RESEARCH ARTICLE

Aestivation induces changes in transcription and translation ofcoagulation factor II and fibrinogen gamma chain in the liver of theAfrican lungfish Protopterus annectensKum C. Hiong1,*, Xiang R. Tan1,*, Mel V. Boo1, Wai P. Wong1, Shit F. Chew2 and Yuen K. Ip1,3,‡

ABSTRACTThis study aimed to sequence and characterize two pro-coagulantgenes, coagulation factor II ( f2) and fibrinogen gamma chain ( fgg),from the liver of the African lungfish Protopterus annectens, and todetermine their hepatic mRNA expression levels during three phasesof aestivation. The protein abundance of F2 and Fgg in the liver andplasmawas determined by immunoblotting. The results indicated thatF2 and Fgg of P. annectens were phylogenetically closer to those ofamphibians than those of teleosts. Three days of aestivation resultedin an up-regulation in the hepatic fgg mRNA expression level, while6 days of aestivation led to a significant increase (3-fold) in the proteinabundance of Fgg in the plasma. Hence, there could be an increasein the blood-clotting ability in P. annectens during the induction phaseof aestivation. By contrast, the blood-clotting ability in P. annectensmight be reduced in response to decreased blood flow and increasedpossibility of thrombosis during the maintenance phase ofaestivation, as 6 months of aestivation led to significant decreasesin mRNA expression levels of f2 and fgg in the liver. There could alsobe a decrease in the export of F2 and Fgg from the liver to the plasmaso as to avert thrombosis. Three to 6 days after arousal from 6 monthsof aestivation, the protein abundance of F2 and Fgg recoveredpartially in the plasma of P. annectens; a complete recovery of thetranscription and translation of f2/F2 in the liver might occur only afterrefeeding.

KEY WORDS: Blood circulation, Haemostasis, Prothrombin,Thrombin, Thrombosis, Fibrin

INTRODUCTIONLungfishes belong to an archaic group of freshwater fishes thatare categorized under class Osteichthyes, subclass Sarcopterygii(lobed-finned fishes), and possess primitive lungs for air breathing.They hold a very important evolutionary position in the tree-of-lifeas they share similarities with both fishes and amphibians, andare important species for studies on the fish–tetrapod transition.Many neontologists consider lungfishes as a sister group ofamphibians (Forey, 1986), but this view is opposed bypaleontologists (Marshall and Schultze, 1992), who usuallysupport a single origin of tetrapods, starting from the Rhipidistia,

which is an extinct group of lobe-finned bony fishes. In contrast,molecular phylogenetic studies favour the lungfishes as the closestliving relatives of tetrapods (Zardoya et al., 1998; Tohyama et al.,2000; Takezaki et al., 2004; Hallstrom and Janke, 2009; Amemiyaet al., 2013).

There are six species of extant lungfishes worldwide. Of these,four (Protopterus aethiopicus, Protopterus amphibius, Protopterusannectens and Protopterus dolloi) are found in Africa. Africanlungfishes are obligate air breathers, and can undergo aestivation insubterranean mud cocoons for as long as 4 years during drought(Smith, 1930; see Ip and Chew, 2010; Ballantyne and Frick, 2010,for reviews). Aestivation is a state of torpor often associated witharid conditions at high environmental temperature and without foodor water intake for an extended period. It is characterized mainly byphysical inactivity and low metabolic rate (Pinder et al., 1992;Hasiotis et al., 2007; Withers and Cooper, 2010). In nature,aestivation can occur inside a subterranean mud cocoon. In thelaboratory, African lungfishes can be induced to aestivate in dried-mucus cocoons in air (Chew et al., 2004; Ip et al., 2005; Loonget al., 2005, 2007, 2008a,b, 2012a,b). There are three phases ofaestivation: induction, maintenance and arousal. During theinduction phase, the aestivating fish detects environmental cues,turns them into internal signals, and makes the requiredbiochemical, physiological, structural and behavioural changes foraestivation. It hyperventilates and secretes plenty of mucus. Themucus will turn into a cocoon after 6–8 days. The fish enters into themaintenance phase of aestivation when it is encased in a dried-mucus cocoon, with a complete cessation of feeding and locomotoractivities. The aestivating lungfish must prevent cell death, preservebiological fuels and structures, and sustain a slow rate of wasteproduction during the maintenance phase of aestivation. Thelungfish can be aroused from aestivation with the addition ofwater. After struggling out of the cocoon, it swims sluggishly to thewater surface to gulp air. Upon arousal, it re-hydrates, excretes theaccumulated waste products and begins to feed after 7–10 days.

Distinctive changes in cardiorespiratory properties and bloodcirculation are hallmarks of the aestivation process, where thelungfish’s ventilation rate, heart rate and mean blood pressure arealtered rapidly. During the induction phase, the lungfishhyperventilates and the frequency of lung breaths increasesrapidly from ∼5 to ∼30 breaths per hour (Fishman et al., 1986).Within 1–2 months (the maintenance phase) of aestivation,hyperventilation gradually slows down until it reaches the originalfrequency of ventilation. Simultaneously, the heart rate alsodecreases from ∼25 to ∼10 beats min−1 (Delaney et al., 1974;Fishman et al., 1986, 1992). Following the decrease in heart rate, themean blood pressure in the systemic circulation declines from ∼30to ∼14 mmHg (Delaney et al., 1974; Fishman et al., 1986). Hence,there must be a decrease in blood flow in the vascular system of theReceived 15 May 2015; Accepted 17 September 2015

1Department of Biological Sciences, National University of Singapore, Kent Ridge,Singapore 117543, Republic of Singapore. 2Natural Sciences and ScienceEducation, National Institute of Education, Nanyang Technological University, 1Nanyang Walk, Singapore 637616, Republic of Singapore. 3The Tropical MarineScience Institute, National University of Singapore, Kent Ridge, Singapore 119227,Republic of Singapore.*These authors contributed equally to this work

‡Author for correspondence (dbsipyk@nus.edu.sg)

3717

© 2015. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

aestivating lungfish due to the reduction in cardiac output and theresultant drop in blood pressure. While blood is maintained in afluid state under physiological conditions, the haemostatic systemhas evolved to react rapidly to seal up injured blood vessels withblood clots (Colman, 2006). Specifically, thrombosis entails theformation of a blood clot (thrombus) in a blood vessel.Theoretically, decreased blood circulation would predispose theaestivating lungfish to intravascular thrombosis. However, it isapparent that thrombosis does not transpire during the maintenancephase of aestivation despite a decrease in blood flow; if it did, thelungfish would succumb during the aestivation process. Therefore,adaptive changes must occur in the haemostatic system of theaestivating lungfish to avoid thrombus formation. However, apartfrom haematological profiling studies (Johansen et al., 1976;Delaney et al., 1976; Ikechukwu and Obinnaya, 2010), there is adearth of information on the blood coagulation system of Africanlungfishes and its relationship to aestivation.The blood coagulation system in fishes is fundamentally similar to

that in mammals (Jagadeeswaran and Sheehan, 1999; Jagadeeswaranet al., 2000;Davidson et al., 2003a,b;Manseth et al., 2004). It involvesa cascade of reactions where the coagulation factors are zymogens ofserine proteases, and each factor sequentially activates the downstreamcoagulation factor by proteolytic cleavage (Furie and Furie, 1988).Eventually, the reactions converge onto a common pathway thattriggers the activation of thrombin to cleave fibrinogen (a blood-borneglycoprotein composed of three pairs of non-identical polypeptidechains) into fibrinmonomers, which are cross-linked to form a fibrousclot. The coagulation factor 2 ( f2) gene encodes prothrombin, whichis predominantly produced by the liver and circulated in thebloodstream. Prothrombin is essential for the formation of bloodclots (haemostasis). When an injury occurs whereby blood vessels aredamaged, prothrombin is converted to its active form, thrombin.Thrombin then converts fibrinogen into fibrin, the primary protein thatmakes up blood clots. The gamma component of fibrinogen isencoded by fibrinogen gamma chain ( fgg). Blood clots seal offdamaged blood vessels and prevent further blood loss after an injury.Using suppression subtractive hybridization, Loong et al.

(2012b) and Hiong et al. (2015) obtained partial sequences of f2and fgg from the liver of P. annectens, and reported possiblechanges in their hepatic mRNA expression during the three phasesof aestivation. Therefore, this study was undertaken to obtain thecomplete coding cDNA sequences of f2 and fgg from the liver ofP. annectens. It was hoped that the deduced F2 and Fgg amino acidsequences would shed light on the phylogenetic relationshipbetween P. annectens and other animals. Furthermore, effortswere made to determine by quantitative real-time PCR (qPCR) themRNA expression of f2 and fgg in the liver of P. annectens kept infreshwater (control) or undergoing the induction phase, themaintenance phase or the arousal phase of aestivation. Based onthe deduced F2 and Fgg amino acid sequence, custom-made anti-F2and anti-Fgg antibodies were developed for determination of theirprotein abundance in the liver and plasma through western blotting.The hypothesis tested was that aestivation would induce changes inmRNA and/or protein expression levels of f2/F2 and fgg/Fgg in theliver during the three phases of aestivation. Specifically, there couldbe increases in the transcription and translation of f2/F2 and fgg/Fggin the liver during the induction phase of aestivation, so as toenhance the blood-clotting capacity in preparation for possiblephysical injuries acquired as the lungfish struggles to get back towater or during burrowing activity. However, during themaintenance phase of aestivation, there could be a decrease in theexpression levels of f2/F2 and fgg/Fgg in the liver, and decreases in

the protein abundance of F2 and Fgg in the plasma in order to avertthrombosis when confronted with decreased blood flow. During thearousal phase of aestivation, the expression of f2/F2 and fgg/Fgg inthe liver would probably recover, at least partially, back to thecontrol levels.

Note on abbreviationsAs the standard abbreviations of genes/proteins of fishes (http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg) are differentfrom those of frogs and human/non-human primates (http://www.genenames.org), two different types of abbreviations were adoptedin this report. In particular, fish gene symbols are italicized, all inlowercase, and fish protein designations are the same as the genesymbol, but non-italicized with the first letter in uppercase.

MATERIALS AND METHODSAnimalsProtopterus annectens (Owen 1839) (80–120 g body mass) were importedfrom Central Africa through a local fish farm in Singapore. They weremaintained in plastic aquaria filled with dechlorinated water, which waschanged daily. No attempt was made to separate the sexes. Fish were fedfrozen fish meat and acclimated to laboratory conditions for at least 2 weeksbefore experiments. This study was performed in accordance with theapproved protocol IACUC 035/09 granted by the Institutional Animal Careand Use Committee of the National University of Singapore.

Experimental conditions and collection of samplesProtopterus annectens kept in freshwater served as controls. Control fish(N=5) were killed with an overdose of neutralized 0.05% MS222 for tissuesampling after food was withheld for 96 h. Blood was collected throughcaudal puncture into heparinized capillary tubes, then centrifuged at 4000 gat 4°C for 10 min to obtain the plasma, which was stored at −80°C untilanalysis. The liver was quickly excised, freeze-clamped with aluminiumtongs pre-cooled in liquid nitrogen and kept at −80°C. A group of fish(N=35) was induced to aestivate individually at 27–29°C and 85–90%humidity in plastic tanks (L×W×H, 29×19×17.5 cm) containing 15 mldechlorinated tapwater (made 0.3‰ with seawater) initially, following theprocedure of Chew et al. (2004). It took approximately 6–8 days for the fishto be encased in a brown dried-mucus cocoon. In order to maintain a highhumidity (>90%) within the tank, 1–2 ml of water was sprayed onto the sideof the tank daily, and the tank was partially covered with a moist towel. Fivefish were killed with a strong blow to the head for tissue sampling on day 3(N=5) and another five on day 6 (N=5), which covered the induction phaseof aestivation. After 12 days, five fish were killed for tissue sampling, whichrepresents the early maintenance phase of aestivation (N=5). For theprolonged maintenance phase, five fish were killed after 6 months ofaestivation (N=5). The remaining 15 fish, which had already aestivated for6 months, were aroused from aestivation (the arousal phase) by the additionof 200 ml of water to the tank followed by appropriate levels of mechanicalstimulation and breakage of the cocoon. Within a few minutes, the fishswam sluggishly in the water. Another 800 ml of water was then added tocover the fish. One, 3 or 6 days after arousal, fish (N=5 each) were killedwith an overdose of neutralized 0.05% MS222 for tissue sampling.Collected samples were kept at −80°C until analysis.

Total RNA extractionTotal RNA from liver samples was extracted using Tri Reagent™ (Sigma-Aldrich Co., St Louis, MO, USA), and purified using the RNeasy PlusMini Kit (Qiagen GmbH, Hilden, Germany). RNA was quantifiedspectrophotometrically using a Hellma traycell (Hellma GmbH & Co.KG, Müllheim, Germany), and its quality was checked electrophoretically.

Rapid amplification of cDNA ends (RACE) cDNA synthesisTotal RNA (1 μg) isolated from the liver of P. annectens was reversetranscribed into 5′-RACE-Ready cDNA and 3′-RACE-Ready cDNA usinga SMARTer™ RACE cDNA Amplification kit (Clontech Laboratories,

3718

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

Mountain View, CA, USA). Based on the partial fragments of f2 and fggobtained from suppression subtractive hybridization PCR by Loong et al.(2012b), specific 5′ and 3′ RACE primers were designed to obtain thecomplete sequences of f2 and fgg (Table 1) through RACE-PCR using theAdvantage® 2 PCR kit (Clontech Laboratories). RACE-PCR cyclingconditions were 30 cycles of 94°C for 30 s, 65°C for 30 s and 72°C for4 min. RACE-PCR products were separated using gel electrophoresis,purified and sequenced. Multiple sequencing was performed in bothdirections to obtain the full-length cDNA. Sequence assembly and analysiswere performed using Bioedit v7.1.3 (Hall, 1999). The cDNA codingsequences of f2 and fgg from P. annectens have been deposited in GenBankwith accession number KJ689301 and KJ689302, respectively.

Deduced amino acid sequences and phylogenetic analysisThe predicted F2 and Fgg amino acid sequences were obtained from the f2and fgg nucleotide sequences using the ExPASy Proteomic server (http://web.expasy.org/translate/). The amino acid sequences were aligned andcompared with selected amino acid sequences from various animal speciesusing BioEdit.

The phylogenetic relationships among F2 and Fgg of P. annectens andthose of other animal species were analysed using the neighbour-joiningmethod (NEIGHBOUR) in the PHYLIP phylogeny package (version 3.67)(Felsentein, 1989), with the inclusion of 100 bootstraps. The respectivephylogenetic trees were generated with CONSENSE using 50% majorityrule, and plotted with the program TREEVIEW. Bootstrap values wereindicated at the nodes of the tree branches. The accession numbers ofselected F2 amino acid sequences (from GenBank) used in the analysisare as follows: Homo sapiens F2, AAL77436.1; Mus musculus F2,AAH13662.1; Rattus norvegicus F2, NP_075213.2; Xenopus (Silurana)tropicalis F2, NP_001015797.1; Xenopus laevis F2, NP_001085292.1;Oncorhynchus mykiss F2, CAD59688.1; Takifugu rubripes F2,AAO33373.1; Danio rerio F2, AAH55596.1; and Eptatretus stoutii F2(as the outgroup), AAA21620.2. The accession numbers of selected FGG/Fgg amino acid sequences (from GenBank) used in the analysis are asfollows: H. sapiens FGG, AAB59531.1;M. musculus FGG, NP_598623.1;R. norvegicus FGG, AAH78893.1; X. laevis FGG, NP_001080639.1;Callorhinchus milii Fgg, AFM90043.1; Plecoglossus altivelis Fgg,CBX31965.1; D. rerio Fgg, NP_998219.1; Hypophthalmichthys molitrixFgg, ADF97606.1; and Culex quinquefasciatus Fgg (as the outgroup),EDS27702.1.

qPCRRNA (4 μg) from the liver samples was reverse transcribed using randomhexamer primers with RevertAid™ first-strand cDNA synthesis kit(Fermentas International Inc.). qPCR was performed in triplicate using aStepOnePlus™ Real-Time PCR System (Applied Biosystems). The qPCRreactions contained 5 µl of KAPA SYBR® FAST Master Mix (2×) ABIPrism® (Kapa Biosystems, Woburn, MA, USA), 0.3 µmol l−1 each offorward and reverse gene-specific qPCR primers (Table 1) and 2 µl ofcDNA (equivalent to 1 ng of RNA) or 2 µl of standard in a total volume of10 µl. Cycling conditions comprised 1 cycle of 95°C for 20 s followed by 40cycles of 95°C for 3 s and 60°C for 30 s. Data (threshold cycle asCT values)were collected at each elongation step. Melt curve analysis was performedby increasing the temperature from 60°C to 95°C in 0.3°C increments to

confirm the presence of only a single product. The PCR products wereseparated on a 2% agarose gel to verify the presence of a single band.

The method of absolute quantification with reference to a standard curvefor each gene was adopted in this study, as it was essential to compare themRNA expression levels of f2 and fgg in the liver of P. annectens. Whilerelative quantitation methods produce fold-change data, they do notfacilitate the comparison of gene expression levels. Furthermore, relativequantification requires the incorporation of a reference gene, the expressionof which is unaffected by the experimental conditions, but we haddifficulties in identifying such a gene as substantial transcriptional changesoccur in the liver of P. annectens during the three phases of aestivation. Inorder to determine the absolute quantity of f2 and fgg transcripts in a qPCRreaction, efforts were made to produce a pure amplicon (standard) of adefined region of f2 or fgg cDNA from the liver of P. annectens according tothe PCR method of Gerwick et al. (2007). PCR was performed with thegene-specific qPCR primers for f2 or fgg with cDNA as a template in a finalvolume of 25 μl. The cycling conditions comprised an initial denaturation of95°C for 3 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s and72°C for 30 s and one extension cycle of 72°C for 10 min. The PCR productwas separated on a 2% agarose gel, excised and purified using a QIAquickgel extraction kit (Qiagen GmbH). The f2 and fgg fragments in the purifiedproduct were cloned into pGEM®-T Easy vector (Promega Corporation,Madison, WI, USA). The presence of the insert in the recombinant cloneswas confirmed by sequencing, and the cloned circular plasmid wasquantified using a spectrophotometer. The standard cDNA (template) wasserially diluted (from 106 to 102 specific copies/2 µl). A standard curve wasobtained from plotting threshold cycle (CT) on the y-axis and the natural logof concentration (copies μl−1) on the x-axis. The CT, slope, PCRamplification efficiency, y-intercept and correlation coefficient (r2) werecalculated using the default setting of StepOne™ Software v2.1 (AppliedBiosystems). Diluted standards were stored at −20°C. The PCR efficiencyfor f2 and fgg was 100% and 95.4%, respectively. The quantity of transcriptin an unknown sample was determined from the linear regression linederived from the standard curve and expressed as copies of transcripts per ngcDNA.

SDS-PAGE electrophoresis and western blottingA commercial firm (GenScript, Piscataway, NJ, USA) was engaged toraise a rabbit polyclonal antibody against amino acids 296–309(TDGAEETDIGGRTS) of the translated amino acid sequence of F2and a rabbit polyclonal antibody against amino acids 376–389(GRYSAQDAGPDGFD) of the translated amino acid sequence of Fggfrom the liver of P. annectens. Immunoreactive bands of F2 and Fgg werevisualized at the expected molecular mass of 69.3 and 50.5 kDa,respectively.

Western blotting was performed on samples obtained from the controlfish and fish that had undergone 6 days, 12 days or 6 months of aestivation,or 3 or 6 days after arousal from 6 months of aestivation. Liver and plasmasamples were homogenized three times in five volumes (w/v) of ice-coldbuffer containing 50 mmol l−1 Tris HCl, (pH 7.4), 1 mmol l−1 EDTA,150 mmol l−1 NaCl, 1 mmol l−1 NaF, 1 mmol l−1 Na3VO4, 1% NP-40,1 mmol l−1 PMSF and 1× HALT™ protease inhibitor cocktail (ThermoFisher Scientific Inc.) at 24,000 rpm for 20 s each with 10 s intervals usingthe Polytron PT 1300D homogenizer (Kinematica AG, Lucerne,

Table 1. Primers used for RACE-PCR and quantitative real-time PCRon coagulation factor II (f2) and fibrinogen gammachain (fgg) from the liver ofProtopterus annectens

Gene Accession no. Purpose Primer sequence (5′ to 3′)

f2 KJ689301 5′ RACE-PCR CACAGTAATGCAGGTTGCAGTAGTCG3′ RACE-PCR CGACTACTGCAACCTGCATTACTGTGqPCR Forward (GATATTGCACTCCTGCACC)

Reverse (ACATCCTGGTCTACAATGGG)fgg KJ689302 5′ RACE-PCR CTTCCCGCGTTGAAATGATCCTCTC

3′ RACE-PCR GAGAGGATCATTTCAACGCGGGAAGqPCR Forward (GCAATGGATGGACAGTTCTC)

Reverse (TACACCGGACCAGTCTTTC)

3719

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

Switzerland). The homogenate was centrifuged at 10,000 g for 20 min at4°C. The protein concentration in the supernatant obtained was determined(Bradford, 1976) and adjusted to 5 µg µl−1 with Laemmli buffer (Laemmli,1970). Samples were heated at 70°C for 15 min, and then kept at −80°Cuntil analysis.

Preliminary experiments showed that the protein abundance of F2 andFgg in the plasma differed from that in the liver. Therefore, 50 µg of liverprotein was loaded for gel separation of F2 and Fgg, but the plasma proteinload for F2 and Fgg was 100 and 20 µg, respectively. Proteins wereseparated by SDS-PAGE (10% acrylamide resolving gel, 4% acrylamidestacking gel) according to the method of Laemmli (1970) using a verticalmini-slab apparatus (Bio-Rad Laboratories, Hercules, CA, USA). Proteinswere then electrophoretically transferred onto a PVDF membrane using atransfer apparatus (Bio-Rad Laboratories). Blocking of the membrane wasperformed with 10% skimmed milk in TTBS (0.05% Tween 20 in Tris-buffered saline: 20 mmol l−1 Tris-HCl, 500 mmol l−1 NaCl, pH 7.6) for 1 h.The blocked membrane was incubated with anti-F2 or anti-Fgg antibodies(1:500 dilution in 1% bovine serum albumin in TTBS) overnight at 4°C. Themembrane was incubated with goat anti-rabbit alkaline phosphatase-conjugated secondary antibody (1:10,000 dilution; Santa CruzBiotechnology Inc.) for 1 h, rinsed, and then incubated for 30 min in asolution of 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt and nitro-blue tetrazolium chloride (Invitrogen, Carlsbad, CA, USA) for colourdevelopment. The developed blots were scanned using a CanoScan 9000FMark II flatbed scanner in TIFF format at 300 dpi resolution. Densitometricquantification of band intensity was performed using ImageJ (version 1.41,NIH), calibrated with a 37 step reflection scanner scale (1×8 in; Stouffer no.R3705-1C). Difficulties were encountered in identifying a reference protein,the expression of which would be unaffected throughout the three phases ofaestivation. Hence, results are expressed as arbitrary densitometric units perµg protein, i.e. with reference to the protein concentration, as reportedelsewhere for protein abundance of L-gulono-γ-lactone oxidase (Chinget al., 2014), Na+/K+-ATPase (Hiong et al., 2014) and betaine-homocysteineS-methyltransferase (Ong et al., 2015) in P. annectens during aestivation.

Statistical analysisResults are presented as means±s.e.m. Statistical analyses were performedusing SPSS version 21 (IBM Corporation, Armonk, NY, USA).Homogeneity of variance was verified using Levene’s test. One-wayanalysis of variance (ANOVA) was performed for all the results, followedby multiple comparisons of means by Tukey’s test (for data with equalvariance) or Dunnett’s T3 test (for data with unequal variance). Theanalysed data were used in the evaluation of the differences between meanswhere applicable. Differences were regarded as statistically significant atP<0.05.

RESULTSThe nucleotide and the deduced amino acid sequences off2/F2The complete cDNA coding sequence of f2 from the liver ofP. annectens consisted of 1836 bp, encoding a protein of 611 aminoacids with an estimated molecular mass of 69.3 kDa. The length ofP. annectens F2 protein was comparable to F2 of other animalspecies (Fig. 1). An alignment of the deduced amino acid sequenceof F2 from P. annectens with those from human, mouse, frog,zebrafish and rainbow trout (Fig. 1) indicated a highly conservedregion between residues 342 and 630 (according to the alignment inFig. 1). This conserved region included the N-glycosylation sites forcarbohydrate attachment, the cysteine residues responsible for thedisulphide interlink between F2 heavy and light chain, and the His-Asp-Ser catalytic triad (histidine 419, aspartate 475 and serine 581)for the charge relay system (Fig. 1). In addition, the identifiedγ-carboxyglutamate (Gla) domain contained multiple conservedglutamate residues, which are critical for anchoring the protein tothe cell membrane via a Ca2+-dependent interaction (Huang et al.,2003). However, the Gla domain, together with the two kringle

Fig. 1. Molecular characterization of coagulation factor II (F2) ofProtopterus annectens. A multiple amino acid alignment of F2 ofP. annectens with F2 sequences from selected vertebrates (Danio rerio,Oncorhynchus mykiss, Xenopus tropicalis, Mus musculus and Homosapiens). Identical or strongly similar amino acids are indicated by shadedresidues. The γ-carboxyglutamate (Gla) and kringle (KR) domains areunderlined. N denotes the N-glycosylation sites, C denotes the charge relaysites and I denotes the interlink sites (disulphide bridge between F2 light andheavy chain). G represents glutamate residues (for Gla formation) and verticallines indicate the cleavage sites of factor Xa.

3720

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

domains, which are required for protein structural folding andinteraction (Patthy et al., 1984), were only weakly conserved acrossthe different animals. Of particular interest for tetrapods andP. annectens, the conserved factor Xa (FXa) cleavage site betweenresidues 327 and 328 revealed that the cleavage was betweenarginine and tyrosine. By contrast, the cleavage site for fishes wasbetween two tyrosine residues.

The nucleotide and the deduced amino acid sequences offgg/FggThe complete cDNA coding sequence of fgg from the liver ofP. annectens consisted of 1311 bp, encoding a protein of 436 aminoacids with a calculated molecular mass of 50.5 kDa. An alignmentof the deduced amino acid sequence of Fgg from P. annectens withthose of other animal species (Fig. 2) showed that all the sequenceswere highly conserved, particularly the glycosylation sites and thecysteine residues that help to form disulphide bridges with the

fibrinogen α and β chains (Hoeprich and Doolittle, 1983).Furthermore, the calcium binding domain and the polymerizationsite required for mediating the cross-linking of fibrin monomers(Olexa and Budzynski, 1981) were conserved in FGG/Fgg acrossthe different animals. Notably, the two plasmin cleavage sitesidentified in H. sapiens were not conserved in FGG/Fgg of otherspecies, suggesting the presence of alternative positions for plasminaction in amphibians and fishes.

Phylogenetic relationshipPhylogenetic analyses revealed that the F2 (Fig. 3) and Fgg (Fig. 4)of P. annectenswere closer to those of tetrapods than those of fishes.

mRNA expression levels of f2 and fgg in the liver during threephases of aestivationThe mRNA expression level of f2 remained unchanged in the liverof P. annectens after 3 or 6 days of aestivation (the induction phase)and after 12 days of aestivation (the early maintenance phase;Fig. 5A). However, 6 months of aestivation (the prolongedmaintenance phase) led to a significant decrease (by 48%) in thef2 mRNA expression level in the liver (Fig. 5A). One day afterarousal from 6 months of aestivation, there was a further decrease inthe mRNA expression level of f2 (by 50%) in the liver comparedwith that of fish aestivated for 6 months (Fig. 5B). The mRNAexpression of f2 in the liver of fish aroused for 3 or 6 days remainedsignificantly lower than that of the control fish (Fig. 5B).

Eptatretus stoutii F2

Takifugu rubripes F2

Oncorhynchus mykiss F2

Danio rerio F2

Proptopterus annectens F2

Homo sapiens F2

Mus musculus F2

Rattus norvegicus F2

Xenopus tropicalis F2

Xenopus laevis F2

100

57

94

99

100

100

100

100

Fig. 3. Phenogramic analysis of F2 of P. annectens. A phenogramillustrating the relationship between F2 of P. annectens and F2 of selectedvertebrates. The number at each branch represents the bootstrap value (max.100). F2 of Eptatretus stoutii was chosen as the outgroup.

Fig. 2. Molecular characterization of fibrinogen γ chain (Fgg) ofP. annectens. A multiple amino acid alignment of Fgg of P. annectens withFgg/FGG sequences from selected vertebrates (Callorhinchus milii, Daniorerio, Xenopus laevis,Mus musculus and Homo sapiens). Identical or stronglysimilar amino acids are indicated by shaded residues. N denotes theN-glycosylation sites and I denotes the interlink sites (disulphide bridgebetween residues 34 and 35). Sa and Sb represent the sites that formdisulphide bridges with fibrinogen α- and β-chain, respectively. Vertical linesindicate the cleavage sites of plasmin.

3721

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

The mRNA expression level of fgg was 10-fold higher than thatof f2 in the liver of P. annectens. There was a transient butsignificant increase (1.7-fold) in the mRNA expression level of fggafter 3 days of aestivation compared with the control (Fig. 6A).After 6 months of aestivation, the fgg mRNA expression leveldecreased significantly by 50% compared with the freshwatercontrol (Fig. 6A). The mRNA expression level of fgg in the liver offish 3 or 6 days (but not 1 day) after arousal from 6 months ofaestivation was comparable to that of the control fish (Fig. 6B).

Protein abundance of F2 and Fgg in the liver during threephases of aestivationThe protein abundance of F2 remained unchanged in the liver ofP. annectens after 6 or 12 days of aestivation, but it increasedsignificantly after 6 months of aestivation or 3 days after arousalfrom 6 months of aestivation as compared with the control (Fig. 7).For Fgg, there was a significant increase in protein abundance in theliver of P. annectens after 12 days of aestivation (Fig. 8).

Protein abundance of F2 and Fgg in the plasma during threephases of aestivationThere was a progressive increase in the protein abundance of F2 inthe plasma of P. annectens during the first 12 days of aestivation(Fig. 9). By day 12, the protein abundance of F2 in the plasma was

significantly higher than that of the control fish. However, 6 monthsof aestivation led to a drastic decrease in plasma F2 proteinabundance. Despite being not statistically different from that of thefreshwater control, the plasma F2 protein abundance of fishaestivated for 6 months was only 25% of the control values(Fig. 9). The plasma F2 protein abundance returned to the controllevel in fish 3 or 6 days after arousal from 6 months of aestivation.

The plasma protein abundance of Fgg increased significantly infish that underwent 6 or 12 days of aestivation, but decreasedsignificantly to 1/6 of the control value after 6 months of aestivation(Fig. 10). Three days after arousal from 6 months of aestivation, theprotein abundance of Fgg in the plasma recovered transiently to thecontrol level.

DISCUSSIONRoles of F2 and Fgg in blood clot formationFibrinogen is a trinodular glycoprotein comprising two symmetricalhalves, with each half consisting of three different polypeptidechains, namely α, β and γ chain linked by disulphide bonds(Doolittle, 2010). F2 is the zymogen form of a serine protease that

Danio rerio Fgg

Protopterus annectens Fgg

Homo sapiens FGG

Mus musculus FGG

Rattus norvegicus FGG

100

100

100

75

54

82

100 100

Culex quinquefasciatus Fgg

Callorhinchus milii Fgg

Plecoglossus altivelis Fgg

Hypophthalmichthys molitrix Fgg

Xenopus laevis FGG

Fig. 4. Phenogramic analysis of Fgg of P. annectens. A phenogramillustrating the relationship between Fgg of P. annectens and FGG/Fgg ofselected vertebrates. The number at each branch represents the bootstrapvalue (max. 100). Fgg of Culex quinquefasciatus was chosen as the outgroup.

A

B

b b

a,ba,b

a

0

1

2

3

FW(control)

3 days 6 days 12 days 6 months

No.

of f

2 tra

nscr

ipts

(�10

3 co

pies

ng–

1 )

c

b

a

a,b a,b

0

1

2

3

FW(control)

6 months 1 day 3 days 6 daysArousal

MaintenanceInduction

Fig. 5. mRNA expression levels of f2 in the liver of P. annectens. Absolutequantification (copies of transcripts per ng cDNA) of f2 mRNA expressionlevels in the liver of P. annectens during (A) the induction phase (3 or 6 days)and the maintenance phase (12 days or 6 months) of aestivation and (B) themaintenance phase (6 months) and arousal phase (1, 3 or 6 days after arousalfrom 6 months of aestivation) of aestivation comparedwith the freshwater (FW)control. Results represent means+s.e.m. (N=5). Means not sharing the sameletter are significantly different (P<0.05).

3722

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

exhibits pro-coagulant properties by cleaving fibrinogen to formfibrin (Siller-Matula et al., 2011). The released Fgg is one of thesubunit polypeptides that is involved in fibrin polymerization andcross-linking by FXIII to form the three-dimensional framework ofa blood clot (Günther and Ruppert, 2006). Fibrin polymerization isa complex process that requires specific three-dimensionalassociation of the activated fibrin molecules. Cleavage offibrinopeptides from fibrinogen exposes the polymerization sitesin the central domain of fibrin, which bind to the complementarysites present at the N-terminal region of another fibrin molecule(Doolittle, 1984; Budzynski, 1986). The association of thesebinding sites results in the formation of half-staggered protofibrils(Fowler et al., 1981; Medved et al., 1990), which are eventuallyaggregated laterally to form fibres (Mosesson, 2005). Thesubsequent branching and cross-linking of the fibres then formsan extensive fibrous network known as a clot. F2 is also involved inthe activation of the transglutaminase FXIII for fibrin cross-linking,self-generation of more thrombin through the activation of FXI,FVIII and FV, and the stimulation of platelet aggregation via

cleavage of the membrane-bound protease-activated receptors(PARs) 1, 3 and 4 (Coughlin, 2005).

Molecular characterization of F2 and Fgg from P. annectensF2 is only activated to functional thrombin when it forms a proteincomplex (prothrombinase complex) with platelet phospholipids,factor V and FXa. Hence, F2 contains a Gla domain to carry outCa2+-dependent interactions with the negatively charged plateletphospholipids (Huang et al., 2003). Each glutamate residue withinthe Gla domain undergoes carboxylation to form Gla residues thatare able to bind to Ca2+ (Presnell and Stafford, 2002), and thereforethe glutamate residues in the Gla domain of F2 are highly conservedacross species including P. annectens to preserve its function. Inaddition, F2 has many interactions with other proteins, which in turnmodulate the activity and functional properties of F2. Kringledomains in F2 are known to play important roles in protein andcofactor interactions (Wu et al., 1997), in the binding of mediatorssuch as membranes, other proteins or phospholipids, and in theregulation of the F2 proteolytic activity. As the kringle domains ofF2 are not well conserved among various animal species, F2 ofdifferent animal species may have variable protein interactions andregulatory control due to the conformational alterations in kringlefolds arising from amino acid substitutions (Castellino and Beals,1987). The activation of F2 is mediated by the cleavage of FXa attwo specific sites to release the catalytic domain from thecarboxyterminal region of the protein (Bode, 2006). Of note, theFXa cleavage sites in F2 of tetrapods and P. annectens are differentfrom the cleavage site in F2 of teleosts, thus showing that the Africanlungfish is evolutionarily closer to tetrapods than to teleosts.Furthermore, a study by Sun et al. (2000) showed that a single amino

A

B

b

c

a,b

a,ba

0

2

4

6

8

FW(control)

b

a a

a,b a,b

0

1

2

3

4

FW(control)

3 days 6 days 12 days 6 months

No.

of f

gg tr

ansc

ripts

(�10

4 co

pies

ng–

1 )

6 months 1 day 3 days 6 daysArousal

MaintenanceInduction

Fig. 6.mRNAexpression levels of fgg in the liver ofP. annectens.Absolutequantification (copies of transcripts per ng cDNA) of fgg mRNA expressionlevels in the liver of P. annectens during (A) the induction phase (3 or 6 days)and the maintenance phase (12 days or 6 months) of aestivation and (B) themaintenance phase (6 months) and arousal phase (1, 3 or 6 days after arousalfrom 6 months of aestivation) of aestivation compared with the FW control.Results represent means+s.e.m. (N=5). Means not sharing the same letter aresignificantly different (P<0.05).

A

B

a a

a,b

c b,c

a

0

0.1

0.2

0.3

0.4

FW(control)

Live

r F2

prot

ein

abun

danc

e (a

.u.)

Ladder FW (control)

6days

12days

6months 3 days 6 days

F2

50 kDa

75 kDa

6 days 12 days 6 months 3 days 6 daysArousal

Arousal

Fig. 7. Western blotting results for F2 in the liver of P. annectens. Proteinabundance of F2 in liver kept in FW on day 0 (control), after 6 days (inductionphase), 12 days (early maintenance phase) or 6 months (maintenance phase)of aestivation, or 3 or 6 days after arousal from 6 months of aestivation (arousalphase). (A) Example immunoblot of F2. (B) F2 protein abundance expressedas arbitrary densitometric units per 50 μg protein (a.u.). Results representmeans+s.e.m. (N=3). Means not sharing the same letter are significantlydifferent (P<0.05).

3723

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

acid substitution of arginine to histidine at this cleavage site resultedin dysprothrombinaemia. This shows the importance of theconserved cleavage site and implies that F2 of teleosts may beactivated differently.The conserved polymerization site identified at the C-terminal

end of Fgg of P. annectens plays an important role of bindingto the N-terminal region of the fibrinogen molecule to mediatefibrin polymerization. Ca2+ is another key player involved ineffective fibrin polymerization (Dang et al., 1985) and therefore theCa2+-binding site is also highly conserved in Fgg of P. annectens.Fibrinolysis of the blood clot is mediated by plasmin, which cleavesthrough the connector region of the three polypeptide chains of thefibrinogen molecules to release fibrin degradation products(Kirschbaum and Budzynski, 1990). An interesting observationmade in this study is that the plasmin cleavage sites are notconserved across the various animal species examined, thussuggesting alternative locations for the action of plasmin. Furtherstudies on the alternative plasmin cleavage sites might provide moreinformation on the control of fibrinolysis in different species.

Phylogenetic analyses of F2 and Fgg from P. annectensLungfishes share similarities with both fishes and amphibians, andare important species for studies on the transition between fishes andtetrapods. Lungfishes are believed by many neontologists to be asister group of amphibians (Forey, 1986); support for this viewcomes from molecular phylogenetic studies, which show lungfishesto be the closest living relatives of tetrapods (Zardoya et al., 1998;Tohyama et al., 2000; Takezaki et al., 2004; Hallstrom and Janke,2009; Amemiya et al., 2013). A study by Davidson et al. (2003a) onthe molecular evolution of vertebrate blood coagulation showed that

the blood coagulation network was well established in all the jawedvertebrates and that it evolved before the divergence of teleosts andtetrapods, which occurred more than 430 million years ago. Assome differences exist between the blood coagulation system inamphibians and teleosts, phylogenetic analyses of bloodcoagulation proteins from P. annectens may provide molecularclues to the evolutionary relationship of lungfishes to teleosts andtetrapods. Our analyses revealed that F2 and Fgg from P. annectensshared greater similarities with those of amphibians than those ofteleosts. When taken together with phylogenetic informationobtained based on the deduced amino acid sequences of othergenes, our results lend support to the notion that lungfish is theintermediary form between teleosts and tetrapods. As lungfishes arethe closest living sister group of land vertebrates, they wouldlogically possess some genes/proteins that are closer to those ofother fishes (e.g. carbamoyl phosphate synthetase III, Loong et al.,2012a; argininosuccinate synthase, Chng et al., 2014) and othersthat have greater similarity to those of tetrapods (e.g. F2 and Fgg,this study; argininosuccinate lyase, Chng et al., 2014; Na+/K+-ATPase α-subunit isoforms, Hiong et al., 2014; L-gulono-γ-lactoneoxidase, Ching et al., 2014; betaine-homocysteine S-methyltransferase, Ong et al., 2015).

Apparent increase in blood-clotting ability during theinduction phase of aestivation in P. annectensDuring the induction phase (after 3 or 6 days) of aestivation in air,the mRNA expression of f2 in the liver of P. annectens remainedstatistically unchanged despite an apparent decreasing trend.

A

B

a

a

b

a a

a

0

0.1

0.2

0.3

FW(control)

Fgg 50 kDa

Live

r Fgg

pro

tein

abu

ndan

ce (a

.u.)

Ladder FW (control)

6days

12days

6months 3 days 6 days

6 days 12 days 6 months 3 days 6 daysArousal

Arousal

Fig. 8. Western blotting results for Fgg in the liver of P. annectens. Proteinabundance of Fgg in liver kept in FWon day 0 (control), after 6 days (inductionphase), 12 days (early maintenance phase) or 6 months (maintenance phase)of aestivation, or 3 or 6 days after arousal from 6 months of aestivation (arousalphase). (A) Example immunoblot of Fgg. (B) Fgg protein abundanceexpressed as arbitrary densitometric units per 50 μg protein (a.u.). Resultsrepresent means+s.e.m. (N=3). Means not sharing the same letter aresignificantly different (P<0.05).

A

B

a,b

b

c

a

a,b

a,b

0

0.15

0.3

0.45

F2 75 kDa

50 kDa

FW(control)

Pla

sma

F2 p

rote

in a

bund

ance

(a.u

.)

Ladder FW (control)

6days

12days

6months 3 days 6 days

6 days 12 days 6 months 3 days 6 daysArousal

Arousal

Fig. 9. Western blotting results for F2 in the plasma of P. annectens.Protein abundance of F2 in plasma kept in FW on day 0 (control), after 6 days(induction phase), 12 days (early maintenance phase) or 6 months(maintenance phase) of aestivation, or 3 or 6 days after arousal from 6 monthsof aestivation (arousal phase). (A) Example immunoblot of F2. (B) F2protein abundance expressed as arbitrary densitometric units per 100 μgprotein (a.u.). Results represent means+s.e.m. (N=3). Means not sharing thesame letter are significantly different (P<0.05).

3724

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

Western blotting results confirmed that 6 days of aestivation had nosignificant effect on the protein abundance of F2 in the liver. Bycontrast, there was an up-regulation in fgg mRNA expression in theliver on day 3 of aestivation. Notably, the hepatic mRNA expressionlevel of fgg was 10-fold higher than that of f2. Furthermore, after6 days of aestivation, there was a significant (3-fold) increase in theprotein abundance of Fgg in the plasma, while the liver Fgg proteinabundance remained unchanged. Taken together, these resultsindicate that there could be an up-regulation of the ability to formblood clots in P. annectens during the induction phase ofaestivation. This also suggests that Fgg could be a more importantregulator of blood clot formation than F2 in P. annectens. It isapparent that Fgg production in the liver could be up-regulatedthrough increased transcription and translation during the inductionphase, and the excess Fgg produced was not retained in the liver, butreleased to the plasma to enhance the ability of blood clot formation.When the lungfish is stranded on land during a drought, it is

exposed to a high partial pressure of atmospheric O2 (PO2), high

environmental temperature and desiccation, and perhaps even highUV radiation. Therefore, up-regulation of the ability to form bloodclots in P. annectens transiently during the induction phase ofaestivation could be interpreted as a stress response. Stress is knownto cause alterations in the blood-clotting system through the releaseof adrenaline (Wedemeyer et al., 1976; Casillas and Smith, 1977;Smith, 1980; Tavares-Dias and Oliveira, 2009). In fishes confrontedwith acute stresses, the elevation of circulating adrenaline levelscan be high enough to cause widespread intravascular clotting

(Woodward et al., 1981). Furthermore, P. annectens becomesphysically more active during the early induction phase ofaestivation, perhaps as it attempts to get back to water. In itsnatural habitat, the aestivating fish may burrow into the mud andform a subterranean cocoon to slow down the rate of desiccation.The burrowing actions may result in skin abrasion with vascularinjury, and it would be essential for effective blood clot formation toprevent infections. In the past, the manifestation of organicstructural modifications in aestivating animals has been largelyneglected. However, recent reports reveal that aestivation in Africanlungfishes involves structural and functional modifications in theheart (Icardo et al., 2008), the kidney (Ojeda et al., 2008; Amelioet al., 2008) and the intestine (Icardo et al., 2012). Indeed, there is anapparent increase in metabolic rate in African lungfishes duringthe induction phase of aestivation. During the first 10 days ofaestivation, hyperventilation occurs with a 2- to 5-fold increase inthe ventilation rate, and the arterial PO2

increases from 25–40 to 50–58 mmHg (Delaney et al., 1974). Hence, during the induction phaseof aestivation, P. annectens is unlikely to be confronted with astagnation of blood flow due to low heart rate and blood pressure,and there is no need to instil anti-thrombotic responses.

Possible decrease in blood-clotting ability during theprolongedmaintenance phase of aestivation in P. annectensIn mammals, a reduced blood flow in the vascular system can lead toblood pooling behind venous valves and sinuses. This would causelocal hypercoagulability due to the accumulation of pro-coagulantsubstances, resulting in the formation of intravascular blood clots,which can lead to occlusion of capillaries (Briones, 2009; Lópezand Chen, 2009). A reduction in the blood-clotting capacity toprevent intravascular thrombosis is a common phenomenon in manyhibernating and aestivating mammals (Lechler and Penick, 1963;Pivorun and Sinnamon, 1981; Boyer and Barnes, 1999; McCarronet al., 2001). The organs of hibernating mammals are hypo-perfusedand are considered to be severely ischaemic (McCarron et al., 2001;Storey, 2003). For instance, cerebral perfusion is known to decreaseby approximately 90% (Boyer and Barnes, 1999; McCarron et al.,2001). Thus, any perturbation to blood flow resulting fromthrombosis can be lethal to the hibernating animal. Hibernatinganimals usually employ several strategies to reduce blood clotting:(1) reduction in circulating platelets (Lechler and Penick, 1963), (2)reduction of pro-coagulant factors such as factor V, XIII or IX(McCarron et al., 2001), (3) synthesis of α2-macroglobulin tofacilitate microcirculation (Srere et al., 1995) and/or (4) reduction inblood viscosity (Maclean, 1981).

During the maintenance phase of aestivation, the blood flow inthe lungfish vascular system is likely to be slow as a result of adecline in blood pressure resulting from a decrease in blood volumeand a reduction in cardiac output (Delaney et al., 1974; Fishmanet al., 1986, 1992). However, it is important for the aestivatinglungfish to maintain continual perfusion of the vital organs suchas the heart, lung, brain and liver. Therefore, there must bemechanisms to avoid intravascular thrombosis. Although 12 days(the early maintenance phase) of aestivation resulted in a significantincrease in the protein abundance of F2 and Fgg in the plasma ofP. annectens, this was probably a carryover from the inductionphase. In fact, 6 months of aestivation had the opposite effect, andthere was a substantial decrease in F2 and Fgg protein abundance inthe plasma. The slight but insignificant decrease in mRNAexpression levels of f2 and fgg in the liver after 12 days ofaestivation is indicative of the initiation of transcriptional changes inthe aestivating lungfish. Indeed, after 6 months of aestivation, there

A

B

b

c c

a

b

a

0

0.05

0.1

0.15

Fgg 50 kDa

FW(control)

Pla

sma

Fgg

prot

ein

abun

danc

e (a

.u.)

Ladder FW (control)

6days

12days

6months 3 days 6 days

6 days 12 days 6 months 3 days 6 daysArousal

Arousal

Fig. 10. Western blotting results for Fgg in the plasma of P. annectens.Protein abundance of Fgg in plasma kept in FWon day 0 (control), after 6 days(induction phase), 12 days (early maintenance phase) or 6 months(maintenance phase) of aestivation, or 3 or 6 days after arousal from 6 monthsof aestivation (arousal phase). (A) Example immunoblot of Fgg. (B) Fgg proteinabundance expressed as arbitrary densitometric units per 20 μg protein (a.u.).Results represent means+s.e.m. (N=3). Means not sharing the same letter aresignificantly different (P<0.05).

3725

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

was significant down-regulation of the mRNA expression levels off2 and fgg in the liver of P. annectens. This supports the hypothesisthat pro-coagulant genes could be down-regulated transcriptionallyto ameliorate the risk of thrombosis during the maintenance phase ofaestivation.However, why would there be a significant increase in the protein

abundance of F2 and Fgg in the liver of P. annectens that hadundergone 12 days and 6 months of aestivation, respectively? Asthe transcription of f2 and fgg was down-regulated, it is highlyunlikely that increased translation would have occurred to increasethe production of F2 and Fgg. A logical explanation is that, in spiteof decreases in hepatic F2 and Fgg production, a restriction on theexport of F2 and Fgg to the plasma to reduce the chance ofthrombosis during the early maintenance phase of aestivationresulted in their accumulation in the liver. Overall, it can beconcluded that long-term aestivation induces changes in theproduction and export of F2 and Fgg in the liver, resulting indecreases in their protein abundance in the plasma of P. annectens.Of note, the gradual decrease in mRNA expression levels of f2

and fgg seems to complement the gradual slow down in heart rateduring aestivation as reported by Delaney et al. (1974), suggestinghomeostatic feedback control in the lungfish. Rubanyi (1993)studied the role of endothelial cells in cardiovascular homeostasisand reported that the activation of endothelial cells could feed backon the regulatory mechanisms of blood coagulation within bloodvessels. In addition, Lowe (2005) showed that blood flow exertedshear stresses on the endothelial cells to alter their morphologyand function. Thus, it is probable that homeostatic control ofblood coagulation occurs in concert with changes in blood flow inP. annectens.

Changes in f2/fgg mRNA expression levels and F2/Fggprotein abundance during the arousal phase of aestivation inP. annectensUpon awakening in water, the lungfish quickly rehydrates andexcretes the accumulated nitrogenous waste, while heart rate and theblood flow to splanchnic organs return to normal (see Chew et al.,2015 for a review). In fact, arousal is associated with the drasticreversal of physiological and morphological changes in thelungfish. Indeed, the protein abundance of plasma F2 recovered inP. annectens 3 or 6 days after arousal from 6 months of aestivation,while that of plasma Fgg returned transiently to the control level3 days after arousal. In addition, the mRNA expression level of fggin the liver of P. annectens returned to a level comparable to that ofthe control fish 3 or 6 days after arousal. Although the hepatic f2mRNA expression level remained significantly lower than thecontrol value during the 6 day arousal period, western blottingresults indicate that the release of F2 accumulated in the liver uponarousal could have contributed to the recovery of plasma F2 proteinabundance. Overall, our result indicated that the complete recoveryof the blood-clotting ability in the aroused P. annectens might takelonger than 6 days. In general, African lungfishes would begin tofeed only 7–10 days after arousal from aestivation. As a completerecovery requires increased synthesis of proteins, it is logical that itwould occur only after re-feeding.

ConclusionsOur results indicate for the first time that there can be an increase inthe blood-clotting ability, mainly due to changes in hepatic fgg/Fggexpression levels, in P. annectens during the induction phase ofaestivation. The fgg mRNA expression in the liver is up-regulatedafter 3 days of aestivation, and the protein abundance of Fgg in the

plasma increases significantly (3-fold) after 6 days of aestivation.By contrast, 6 months of aestivation leads to significant down-regulation in mRNA expression levels of both f2 and fgg in the liverof P. annectens. There may also be a restriction on F2 and Fggexport from the liver to the plasma, leading to substantial decreasesin plasma F2 and Fgg protein abundance to suppress thrombosis.Overall, these results reveal that adaptive responses in P. annectensdiffer during the three phases of aestivation. As there is limitedinformation on processes specific to the induction or arousal phasesof aestivation, efforts should be made in the future to identifyadaptive responses particular to each of the three phases ofaestivation in African lungfishes.

Competing interestsThe authors declare no competing or financial interests.

Author contributionsY.K.I. and S.F.C. conceived and designed the experiments. X.R.T., K.C.H. andM.V.B. performed the experiments. X.R.T., K.C.H., M.V.B. and Y.K.I. analysedthe data. W.P.W. worked with the animals. X.R.T. and Y.K.I. drafted the manuscript.K.C.H., M.V.B. and Y.K.I. revised the manuscript.

FundingThis project was supported by the Ministry of Education of the Republic of Singaporethrough grants (R-154-000-429-112 and R154-000-470-112), administered to Y.K.I.

ReferencesAmelio, D., Garofalo, F., Brunelli, E., Loong, A.M.,Wong,W. P., Ip, Y. K., Tota, B.

and Cerra, M. C. (2008). Differential NOS expression in freshwater andaestivating Protopterus dolloi (lungfish): heart vs kidney readjustments. NitricOxide 18, 1-10.

Amemiya, C. T., Alfoldi, J., Lee, A. P., Fan, S., Philippe, H., MacCallum, I.,Braasch, I., Manousaki, T., Schneider, I., Rohner, N. et al. (2013). The Africancoelacanth genome provides insights into tetrapod evolution. Nature 496,311-316.

Ballantyne, J. S. and Frick, N. T. (2010). Lungfish metabolism. In The Biology ofLungfishes (ed. J. M. Jorgensen and J. Joss), pp. 305-340. New Hampshire:Science Publishers.

Bode, W. (2006). Structure and interaction modes of thrombin. Blood Cell. Mol. Dis.36, 122-130.

Boyer, B. B. and Barnes, B. M. (1999). Molecular and metabolic aspects ofmammalian hibernation. Bioscience 49, 713-724.

Bradford, M. M. (1976). A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein–dye binding. Anal.Biochem. 72, 248-254.

Briones, M. A. (2009). Chapter 131 – general overview of the hypercoaguable state.In Transfusion Medicine and Hemostasis (ed. C. D. Hillyer, B. H. Shaz, J. C.Zimring and T. C. Abshire), pp. 677-679. San Diego: Academic Press.

Budzynski, A. Z. (1986). Fibrinogen and fibrin: biochemistry and pathophysiology.Crit. Rev. Oncol. Hematol. 6, 97-146.

Casillas, E. and Smith, L. S. (1977). Effect of stress on blood coagulation andhaematology in rainbow trout (Salmo gairdneri). J. Fish Biol. 10, 481-491.

Castellino, F. J. and Beals, J. M. (1987). The genetic relationships between thekringle domains of human plasminogen, prothrombin, tissue plasminogenactivator, urokinase, and coagulation factor XII. J. Mol. Evol. 26, 358-369.

Chew, S. F., Chan, N. K. Y., Loong, A. M., Hiong, K. C., Tam, W. L. and Ip, Y. K.(2004). Nitrogenmetabolism in the African lungfish (Protopterus dolloi) aestivatingin a mucus cocoon on land. J. Exp. Biol. 207, 777-786.

Chew, S. F., Ching, B., Chng, Y. R., Ong, J. L. Y., Hiong, K. C., Chen, X. L. and Ip,Y. K. (2015). Aestivation in African lungfishes: physiology, biochemistry andmolecular biology. In Phylogeny, Anatomy and Physiology of Ancient Fishes (ed.G. Zaccone, K. Dabrowski, M. S. Hedrick, J. M. O. Fernandes and J. M. Icardo),pp. 81-132. Boca Raton: CRC Press.

Ching, B., Ong, J. L. Y., Chng, Y. R., Chen, X. L., Wong, W. P., Chew, S. F. and Ip,Y. K. (2014). L-gulono-γ-lactone oxidase expression and vitamin C synthesis inthe brain and kidney of the African lungfish, Protopterus annectens. FASEB J. 28,3506-3517.

Chng, Y. R., Ong, J. L. Y., Ching, B., Chen, X. L., Wong, W. P., Chew, S. F. and Ip,Y. K. (2014). Molecular characterization of argininosuccinate synthase andargininosuccinate lyase from the liver of the African lungfish Protopterusannectens, and their mRNA expression levels in the liver, kidney, brain andskeletal muscle during aestivation. J. Comp. Physiol. B 184, 835-853.

Colman, R. W. (2006). Are hemostasis and thrombosis two sides of the same coin?J. Exp. Med. 203, 493-495.

3726

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

Coughlin, S. R. (2005). Protease-activated receptors in hemostasis, thrombosisand vascular biology. J. Thromb. Haemost. 3, 1800-1814.

Dang, C. V., Ebert, R. F. and Bell, W. R. (1985). Localization of a fibrinogen calciumbinding site between gamma-subunit positions 311 and 336 by terbiumfluorescence. J. Biol. Chem. 260, 9713-9719.

Davidson, C. J., Tuddenham, E. G. and McVey, J. H. (2003a). 450 million years ofhemostasis. J. Thromb. Haemost. 1, 1487-1494.

Davidson, C. J., Hirt, R. P., Lal, K., Snell, P., Elgar, G., Tuddennham, E. G. D. andMcvey, J. H. (2003b). Molecular evolution of the vertebrate blood coagulationnetwork. J. Thromb. Haemost. 89, 420-428.

Delaney, R. G., Lahiri, S. and Fishman, A. P. (1974). Aestivation of the Africanlungfish, Protopterus aethiopicus: cardiovascular and respiratory functions.J. Exp. Biol. 61, 111-128.

Delaney, R. G., Shub, C. and Fishman, A. P. (1976). Hematologic observations onthe aquatic and estivating African lungfish, Protopterus aethiopicus.Copeia 1976,423-434.

Doolittle, R. F. (1984). Fibrinogen and fibrin. Annu. Rev. Biochem. 53, 195-229.Doolittle, R. F. (2010). Chapter 17 – Structural basis of signaling events involvingfibrinogen and fibrin. InHandbook of Cell Signalling, 2nd edn (ed. R. A. Bradshawand E. A. Dennis), pp. 111-114. San Diego: Academic press.

Felsentein, J. (1989). PHYLIP – phylogeny inference package (version 3.2).Cladistics 5, 164-166.

Fishman, A. P., Pack, A. I., Delaney, R. G. and Galante, R. J. (1986). Estivation inProtopterus. J. Morphol. 190, 237-248.

Fishman, A. P., Galante, R. J., Winokur, A. and Pack, A. I. (1992). Estivation in theAfrican lungfish. Proc. Am. Philos. Soc. 136, 61-72.

Forey, P. L. (1986). Relationships of lungfishes. J. Morphol. 190, 75-91.Fowler, W. E., Hantgan, R. R., Hermans, J. and Erickson, H. P. (1981). Structureof the fibrin protofibril. Proc. Natl. Acad. Sci. USA 78, 4872-4876.

Furie, B. and Furie, B. C. (1988). The molecular basis of blood coagulation.Cell 53,505-518.

Gerwick, L., Corley-Smith, G. andBayne, C. J. (2007). Gene transcript changes inindividual rainbow trout livers following an inflammatory stimulus. Fish ShellfishImmunol. 22, 157-171.

Gunther, A. and Ruppert, C. (2006). Coagulation cascade | Antithrombin III. InEncyclopedia of Respiratory Medicine (ed. J. L. Geoffrey and S. D. Shapiro), pp.486-490. Oxford: Academic Press.

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95-98.

Hallstrom, B. M. and Janke, A. (2009). Gnathostome phylogenomics utilizinglungfish EST sequences. Mol. Biol. Evol. 26, 463-471.

Hasiotis, S. T., Platt, B. F., Hembre, D. I. and Everhart, M. J. (2007). The trace-fossil record of vertebrates. In Trace Fossils: Concepts, Problems, Prospects (ed.W. Miller), pp. 196-218. Amsterdam: Elsevier Academic Press.

Hiong, K. C., Ip, Y. K., Wong, W. P. and Chew, S. F. (2014). Brain Na+/K+-ATPaseα-subunit isoforms and aestivation in the African lungfish, Protopterus annectens.J. Comp. Physiol. B 184, 571-587.

Hiong, K. C., Ip, Y. K., Wong, W. P. and Chew, S. F. (2015). Differential geneexpression in the liver of the African lungfish, Protopterus annectens, after 6months of aestivation in air or 1 day of arousal from 6 months of aestivation. PLoSONE 10, e0121224.

Hoeprich, P. D. and Doolittle, R. F. (1983). Dimeric half-molecules of humanfibrinogen are joined through disulfide bonds in an antiparallel orientation.Biochemistry 22, 2049-2055.

Huang, M., Rigby, A. C., Morelli, X., Grant, M. A., Huang, G., Furie, B., Seaton, B.and Furie, B. C. (2003). Structural basis of membrane binding by Gla domains ofvitamin K-dependent proteins. Nat. Struct. Biol. 10, 751-756.

Icardo, J. M., Amelio, D., Garofalo, F., Colvee, E., Cerra, M. C.,Wong,W. P., Tota,B. and Ip, Y. K. (2008). The structural characteristics of the heart ventricle of theAfrican lungfish Protopterus dolloi: freshwater and aestivation. J. Anat. 213,106-119.

Icardo, J. M., Loong, A. M., Colvee, E., Wong, W. P. and Ip, Y. K. (2012). Thealimentary canal of the African lungfish Protopterus annectens during aestivationand after arousal. Anat. Rec. 295, 60-72.

Ikechukwu, O. A. andObinnaya, C. L. (2010). Haematological profile of the Africanlungfish, Protopterus annectens (Owen) of Anambra River, Nigeria. J. Am. Sci. 6,123-130.

Ip, Y. K. and Chew, S. F. (2010). Nitrogen metabolism and excretion duringaestivation. In Progress in Molecular and Subcellular Biology, Vol. 49 (ed. C. A.Navas and J. E. Carvalho), pp. 63-94. Berlin: Springer-Verlag.

Ip, Y. K., Yeo, P. J., Loong, A. M., Hiong, K. C., Wong, W. P. and Chew, S. F.(2005). The interplay of increased urea synthesis and reduced ammoniaproduction in the African lungfish Protopterus aethiopicus during 46 days ofaestivation in a mucus cocoon on land. J. Exp. Zoolog. A Comp. Exp. Biol. 303A,1054-1065.

Jagadeeswaran, P. and Sheehan, J. P. (1999). Analysis of blood coagulation in thezebrafish. Blood Cell. Mol. Dis. 25, 239-249.

Jagadeeswaran, P., Gregory, M., Johnson, S. and Thankavel, B. (2000).Haemostatic screening and identification of zebrafish mutants with coagulation

pathway defects: an approach to identifying novel haemostatic genes in man.Br. J. Haematol. 110, 946-956.

Johansen, K., Lykkeboe, G., Weber, R. E. and Maloiy, G. M. O. (1976).Respiratory properties of blood in awake and estivating lungfish, Protopterusamphibius. Respir. Physiol. 27, 335-345.

Kirschbaum, N. E. and Budzynski, A. Z. (1990). A unique proteolytic fragment ofhuman fibrinogen containing the A alpha COOH-terminal domain of the nativemolecule. J. Biol. Chem. 265, 13669-13676.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227, 680-685.

Lechler, E. and Penick, G. D. (1963). Blood clotting defect in hibernating groundsquirrels (Citellus tridecemlineatus). Am. J. Physiol. 205, 985-988.

Loong, A. M., Hiong, K. C., Lee, S. M. L., Wong, W. P., Chew, S. F. and Ip, Y. K.(2005). Ornithine-urea cycle and urea synthesis in African lungfishes, Protopterusaethiopicus and Protopterus annectens, exposed to terrestrial conditions for 6days. J. Exp. Zoolog. A Comp. Exp. Biol. 303A, 354-365.

Loong, A. M., Tan, J. Y. L., Wong, W. P., Chew, S. F. and Ip, Y. K. (2007). Defenseagainst environmental ammonia toxicity in the African lungfish, Protopterusaethiopicus: bimodal breathing, skin ammonia permeability and urea synthesis.Aquat. Toxicol. 85, 76-86.

Loong, A. M., Ang, S. F., Wong, W. P., Portner, H. O., Bock, C., Wittig, R.,Bridges, C. R., Chew, S. F. and Ip, Y. K. (2008a). Effects of hypoxia on theenergy status and nitrogen metabolism of African lungfish during aestivation in amucus cocoon. J. Comp. Physiol. B. 178, 853-865.

Loong, A. M., Pang, C. Y. M., Hiong, K. C., Wong, W. P., Chew, S. F. and Ip, Y. K.(2008b). Increased urea synthesis and/or suppressed ammonia production in theAfrican lungfish, Protopterus annectens, during aestivation in air or mud. J. Comp.Physiol. B 178, 351-363.

Loong, A. M., Chng, Y. R., Chew, S. F., Wong, W. P. and Ip, Y. K. (2012a).Molecular characterization and mRNA expression of carbamoyl phosphatesynthetase III in the liver of the African lungfish, Protopterus annectens, duringaestivation or exposure to ammonia. J. Comp. Physiol. B 182, 367-379.

Loong, A. M., Hiong, K. C., Wong, W. P., Chew, S. F. and Ip, Y. K. (2012b).Differential gene expression in the liver of the African lungfish, Protopterusannectens, after 6 days of estivation in air. J. Comp. Physiol. B 182, 231-245.

Lopez, J. A. and Chen, J. (2009). Pathophysiology of venous thrombosis. Thromb.Res. 123 Suppl. 4, S30-S34.

Lowe, G. D. O. (2005). Virchow’s triad revisited: abnormal flow. Pathophysiol.Haemost. Thromb. 33, 455-457.

Maclean, G. S. (1981). Blood viscosity of two mammalian hibernators:Spermophilus tridecemlineatus and Tamias striatus. Physiol. Zool. 54, 122-131.

Manseth, E., Skjervold, P. O. and Flengsrud, R. (2004). Sample displacementchromatography of Atlantic salmon (Salmo salar) thrombin. J. Biochem. Biophys.Methods 60, 39-47.

Marshall, C. and Schultze, H.-P. (1992). Relative importance of molecular,neontological, and paleontological data in understanding the biology of thevertebrate invasion of land. J. Mol. Evol. 35, 93-101.

McCarron, R. M., Sieckmann, D. G., Yu, E. Z., Frerichs, K. and Hallenbeck, J. M.(2001). Hibernation, a state of natural tolerance to profound reduction in organblood flow and oxygen delivery capacity. In Molecular Mechanisms of MetabolicArrest (ed. K. B. Storey), pp. 23-42. Oxford: BIOS Scientific Publishers.

Medved, L., Ugarova, T., Veklich, Y., Lukinova, N. andWeisel, J. (1990). Electronmicroscope investigation of the early stages of fibrin assembly. Twisted protofibrilsand fibers. J. Mol. Biol. 216, 503-509.

Mosesson, M. W. (2005). Fibrinogen and fibrin structure and functions. J. Thromb.Haemost. 3, 1894-1904.

Ojeda, J. L., Wong, W. P., Ip, Y. K. and Icardo, J. M. (2008). Renal corpuscle of theAfrican lungfish Protopterus dolloi: structural and histochemical modificationsduring aestivation. Anat. Rec. 291, 1156-1172.

Olexa, S. A. and Budzynski, A. Z. (1981). Localization of a fibrin polymerizationsite. J. Biol. Chem. 256, 3544-3549.

Ong, J. L. Y., Woo, J. M., Hiong, K. C., Ching, B., Wong,W. P., Chew, S. F. and Ip,Y. K. (2015). Molecular characterization of betaine-homocysteinemethyltransferase 1 from the liver, and effects of aestivation on its expressionsand homocysteine concentrations in the liver, kidney and muscle of the Africanlungfish, Protopterus annectens. Comp. Biochem. Physiol. B 183, 30-41.

Patthy, L., Trexler, M., Vali, Z., Banyai, L. and Varadi, A. (1984). Kringles: modulesspecialized for protein binding. Homology of the gelatin-binding region offibronectin with the kringle structures of proteases. FEBS Lett. 171, 131-136.

Pinder, A. W., Storey, K. B. and Ultsch, G. R. (1992). Estivation and hibernation. InEnvironmental Physiology of the Amphibians (ed. M. E. Feder and W. W.Burggren), pp. 250-274. Chicago: University of Chicago Press.

Pivorun, E. B. and Sinnamon, W. B. (1981). Blood coagulation studies innormothermic, hibernating, and aroused Spermophilus franklini. Cryobiology 18,515-520.

Presnell, S. R. and Stafford, D. W. (2002). The vitamin K-dependent carboxylase.J. Thromb. Haemost. 87, 937-946.

Rubanyi, G. M. (1993). The role of endothelium in cardiovascular homeostasis anddiseases. J. Cardiovasc. Pharmacol. 22 Suppl. 4, S1-S14.

3727

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology

Siller-Matula, J. M., Schwameis, M., Blann, A., Mannhalter, C. and Jilma, B.(2011). Thrombin as a multi-functional enzyme. Focus on in vitro and in vivoeffects. J. Thromb. Haemost. 106, 1020-1033.

Smith, H. W. (1930). Metabolism of the lungfish, Protopterus aethiopicus. J. Biol.Chem. 88, 97-130.

Smith, A. C. (1980). Formation of lethal blood clots in fishes. J. Fish. Biol. 16, 1-4.Srere, H. K., Belke, D., Wang, L. C. H. and Martin, S. L. (1995). α2-Macroglobulingene expression during hibernation in ground squirrels is independent of acutephase response. Am. J. Physiol. 268, 1507-1512.

Storey, K. B. (2003). Mammalian hibernation: transcriptional and translationalcontrols. In Advances in Experimental Medicine and Biology, Vol. 543 (ed. R. C.Roach, P. D. Wagner and P. H. Hackett), pp. 21-38. New York: Kluwer Academic/Plenum Publishers.

Sun,W. Y., Burkart, M. C., Holaha, J. R. andDegen, S. J. (2000). Prothrombin SanAntonio: a single amino acid substitution at a Factor Xa activation site (Arg320 toHis) results in dysprothrombinemia. Blood 95, 711-714.

Takezaki, N., Figueroa, F., Zaleska-Rutczynska, Z., Takahata, N. and Klein, J.(2004). The phylogenetic relationship of tetrapod, coelacanth, and lungfishrevealed by the sequences of forty-four nuclear genes. Mol. Biol. Evol. 21,1512-1524.

Tavares-Dias, M. and Oliveira, S. (2009). A review of the blood coagulation systemof fish. Rev. Bras. Biocienc. 7, 205-224.

Tohyama, Y., Ichimiya, T., Kasama-Yoshida, H., Cao, Y., Hasegawa, M., Kojima,H., Tamai, Y. and Kurihara, T. (2000). Phylogenetic relation of lungfish indicatedby the amino acid sequence of myelin DM20. Brain Res. 80, 256-259.

Wedemeyer, G. A., Meyer, F. P. and Smith, L. (1976). Environmental stress andfish diseases. In Book 5 of Diseases of fish (ed. S. F. Snieszko and H. R.Axelrodpp), pp. 192. New Jersey: T.F.H. Publications Inc.

Withers, P. C. and Cooper, C. E. (2010). Metabolic depression: a historicalperspective. In Progress in Molecular and Subcellular Biology, Vol. 49 (ed. C. A.Navas and J. E. Carvalho), pp. 1-23. Berlin: Springer-Verlag.

Woodward, J. J., Smith, L. and Casillas, E. (1981). Thrombocyte aggregation inrainbow trout. Comp. Biochem. Physiol. A 68, 457-466.

Wu, W., Bancroft, J. D. and Suttie, J. W. (1997). Structural features of the kringledomain determine the intracellular degradation of under-gamma-carboxylatedprothrombin: studies of chimeric rat/human prothrombin. Proc. Natl. Acad. Sci.USA 94, 13654-13660.

Zardoya, R., Cao, Y., Hasegawa, M. and Meyer, A. (1998). Searching for theclosest living relative(s) of tetrapods through evolutionary analysis ofmitochondrial and nuclear data. Mol. Biol. Evol. 15, 506-517.

3728

RESEARCH ARTICLE Journal of Experimental Biology (2015) 218, 3717-3728 doi:10.1242/jeb.125260

Journal

ofEx

perim

entalB

iology