Upload File

ade.az.gov ed07-0041- attachment 6.' supplemental fee schedule cost per hour for supplemental...

  • Home
  • Documents
  • ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
20

Upload: trinhque

Post on 24-Mar-2018

214 views

Category:

Documents


2 download

Report

TRANSCRIPT

Page 1: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 2: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 3: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 4: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 5: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 6: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 7: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 8: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 9: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 10: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 11: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 12: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 13: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 14: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 15: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 16: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 17: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 18: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 19: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …
Page 20: ade.az.gov ED07-0041- ATTACHMENT 6.' SUPPLEMENTAL FEE SCHEDULE Cost per hour for Supplemental Educational Services as per Scope of Work Section 1 …

Supplemental material Supplemental figures

166 Supplemental Tables August 2012 August/NIPA Tables...3 166 Supplemental Tables August 2012 7. Supplemental Tables Table 7.1. Selected Per Capita Product and Income Series in Current

s21.q4cdn.com · PRELIMINARY RESULTS * (In thousands, except per share amounts) - Unaudited GAAP TO NON.GAAP RECONCILIATION SUPPLEMENTAL FINANCIAL INFORMATION

Agenda Item D.4 Supplemental Attachment 4 June 2015 ... · Supplemental Attachment 4 (Electronic Only) June 2015. 2 ... fisheries) should not exceed more than 28 fish per year. A

Supplemental Material Supplemental Experimental Procedures

Considering Supplemental Instruction for Your Institution ... · Considering Supplemental Instruction for Your Institution ... 3-4 voluntary review sessions per week. ... Bus 230:

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

JOINT BIDS AND AWARDS COMMITTEE … Supplemental Bid Bulletin No. 3 is ... Per Supplemental Bid Bulletin No ... 12.1.a.viii Valid and current Philippine Contractors Accreditation Board

Supplemental Figures Supplemental Figure 1€¦ · Supplemental Figures . Supplemental Figure 1 . Supplemental Figure 1. AdipoChaser mouse models used for cold and thermoneutral exposures

At Command Set for SAGEM HiLo HiLoNC Modules - 5635.1 008 70248 ED07 24june09

Internal Medicine Supplemental Guide Draft Supplemental ... › ... › InternalMedicineSupplementalGuideDraf… · Internal Medicine Supplemental Guide Draft . 1 . Supplemental Guide:

Collected Supplemental Figures Marginsgenesdev.cshlp.org/content/suppl/2007/10/01/21.19.2448.DC1/... · Supplemental Figure 2 Supplemental Figure 4 Supplemental Figure 5 Supplemental

Supplemental Figure 1. (a) Illustration of climatic water ... · Supplemental Table 3. Mean of trees per hectare for FIA and VTM surveys for small (10.2 - 30.4 cm dbh), medium (30.5-60.9

Supplemental Beer Pairing Supplemental W ine Pairing 45.00 ... · Supplemental Beer Pairing 15.00/person Supplemental W ine Pairing 35.00/person Supplemental Full Beverage Pairing

Document S1. Supplemental Results, Supplemental Experimental

No-Clean Lead-Free Solder Paste Supplemental … Solder Paste Supplemental Data Package ... 2.2 Surface Insulation Resistance per Bellcore GR-78-CORE ... Bellcore …

Supplemental Data Supplemental Figures Legends …dm5migu4zj3pb.cloudfront.net/manuscripts/42000/42127/JCI42127sd.pdf · Supplemental Data Supplemental Figures Legends Suppl. Figure

Supplemental Specifications Table of Contents Park... · Supplemental Specifications -Table of Contents DIVISION 10 ... a. 70, National Electrical Code (NEC). ... c. Color: Per ANSI

Supplemental Feeding of White-Tailed Deertexnat.tamu.edu/files/...Supplemental-Feeding-of-White-Tailed-Deer.pdfhigher, hunter effort per deer was 6 percent less, and that deer-vehicle

2018 RESULTS PRESENTATION - Somero/media/Files/S/Somero-IR/reports-and... · dividend 13.2 50% Supplemental dividend 6.6 Excess net cash Supplemental dividend: $0.117 per share 3.1

Supplemental Table 1: References used for … · Web viewTitle Supplemental Table 1: References used for evidence criteria per patient Author Kelly Farwell Hagman Last modified by

SLM CORPORATION SUPPLEMENTAL FINANCIAL INFORMATION …€¦ · SECOND QUARTER 2006 (Dollars in millions, except per share amounts, unless otherwise stated) The following supplemental

Supplemental Information - Plant Cell · Supplemental Data. Elliott et al. (2014). Plant Cell 10.1105/tpc.114.123620 1 Supplemental Information Supplemental Figures Supplemental Fig

Choi et al. Supplemental Information SUPPLEMENTAL ...€¦ · Choi et al. Supplemental Information 1 SUPPLEMENTAL INFORMATION SUPPLEMENTAL METHODS Isolation of Mouse Embryonic Dermal

SUPPLEMENTAL DATA Supplemental figures · SUPPLEMENTAL DATA Supplemental figures Supplemental Figure 1. ... 28 Rhodanese/Cell cycle control phosphatase superfamily protein At2g40760

SUPPLEMENTAL AGENDA MATERIAL for Supplemental …

Supplemental Material, Quan et al. contains: Supplemental ... · Supplemental Material, Quan et al. contains: Supplemental Figures S1 to S7 Supplemental Document 1 and 2 Supplemental

1. Supplemental Figure 1 - International Journal of ... · Supplemental Figure 1 2. Supplemental Figure 2 3. Supplemental Figure 3 4. Supplemental Figure 4 5. Supplemental Figure

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B

Supplement Supplemental Figures and Supplemental Figure

CLINICA REVISTA - ED07 [16062016]

abc.ky.gov Ordinances/Hardin... · xtended hours supplemental license, per um aterer's license, per annum ottling house or bottling house storage icense, per annum rewer's license,

Supplemental Information Bigdeli Supplemental Information ...Supplemental Information Bigdeli 1 Supplemental Information Descriptions of Participating Replication Studies Generation

Supplemental Guide for Psychiatry Supplemental Guide

Supplemental Fig.1 SUPPLEMENTAL FIGURES