Upload File

additional file 1: figure s1

1
A B C F E D Additional file 1: Figure S1

Upload: jasmine-sweet

Post on 31-Dec-2015

19 views

Category:

Documents


0 download

Report

DESCRIPTION

A. D. B. E. F. C. Additional file 1: Figure S1. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Additional file 1: Figure S1

A

B

C F

E

D

Additional file 1: Figure S1

CDetection: CRISPR-Cas12b-based DNA detection …...the M13 phage genome (Additional file 1: Figure S1c and Additional file 2: Table S1). The non-canonical collateral ssDNA cleavage

Supplementary figure legends Figure S1. Figure S2. · 1 Supplementary figure legends Figure S1. SMARCA5 functions in the transcription-coupled UV response. (A) RRS levels determined

Figure S1 A-C

Additional files Additional Tables: Table S1. Bacterial …10.1186... ·  · 2015-09-29Additional files Additional Tables: Table S1. ... glmS_pstR TACCGAGTAGAACCTCCTTAGC under glmS

Supplemental Figure S1

Figure S1

Supporting InformationS4 II. ADDITIONAL DATA AND FIGURES p. S6 Figure S1. 1H NMR of CDPA. Figure S2. UV-Vis spectrum of CDPA. Figure S3. Kinetic evaluation of PMMA-TTC RAFT removal

Supplementary figure S1

Figure S1. Figure S2 (a) Figure S2 (b) Figure S2 (c)

Figure S1:

Castel_Figure S1, related to Figure 1

Figure S1: DHTGFLpTEpYVATR

Supplementary Material Table of Contents10.1186...Additional file 1 Casjens et al. 1 Supplementary Material Table of Contents Figure legends Figure S1. Borreliella plasmid PFam32 protein

Supplementary Figure Legends Figure S1. fileSupplementary Figure Legends Figure S1. Group statistic maps for somatomotor connectivity of the TBI sub-groups. Seeds were placed at the

Figure S1, SDCdownload.lww.com/wolterskluwer_vitalstream_com/... · Figure S1, SDC Figure S1, SDC: A sample of 66,596 first adult kidney transplants with organs from living donors

Figure S1 A - Rockefeller University

Supplementary Figure S1

Supplement 1 Table S1: Additional guidelines for

Supplemental Figure S1

Figure S1. Lee et al

Kuwano et al., Supplemental Figure S1

Supplementary Figure Legends Figure S1....Supplementary Figure Legends Figure S1. Group statistic maps for somatomotor connectivity of the TBI sub-groups. Seeds were placed at the

Supplemental Figure Legends: Supplemental Figure S1 ...genesdev.cshlp.org/content/suppl/2014/07/11/gad... · Supplemental Figure Legends: Supplemental Figure S1 Vernalization response

Additional file 110.1186... · 2020-06-05 · Additional file 1 ： Figure S1. Amino acid sequence alignment of . IbNACs. and a NAC transcription factor . PpBL (ALK27819.1) in peach

Figure S1 - Genes & Developmentgenesdev.cshlp.org/content/suppl/2019/01/28/gad.319889... · 2019. 1. 28. · Figure S1 Figure S1. (A) Top, Diagram of human CD44 pre-mRNA depicting

media.nature.com · 1 Supplementary Materials Supplementary Table S1 Supplementary Table S2 Supplementary Table S3 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure

Supplementary Figure S1 - ncbi.nlm.nih.gov

Supplementary figure S1

Figure S1, Birtwistle et al

Additional information: Figure S1

Rust et al., Figure S1

SUPPLEMENTAL FIGURE LEGENDS Figure S1. Programmed cell ...genesdev.cshlp.org/.../Supplemental_Figures.pdf · 6.02.2017  · SUPPLEMENTAL FIGURE LEGENDS Figure S1. Programmed cell

Figure S1 Figure S1. European corn borer (ECB) oral secretions (OS) did not induce the expression of…

Supplemental Figure S1. Coleorhiza anatomy

Supplemental Figures S1-S8. Supplemental Figure S1