AppendixExposure to and colonization by antibiotic-resistant E. coli in UK coastal water users: environmental surveillance, exposure assessment, and epidemiological

study (Beach Bum Survey)

ContentsAdditional materials and methods........................................................................................................2

Bathing water collection (see section 2.1.1)......................................................................................2

Sample preparation, bacterial cell counts an estimating the prevalence of 3GC-resistant bacteria (see section 2.1.2)..............................................................................................................................2

Estimating the prevalence of blaCTX-M carriage in coliforms isolated from bathing waters (see section 2.1.3).....................................................................................................................................2

Characterizing blaCTX-M diversity (see section 2.1.3)...........................................................................2

Bacterial species identification of resistant colonies (see section 2.1.4)...........................................2

Table S1. Primer pair sequences used for PCR or qPCR.....................................................................3

Estimating water user exposure to blaCTX-M-bearing E. coli in coastal bathing waters (see section 2.2)....................................................................................................................................................5

The Beach Bum Survey (see section 2.3)...........................................................................................6

Sample size calculation......................................................................................................................6

Eligibility criteria................................................................................................................................6

Participant recruitment.....................................................................................................................6

The questionnaire and materials for participants..............................................................................7

Laboratory work (see section 2.3.2)..................................................................................................7

Data analysis......................................................................................................................................9

Table S3. Survey given to Beach Bum Survey Participants...............................................................10

Additional results.................................................................................................................................16

Environmental monitoring (see section 3.1)....................................................................................16

Figure S1 The mean percent of E. coli that are resistant to third-generation cephalosporins (3GCs) for each month that bathing water samples were received............................................................16

Table S4. Prevalence of blaCTX-M positive isolates among 3GC resistant coliform bacteria isolated from bathing water-associated samples, and two reference wastewater samples. *A number of isolates were either lost during sub-culturing/storage, or it was not possible to amplify the entire blaCTX-M gene for genotype identification.........................................................................17

Estimating the risk of exposure to blaCTX-M -bearing E. coli among coastal water users (see section 3.2)..................................................................................................................................................19

Table S5. Population-level estimate of water user exposure to CTX-M-producing E. coli in coastal waters of England and Wales in 2015..............................................................................................19

Results of the epidemiological survey (see section 3.3)..................................................................20

1

Table S6. The number (%) of surfers and controls colonized by antibiotic resistant non-E. coli coliforms..........................................................................................................................................20

Table S7. Demographic characteristics of participants....................................................................21

References for supplementary materials............................................................................................22

Additional materials and methodsBathing water collection (see section 2.1.1)97 bathing water samples were collected by Environment Agency from England and Wales between July 2012 and September 2012 as part of their routine water quality monitoring (Johnathon Porter, personal communication). Samples were kept at 4oC overnight and then transported on ice to our lab for immediate processing. One additional sample was collected from a beach in Cornwall.

Sample preparation, bacterial cell counts an estimating the prevalence of 3GC-resistant bacteria (see section 2.1.2)Water samples were centrifuged at 8,000 rpm for 10 minutes at 4oC. After discarding the supernatant, the pellets were re-suspended in 2 mL of sterile saline (0.85% NaCI). A portion of 100 µl cell suspensions was spread onto Chromocult Coliform Agar Enhanced Selectivity (Merck) supplemented with the third-generation cephalosporin (3GC) antibiotics ceftazidime (4 µg/mL) or cefotaxime (2 µg/mL) or no antibiotic, respectively, using an Easy Spiral Automatic Plater (Interscience). The plates were incubated at 37oC for 18-20 hr. Colony forming units (CFU) for total presumptive E. coli and non-E. coli coliforms were enumerated from the selective and non-selective plates. The prevalence of 3GC-resistant E. coli was estimated by dividing the number of colonies that grew in the presence of 3GC by the number of E. coli colonies that grew on the non-selective media.

Estimating the prevalence of blaCTX-M carriage in coliforms isolated from bathing waters (see section 2.1.3)In 2013, 3GC resistant colonies were picked and transferred to a new plate of Chromocult Coliform Agar supplied with ceftazidime or cefotaxime at the same concentration as before. Colony PCRs were performed using CTX-M universal primer pairs to detect the presence or absence of the blaCTX-M gene family. The prevalence of E. coli harboring blaCTX-M was estimated by dividing the number of blaCTX-M -bearing E. coli by the total number of E. coli grown on the non-selective agar plates.

Characterizing blaCTX-M diversity (see section 2.1.3)blaCTX-M -bearing E. coli underwent PCR with genotype-group specific primer pairs for groups 1, 2, 8, 9 and 25 blaCTX-M genes were used as previously described (see Table S1 for primer sequences used and references to relevant papers). To further characterize the blaCTX-M genes, the entire genes were amplified and sequenced using the primers reported in Table S1 below. The PCR products were purified with the DNA Clean and Concentrator kit (Zymo Research) and sent to GATC Biotech (German) for sequencing. These sequences were trimmed in order to remove low-quality reads and then aligned using ClustalW in MEGA7 software in order to obtain a single sequence. These sequences were used, along with

2

published sequences of known blaCTX-M genes, to identify to which CTX-M subtype each sample belonged.

Bacterial species identification of resistant colonies (see section 2.1.4)Isolates that tested positive for the blaCTX-M gene underwent PCR with the dnaJ gene specific primer pair (Table S1) to sequence the gene for bacterial species identification. DNA sequences were BLAST-searched against GenBank. Multiplex PCR was used to type the phylogroups of blaCTX-M-bearing E.coli. Furthermore, E. coli O25b-ST131 clones were detected by PCR (Table S1). A positive control for this PCR was provided by Edward Topp (personal communication).

Table S1. Primer pair sequences used for PCR or qPCRPrimer pair sequences ReferencesPrimers for blaCTX-M gene detection

Universal primer pair CTX-F: TCT TCC AGA ATA AGG AAT CCCCTX-R: CCG TTT CCG CTA TTA CAA AC

(1)

Primers for blaCTX-M gene characterizationCTX-M-1 group specific primersForward: CTT CCA GAA TAA GGA ATC CCReverse: CGT CTA AGG CGA TAA ACA AA

(2)

CTX-M-9 group specificForward: TGA CCG TAT TGG GAG TTT GReverse: ACC AGT TAC AGC CCT TCG

(2)

CTX-M-25 group specificForward: AAT GTT CAG GGG ATT AGG AReverse: ATC ACT CCA CAT GGT GAG TA

(2)

CTX-M-2 group specificForward: CGA CGC TAC CCC TGC TAT T Reverse: CCA GCG TCA GAT TTT TCA GG

(3)

CTX-M-8 group specific Forward: TCG CGT TAA GCG GAT GAT GCReverse: AAC CCA CGA TGT GGG TAG C

(3)

Primers for amplifying and sequencing entire CTX-M-1 group genesCTXprom: TGC TCT GTG GAT AAC TTG CORF477R: CCG ATG ACT ATG CGC ACT GGG

(4, 5)

Primers for amplifying and sequencing entire CTX-M-9 group genesCtxm9f: ATG GTG ACA AAG AGA GTG CAA C)CTXM9R: TTA CAG CCC TTC GGC GAT GAT

This study

Primers for phylogrouping E. coli chuA.1b: ATGGTACCGGACGAACCAACchuA.2: TGCCGCCAGTACCAAAGACA

(6)

yjaA.1b:CAAACGTGAAGTGTCAGGAGyjaA.2b: AATGCGTTCCTCAACCTGTG TspE4C2.1b: CACTATTCGTAAGGTCATCCTspE4C2.2b: AGTTTATCGCTGCGGGTCGCAceK.f: AACGCTATTCGCCAGCTTGCArpA1.r: TCTCCCCATACCGTACGCTAArpAgpE.f: GATTCCATCTTGTCAAAATAT GCCArpAgpE.r: GAAAAGAAAAAGAATTCCCAA GAGtrpAgpC.1: AGTTTTATGCCCAGTGCGAGtrpAgpC.2: TCTGCGCCGGTCACGCCC

Primers for detecting E. coli O25b-ST131 Mdh36_forward: TTTAACGTTAACGCCGGTMdh36_reverse:GGTAACACCAGAGTGACCA

(7)

3

gyrB47_forward: CGCGATAAGCGCGACgyrB47_reverse: CCGTCTTTTTCGGTGGAA

Primers for species identification of non-E. coli coliforms DN1-1F: GATYTRCGHTAYAACATGGADN1-2R: TTCACRCCRTYDAAGAARC

(8)

PROM+: TGCTCTGTGGATAACTTGCPRECTX-M: CCGTTTCCGCTATTACAAAC(if no product, replaced PROM+ with IS26ENDF)IS26ENDF: GTACGGCCCACAGAATGATGTC

(4, 9)

Primers for amplifying UidA gene using qPCRUidA_F: CAATGGTGATGTCAGCGTTUidA_R: ACACTCTGTCCGGCTTTTG6FAM(probe):TTGCAACTGGACAAGGCACCAGC-BBQ

(10)

4

Estimating water user exposure to blaCTX-M-bearing E. coli in coastal bathing waters (see section 2.2)

The mean number of CTX-M-producing E. coli that vary forming units per mL), and V is the mean volume of water that water users ingest per session of their chosen water sport (in mL)

P: Section 2.1.3 describes the methods used to derive the proportion of E. coli isolated from bathing waters that were found to be carrying blaCTX-M . The total number of blaCTX-M -bearing E. coli per plate were counted and divided by the total number of E. coli grown in the absence of antibiotics to generate the proportion of blaCTX-M-bearing E. coli per plate. The proportion was then averaged over all the samples.

D: E. coli density data for 505 designated bathing beaches were obtained from the Environment Agency website (https://environment.data.gov.uk/bwq/profiles/data.html), and from Natural Resources Wales (personal communication) for the 2015 bathing season. Water samples were categorized based upon E. coli density into those that were “Guideline” (E. coli density <250 cfu/100mL), “Mandatory” (E. coli density 251 – 500 cfu/100mL) and “Fail” (E. coli density >500 cfu/100mL).

V: A review of the literature on the volumes of water that people ingest while doing various water sports was conducted, and the most reliable estimates were chosen to use in the calculation of the number of CTX-M-producing E. coli that various water users ingest per session of their chosen water sport. Full search and quality appraisal methods have been reported previously (11).

5

The Beach Bum Survey (see section 2.3)This cross-sectional study aimed to investigate regular surfers, body boarders and body surfers (hereafter referred to as ‘surfers’) as the group exposed to coastal waters, alongside people with very little exposure to seawater as the ‘control’ group. Planning for this study began in 2014 after the results of the environmental monitoring were available. Participants were asked to collect their own rectal swab and these were submitted within 48 hours to our laboratory for analysis. Gut bacteria collected on these swabs were tested for their resistance to two clinically important antibiotics (cefotaxime and meropenem), as an indication of gut colonization by antibiotic resistant bacteria among surfers and controls. Resistant colonies were screened for genes commonly responsible for their resistance phenotypes. The main outcome of interest was the presence or absence of blaCTX-M-bearing enteric bacteria in fecal samples from participants.Sample size calculationTo detect a difference of 15 percentage points (25% versus 10%, respectively) in the prevalence of gut colonization by blaCTX-M–bearing E. coli with 90% power at the 5% (2-tailed) level of significance, it was estimated that 150 surfers and 150 matched controls would be needed. The prevalence of gut colonization in the wider community (10%) was obtained from Wickramasinghe and colleagues (2012) (12).Eligibility criteriaPeople were only eligible to take part in this study if they met the following criteria:

Aged 18 or over; Lived in England, Wales or Northern Ireland; Did not have any underlying chronic conditions that made them

susceptible to infection or required frequent visits to hospital; Had not travelled outside Europe in the past six months; Had not spent the night in a healthcare facility in the past six months; Had not received treatment involving a course of antibiotics in the past six

months; Had not participated in water sports outside the UK in the past six months.

Surfers who met the definition of regular surfer (surfer, body boarder or body surfer who goes at least 3 times per month) were asked to recruit their own matched control. Participants were instructed that matched controls should be a person of the same sex, same age (+/- five years) who lived in the same part of the county as the recruiting surfer, who did not surf, and who had very little exposure to the sea (going in the sea on average less than once per month). In order to avoid likely person-to-person transmission, controls were not eligible to take part if they lived in the same house as the surfer, or were a recent sexual partner (in the past six months) of their recruiting surfer.Participant recruitmentThe primary method of participant recruitment was conducted using Surfers Against Sewage’s network of regional representatives (Reps) to recruit 150 surfers. These individuals were asked to communicate the existence and purpose of the study to surfers in their area, and to recruit interested people to the study. Following extensive local, national, and global media coverage of the survey in June 2015, many volunteers contacted Surfers Against Sewage (SAS) to express interest in taking part. An employee at SAS sent interested individuals further

6

information on the study (including the information sheet for participants) and screened them for eligibility. Once confirmed as eligible, volunteers were sent kits containing information about the study, a consent form, a rectal swab (Medical wire, Fecal Transwab Cary Blair Media), along with illustrated instructions to help participants safely and hygienically collect their specimens, and a short questionnaire. Participants were instructed to complete the questionnaire, sign the consent form and return these along with their rectal swab by first class post to the laboratory as soon as possible. Participants were reimbursed for the cost of postage.Eight months into data collection, the desired sample size had not been achieved, and SAS introduced a reward scheme for their Reps whereby they were rewarded with merchandise from Finisterre for recruiting people to the study. Reps were reminded to follow previous guidelines for recruitment, which instructed that people had to be volunteers, and that they were allowed to leave the study at any time. Further recruitment efforts were made at the Eden Project (October 2015), as well as at the Newquay Marine Group (November 2015), and Plymouth Marine Laboratory (November 2015). The questionnaire and materials for participantsThe short anonymous questionnaire collected some demographic information (sex, age, ethnic group, in which part of the UK they lived, a measure of socioeconomic status), recent exposure to the sea, surfer risk behaviors (for example, how much time they usually spend in water, whether they surf in water that they know is affected by pollution), and information on various risk factors (such as consumption of meat and contact with animals), which are thought to be associated with gut colonization by antibiotic resistant bacteria. Laboratory work (see section 2.3.2)Questionnaires were marked with a unique identifying number, which was transcribed onto the accompanying Fecal Transwab Tube. The questionnaire was kept separate from the laboratory work after this so that the investigator was blinded to the exposure status of the individual who had submitted the swab. EnrichmentThe main outcome of interest was the presence or absence of blaCTX-M-bearing E. coli in participants’ fecal samples to estimate the proportion of surfers colonized by resistant bacteria compared to non-surfers. Therefore, bacteria in the fecal samples were enriched using ampicillin to increase the ability of the subsequent methods to detect resistant bacteria. Each Fecal Transwab tube was vortexed to suspend any fecal material in the liquid Cary Blair medium. A sample (1 mL) of this medium was enriched in LB broth (Miller) containing 50 mg/L ampicillin and incubated overnight (18 - 20 hr) at 37oC, shaking at 160 rpm. To ensure that the bacteria present on the swab were still culturable, a sample (100 µL) of the pre-enriched liquid Cary Blair medium were plated onto LB agar containing no antibiotics. Plates were incubated at 37oC and inspected the next day for bacterial grow. Selective cultureThe enrichments were then plated out onto Coliform Chromocult Enhanced Selectivity agar (Merck) of three different types: 1) agar amended with cefotaxime (2 mg/L), to isolate blaCTX-M -bearing colonies;2) agar amended with meropenem (8 mg/L), to isolate carbapenemase-

producing colonies;3) agar amended with no antibiotics.

7

The concentrations of antibiotics used were the minimum inhibitory concentrations reported by the European Committee on Antimicrobial Susceptibility Testing (13). Samples were recorded as being positive for enteric bacteria that were resistant to any of the antibiotics investigated if presumptive E. coli colonies (blue) or presumptive non-E. coli coliforms (NEC) colonies (pink) grew in the presence of these antibiotics Note that samples were also grown on non-selective media. This was to ensure that the bacteria on the swabs were still viable and that the absence of bacteria on selective media was due to the absence of resistant bacteria. Bacteria containing known resistance profiles from the Public health England Culture collection were plated out as well (as positive and negative controls) to ensure that the antibiotics used were still effective and at the correct concentration to discern between resistant and susceptible phenotypes. These were:Escherichia coli strain NCTC 10418 (susceptible to antibiotics), an E. coli harboring blaCTX-M (conferring resistance to cefotaxime), and Klebsiella pneumoniae strain NCTC 13443 (containing blaNDM-1 metallo-beta-lactamase conferring resistance to carbapenems). In contrast to the environmental monitoring phase (section 2.1), only cefotaxime was used to isolate blaCTX-M-bearing E. coli. Resistance to cefotaxime is indicated as the best indicator of CTX-M type enzymes (14), and used alone is sufficient for the isolation of colonies producing these enzymes. Detection and characterization of CTX-M genesA maximum of five presumptive E. coli and a maximum of five presumptive non-E. coli colonies resistant to cefotaxime per subject underwent PCR to identify those harboring blaCTX-M genes using methods described above. Meropenem resistant isolates were sent to the Public Health England Reference Laboratory for characterization of resistance mechanisms responsible for the observed phenotype.PCR for the entire blaCTX-M gene was performed on CTX-M-producing E. coli and non-E. coli colonies using the methods described above. PCR products were purified again and sent for bidirectional sequencing. Sequences obtained from colonies isolated from individuals were trimmed in order to remove low-quality reads. These were then aligned using ClustalW in MEGA7 software as before. These sequences were used, along with published sequences of known blaCTX-M genes, to identify to which CTX-M genotype each belonged. Bacterial species identification of resistant coloniesThe identities of CTX-M-producing colonies, as well as colonies resistant to meropenem, were investigated:Investigating the identities of resistant non-E. coli coliforms

PCR for the dnaJ gene was performed as described above on CTX-M-producing non-E. coli coliforms and meropenem-resistant non-E. coli coliforms. PCR products were processed and analyzed as before. Since a number of CTX-M-producing presumptive non-E. coli coliforms were revealed through sequence analysis to be E. coli, cefotaxime resistant non-E. coli coliforms that did not harbor the blaCTX-M gene were further characterized. This was done by performing qPCR amplification of the E. coli-specific gene uidA (Table S1). E. coli phylogroup typing

8

Quadruplex PCR was used as described as above to type the phylogroups of blaCTX-M-bearing E.coli. Furthermore, E. coli O25b-ST131 clones were detected by PCR (Table S1).Identification of meropenem-resistance genesPublic Health England performed real-time PCR on the meropenem-resistant isolates for the following carbapenemase-producing Enterobacteriaceae genes: New Delhi metallo-beta-lactamase (blaNDM), Klebsiella pneumoniae carbapenemase (blaKPC), Verona integron-encoded metallo-beta-lactamase (blaVIM), and oxacillin-hydrolyzing genes (blaOXA-48). Sequences of primers and probes are listed in Table S2.

9

Table S2. Sequences of primers and probes used for CPE RT-PCR (provided by Houdini Wu and Li Xu at Public Health England)Name 5’

label

Sequence 3’ label

NDM_fwd_new   CCAGCAAATGGAAACTGGCGAC  NDM_R   ATCCAGTTGAGGATCTGGGCG  NDM_probe TAM ACCGAATGTCTGGCAGCACACTTC BHQ-

2KPC-Fwd   GCAGCGGCAGCAGTTTGTTGATT  KPC-Rev   GTAGACGGCCAACACAATAGGTGC  KPC-probe ROX CAGTCGGAGACAAAACCGGAACCTGC BHQ-

2VIM_fwd_new   TTGCTTTTGATTGATACAGCGTGGGG  VIM_rev_new   GTACGTTGCCACCCCAGCC  VIM_II_probe CY5 TCTCGCGGAGATTGAAAAGCAAATTGGA

CTTCCBHQ-3

OXA-48_like_new_fwd   GATTATGGTAATGAGGACATTTCGGGC  OXA-48_like_new_rev   CATATCCATATTCATCGCAAAAAACCACA

C 

OXA-48_like_new_probe JOE CCATTGGCTTCGGTCAGCATGGCTTGTTT BHQ-1

Data analysisInformation from returned questionnaires was transcribed into a spreadsheet. Where respondents had not answered a question, or had marked more than one of the response options for a question, these were coded as missing data. Laboratory results from each swab were transcribed into this spreadsheet. Individual samples were marked as positive or negative for the presence of bacteria that were resistant to the antibiotics tested. The data were entered into STATA v13. (STATACorp, 2013) for analysis, and people who did not meet the study’s eligibility criteria (see Participant recruitment) were excluded from the main analysis.The exposure of interest was a dichotomous variable: recreational exposure to coastal waters or not. This was determined by whether or not the respondents self-identified as a regular surfer, or as a control subject. The risk ratio and test-based 95% confidence interval were estimated for the presence of ARB, along with the risk difference and accompanying 95% confidence intervals. Adjusting for confounding was not suitable since the number of people with the outcome of interest was too small. However, other potential risk factors for gut colonization by antibiotic resistant bacteria (e.g. diet, overseas travel, occupation, etc.) were assessed for their association with both the exposure variable and outcome variable. None were revealed to be associated with both. This study was approved by the University of Exeter Medical School Research Ethics committee (reference number 15/02/067).

10

11

Table S3. Survey given to Beach Bum Survey Participants

The Beach Bum Survey 7. QUESTIONNAIRE

This questionnaire has 6 sections (A-F) which will collect some personal information as well as information on aspects of your life that might influence whether antibiotic resistant bacteria are in your gut.Please complete the questionnaire and return it with your swab and signed consent form.

Section A: About you

1. Sex (Please choose one)☐ Male ☐ Female

2. Age (Please choose one) ☐ 18-24 ☐ 25-34 ☐ 35-44 ☐ 45-54 ☐ 55-64 ☐ 65+

3. What is your ethnic group? (Please choose one option that best describes your ethnic group or background)

White☐ English/ Welsh/ Scottish/ Northern Irish/ British☐ Irish☐ Gypsy or Irish Traveller☐ Any other White background

Asian/ Asian British☐ Indian☐ Pakistani☐ Bangladeshi☐ Chinese☐ Any other Asian background

Mixed/ Multiple ethnic groups☐ White and Black Caribbean☐ White and Black African☐ White and Asian☐ Any other Mixed/ Multiple ethnic background

Black/ African/ Caribbean/ Black British☐ African☐ Caribbean☐ Any other Black/ African/ Caribbean background

Other ethnic group☐ Arab☐ Any other ethnic group

12

4. Please tell us in which UK County you live ________________________________________5. What is the highest level of qualification you have completed?

(Please choose one) ☐ No formal qualifications☐ Level 1: 1-4 GCSEs or equivalent qualifications☐ Level 2: 5 or more GCSEs or equivalent qualifications☐ Apprenticeship☐ Level 3: 2 or more A-levels or equivalent qualifications☐ Level 4: Bachelor’s degree or equivalent, higher qualifications☐ Other qualification

Full list of qualifications in each levelNo Qualifications: No academic or professional qualificationsLevel 1 qualifications: 1-4 O Levels/CSE/GCSEs (any grades), Entry Level, Foundation Diploma, NVQ level 1, Foundation GNVQ, Basic/Essential SkillsLevel 2 qualifications: 5+ O Level (Passes)/CSEs (Grade 1)/GCSEs (Grades A*-C), School Certificate, 1 A Level/ 2-3 AS Levels/VCEs, Intermediate/Higher Diploma, Welsh Baccalaureate Intermediate Diploma, NVQ level 2, Intermediate GNVQ, City and Guilds Craft, BTEC First/General Diploma, RSA DiplomaApprenticeshipLevel 3 qualifications: 2+ A Levels/VCEs, 4+ AS Levels, Higher School Certificate, Progression/Advanced Diploma, Welsh Baccalaureate Advanced Diploma, NVQ Level 3; Advanced GNVQ, City and Guilds Advanced Craft, ONC, OND, BTEC National, RSA Advanced DiplomaLevel 4+ qualifications: Degree (for example BA, BSc), Higher Degree (for example MA, PhD, PGCE), NVQ Level 4-5, HNC, HND, RSA Higher Diploma, BTEC Higher level, Foundation degree (NI), Professional qualifications (for example teaching, nursing, accountancy)Other qualifications: Vocational/Work-related Qualifications, Foreign Qualifications (Not stated/ level unknown).

13

Section B: Watersports

6. Are you taking part in this study as a surfer/body boarder or as someone who has little contact with seawater? (Please choose one)☐ As a surfer/body boarder☐ As someone who has little contact with seawater

7. Do you participate in any of the following watersports in water bodies that are not the sea (i.e. swimming pools, rivers) on a regular basis? (Please choose one for each activity)

Swimming Diving Rowing/boating

Canoeing/kayaking Other

☐ Yes ☐ No

☐ Yes ☐ No

☐ Yes ☐ No

☐ Yes ☐ No

☐ Yes ☐ No

8. When was the last time you went in the sea in the UK? (Please

choose one)☐ Less than 7 days ago☐ In the past month☐ More than a month ago ☐ More than a year ago

9. How many times in the past 6 months have you been in the sea? (Please choose one)☐ Never ☐ Between 1 – 5 times☐ Between 6 – 10 times ☐ Between 11 – 15 times☐ Between 16 – 20 times☐ Between 21 – 25 times☐ More than 25 times

10. In the past month, have you done any of the following activities at the beach in the UK? (Please choose one for each activity)

Walking/running

Rock pooling Fishing

Sun bathing/ sitting on the

beachPlaying in the sand

☐ Yes ☐ No

☐ Yes ☐ No

☐ Yes☐ No

☐ Yes ☐ No

☐ Yes ☐ No

11. The remaining questions in this section are for surfers and

14

body boarders only. If you are responding to this questionnaire as someone who has little contact with seawater, please continue to Question 12 in Section C (on the next page).

a) In which UK County do you usually go surfing/body boarding? __________________________________

b) How much time do you spend in the water (on average) each time you go surfing/body boarding? (Please choose one)

☐ Less than 1 hour ☐ Between 1 and 3 hours☐ More than 3 hours

c) How many times have you been surfing/body boarding in the past month? (Please choose one)

☐ Less than 3 times ☐ 3 – 7 times☐ More than 7 times

d) How often do you look for information* on the water quality at beaches before you go surfing/body boarding? (Please choose one)

☐ Always☐ Often

☐ Rarely☐ Never

*Information on the water quality at beaches can be found on water quality apps, beach signs, news, social media, online, word of mouth, etc.

e) Do you avoid surfing/body boarding at beaches if you know warnings are in place that the water is polluted? (Please choose one)

☐ Always☐ Often☐ Rarely

☐ Never☐ Not applicable

15

Section C: Travel12. Have you travelled within Europe in the past 6 months? (Do

not include travel within the UK)☐ Yes ☐ No

Section D: Diet13. Do you eat the following foods on a regular basis (i.e. do

you eat them at least once a month)? Beef Pork Lamb Chicken Seafood Salad

☐ Yes☐ No

☐ Yes☐ No

☐ Yes☐ No

☐ Yes☐ No

☐ Yes☐ No

☐ Yes☐ No

14. Is your tap water at home from a private source? (i.e. not supplied by mains)

☐ Yes ☐ No

Section E: Your household

15. Do you, or anyone you live with, own a pet or domestic animal?

☐ Yes ☐ No16. To your knowledge, is there anyone in your household who

works in a healthcare setting?☐ Yes ☐ No17. To your knowledge, is there anyone in your household who

works with animals (e.g. farmer, butcher)? ☐ Yes ☐ No18. To your knowledge, is there anyone in your household who

has been hospitalised (spent 24 hours or more in hospital) in the past 6 months?

☐ Yes ☐ No19. To your knowledge, is there anyone in your household who

has taken antibiotics in the past 6 months?☐ Yes ☐ No20. Is there anyone in your household who has spent time

abroad in the past 6 months?

16

☐ Yes ☐ No

Section F: Your occupation or voluntary work

21. Do you work in a healthcare setting (e.g. hospital, nursing home)?

☐ Yes ☐ No22. Does your work involve contact with animals? ☐ Yes ☐ No

Please tell us the date and time that you collected your rectal swab:Date (dd/mm/yy): ____/____/____Time: ____:_____ am / pm (please delete as appropriate)

End of survey

Please put your completed survey in the large grip seal bag provided along with your signed consent form, and place in the

addressed envelope.

17

Additional resultsEnvironmental monitoring (see section 3.1)Figure S1 The mean percent of E. coli that are resistant to third-generation cephalosporins (3GCs) for each month that bathing water samples were received

18

Table S4. Prevalence of blaCTX-M positive isolates among 3GC resistant coliform bacteria isolated from bathing water-associated samples, and two reference wastewater samples. *A number of isolates were either lost during sub-culturing/storage, or it was not possible to amplify the entire blaCTX-M gene for genotype identification

19

20

Characteristic Coastal bathing water

Wastewater

3GC-resistant coliforms 458 1543GC-resistant E. coli 140 783GC-resistant Non-E.coli 318 76

CTX-M-producing coliforms 110 86 Diversity of blaCTX-M genes carried by E. coliCTX-M-1 4 11CTX-M-3A 0 3CTX-M-15 50 20CTX-M-17 0 1CTX-M-27 4 1Isolates not analyzed * 25 1Total 83 37Phylogenetic groups of E. coli producing CTX-M

A 12 10B1 1 3B2 17 (11 E. coli ST131) 2 (1 E. coli

ST131)C 4 4D 5 1E 0 0F 13 6Unknown 1 1Isolates not analyzed* 5 10Total 58 37

Diversity of blaCTX-M genes carried by non-E. coli coliforms and host diversity

Coastal bathing water

Wastewater

Citrobacter braakii CTX-M-15 (2)Citrobacter freundii CTX-M-1 (9) CTX-M-1 (1)Enterobacter kobei CTX-M-9 (1)Klebsiella pneumonium CTX-M-15 (1)Shigella flexneri CTX-M-15 (1)Total 12 3Isolates not analyzed* 52 49 (86-37)

Estimating the risk of exposure to blaCTX-M -bearing E. coli among coastal water users (see section 3.2)Table S5. Population-level estimate of water user exposure to CTX-M-producing E. coli in coastal waters of England and Wales in 2015. Activity Averag

e number of sessions per person per year (EFTEC 2002)

Population in 2015 (Office for National Statistics)

Total number of water sports sessions

Number of sessions occurring in each water quality category

Number of sessions involving ingestion of blaCTX-M bearing E. coli

Total number of sessions in which blaCTX-M bearing E. coli were ingested

Guideline (95.2%)

Mandatory (2.43%)

Fail (2.36%)

Guideline

Mandatory

Fail

High-contact water sportsSwimming (adults)

1.2 44,879,840 53,855,808

51,270,729

1,308,696 1,270,997 151,664 52,037 330,038

533,739

Swimming (non-adults)

1.2 13,005,573 15,606,688

14,857,567

379,243 368,318 101,635 34,872 221,169

357,675

Surfing/water-skiing/windsurfing

0.4 57,885,413 23,154,165

562,646 562,646 546,438 695,247 238,543 546,438

1,480,228

Diving 0.2 57,885,413 11,577,083

281,323 273,219 22,792 20,172 6,921 43,898 70,992

Low-contact water sportsBoating 0.5 57,885,413 28,942,70

7703,308 683,048 21,296 18,849 6,467 41,016 66,331

Canoeing/jet skiing

0.2 57,885,413 11,577,083

281,323 273,219 8,979 7,947 2,727 17,293 27,967

Fishing No data

57,885,413 - - - - - - - -

Kayaking No data

57,885,413 - - - - - - - -

Rowing No 57,885,413 - - - - - - - -

21

dataWading/splashing

No data

57,885,413

2,536,932

22

Results of the epidemiological survey (see section 3.3)Table S6. The number (%) of surfers and controls colonized by antibiotic resistant non-E. coli coliforms

Surfers (N=143)

Controls (N=130)

Risk ratio (95% CI) P value

Non-E. coli coliforms resistant to cefotaxime

12 (8.4%)

18 (13.8%)

0.61 (0.31 to 1.20)

0.15

Non-E. coli coliforms harboring blaCTX-M

0 0 - -

Non-E. coli coliforms resistant to meropenem

1 (0.7%)

1 (0.8%)

0.91 (0.06 to 14.4)

0.95

23

Table S7. Demographic characteristics of participantsDemographic variable Surfers

N=143 Controls N=130

SexMaleFemaleMissing

98 (68.5%)43 (30.1%)2 (1.4%)

50 (38.5%)79 (60.8%)1 (0.8%)

Age18-2425-3435-4445-5455-64≥65Missing

39 (27.3%)38 (26.6%)50 (35.0%)6 (4.2%)7 (4.9%)3 (2.1%)0 (0%)

33 (25.4%)30 (23.1%)20 (15.4%)23 (17.7%)14 (10.8%)10 (7.7%)0 (0 %)

Ethnic groupEnglish/Welsh/Scottish/Northern Irish/BritishIrishAny other White backgroundWhite and AsianAny other Mixed/ Multiple ethnic backgroundAny other Asian backgroundMissing

133 (93.0%)2 (1.4%)6 (4.2%)0 (0%)1 (0.7%)0 (0%)1 (0.7%)

120 (92.3%)0 (0%)7 (5.4%)1 (0.8%)1 (0.8%)1 (0.8%)0 (0%)

EducationLevel 1: 1-4 GCSEs or equivalent qualifications Level 2: 5 or more GCSEs or equivalent Apprenticeship Level 3: 2 or more A-levels or equivalent Level 4: Bachelor’s degree or equivalent, higher Other qualificationMissing

6 (4.2%)5 (3.5%)3 (2.1%)31 (21.7%)84 (58.7%)3 (2.1%)11 (7.7%)

2 (1.5%)6 (4.6%)1 (0.8%)35 (26.9%)73 (56.2%)4 (3.1%)9 (6.9%)

Region of residenceEngland

Southwest EnglandSoutheast EnglandNorthwest EnglandEast of England West MidlandsEast MidlandsYorkshire and HumberNortheast England

WalesNorthern IrelandMissing

92 (39.1%)74 (31.5%)9 (3.8%)3 (1.3%)2 (0.9%)0 (0%)0 (0%)3 (1.3%)1 (0.4%)14 (9.8%) 17 (14.0%)20 (14.0%)

90 (40.9%)60 (27.3%)11 (5.0%)5 (2.3%)3 (1.4%)1 (0.5%)6 (2.7%)4 (1.8%)0 (0%)8 (6.2%)4 (3.1%)28 (21.5%)

24

References for supplementary materials

1. Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P. Molecular characterization and epidemiology of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrobial agents and chemotherapy. 2008;52(8):2818-24.2. Liu JH, Wei SY, Ma JY, Zeng ZL, Lu DH, Yang GX, et al. Detection and characterisation of CTX-M and CMY-2 beta-lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China. Int J Antimicrob Agents. 2007;29(5):576-81.3. Woodford N, Fagan EJ, Ellington MJ. Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum (beta)-lactamases. The Journal of antimicrobial chemotherapy. 2006;57(1):154-5.4. Poirel L, Gniadkowski M, Nordmann P. Biochemical analysis of the ceftazidime-hydrolysing extended-spectrum beta-lactamase CTX-M-15 and of its structurally related beta-lactamase CTX-M-3. The Journal of antimicrobial chemotherapy. 2002;50(6):1031-4.5. Geser N, Stephan R, Korczak BM, Beutin L, Hachler H. Molecular identification of extended-spectrum-beta-lactamase genes from Enterobacteriaceae isolated from healthy human carriers in Switzerland. Antimicrobial agents and chemotherapy. 2012;56(3):1609-12.6. Clermont O, Christenson JK, Denamur E, Gordon DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environmental Microbiology Reports. 2013;5(1):58-65.7. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M. Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States. Clinical Infectious Diseases. 2010;51(3):286-94.8. Pham HN, Ohkusu K, Mishima N, Noda M, Monir Shah M, Sun X, et al. Phylogeny and species identification of the family Enterobacteriaceae based on dnaJ sequences. Diagnostic microbiology and infectious disease. 2007;58(2):153-61.9. Dhanji H, Murphy NM, Akhigbe C, Doumith M, Hope R, Livermore DM, et al. Isolation of fluoroquinolone-resistant O25b:H4-ST131 Escherichia coli with CTX-M-14 extended-spectrum beta-lactamase from UK river water. The Journal of antimicrobial chemotherapy. 2011;66(3):512-6.10. Srinivasan S, Aslan A, Xagoraraki I, Alocilja E, Rose JB. Escherichia coli, enterococci, and Bacteroides thetaiotaomicron qPCR signals through wastewater and septage treatment. Water Res. 2011;45(8):2561-72.11. Leonard A, Zhang L, Balfour A, Garside R, Gaze W. Human recreational exposure to antibiotic resistant bacteria in coastal bathing waters. Environment International. 2015;82:92-100.12. Wickramasinghe NH, Xu L, Eustace A, Shabir S, Saluja T, Hawkey PM. High community faecal carriage rates of CTX-M ESBL-producing Escherichia coli in a specific population group in Birmingham, UK. The Journal of antimicrobial chemotherapy. 2012;67(5):1108-13.13. Breakpoint tables for interpretation of MICs and zone diameters. Version 4.0 [Internet]. The European Committee on Antimicrobial Susceptibility Testing. 2014 [cited 27/4/2014]. Available from: http://www.eucast.org.

25

14. Livermore DM, Brown DF. Detection of beta-lactamase-mediated resistance. The Journal of antimicrobial chemotherapy. 2001;48 Suppl 1:59-64.

26