
FBXL10 / KDM2B protein Baculovirus 20 µg 31455
JMJD1A / KDM3A protein Baculovirus 20 µg 31456
JMJD2A / KDM4A protein Baculovirus 20 µg 31457
JMJD2C / KDM4C protein Baculovirus 20 µg 31458
JMJD2D / KDM4D protein Baculovirus 20 µg 31459
LSD1 / KDM1A protein Baculovirus 50 µg 31334
MECOM / PRDM3 protein Baculovirus 20 µg 31398
MLL / HRX - SET E. coli 20 µg 31419
MLL2-SET E. coli 20 µg 31420
MLL4-SET E. coli 20 µg 31422
MMSET / WHSC1 protein Baculovirus 20 µg 31453
PRC2 Complex Baculovirus 20 µg 31387
PRC2 EZH2(A677G) Complex Baculovirus 20 µg 31391
PRC2 EZH2(Y641C) Complex Baculovirus 20 µg 31389
PRC2 EZH2(Y641F) Complex Baculovirus 20 µg 31388
PRC2 EZH2(Y641N) Complex Baculovirus 20 µg 31390
PRDM10 protein Baculovirus 20 µg 31396
PRMT1 protein Baculovirus 20 µg 31411
PRMT2 protein Baculovirus 20 µg 31392
PRMT5 complex Baculovirus 20 µg 31356
Set2 protein E. coli 50 µg 31358
Set8 protein E. coli 10 µg 31321
Set8 D338A protein E. coli 10 µg 31322
Set9 protein E. coli 10 µg 31319
SETDB1 protein Baculovirus 20 µg 31452
SETMAR protein Baculovirus 20 µg 31454
Smyd1 protein Baculovirus 20 µg 31405
Smyd2 protein E. coli 10 µg 31323
Smyd5 protein Baculovirus 20 µg 31409
SUV39H1 protein E. coli 25 µg 31339
SUV420H1 protein E. coli 50 µg 31360UTX / KDM6A protein Baculovirus 20 µg 31460
![Page 31: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/31.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 29
reCoMbinanT ProTeins
Description Expressed In Format Cat. No.
BROMODOMAINSASH1L (2407-2579) E. coli 100 µg 31445
ATAD2 (981-1108) E. coli 100 µg 31376
BAZ1B (1340-1457) E. coli 100 µg 31444
BPTF / FALZ (2791-2911) E. coli 100 µg 31447
BRD1 (556-688) E. coli 100 µg 31438
BRD2 (344-455) E. coli 100 µg 31378
BRD3 (306-416) E. coli 100 µg 31377
BRD4 (44-168) E. coli 100 µg 31380
BRD7 (129-236) E. coli 100 µg 31381
BRD9 (130-259) E. coli 100 µg 31382
BRDT (21-137) E. coli 100 µg 31450
BRPF1 (627-746) E. coli 100 µg 31375
BRWD3 (1295-1443) E. coli 100 µg 31443
CREBBP (1081-1197) E. coli 100 µg 31373
GCN5 (726-837) E. coli 100 µg 31371
PBRM1 (23-156) E. coli 100 µg 31383
PBRM1 (464-605) E. coli 100 µg 31384
PCAF (715-829) E. coli 100 µg 31370
SMARCA2 / BRM (1367-1511) E. coli 100 µg 31449
SP140 (688-862) E. coli 100 µg 31448
TAF1 (1398-1524) E. coli 100 µg 31403
TAF1 (1522-1656) E. coli 100 µg 31439
TRIM24 (862-980) E. coli 100 µg 31368
TRIM33 (959-1069) E. coli 100 µg 31367
TRANSCRIPTION FACTORSER protein Baculovirus 4 µg 31119
c-Fos protein Baculovirus 5 µg 31115
FXR protein E. coli 10 µg 31120
GR protein Baculovirus 5 µg 31121
c-Jun protein Baculovirus 5 µg 31116
LXRa protein E. coli 10 µg 31122
MAD1 protein E. coli 10 µg 31329
MAD4 protein E. coli 10 µg 31248
MAX protein E. coli 10 µg 31244
c-Myc protein E. coli 5 µg 31117
NFκB p50 protein E. coli 15 µg 31301
NFκB p65 protein E. coli 15 µg 31302
p53 protein Baculovirus 5 µg 31103
PARP-1 protein Baculovirus 10 µg 31238
PPARa protein E. coli 10 µg 31125
PPARb(δ) protein E. coli 10 µg 31126
PPARg protein E. coli 10 µg 31127
RAR-a protein Baculovirus 5 µg 31130
RAR-b protein Baculovirus 5 µg 31131
Description Expressed In Format Cat. No.
pRb protein Baculovirus 5 µg 31128
RXR-a protein E. coli 10 µg 31133
RXR-b protein E. coli 5 µg 31134
RXR-LBD protein E. coli 10 µg 31135
Purified Sp1 protein HeLa cells 2 µg 31137
Recombinant Sp1 protein Baculovirus 5 µg 31136
Spt16 / FACT p140 protein Baculovirus 10 µg 31344
SSRP1 / FACT p80 protein Baculovirus 10 µg 31345
STAT3 protein E. coli 10 µg 31140
TBP protein E. coli 10 µg 31246
TFIIA2 protein E. coli 10 µg 31249
TFIIE a protein E. coli 10 µg 31241
TRa1 protein Baculovirus 10 µg 31138
TRb1 protein E. coli 10 µg 31139
USF1 protein E. coli 10 µg 31333YY1 protein E. coli 10 µg 31332
DNA METHYLATIONDNMT1 protein Baculovirus 10 µg 31335b-Glucosyltransferase enzyme E. coli 500 Units 55012PvuRts1 I restriction enzyme E. coli 50 Units 55011Tet1 protein E. coli 25 µg 31363
UBIQUITINATIONUBA1 protein E. coli 10 µg 31227UBC4 protein E. coli 10 µg 31228UBCH6 protein E. coli 100 µg 31362UBE2D2 protein E. coli 10 µg 31229UBE2D3 protein E. coli 10 µg 31230Ubiquitin protein E. coli 10 µg 31231Ubiquitin G76A protein E. coli 10 µg 31232
PROTEIN KINASESAKT1 protein Baculovirus 20 µg 31145AKT2 protein Baculovirus 100 µg 31146AKT3 protein Baculovirus 20 µg 31147EGFR protein Baculovirus 10 µg 31165ERK1 protein E. coli 10 µg 31152ERK2 protein E. coli 5 µg 31153FAK protein Baculovirus 10 µg 31168IKKb protein Baculovirus 10 µg 31176IKKε protein Baculovirus 10 µg 31177JAK2 protein Baculovirus 10 µg 31181Myelin Basic Protein, dephosphorylated Bovine 5 mg 31314PKA protein E. coli 50 µg 31158Src protein Baculovirus 10 µg 31195SYK protein Baculovirus 10 µg 31196
The recombinant proteins shown above are only a small sample of the over 300 recombinant proteins currently offered. For a complete, up-to-date list of all recombinant proteins available, please visit www.activemotif.com/proteins.
![Page 32: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/32.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com30
Inhibitors & Activators
Active Motif has an expanding collection of small-molecule epigenetic modulators (activators and inhibitors) that target changes to DNA methylation and chromatin remodeling proteins, such as histones. These include targets to DNA Methyltransferases (DNMTs), Histone Acetyltransferases (HATs),
Histone Deacetylases (HDACs), Histone Methyltransferases (HMTs), Histone Demethylases (HDMs), and the BET family bromodomains. As epigenetic aberrations are implicated in many diseases, these modulators are important tools for researchers in their assay development and drug discovery initiatives.
small molecules to modulate epigenetic processes
sMall MoleCule CoMPounds
Description Target Format Cat. No.
HISTONE DEACETYLASEApicidin HDAC inhibitor 1 mg
5 mg14041 14040
BML-210 HDAC inhibitor 5 mg 25 mg
14049 14048
CUDC-101 HDAC inhibitor 5 mg 25 mg
14061 14060
HPA (Hexyl-4-pentynoic acid) HDAC inhibitor 10 mg 50 mg
14035 14034
MS-275 HDAC inhibitor 5 mg 25 mg
14043 14042
Panobinostat HDAC inhibitor 5 mg 25 mg
14045 14044
Phenylbutyrate Na HDAC inhibitor 1 g 14033
Romidepsin HDAC inhibitor 1 mg 14083
Sodium Valproate HDAC inhibitor 5 g 14021
Splitomycin Sir2p inhibitor 5 mg 25 mg
14087 14086
Trichostatin A HDAC inhibitor 1 mg 5 mg
14039 14038
Tubastatin A HDAC inhibitor 1 mg 5 mg
14085 14084
Vorinostat (SAHA) HDAC inhibitor 10 mg 50 mg
14027 14026
Description Target Format Cat. No.
LYSINE METHYLTRANSFERASE & LYSINE DEMETHYLASEBIX-01294 HMT inhibitor 5 mg
25 mg14073 14072
Chaetocin HMT inhibitor 200 µg 14051
Daminozide HDM inhibitor 50 mg 250 mg
14059 14058
DMOG HDM inhibitor 10 mg 50 mg
14063 14062
GSK-J1 (cell impermeable) HDM inhibitor 5 mg 25 mg
14069 14068
GSK-J4 (cell permeable) HDM inhibitor 5 mg 25 mg
14071 14070
IOX1 HDM inhibitor 5 mg 25 mg
14057 14056
ML-324 HDM inhibitor 5 mg 25 mg
14079 14078
Tranylcypromine hemisulfate HDM inhibitor 50 mg 250 mg
14047 14046
Description Target Format Cat. No.
SIRTUINAK-7 SIRT2 inhibitor 5 mg
25 mg14055 14054
BML-278 SIRT1 activator 5 mg 25 mg
14025 14024
EX-527 SIRT1 inhibitor 5 mg 25 mg
14029 14028
Piceatannol SIRT1 activator 5 mg 25 mg
14037 14036
Resveratrol SIRT1 activator 100 mg 500 mg
14023 14022
SirtAct SIRT1 activator 5 mg 25 mg
14081 14080
Sirtinol SIRT2 inhibitor 5 mg 25 mg
14075 14074
Description Target Format Cat. No.
METHYLATION5-Azacytidine DNA methyltransferase
inhibitor50 mg 250 mg
14103 14102
Decitabine (5-Aza-2́ -deoxycytidine)
DNA methyltransferase inhibitor
10 mg 50 mg
14101 14100
RG108 DNA methyltransferase inhibitor
5 mg 25 mg
14105 14104
Sinefungin Methylation inhibitor 1 mg 14089
Description Target Format Cat. No.
BROMODOMAINJQ1 (racemic) Bromodomain inhibitor 5 mg
25 mg14067 14066
Description Target Format Cat. No.
OTHERFK-866 HCl NAD biosynthesis inhibitor 5 mg
25 mg14031 14030
Description Target Format Cat. No.
HISTONE ACETYLTRANSFERASEC646 HAT inhibitor 5 mg
25 mg14053 14052
CTPB HAT activator 5 mg 25 mg
14065 14064
Garcinol HAT inhibitor 10 mg 50 mg
14077 14076
![Page 33: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/33.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 31
hisTone aCeTylaTion & deaCeTylaTion
HAT & HDAC Assay Kits
Active Motif’s HAT & HDAC Assay Kits are easy-to-use, sensi-tive assays to analyze the activity of histone acetyltransferases and histone deacetylases in your cell and nuclear extracts, immunoprecipitates and purified enzymes, as well as to screen
the effects of potential inhibitor compounds. The HAT Assay Kit uses a fluorescent readout, while HDAC Assay Kits are available in both fluorescent and colorimetric formats.
rapid, sensitive assays for HAT & HDAC activity and inhibitor compounds
The HAT FamilyHistone acetyltransferases (HAT) are enzymes that acetylate conserved lysine amino acids on histones. Generally, histone acetylation is associated with the activation of gene expression, as hyperacetylated chromatin is transcriptionally active. Histone deacetylases (HDAC) remove these acetyl groups from histones. Their action is opposite to that of histone acetyltransferases, as hypoacetylated chromatin is silent. Because of the link between histone deacetylation and cell-static effects, there has been a surge in the interest of pharmaceutical companies in HDACs and their inhibition as possible strategies for therapeutic intervention.
How do the HDAC Assay Kits work?The HDAC Assay Kits utilize a peptide substrate that contains an acetylated lysine residue that can be deacetylated by Class I, IIB and IV HDAC enzymes. (Class III HDAC enzymes, or the Sirtuins, require the addition of the NAD+ cofactor in the assay.) Once the substrate is deacetylated, the lysine reacts with the Developing Solution to produce either a colorimetric or fluo-rescent product. The colorimetric product absorbs maximally at 405 nm; the fluorescent product can be read with an excita-tion wavelength of 360 nm and emission wavelength of 460 nm (Figure 2). A deacetylated assay standard is provided in each kit to enable calculation of HDAC activity in pmol/min/mg.
F I G U R E 1 :The HAT assay was used to analyze the effect of anacardic acid, a HAT inhibitor, on p300 activity.
0
5K
10K
15K
20K
25K
30K
35K
40K
Background p300 Anacardic Acid
p300 Activity
Histone H3 peptide
Histone H4 peptide
Arb
itra
ry F
luor
esce
nce
Uni
ts (A
FU)
F I G U R E 2 :Untreated and Trichostatin A-treated HeLa nuclear extracts were assayed for HDAC activity using the fluorescent version of the HDAC Assay Kit.
0
10000
20000
30000
40000
50000
UntreatedTrichostatin A
HeLa Nuclear Extract (µg)
Fluo
resc
ence
Inte
nsity
5 2.5 1.25 0.625 0.312 0.156 010
Product Format Cat. No.
HAT Assay Kit (Fluorescent) 1 x 96 rxns 56100
Recombinant p300 protein, catalytic domain 5 µg 31205
Recombinant GCN5 protein, active 5 µg 31204
HDAC Assay Kit (Fluorescent) 1 x 96 rxns 56200
HDAC Assay Kit (Colorimetric) 1 x 96 rxns 56210
How does the HAT Assay Kit work?The HAT Assay Kit is a quick and sensitive method to de-termine the activity of your own source of purified histone acetyltransferases, or to screen for potential inhibitors of HAT activity. HATs will catalyze the transfer of acetyl groups from the provided acetyl-CoA to generate an acetylated peptide and CoA-SH. After stopping the reaction with stop solution, a developer is added that reacts with the free sulfhydryl groups on CoA-SH to give a fluorescent signal (Figure 1).
This fluorescent 96-well plate assay includes N-terminal histone H3 and H4 substrate peptides for screening HAT enzymes and a positive control p300 catalytic domain protein to screen for inhibitors. Anacardic acid is also provided for use as a control, as it is a potent HAT inhibitor. A standard curve can be generated with either b-mercaptoethanol or Coenzyme A in order to relate the fluorescence of your HAT to pmol/min/µg specific activity.
![Page 34: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/34.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com32
hisTone deMeThylaTion
Histone Demethylase Assay
Histone methylation is central to many biological processes, including transcriptional regulation and chromatin remodeling. LSD1 specifically demethylates H3K4 and H3K9 and regulates gene silencing during these processes. Active Motif’s Histone
Demethylase Assay provides a simple, high-throughput and accurate method to screen LSD1 demethylase activity. The assay employs a recombinant Histone H3K4me2 substrate that mimics native substrate to more closely resemble in vivo conditions.
screen LSD1 for histone demethylase activity
How does it work?The fluorescent Histone Demethylase Assay is a simple way to analyze the efficiency of lysine specific demethylase enzyme (LSD1, also known as KDM1) samples, or to screen inhibitor compounds that change histone demethylation activity. The Histone Demethylase Assay is designed to detect the formal-dehyde released from the reaction of LSD1 with a methylated substrate. As the LSD1 enzyme demethylates the recombinant histone substrate, formaldehyde is released as a by-product, which then reacts with the Detection Reagent to generate a fluorescent signal equivalent to the overall production of formaldehyde (Figure 1).
Better substrate for more accurate resultsThe provided Recombinant Histone H3K4me2 substrate mimics a native histone substrate for results that more closely resemble in vivo conditions. As shown in Figure 2, the LSD1 enzyme is able to more efficiently demethylate the included recombinant histone H3K4me2 protein than a histone H3K4me2 peptide sub-strate. Because the recombinant histone more closely resembles a native histone, the Histone Demethylase Assay enables more accurate analysis of histone demethylation activity.
What’s in the box?The Histone Demethylase Assay contains a Recombinant Histone H3K4me2 substrate, optimized buffers and black 96-well half area microplates to perform the assay. For added convenience, a Demethylation Standard, which can be used to quantify the amount of formaldehyde released, and an aliquot of LSD1 enzyme are included as controls. For more complete details, please visit www.activemotif.com/lsd1.
Product Format Cat. No.
Histone Demethylase Assay (Fluorescent) 48 rxns 53200
Recombinant LSD1 / KDM1A protein, active 50 µg 31334
F I G U R E 1 :Fluorescence detection of LSD1 demethylase activity using the Histone Demethylase assay.
LSD1 Demethylase Activity
0
2K
4K
6K
8K
10K
12K
Blank LSD1 Background LSD1 + H3K4me2
Rela
tive
fluor
esce
nce
F I G U R E 2 :The Histone Demethylase Assay was used to compare LSD1 demethylase efficiency using different histone substrates. Results show that LSD1 demethylates H3K4me2 protein substrate more efficiently than H3K4me2 peptide.
Comparison of Methylated Histone Substrates
0%
10%
20%
30%
40%
50%
60%
70%
80%
LSD1 + H3K4me2 peptide LSD1 + Recombinant H3K4me2 protein
Form
alde
hyde
conv
ersio
n ef
ficie
ncy
14%
73%
hisTone deMeThylase assay advanTages
• The recombinant histone H3K4me2 substrate mimics a na-tive substrate to more closely resemble in vivo conditions
• Includes a Demethylation Standard for formaldehyde quantification and LSD1 enzyme for use as a positive control
• Simple, easy fluorescent assay for detection of the formaldehyde by-product
![Page 35: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/35.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 33
ChroMaTin asseMbly
Chromatin Assembly Kitthe most biologically relevant substrate for downstream success
Active Motif’s Chromatin Assembly Kit provides an easy and complete solution for chromatin reconstitution to produce a substrate that closely mimics native chromatin for downstream assays. In general, there are ATP-dependent and ATP-independent methods for reconstituting or assembling chromatin in vitro. The ATP-independent method results in a
random arrangement of histones on the DNA that does not accurately reflect the native core nucleosome. The Chromatin Assembly Kit is designed to assemble chromatin using an ATP-dependent process to generate an extended array of ordered nucleosomes on a length of DNA greater than 250 bp to produce the most biologically relevant substrate.
The Chromatin Assembly Kit advantageWith Active Motif’s Chromatin Assembly Kit, you can design your own chromatin. Using an ATP-dependent method, the included purified HeLa core histones are combined with the histone chaperone NAP-1 (h-NAP-1) in a high-salt buffer, which is ideal for proper histone configuration. Purified recombinant human chromatin assembly complex ACF and sample DNA are then added with the complete ATP regeneration system for in vitro assembly of extended, regularly ordered, periodic arrays of nucleosomes.
The resulting chromatin closely resembles natural in vivo chromatin, enabling studies of histone modifications and associ-ated proteins that are crucial to regulation of the target DNA sequence. The assembled chromatin is ready to use in down-stream assays such as in vitro transcription assays, chromatin immunoprecipitation and histone acetyltransferase (HAT) assays. Chromatin assembly is verified by partial digestion with the provided Enzymatic Shearing Cocktail and analyzed by gel electrophoresis. High-quality chromatin should yield six or more distinct bands (Figure 1). For your convenience, supercoiled DNA is provided as a positive control. For details on the Chromatin Assembly Kit, go to www.activemotif.com/chromassembly.
Nucleosome Assembly Control DNAThe Nucleosome Assembly Control DNA will prove to be a key component of your in vitro chromatin assembly reac-tions. The 187 bp double-stranded DNA containing the well-characterized 601 sequence was selected based on its ability to bind to histone octamers with high affinity. It can be directly added to your purified histones or histone extracts resulting in mononucleosome formation that can be easily visualized on a gel by mobility shift. The Nucleosome Assembly Control DNA can be used as a control to validate the proper assembly of the components of your in vitro chromatin assembly reactions. Alternatively, the Nucleosome Assembly Control DNA can be used as a template to monitor assembly kinetics in the presence or absence of chromatin-interacting proteins or compounds. For details on the Nucleosome Assembly Control DNA, please visit us at www.activemotif.com/nucleosomeDNA.
F I G U R E 1 : .Chromatin assembled from samples of circular DNA (Lanes 1 & 2) and linear DNA (Lanes 3 & 4) were digested for 2 and 4 minutes, respectively, deproteinated, phenol/chloroform extracted and run on an agarose gel. Each sample type processed with the Chromatin Assembly Kit resulted in regularly spaced nucleosomes.
Product Format Cat. No.
Chromatin Assembly Kit 10 rxns 53500
HeLa Core Histones 36 µg 53501
Nucleosome Assembly Control DNA 50 µg 53502
why use The ChroMaTin asseMbly KiT?• Generate chromatin from linear or supercoiled DNA
• ATP-dependent method results in an extended array of regularly spaced nucleosomes
• The most biologically relevant substrate for your assays
• Easy protocol – simply incubate the supplied components with your DNA
![Page 36: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/36.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com34
NOMe-Seq
Active Motif’s NOMe-Seq Kit is the first commercially available assay that can be used to study the relationship between mul-tiple epigenetic modifications on the same DNA molecule. It is a high-resolution, single-molecule Nucleosome Occupancy and Methylome Sequencing kit that provides both a nucleosome footprint and a DNA methylation profile for the same DNA strand. While currently used research methods can determine
nucleosome occupancy or DNA methylation independently, NOMe-Seq is the first technique capable of providing simul-taneous information on both. This provides a means to better understand the different states of chromatin and their effects on gene regulation, and enables researchers to study the role of nucleosome and transcription factor occupancy in the context of DNA methylation for their specific gene of interest.
simultaneous analysis of nucleosome occupancy and DNA methylation profiles
ChroMaTin analysis
CpG sites
CpG sites
GpC sites
CpG sites
CpG sites
GpC sites
CpG sites
GpC sites
Fix cells & shear chromatin by sonication to > 1 kb
Treat with GpC Methyltransferase
Reverse cross-links/DNA purificationBisulfite conversion
PCR amplification/cloning, followed by sequencing
Unmethylated Methylated Nucleosome Bound transcription factor
≥ 147 bpNucleosome
≥ 147 bpNucleosome
10-80 bpProtein
≥ 147 bpNucleosome
NOMe-Seq Method
F I G U R E 1 :The NOMe-Seq method.NOMe-Seq begins with a formaldehyde fixation of cells that preserves nucleosome position as well as protein/DNA binding interactions. After sonication, the fragmented chromatin is enzymatically treated with a GpC methyltransferase to artificially methylate GpC residues that are not protected by bound nucleosomes or proteins. Following reversal of cross-links and DNA purification, bisulfite conversion is performed to identify the methylated cytosines on each DNA strand. For gene-specific analysis, the regions of interest are PCR amplified, cloned and sequenced. The GpC methylation profile will determine the nucleosome or protein binding site positions, while the CpG methylation reveals the endogenous methylation pattern of the gene of interest.
noMe-seq advanTages
• Simultaneous analysis of nucleosome occupancy and CpG methylation on the same DNA strand
• Provides a spatiotemporal relationship between nucleosome occupancy and DNA methylation
• Sensitive enough to detect even subtle changes in nucleosome position
• Lacks nucleosome occupancy bias that is seen when using nuclease digestion techniques
• Chromatin fixation also provides information regarding transcription factor binding sites
How does NOMe-Seq work?NOMe-Seq was developed by the Peter A. Jones laboratory to study the relationship between nucleosome occupancy, tran-scription factor binding and DNA methylation at specific gene loci.1-4 It begins with formaldehyde fixation of cells to preserve nucleosome position and protein/DNA binding interactions, followed by sonication. The fixed chromatin fragments are then treated with a GpC methyltransferase enzyme to artificially methylate GpC dinucleotides not protected by nucleosomes or other DNA-bound proteins. Because GpC residues are highly abundant, this method provides a high-resolution nucleosome occupancy footprint that can detect even subtle changes in nucleosome position. Following bisulfite conversion, gene-specific loci are sequenced to establish a DNA methylation profile for a single DNA strand. As GpC dinucleotides are not methylated in mammalian genomes, the sequencing results can be mapped to compare the artificially methylated GpC and the endogenously methylated CpG residues. A region of GpC sequence data containing unmethylated cytosines spanning 147 bp or larger represents the position of a nucleosome, while smaller unmethylated regions of 10-80 bp represent sites of transcription factor binding. By overlaying sequencing data for the artificial (GpC) and endogenous (CpG) methylation profiles, a spatiotemporal relationship between nucleosome occupancy and DNA methylation can be achieved for a single DNA strand. To learn more, please visit www.activemotif.com/nome-seq.
Product Format Cat. No.
NOMe-Seq 10 rxns 54000
REFERENCES1. You, J.S. et al. (2011) Proc. Natl. Acad. Sci. 108(35): 14497-14502.2. Wolff, E.M. et al. (2010) PLoS Genetics 6(4): e1000917.3. Kelly, T.K. et al. (2010) Molecular Cell 39(6): 901-911.4. Kelly, T.K. et al. (2012) Genome Research doi:10.1101/gr.143008.112.
![Page 37: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/37.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 35
DNA Methylation / Demethylation Overview
The identification of 5-hydroxymethylcytosine (5-hmC), a derivative of the well-characterized 5-methylcytosine (5-mC) epigenetic mark, established a precedent for the role of Tet enzymes in catalyzing DNA demethylation as a mechanism for epigenetic reprogramming. Recent studies reveal that the path-way of demethylation may involve further oxidation of 5-hmC to 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC) during
cell differentiation and development. To aid in the study of how DNA methylation and demethylation work in concert to regu-late gene expression, development, and stem cell identity, Active Motif has developed an expansive line of products and technol-ogies to address the most current and cutting edge areas in DNA methylation research. Let our antibodies, assays, enzymes and contract research services assist in your research efforts.
tools to analyze all aspects of DNA methylation
dna MeThylaTion ProduCTs
• CGBP Antibody (p. 2)• Methylated DNA Standard Kit (p. 43)
• Recombinant Tet1 Protein (p. 44)
• 5-fC Antibody (p. 45)
• Recombinant Tet1 Protein (p. 44)
Tet
DNMT
Dec
arbo
xyla
se
Tet
Tet
• Recombinant Tet1 Protein (p. 44)
• 5-caC Antibody (p. 45)• 5-Carboxylcytosine DNA Standard (p. 45)
• DNMT Activity/Inhibition Assay (p. 42)• DNMT Antibodies (p. 2)• Recombinant DNMT1 Protein (p. 29)• HP1 Antibodies (p. 3)• MBD Antibodies (p. 2)• MeCP2 Antibodies (p. 2)• Uhrf1 Antibody (p. 2)
• MethylCollector Ultra™ (p. 38)• HypoMethylCollector™ (p. 40)• MeDIP Assay (p. 39)• Bisulfite Conversion (p. 41)• 5-mC Antibodies (p. 39)• Methylated DNA
Standard Kit (p. 43)
• Hydroxymethyl Collector™ (p. 36)• hMeDIP Assay (p. 37)• PvuRts1I enzyme (p. 44)• b-Glucosyltransferase (p. 44)• 5-hmC Antibodies (p. 37)• Methylated DNA
Standard Kit (p. 43)
F I G U R E 1 :Schematic representation of the oxidation of 5-methylcytosine by Tet enzymes and related products.Tet enzymes catalyze the conversion of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), 5-formylcytosine (5-fC), and 5-carboxylcytosine (5-caC) via oxidation of the methyl group at the 5-position on the cytosine ring. The schematic depicts the demethylation pathway and the various Active Motif products associated with each of the individual steps of the reaction.
![Page 38: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/38.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com36
Hydroxymethyl Collector™
The Hydroxymethyl Collector Kit is designed for the highly specific capture of DNA fragments that contain 5-hydroxymethyl-cytosine (5-hmC) residues. The method takes advantage of an efficient chemical labeling procedure that enables the enriched
samples to be collected as double-stranded DNA fragments. This makes it easy to prepare libraries for various downstream applications, including Next Generation sequencing (Figure 1). Please visit www.activemotif.com/hydroxy-mc for more details.
biotin-based magnetic bead enrichment of 5-hydroxymethylcytosine
5-hydroxyMeThylCyTosine dna enriChMenT
How does it work?The Hydroxymethyl Collector method utilizes a b-glucosyltransferase enzyme to transfer a modified glucose moiety to 5-hmC residues in double-stranded DNA. This modified glucose is then used to chemically attach a biotin conjugate for capture and enrichment using streptavidin-coated magnetic beads and a magnet (Diagram 1).
What’s in the box?The Hydroxymethyl Collector Kit contains reagents to per-form the glucosylation reaction, biotin conjugation, streptavidin capture, elution and purification of enriched DNA. For added convenience, positive control 5-hmC DNA and PCR primers are also included to confirm the efficiency of the enrichment.
Why use Hydroxymethyl Collector?Hydroxymethyl Collector is extremely specific in its capture of hydroxymethylated DNA fragments. Utilizing chemical label-ing of 5-hmC residues ensures no cross-reactivity with 5-mC, and the method is not limited by the specific properties or consensus sequences that constrain traditional methods, such as glucosyl-sensitive restriction enzyme digestion. Streptavidin magnetic beads are used to enable the quick and efficient recovery of enriched 5-hmC DNA in less than 4 hours. The high affinity of the biotin-streptavidin capture allows more stringent binding and wash conditions to enable enrichment of 5-hmC resi-dues that cannot be detected by antibody immunoprecipitation methods. The result is reduced background and increased sensi-tivity, enabling enrichment of DNA fragments containing as few as two 5-hmC residues. Enriched DNA can be used in the analysis of individual genes by PCR and qPCR, or with microarrays and sequencing for genome-wide analysis.
N
N
NH2O
O
HO
OH
HOHO
N3
Biotin
N
N
NH2O
O
HO
OH
HOHO
N3
N
N
NH2OH
HO
β-Glucosyltransferase + UDP-Azide-Glucose
(1 hr at 37°C)
Biotin Conjugate Solution
(1 hr at 37°C)
Magnetic Streptavidin
Beads (30 min at RT)
Elute the DNA from the Biotin(30 min at RT)
1. Fragmented DNA containing 5-hmC
Enriched DNA containing 5-hmC
is ready for analysis.5. Eluted DNA is purified using the included reagents.
2. Modified Glucosyl-5-hmC
3. Biotinylated Glucosyl-5-hmC
4. DNA is captured for washing and elution.
N
N
NH2O
O
HO
OH
HOHO
N3
N
N
NH2O
O
HO
OH
HOHO
N3
BiotinSA
D I AG R A M 1 :Flow chart of the Hydroxymethyl Collector method.F I G U R E 1 :
Human tiling array data showing enrichment of 5-hmC across the entire length of the JARID2 gene in chromosome 6 using human brain DNA that was enriched with Hydroxymethyl Collector.
Product Format Cat. No.
Hydroxymethyl Collector™ 25 rxns 55013
hydroxyMeThyl ColleCTor advanTages
• Chemical labeling ensures specific modification of 5-hmC DNA without cross-reactivity of 5-mC sites
• Biotin-streptavidin binding enables more stringent binding and wash conditions, which reduces non-specific background without compromising assay sensitivity
• Use of dsDNA throughout the procedure makes it easier to prepare libraries for Next-Gen sequencing
![Page 39: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/39.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 37
hMeDIP
An alternative form of DNA methylation, 5-hydroxymethyl- cytosine (5-hmC), results from the enzymatic conversion of 5-methylcytosine (5-mC) into 5-hmC by the TET family of cytosine oxygenases. While its precise function has yet to be determined, it is postulated that 5-hmC, along with methylation variants 5-fC and 5-caC (see page 45), could represent a pathway to demethylate DNA. Active Motif’s hMeDIP Assay is specific
for the enrichment of DNA containing the 5-hmC residue and enables researchers to isolate 5-hmC DNA separate from 5-mC DNA to study the specific effects of 5-hmC on gene regulation (Figure 1). The hMeDIP Assay’s ability to distinguish between the two types of DNA methylation is highly advantageous as most common methods to analyze DNA methylation, such as bisulfite conversion, do not distinguish between 5-mC and 5-hmC residues.
easily obtain 5-hydroxymethylcytosine-specific DNA fragments
5-hMC dna iMMunoPreCiPiTaTion
How does it work?The hMeDIP assay is designed to isolate and enrich for DNA fragments containing 5-hydroxymethylcytosine. The assay contains a highly specific purified 5-hydroxymethylcytosine antibody and the necessary buffers to perform hydroxymethylated DNA immunoprecipitation (hMeDIP). The hMeDIP Assay starts with either double-stranded or single-stranded genomic DNA fragments. Following an overnight incubation with the 5-hydroxymethylcytosine antibody, and a 2 hour incubation with protein G magnetic beads, the included magnet is used to capture, wash and elute the immunoprecipitated 5-hmC DNA. The fast, magnetic protocol streamlines the number of wash and incubation steps needed, saving you valuable time.
What’s in the box?The hMeDIP Kit contains 5-hmC antibody, buffers, Protein G magnetic beads and a bar magnet for the immunoprecipitation, separation and elution of DNA fragments containing 5-hmC. Protocols are provided for DNA fragmentation all the way through to analysis by real-time PCR.
For added convenience, the kit also includes a negative control rabbit IgG antibody as well as DNA standards that can be used as spike-in controls to confirm the efficiency of the hMeDIP en-richment by qPCR with the provided PCR primer mix (Figure 1).
Antibodies for 5-hydroxymethylcytosine detectionIn addition to the complete hMeDIP Assay, Active Motif also offers both monoclonal and polyclonal antibodies for the study of 5-hydroxymethylcytosine. Each antibody has been validated for use in multiple applications, including dot blot and methyl-DNA immunoprecipitation (Figure 2). The polyclonal antibody is available in two formats depending on your preference: whole rabbit serum (Catalog No. 39769) and purified IgG (Catalog No. 39791). For more information about 5-hydroxymethylcytosine antibodies and assays, please visit www.activemotif.com/hmc.
genes + strand
Elevated signal in gene bodies
F I G U R E 2 :5-hMeDIP-chip performed on human brain DNA shows that 5-hmC is enriched primarily in the coding region of genes, rather than the promoter or regulatory regions.
Product Format Cat. No.
hMeDIP Assay 10 rxns 55010
5-Hydroxymethylcytosine (5-hmC) antibody mAb 100 µg 39999
5-Hydroxymethylcytosine (5-hmC) antibody pAb 100 µl 39769
5-Hydroxymethylcytosine (5-hmC) antibody pAb (IgG) 100 µg 39791
hMeDIP-Seq servicesActive Motif also offers hMeDIP-Seq as a custom service. See page 47 or visit us at www.activemotif.com/services for details.
0
2K
4K
6K
8K
unDNA meDNA hmeDNA Neg Ctrl Rabbit IgG
Fold
enr
ichm
ent
F I G U R E 1 :Real-time PCR results of hMeDIP assay performed on Mse I digested human genomic DNA spiked with the included unmethylated, methylated or hydroxymethylated DNA standard controls.
![Page 40: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/40.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com38
5-MeThylCyTosine dna enriChMenT
MethylCollector™ Ultra
Active Motif’s MethylCollector Ultra Kit* provides improved enrichment of CpG-methylated DNA compared to alter-native methyl-binding domain protein (MBD) or antibody
immunoprecipitation methods. Enriched DNA is suitable for use in various downstream applications such as PCR, bisulfite con-version, or amplification and labeling for microarray analysis.
fast magnetic assay for specific enrichment of CpG-methylated DNA
Why use MethylCollector Ultra?Active Motif’s MethylCollector Ultra Kit improves the enrichment of CpG-methylated DNA by incorporating the Methylated CpG Island Recovery Assay (MIRA), which uses a combination of methyl-binding proteins (MBD2b and MBD3L1) to increase the affinity for methylated DNA fragments.1 This unique protein complex provides greater specificity for methylated CpG dinucleotides than alternative MBD or antibody immunoprecipitation (MeDIP) methods, in less than half the time. The kit also includes positive control human, male genomic DNA and methylation-specific PCR primers to validate your results.
What’s in the box?The MethylCollector Ultra Kit contains all necessary components for enrichment of CpG-methylated DNA including His-MBD2b/MBD3L1 protein complex, binding and elution buffers, and magnetic nickel beads. Control Mse I digested genomic DNA, PCR primer mixes and reagents are also included to confirm the efficiency of the enrichment by real-time PCR.
Product Format Cat. No.
MethylCollector™ Ultra 30 rxns 55005* Technology covered under U.S. Patent No. 7,425,415.
F I G U R E 2 :Real-time PCR analysis of methylated, SNRPN (red), and unmethylated, FOXD2 (blue), promoters validates MethylCollector Ultra specificity.
His-MBD2b/MBD3L1 Capture(MethylCollector™ Ultra)
8
7
6
5
4
3
2
1
12 16 20 24 28 32 36 40
Cycle
SNRPNFOXD2
Rn
Break open cells and shearDNA by Sonication orEnzymatic Shearing.
methylatedDNA
Incubate sheared DNA withHis-tagged MBD2b/MBD3L1
protein complexes.
The purified, methylatedDNA is ready
for PCR analysis.
Elute the bound, methylatedDNA, while simultaneously
degrading the protein complexes.
Capture the methylated protein-DNA complexes with nickel-coated magnetic beads.
Wash to remove the unmethylated
DNA fragments.
F I G U R E 1 :Flow chart of the MethylCollector Ultra process.
REFERENCES1. Rauch, T. and Pfeifer, G. (2005) Lab. Investigation 85: 1172-1180.
MeThylColleCTor ulTra advanTages
• Improved efficiency – provides greater enrichment of CpG-methylated DNA than other MBD capture or antibody immunoprecipitation (MeDIP) methods
• Faster procedure – magnetic protocol can be completed in less than 3 hours
• Uses minimal sample material – requires as little as 1 ng of DNA fragmented by sonication or enzymatic digestion
• Controls ensure success – includes positive control DNA and methylation-specific PCR primers
MethylCollector Ultra-Seq (MIRA-Seq) servicesMethylCollector Ultra-Seq is also offered as a custom service by Active Motif’s Epigenetic Services. Customers can submit their cells or DNA and receive fully analyzed genome-wide methylation data in just weeks. For more complete details, see page 47 or visit us at www.activemotif.com/services.
![Page 41: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/41.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 39
why use The MediP assay?• Works efficiently with 100 ng – 1 µg of fragmented,
single-stranded DNA
• Includes 5-mC and Bridging antibodies for methylated DNA enrichment, and a negative control mouse IgG antibody
• Positive control human genomic DNA and PCR primers are provided to verify the efficiency of the enrichment
• Fast magnetic protocol minimizes the number of wash and incubation steps, saving you valuable time
• Enriched DNA can be used for downstream applications including real-time PCR and Next Generation sequencing
MeDIP
Methylated DNA Immunoprecipitation (MeDIP) is an immuno-capture technique in which an antibody specific for 5-methylcy-tosine is used to immunoprecipitate methylated DNA fragments from the rest of the sample population. One advantage of using the MeDIP antibody capture approach over methyl-binding
protein capture is that the MeDIP antibody is not limited to the study of DNA methylation in the context of CpG dinucleotides. The antibody can also immunoprecipitate DNA fragments that contain CpA or CpT methylation, which has been reported to exist in embryonic stem cells.
How does it work?The MeDIP assay utilizes a highly specific monoclonal antibody that recognizes 5-methylcytosine (5-mC) to immunoprecipitate and enrich for methylated DNA. The assay begins by heat de-naturing fragmented genomic DNA to generate single-stranded fragments. This step is critical because the 5-Methylcytosine antibody does not recognize 5-mC on double-stranded DNA, as shown in Figure 1. The 5-Methylcytosine antibody is then added to the DNA in the presence of a Bridging Antibody and protein G magnetic beads. The reactions undergo an overnight incuba-tion before the included magnet is used to capture, wash and elute the 5-methylcytosine containing DNA from the protein G beads. For added convenience, the kit also includes a negative control mouse IgG antibody, positive control Mse I digested human genomic DNA and real-time PCR primers that can be used to verify the efficiency of the MeDIP enrichment.
specific enrichment of 5-mC DNA using antibody immunoprecipitation
5-MC dna iMMunoPreCiPiTaTion
F I G U R E 2 :Next-Gen sequencing data of human PBMC DNA enriched by MeDIP shows enriched regions correlate well with CpG density.
Antibodies for 5-methylcytosine detectionIn addition to the MeDIP Assay, the 5-mC and Bridging antibodies can be purchased separately. The 5-Methylcytosine antibody is a mouse monoclonal antibody, Clone 33D3, that has been validated for applications such as MeDIP, IP, flow cytometry, IHC and dot blot. A polyclonal 5-mC antibody is also available.
Bridging Antibody can be used to improve immunoprecipitation reactions. Some isotypes of mouse IgG antibodies do not bind well to protein G-conjugated agarose/magnetic beads. The inclusion of a Bridging Antibody into the reaction can increase capture efficiency due to the Bridging Antibody’s strong affinity to both the protein G beads and the mouse IgG (Figure 2).
Product Format Cat. No.
MeDIP Assay 10 rxns 55009
5-Methylcytosine (5-mC) antibody mAb (Clone 33D3) 50 µg 39649
5-Methylcytosine (5-mC) antibody pAb 100 µg 61255
Bridging Antibody for Mouse IgG 500 µg 53017
F I G U R E 1 :Dot blot analysis of DNA methylation antibody binding specificity.Unmethylated (DNA), 5-meth-ylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) DNA from the Methylated DNA Standard Kit (Catalog No. 55008) was probed with 5-Methylcytosine antibody (Catalog No. 39649) (Top panel) and 5-Hydroxymethylcytosine antibody (Catalog No. 39769) (Bottom panel). Lane 1: single-stranded DNA. Lane 2: double-stranded DNA.
MeDIP-Seq servicesActive Motif now offers MeDIP-Seq as a custom service. See page 47 or visit us at www.activemotif.com/services for details.
To learn more about Active Motif’s DNA methylation antibod-ies and assays, please visit www.activemotif.com/dnamt.
MeDIP CpG Density
![Page 42: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/42.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com40
unMeThylaTed dna enriChMenT
HypoMethylCollector™for enrichment of hypomethylated DNA regions
Active Motif’s HypoMethylCollector Kit is a novel assay for the specific enrichment of hypomethylated DNA from cell or tissue samples. The HypoMethylCollector Kit utilizes the CXXC do-main from mouse methyl binding protein, MBD1, to specifically capture DNA fragments lacking CpG methylation. The method
is capable of binding DNA fragments that contain only a single unmethylated CpG dinucleotide, while methylated DNA remains unbound. The kit also includes optimized buffers, magnetic beads for convenient wash and elution steps, control DNA, and PCR primers suitable for use in endpoint or qPCR analysis.
Why use HypoMethylCollector?Methylation at the fifth-carbon of cytosine in a CpG dinucleotide is an extremely important DNA modification in eukaryotes. While CpG islands, short CG-rich regions, are found only in approxi-mately 1% of the genome, more than 60% of human promoters contain CpG islands. Normally, CpG islands are unmethylated; in cases where methylation does occur, the associated gene is silenced. Due to the importance of methylation in the context of disease, Active Motif’s HypoMethylCollector Kit provides a simple method for enhanced analysis of CpG island methylation in normal and diseased samples. The HypoMethylCollector Kit makes it possible to identify hypomethylated promoters and to study the effects of inhibitor compounds with a positive readout.
Product Format Cat. No.
HypoMethylCollector™ 30 rxns 55004
How does it work?The HypoMethylCollector Kit uses a recombinant His-CXXC protein to specifically bind unmethylated CpG sites. The kit provides two binding buffers: a low-salt buffer for use with samples containing less than 5 CpG dinucleotides and a higher salt buffer for efficient binding of samples with a large number of CpGs. Nickel-coated magnetic beads capture the protein-DNA complexes, which are separated from the rest of the genomic DNA using the included magnet. Following clean up, the eluted DNA is ready for use in PCR analysis, sequencing or other downstream applications.
Specificity of the HypoMethylCollector technique for hypomethylated DNA fragments has been validated using both a side-by-side comparison of fractions obtained from HypoMethylCollector and MethylCollector™ Ultra Kits across multiple loci (Figure 1), and by bisulfite sequencing analysis (Figure 2).
What’s in the box?The HypoMethylCollector Kit includes His-CXXC protein to bind unmethylated CpG sites, optimized buffers, reagents and beads for capture of protein-DNA complexes, as well as control PCR primers and Mse I digested genomic DNA to validate your results prior to downstream analysis.
F I G U R E 1 :Direct comparison of HypoMethylCollector and MethylCollector Ultra using real-time PCR illustrates each kit’s unique specificity. HypoMethylCollector clearly captures the unmethylated GAPDH locus, while MethylCollector Ultra enriches for the methylated Xist promoter.
0%
20%
40%
60%
80%
100%
120%
140%
Unbound Eluted
Low Salt Binding Conditions
Enric
hmen
t
GAPDH (unmethylated) Xist (methylated)
HypoMethylCollector™
0%
20%
40%
60%
80%
100%
120%
Unbound Eluted
Low Salt Binding Conditions
Enric
hmen
t
GAPDH (unmethylated)
Xist (methylated)
MethylCollector™ Ultra
12345678
Bisulfite sequence results for APC (19 CpGs)
Methylated CpG
Unmethylated CpG
F I G U R E 2 :HypoMethylCollector was used to enrich for unmethylated DNA fragments. DNA was bisulfite treated (see page 41 for details) to confirm the specificity of HypoMethylCollector.
![Page 43: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/43.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 41
Bisulfite Conversion Kitsimplified bisulfite conversion of DNA with easily verified results
bisulfiTe Conversion
Bisulfite conversion followed by DNA sequencing is considered the gold standard in DNA methylation analysis as it provides single-base-pair resolution of the DNA methylation profile. The conversion reaction occurs as a three-step deamination of
cytosine residues into uracil (Figure 1). As only unmethylated cytosine residues are susceptible to bisulfite conversion, the original methylation state of the DNA can be determined. For more details, please visit www.activemotif.com/bis-conv.
Bisulfite Conversion Kit advantagesThe Bisulfite Conversion Kit simplifies the bisulfite treatment of DNA while minimizing DNA fragmentation, degradation and sample loss during the procedure and cleanup steps. A thermal cycler is used to denature the DNA and perform bisulfite con-version in as little as 1.5 hours.
Using a thermal cycling approach gives an added advantage as it has been shown that using a fixed temperature halts the con-version reaction, whereas temperature cycling during the reac-tion improves the overall efficiency of the conversion reaction. The included spin columns combine desulfonation and DNA purification into a single step. The purified, converted DNA is ideal for PCR amplification and sequencing, endonuclease diges-tion and other downstream applications (Figure 2).
Product Format Cat. No.
Bisulfite Conversion Kit 50 rxns 55016
What’s in the box?Each Bisulfite Conversion Kit contains proteinase K for pre-treatment of the DNA, optimized conversion and purification reagents, an easy-to-use protocol and conversion-specific PCR primers suitable for use with human and mouse samples. Because the conversion-specific primer pair produces a PCR product only if conversion has occurred, the primers can be used to validate the results before starting sequencing or other analysis methods.
Bisulfite sequencing servicesActive Motif Epigenetic Services team now offers both Targeted Next-Gen Bisulfite Sequencing and traditional Sanger Bisulfite Sequencing. The bisulfite sequencing services includes primer design and testing, isolation of DNA from cells, bisulfite conversion of DNA, PCR amplification and gel analysis of PCR products, gel purification of PCR products, cloning of PCR products, amplification of cloned inserts, sequencing and data analysis. For more information, see page 47 or go to www.activemotif.com/services.
KiT highlighTs
• Rapid conversion of DNA in as little as 1.5 hours
• Minimal DNA fragmentation, degradation and loss
• Thermal cycling approach for better conversion efficiency
• Reproducible assay consistently provides 99% conversion efficiency of unmethylated cytosines
• Easily convert 200 pg – 2 µg DNA
• Conversion-specific PCR primers included to validate results
GATCGAUGATCGGAGUGTAGGTACGAUGTT
GATCGACGATCGGAGCGTAGGTACGACGTT
Me MeMe
GATCGATGATCGGAGTGTAGGTACGATGTT
Bisulfite Conversion
PCR Amplification
F I G U R E 1 :Example of bisulfite treatment modifying unmethylated cytosine residues into uracil, which are then converted to thymines following PCR amplifica-tion. Methylated cytosines remain unchanged.
-20 0 20 40 60 80 100 120 140 160 180 200 220 240 260 280 300
Unmethylated CpGMethylated CpG
F I G U R E 2 :Bisulfite sequencing results for the CCND2 locus in PC-9 human lung adenocarcinoma cells. Red circles are methylated CpGs and blue circles are unmethylated CpGs.
![Page 44: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/44.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com42
In mammals and other vertebrates, DNA methylation occurs at the 5 position of cytosine (5-mC), mostly within CpG dinucleotides. Modifications at these sequences by DNA methyltransferase enzymes (DNMTs) can have profound effects
on transcription. Active Motif’s DNMT Activity / Inhibition Assay is a fast, user-friendly assay to simplify the measurement of DNA methyltransferase activity or the efficacy of DNMT inhibitors without the need for radioisotopes or expensive equipment.
non-radioactive assay to screen for DNA methyltransferase activity
Unique method enhances sensitivityThe DNMT Activity / Inhibition Assay is a non-radioactive assay to measure the activity or inhibition of DNA methyltransferases. The assay employs a unique and sensitive ELISA-based method that utilizes a methyl-CpG binding domain (MBD) protein to detect methyltransferase activity. In the assay, a universal CpG-enriched DNA substrate has been immobilized on a 96-stripwell plate. Purified DNMTs or DNMT activities from nuclear extracts are added, which catalyze the transfer of meth-yl groups from the provided AdoMet reagent to the coated DNA substrate. The resulting methylated DNA is recognized and bound by the recombinant MBD2b protein. MBD proteins are capable of binding methylated DNA with a higher affinity than antibodies, increasing the sensitivity of the assay relative to antibody-based methods. Addition of a polyHistidine antibody conjugated to horseradish peroxidase (HRP) and developing solution provides a sensitive colorimetric readout that is easily quantified by spectrophotometry. With this method, activity can be detected from as little as 0.5 ng of purified enzyme or 0.5 µg of nuclear extract (Figure 1). The DNMT assay can also be used to screen for DNA methyltransferase inhibitors (Figure 2). For more complete information on the DNMT Activity / Inhibi-tion Assay and DNMT-related products, please visit us at www.activemotif.com/dnmt.
Product Format Cat. No.
DNMT Activity / Inhibition Assay 1 x 96 rxns 55006
F I G U R E 1 :The DNMT Activity / Inhibition Assay range of detection is demonstrated with increasing concentrations of Jurkat nuclear extracts prepared using Active Motif’s Nuclear Extract Kit (Catalog No. 40010).
DNMT Activity from Nuclear Extracts
0
0.2
0.4
0.6
0.8
1.0
Blank 0.625 1.25 2.5 5 10
Jurkat Nuclear Extracts (µg/well)
OD
450
nm
F I G U R E 2 :The DNMT Activity / Inhibition Assay was used to show DNMT inhibition in MCF-7 cells treated with procaine versus untreated cells.
DNMT Activity / Inhibition Assay
0
0.2
0.4
0.6
0.8
1
1.2
1.4
0.313 0.625 1.25 2.5 5 10
Extract (µg/well)
OD
450
nm
MCF-7 Untreated
MCF-7 + 5 mM Procaine
dna MeThylTransferases (dnMT)
DNMT Activity / Inhibition Assay
dnMT assay advanTages
• Non-radioactive – colorimetric assay is easily quantified by spectrophotometry on a microplate reader at 450 nm
• Sensitive – unique MBD protein approach enhances the sensitivity of detection from both purified proteins (DNMT1, DNMT3a & DNMT3b) and nuclear extracts
• Fast – assay can be completed in less than 3 hours
• Flexible – stripwell plate allows screening in low or high throughput
What’s in the box?The DNMT Activity / Inhibition Assay provides all the opti-mized buffers and reagents needed to measure activity of recombinant DNMT enzymes or nuclear extract samples, including substrate-coated plates for DNMT capture, AdoMet, His-MBD2b protein and anti-polyHis-HRP antibody for detection. A CpG Methyltransferase is also included as a positive control.
![Page 45: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/45.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 43
Methylated DNA Standards
Active Motif understands the importance of using appropriate controls to validate experimental results. That is why Active Motif offers a Methylated DNA Standard Kit, which can be used to study unmethylated DNA, 5-methylcytosine methylated DNA
and 5-hydroxymethylcytosine methylated DNA. And, for those researchers who require the study of DNA in a genomic con-text, Active Motif also offers both fully methylated and Jurkat genomic DNA.
Methylated DNA Standard KitThe methylation of cytosine residues at CpG dinucleotides is an important event that regulates gene expression and genome organization. To better understand the implications of DNA methylation on gene regulation and disease, Active Motif offers the Methylated DNA Standard Kit, which contains positive control DNA oligonucleotides for each of the three cytosine methylation states: unmethylated, 5-methylcytosine and 5-hydroxymethylcytosine. The kit is ideal for use as a control in experiments utilizing antibodies specific to the different types of DNA methylation.
The Methylated DNA Standard Kit includes three recombinant DNA standards derived from the APC gene promoter. Each standard is 338 base pairs and contains multiple cytosine resi-dues in both CpG and non-CpG contexts. Each oligonucleotide is generated to be 100% unmethylated, 5-methylcytosine meth-ylated or 5-hydroxymethylcytosine methylated. In addition to the DNA standards, PCR primers specific to the APC promoter are also provided. The identity of the methylated standards are confirmed by dot blot antibody detection (Figure 1).
DNA standards for studying different types of methylation
Product Format Cat. No.
Methylated DNA Standard Kit 3 x 2.5 µg 55008
Fully Methylated Jurkat DNA 10 µg 55003
Jurkat genomic DNA 10 µg 55007
F I G U R E 1 :Dot blot analysis of Methylated DNA Standard Kit samples.Fifty nanograms of the DNA standards included in the Methylated DNA Standard Kit were spotted onto a positively charged nylon membrane: DNA (unmethylated DNA), 5-mC (5-methylcytosine methylated DNA), 5-hmC (5-hydroxymethylcytosine methylated DNA). Top panel: Dot blot probed with 5-Methylcytosine antibody (Catalog No. 39649). Bottom panel: Dot blot probed with 5-Hydroxymethylcytosine antibody (Catalog No. 39769). Lane 1: single-stranded DNA. Lane 2: double-stranded DNA.
Fully Methylated Jurkat DNAActive Motif offers Fully Methylated Jurkat DNA for use as a control in your DNA methylation applications. Whether you are performing bisulfite sequencing, methylation-specific PCR (MSP), MeDIP or using our MethylCollector™ Ultra or MethylDetector™ Kits, Fully Methylated Jurkat DNA is a con-venient positive control for investigating CpG dinucleotide methylation.
Fully Methylated Jurkat DNA is supplied with a BRCA1 primer set. As native Jurkat DNA is not methylated at the BRCA1 locus, this primer set is ideal for use as a control in methylation-specific experiments with Fully Methylated Jurkat DNA. Jurkat genomic DNA is also available.
MeThylaTed dna sTandard KiT advanTages
• Enables inclusion of controls in experiments involving both forms of DNA methylation, 5-methylcytosine and 5-hydroxymethylcytosine
• Includes primers that enable detection of the control DNA using endpoint or real-time PCR
• Validated for use in MeDIP, hMeDIP (See pages 37-39) and dot blot experiments
• DNA is methylated at both CpG and non-CpG sites
Active Motif offers a broad range of antibodies and assays for the study of DNA methylation. To learn more about the antibodies available for the detection of 5-methylcytosine and 5-hydroxymethylcytosine, please see pages 37 & 39.
For a complete list of available DNA methylation assays, please visit us at www.activemotif.com/dnamt.
MeThylaTed dna sTandards
![Page 46: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/46.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com44
5-Hydroxymethylcytosine Enzymes
To assist researchers working to elucidate the functions of 5-hydroxymethylcytosine in gene regulation, Active Motif is pleased to offer enzymes to study not only the mecha-nism by which 5-methylcytosine (5-mC) is converted into 5-hydroxymethylcytosine (5-hmC), but also enzymes that can
differentiate between these two forms of DNA methylation. We offer our Tet1 enzyme to study the mechanism of conversion, our b-glucosyltransferase enzyme for the addition of glucose to hydroxymethylcytosine and our novel PvuRts1I enzyme for the direct discrimination of hydroxymethylated DNA.
additional offerings for the study of hydroxymethylated DNA
5-hydroxyMeThylCyTosine aCCessories
F I G U R E 2 :Specificity of PvuRts1I enzymatic digestion of 5-hmC DNA is shown by unmethylated (Un), 5-methylcytosine (mC) or 5-hydroxymethylcytosine (hmC) Methylated DNA Standards (Catalog No. 55008, see page 43 for complete details) that were incubated in the absence (–) or presence (+) of PvuRts1I.
F I G U R E 1 :Dot blot of double-stranded DNA containing 5-methylcytosine that was incubated with 5 µg of recombinant Tet1 enzyme (+Tet1) or without Tet1 (-Tet1) shows the conversion of 5-methylcytosine into 5-hydroxymethylcytosine by Tet1.
b-Glucosyltransferase modification of 5-hmCThe recent identification that the TET family of dioxygenases can convert 5-methylcytosine (5-mC) into 5-hydroxymethylcytosine (5-hmC) has raised questions about the functional relevance of 5-hmC in mammalian genomes. b-glucosyltransferase serves as a valuable tool to analyze 5-hmC because this enzyme is capable of modifying 5-hydroxymethylcytosine with the addition of a glucose moiety. This glucosylated residue can easily be distinguished from tradi-tional 5-methylcytosine by the use of glucosyl-sensitive restric-tion enzymes. Alternatively, use of the b-glucosyltransferase enzyme in combination with a radiolabeled UDP-glucose donor allows for direct labeling of hydroxymethylated residues.
Product Format Cat. No.
Recombinant Tet1 protein, active 25 µg 31363
PvuRts1I restriction enzyme 50 Units 55011
b-Glucosyltransferase enzyme 500 Units 55012
Tet1 enzyme converts 5-mC DNA into 5-hmC DNATet1 (Ten-eleven Translocation Gene Protein 1) is a member of the TET family of cytosine oxygenases that convert 5-meth-ylcytosine (5-mC) into 5-hydroxymethylcytosine (5-hmC). For researchers interested in studying the mechanism of how 5-hydroxymethylcytosine is generated, our Recombinant Tet1 protein is an active enzyme that can be used to convert 5-mC containing DNA into 5-hmC containing DNA (Figure 1).
Direct digestion of 5-hydroxymethylcytosineWhile glucosyl-sensitive restriction enzymes offer a method to enzymatically differentiate between 5-mC and 5-hmC, they require the prior addition of a glucose moiety to the 5-hydroxymethylcytosine residue. Active Motif’s novel PvuRts1I restriction enzyme, however, is able to bypass this intermedi-ary step and directly differentiate between 5-mC and 5-hmC residues. PvuRts1I directly cleaves hydroxymethylated DNA in its non-glucosylated form, but will not digest 5-methylcytosine or unmethylated cytosine residues (Figure 2). The enzyme also cleaves glucosylated-5-hmC DNA, but at a lower efficiency. To learn more about this unique enzyme’s digestion properties, please visit www.activemotif.com/hmc.
![Page 47: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/47.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 45
F I G U R E 3 :Dot blot analysis of varying amounts of DNA from the 5-Carboxylcytosine DNA Standard Kit that were spotted onto a nylon membrane shows specificity of Active Motif’s 5-Carboxylcytosine antibody (Catalog No. 61225) for 5-caC.
F I G U R E 2 :Representative confocal images of fertilized oocytes co-stained with Active Motif’s 5-Formylcytosine (5-fC) and 5-Carboxylcytosine (5-caC) antibodies (red, Catalog Nos. 61223 and 61225, respectively), and a 5-methylcytosine (5-mC) antibody (green) (Inoue et al.*).
F I G U R E 1 :Shown are representative immunofluorescent images of mitotic chromosome spreads that have been co-stained with Active Motif’s 5-Formylcytosine (left) or 5-Carboxylcytosine (right) antibodies (red, Catalog Nos. 61223 and 61225, respectively), a 5-methylcytosine (5-mC) antibody (green) and DAPI (blue) at the two-cell stage of mouse preimplantation development. The images reveal that, at the two-cell stage, only one of the two sister chromatids is enriched for 5-fC and 5-caC, consistent with findings that 5-fC and 5-caC levels are diminished by half in blastomeres with each round of DNA replication (Inoue et al.*).
5-Formylcytosine (5-fC) & 5-Carboxylcytosine (5-caC)antibodies to study alternative forms of cytosine methylation
The TET family of cytosine oxygenases, which convert 5-methyl-cytosine (5-mC) into 5-hydroxymethylcytosine (5-hmC), further oxidize 5-hmC into 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC). These two novel DNA modifications have been found to exist in many vertebrate cell types, includ-ing embryonic stem cells. 5-fC and 5-caC appear in the paternal pronucleus after fertilization (Figure 2), concomitant with the
disappearance of 5-mC. The levels of 5-fC and 5-caC are gradual-ly diluted out by DNA replication, rather than being enzymatical-ly removed (Figure 1). While this pathway may represent a mecha-nism by which 5-mC methylation is removed, these variants may also serve unique functions in pre-implantation development. Active Motif offers 5-fC and 5-caC antibodies and a 5-caC DNA Standard Kit (Figure 3) to study these novel modifications.
dna MeThylaTion varianTs (5-fC & 5-CaC)
Product Format Cat. No.
5-Formylcytosine (5-fC) antibody (pAb) 100 µl 61223
5-Formylcytosine (5-fC) antibody (pAb) 100 µg 61227
5-Carboxylcytosine (5-caC) antibody (pAb) 100 µl 61225
5-Carboxylcytosine (5-caC) antibody (pAb) 100 µg 61229
5-Carboxylcytosine DNA Standard Kit 0.5 µg 55014
5-fCpAb
5-mCpAb
Merge
5-caCpAb
5-mCpAb
Merge
5-caC Modified DNA Standard
Unmodified DNA Standard
ss ssds ds
5-fC 5-mC DAPI
5-caC 5-mC DAPI
* The images above were kindly provided by the laboratory of Yi Zhang, HHMI Investigator at the University of North Carolina at Chapel Hill. The data is described in detail in Inoue et al. (2011) Cell Research 21(12): 1670-1676.
![Page 48: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/48.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com46
ChIP Servicesutilize our experienced research team for your epigenetics studies
Chromatin immunoprecipitation (ChIP) is a powerful tool for studying protein/DNA interactions. ChIP-Seq takes ChIP a step further by combining it with Next Generation sequencing in order to generate whole-genome data sets. However, the various technical and bioinformatic challenges associated with ChIP-Seq present a barrier to many researchers in need of this data. To
overcome this barrier, researchers can utilize our expertise to facilitate their research into transcription factor binding, transcriptional regulation and histone distribution. Active Motif’s Epigenetic Services team has over 9 years of success providing a wide variety of ChIP services. For complete details, please give us a call or visit us at www.activemotif.com/services.
Contact us about our ChIP antibody validation service.
F I G U R E 1 :ChIP-Seq of chromatin of small molecule inhibitor-treated CD34+ cells using antibodies against a histone acetyltransferase (HAT) and its corresponding histone modification shows reduction in the occupancy of HAT at the promoter of the RBBP4 gene but not at other genes. As expected, the corresponding histone tail acetylation was also reduced at the RBBP4 gene.
F I G U R E 2 :ChIP-Seq was performed using chromatin from control and estrogen- treated MCF-7 cells using antibodies against RNA pol II and SRC3. The estrogen-induced SRC3 binding observed at the promoter and gene body of the RET gene (top panel) correlates with induced transcription of the RET gene as measured by RNA pol II occupancy (bottom panel).
ChIP-Seq ServicesSeveral types of ChIP-Seq are offered; ChIP is performed on different types of targets to answer different questions:
• FactorPath™ ChIP-Seq – discover, identify and quantitate transcription factor and cofactor binding sites
• HistonePath™ ChIP-Seq – map histone modifications or histone modifying enzymes across the genome
• TranscriptionPath™ ChIP-Seq – measure transcription rates globally as a function of RNA pol II occupancy
In addition, we offer MethylPath™ MeDIP-Seq and a number of other services for DNA methylation research (see page 47).
Active Motif Epigenetic Services
• Experience – thousands of genome-wide data sets generated
• Quality – QC steps ensure high-quality whole-genome data
• Support – all services include bioinformatics analysis
Customer fixes cell lines or freezes tissue samples.
1
Chromatin preparation is quantified and sized.
Antibody is ChIP Qualified prior to ChIP-Seq ChIP rxns.
qPCR is used to validate success of the ChIP rxns.
QC by qPCR, quantification of yield and library size.
Sequencing to yield≥ 30 million tags.
Active Motif prepares chromatin and sonicates.
2
Active Motif performs the ChIP reactions.
3
Active Motif constructsChIP-Seq libraries.
4
Libraries sequenced usingIllumina HiSeq.
5
Analysis and Data Delivery.6
ChIP-Seq ServicesProcess Steps
ChIP-Seq Quality Control
+ Inhibitor
Vehicle
+ Inhibitor
Vehicle
Reduced Acetyltransferase Occupancy
HATChIP-Seq
AcetylatedHistone
ChIP-Seq
{{
ZBTB80S SYNC
Reduced Histone Acetylation
33,220,00033,200,00033,180,00033,160,00033,140,00033,120,00033,100,00080,000
KIAA1522RBBP4
Estrogen
Estrogen
Control
Control
SRC3ChIP-Seq
Pol IIChIP-Seq
{{
RET
42,880,000 42,900,000 42,920,000 42,940,000q11.21
ePigeneTiC serviCes
![Page 49: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/49.jpg)
www.activemotif.com JAPAN +81 (0)3 5225 3638 EUROPE +32 (0)2 653 0001 NORTH AMERICA 877 222 9543 47
ePigeneTiC serviCes
DNA Methylation Research Services
Determining the impact of differential DNA methylation across multiple samples is important to understanding the underlying mechanisms of development and disease. Our DNA methylation
services give customers access to the state-of-the-art technolo-gies that make a real impact on this ever expanding field. For details, please visit us at www.activemotif.com/services.
utilize our experienced research team to study DNA methylation patterns
0 10050
172
24
1
48
2 3 4 5 6 7 8 9
Normal Patients
Diseased Patients
Disease ModelCell Lines
% DNA Methylation
CpG
Site
CellType 1
CellType 2
1234567
1234567
F I G U R E 3 :Targeted Next-Gen Bisulfite Sequencing was performed using 9 separate samples and 10 different primer pairs. All 90 amplicons were sequenced in a single Next Genera-tion sequencing run. This heat map shows methylation data from one of the ten primer pairs across the population of 9 samples.
F I G U R E 4 :Bisulfite sequencing reveals differen-tial methylation in two cell lines.Sanger bisulfite sequencing was performed on customer-selected genomic locations. This data compares the methylation state of a region with 24 CpGs in two different cell lines. Seven clones from each of the cell lines were sequenced.
F I G U R E 1 :Next Generation sequencing was performed on DNA enriched from human PBMC DNA using MethylCollector™ Ultra, and tags were mapped to generate a whole-genome DNA methylation profile. Data show DNA methylation is detected at CpG shores rather than in the CpG island itself.
F I G U R E 2 :DNA was enriched by MeDIP from adaptor-ligated human PBMC DNA. Next Generation sequencing was performed and tags were mapped to generate a whole-genome DNA methylation profile. The image above shows that the enriched regions correlate well with CpG density.
MethylCollector™ Ultra-SeqCpG Density
MeDIP CpG Density
Genome-wide DNA Methylation Services
• MeDIP-Seq – enrichment of methylated DNA with a highly specific 5-methylcytosine antibody
• MethylCollector™ Ultra-Seq – based on the patented MIRA (Methylated CpG Island Recovery Assay) technology
• hMeDIP-Seq – enrichment using the most specific, highly cited 5-hydroxymethylcytosine antibody
• fC & caC genome-wide profiling – enrichment using a 5-formylcytosine or a 5-carboxylcytosine antibody, followed by Next Generation sequencing
The Genome-wide DNA methylation Services include:
– DNA isolation from cells or tissues, followed by enrichment of methylated DNA
– qPCR analysis of positive and negative control sites
– Next-Gen Library generation
– Sequencing of ≥ 30 million tags using the Illumina HiSeq
– Analysis: mapping, peak calling, visualization files and Excel output
Bisulfite Sequencing ServicesBisulfite Sequencing is the only method that enables detection of the methylation status of individual cytosines at single-base-pair resolution. Active Motif Epigenetic Services offers two Bisulfite Sequencing options:
Targeted Next-Gen Bisulfite Sequencing
• Multiplex many samples and multiple amplicons into a single Next-Gen sequencing reaction
• 100X to 10,000X coverage of each amplicon
• No cloning bias
• Multiplexing makes large experiments cost-effective
Sanger Bisulfite SequencingThis traditional bisulfite approach requires cloning of bisulfite converted amplicons and sequencing of 8 to 16 clones.
• Service includes all steps from primer design to analysis
• Recommended for small-scale experiments of < 5 samples
![Page 50: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/50.jpg)
NORTH AMERICA 877 222 9543 EUROPE +32 (0)2 653 0001 JAPAN +81 (0)3 5225 3638 www.activemotif.com48
LightSwitch™ Luciferase Assay System
The LightSwitch Luciferase Assay System is a complete solution for performing transcriptional & post-transcriptional gene regulation studies in living mammalian cells. It is particularly well-suited for use in functional validation of protein binding events detected by ChIP. With over 18,000 human promoters &
12,000 3́ UTRs available as transfection-ready GoClone™ reporter vectors, you can perform your assays immediately, without the need to clone or prepare DNA. Optimized assay & transfection reagents and protocols for every step of the process make the entire procedure faster and simpler than with other methods.
directly measure the functional impact of binding at promoters and 3́ UTRs
rePorTer ConsTruCTs, assays & serviCes
F I G U R E 2 :Use our convenient online tool to quickly find pre-cloned regulatory elements for your genes of interest. Simply enter your gene’s name, accession number or other identifier, then click one of the buttons. In this example, a search was performed to find both promoter and 3́ UTR constructs of DNMT3A and DNMT3B.
F I G U R E 1 :After choosing a LightSwitch construct and transfecting, the cells are treated (if desired) and then assayed. The luciferase produced oxidizes the assay substrate and produces light, which is proportional to the effect of the cloned promoter.
SEARCH BY GENE IDENTIFIER
Search for:
In the box below, type or paste in a list of one or more gene identifiers on separate lines. Click on one of the buttons below to search.
DNMT3ADNMT3B
Promoter 3´UTR Both
Prod ID Gene Symbol Type Seq. of Cloned Elements FormatS709833 DNMT3A PROMOTER Sequence and Clone Info 5 µgS709808 DNMT3B PROMOTER Sequence and Clone Info 5 µgS808608 DNMT3A 3´UTR Sequence and Clone Info 5 µgS809202 DNMT3B 3´UTR Sequence and Clone Info 5 µg
PromoterPre-cloned into
a Reporter Vector
2. Treat with compounds, pathogens, or growth conditions to induce expression.
3. Measure luciferase activity to determine the functional effects of TF binding, treatments and/or sequence variations.
RenSPLuciferase
LightSwitch™PromoterReporter
Gene of interest
Human genome
1. Transfect vector.
LightSignal
lighTswiTCh aPPliCaTions
• Assess the functional consequences of binding events detected through ChIP, or monitor promoter activity in response to variations in transcription factor function
• Generate dose response curves to various test compounds or growth conditions
• Dissect transcription factor binding motifs using mutagenesis and naturally occurring sequence variants
• Validate miRNA targets, and study post-transcriptional regulation mediated through miRNA-3́ UTR interactions
Quickly determine if binding imparts functionWhile ChIP and ChIP-Seq can be used to map the genome-wide binding sites of transcription factors, the functional conse-quences of binding must still be determined. A transcription factor may bind at hundreds of sites in the genome, sometimes in proximal promoter regions far away from genes, and it may act as an activator or a repressor, or it may have no effect at all. So, binding alone does not predict the functional outcome.
The LightSwitch System simplifies this task by providing over 18,000 pre-cloned human promoters and a fast, easy-to-use optimized assay. So, you can quickly determine if your binding event has any functional consequence by testing it in live cells.
Comprehensive system to study gene regulationThe LightSwitch System also includes validated stable cell lines, miRNA mimics & inhibitors, and collections of cloned synthetic regulatory elements that can provide greater sensitivity than their endogenous counterparts. In addition, our services team offers custom cloning, mutagenesis, pathway screening, miRNA target validation and sequence variant analysis. For more infor-mation, please visit www.activemotif.com/lightswitch.
![Page 51: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/51.jpg)
More Tools for Epigenetics Research
Get any (or all) of our product information by mail or by downloadIn addition to this product profile, Active Motif has created profiles that describe our products in other areas of epigenetics and gene regulation. These detailed brochures can be downloaded or requested by mail at www.activemotif.com/info. Product manuals and technical data sheets are also available on our website.
ChIP-IT® Products for Chromatin IP
Products for Histone Analysis
Products for DNA Methylation
Stem Cell Epigenetics
Antibodies for Epigenetics and Gene Regulation
Tools for Drug Discovery
LightSwitch™ Reporters for Gene Regulation
Histone ModificationsGuide
Epigenetic Services
Enabling Epigenetics Research
![Page 52: Active Motif’s Epigenetics Products & Services Brochure · 2019-01-22 · Active Motif’s MODified Histone Peptide Array (Catalog No. 13001; see page 21) confirms Histone H3K9me3](https://reader031.vdocument.in/reader031/viewer/2022011905/5f304f47ded71d5c7e21f9c5/html5/thumbnails/52.jpg)
UNITED STATES
1914 Palomar Oaks Way, Suite 150Carlsbad, CA 92008 USAToll Free: 1 877 222 9543
Direct: 1 760 431 1263Fax: 1 760 431 1351
EUROPE
Office Park NysdamAvenue Reine Astrid, 92B-1310 La Hulpe, Belgium
Germany Free Phone: 0800/181 99 10France Free Phone: 0800/90 99 79
UK Free Phone: 0800/169 31 47 Other Countries, Direct: +32 (0)2 653 0001
Fax: +32 (0)2 653 0050 [email protected]
JAPAN
Azuma Bldg. 7th Floor2-21 Ageba-Cho, Shinjuku-Ku
Tokyo, 162-0824, JapanDirect: +81 (0)3 5225 3638
Fax: +81 (0)3 5261 [email protected]
Enabling Epigenetics Research