Transposable Element Lab Report

Isabella RoigBIO 356-001H4 March 2015

Dr. Walters-Conte & Hongmei MaPartners: Jordyn Giannone and Meaghan Cuddy

Abstract:An experiment was conducted to determine the use of CanSINEs as identification

markers to distinguish species and by extension create phylogenetic maps. Transposable

Elements are sequences of DNA that have the ability to move to new sites in the genome and are

used as identification markers of species. SINEs are a subclass of retrotransposon and are found

in most Eukaryotic organisms. CanSINEs at eight loci were examined for 24 breeds of dogs.

Primers were designed for each locus and tested using control DNA, Boxer DNA, and Poodle

DNA. Each SINE at a particular locus was identified as being either Boxer+/ Poodle- or Boxer-/

Poodle+. Successfully tested primers were used to test the 24 unknown dog breed DNAs. The

results were inconclusive. CanSINEs can be used to connected dogs to their breeds and find

similarities between breeds, but cannot be used to identify breeds.

Introduction:Transposable Elements are often described as “jumping genes” because they are

sequences of DNA that have the ability to move to new sites in the genome. Transposable

Elements move about the genome in two ways: transposon method, which is a cut and paste

method without a RNA intermediate, and a retrotransposons method, which is transcription from

DNA to RNA and reverse transcribed to DNA and inserted into a new position (Kramerov and

Vassetzsky, 2011).

Retrotransposons have a few subclasses, one of which is Short Interspersed Elements

(SINEs). SINEs are distinguished from other Transposable Elements because they are

transcribed by RNA polymerase III and contain a polymerase III promoter in their sequence.

SINEs are found in most eukaryotic organisms and their size ranges from 100 to 600bp. The

genomes can contains many hundreds of thousands copies of SINEs (Kramerov and Vassetzsky,

2011). SINEs are connected with unequal recombination and genetic diseases and known to be

revealing evolutionary markers over genomes of species (Walters-Conte and Johnson, et all,

2011).

Certain types of Transposable Elements can be seen across different species linking them

together. All primates, including humans, have “Alu” sequences, a type of Transposable

Element. Alu sequences make up 10% of the human genome (Wang and Kirkness, 2005). Alu

sequences that are found in homologous regions of the genome are used to demonstrate how

species are related. It is possible to draw this connection because Transposable Elements either

remain in the same region or are inserted elsewhere on the genome. Insertions that persist can

define a certain population and be used to identify them. This identity can be compared to other

species with the same Transposable Elements at homologous or non-homologous regions to

determine their evolutionary relationship.

CanSINEs are a family of SINEs only found in Carnivora. The recent publication of the

entire genome of the domestic dog and cat has revealed much more evolutionary insight by

looking at CanSINEs. Because the genome of the domestic dog is available, DNA extraction is

easy, and they are more evolutionarily developed than the rat or the fruit fly, dogs are

particularly useful for genetic studies. Entire genome sequences are useful references for

analytical comparison. Because of this knowledge of CanSINE location in coding and noncoding

regions that are specific to population, lineage, or species, CanSINEs can be used to determine

domestic breeds of dogs, in addition to species, genus, familial, and suborder relationship to

other members of Carnivora (Walters-Conte and Johnson, et all, 2011).

In 2005, Wang and Kirkness performed an experiment after which ours in modeled. They

noted the evolutionary mapping possibility based on identifying and mapping SINEs,

Specifically they looked the CanSINEs in Boxers and Poodles to determine their linkage and the

identification of other unknowns as Boxer or Poodle. (Wang and Kirkness, 2005) In this

experiment, CanSINEs were observed to determine if they could be used to identify breeds. Both

the Poodle and Boxer genome has been published in their entirety. Primers were made to

observed SINEs that were either only available in the poodle or in the boxer. These two genomes

were our control and test to see which breeds were related to the poodle or the boxer. Based on

the results of the final primer test on an agarose gel, the SINEs should determine the breed and

then the breed will be reveal after the gel is visualized to determine if the experiment was

successful or not. First, PCR primers were designed for the regions of interest. Primers were

designed by using NCBI and the UCSC genome browser. DNA was extracted from buccal swabs

collected from dogs belonging to faculty of the Biology Department at American University. The

primers were designed to amplify loci that contained or did not contain SINE insertion in the

genome of the domestic dog. The designed primers were tested on control DNA to determine

their ability to work at standard conditions. If the primers were successful, they were used on an

agarose gel the next week with the DNA of the unknown dogs of the faculty. If CanSINEs are

evolutionary markers, then dogs of the same breed will have SINEs at certain homologous loci

and therefore SINEs can be used to identify breed.

Materials & Methods:

For Boxer+/Poodle – Regions:On the genome tab of the UCSC genome browser, change the group to mammal, genome

to dog, and assembly to July 2004. In the search bar, enter the coordinates of the putative SINE

region and press submit. Click “Browser” on the highest match. Look at the “Repeating

Elements by Repeat Masker” track. Confirm that there is a bar in the SINE category. Click on

the SINE bar. Click on the link that says “View DNA for this feature (canFam1/Dog)”. In the

options, add 100 extra base pairs to each side. Also check the “Mask Repeats” box with the “to

lower case” option set. Then press “get DNA”.

For Poodle+/Boxer- Regions:Use the GenBank accession number on the nucleotide database in NCBI to get the

GenBank record for that region. At the bottom of the page is the entire sequence entry. On the

genome tab of the UCSC genome browser and change the group to mammal, genome to dog, and

assembly to July 2005. Enter the sequence retrieved from NCBI in the BLAT tab. Get the results

for the highest match. Click the PCR tab on the ucsc genome browser. Paste sequences into the

boxes for the forward and reverse primers. Once hitting submit, only one result should appear,

meaning the primers are good and specific.

DNA Extraction: Sterile tweezers were used to transfer the buccal swab to the 1.5ml tube containing 500µl

of 10% Chelex solution and squish it into the solution. The tube was vortexed to completely

suspend the cells in the Chelex solution. The cell sample was heated for 20 minutes on a heat

block at 95°C. Sterile tweezers were used to remove and discard the swab from the tube. The

tube was spun in the microcentrifuge for 1 minute. The supernatant was transferred to a new

1.5ml tube using a 200µl pipette. The DNA in the sample was measured using the Nanovue

spectrophotometer. 2µl of the sample was put on the Nanovue. After the sample is read, the rest

of the sample was stored in the freezer until the next week.

Two weeks later, a PCR was run to test the designed primers to see if they work at

standard conditions. Primers were pre-diluted to 10µM stocks. In each of the ready-bead PCR

tubes, 2µL of the primer (both forward and reverse primers) were added, as well as 2µL of DNA

and 21µL of sterile H2O. 1% agarose gels were pre-made by the lab instructor. 10µL of the PCR

product was added to a microtiter plate that contained loading dye and mixed up and down using

a pipette. 10µL of the PCR product was added to the appropriate well in the gel. The gel was run

for minutes at 100mV and then visualized under a UV box.

The following week, PCR was run using the designed primers. The designed primers

were used on the sample DNA that was extracted a few weeks ago. Load 10µl of each PCR

product into an agarose gel. 10µl was pipetted into the microtiter plate that contained 1µl of the

loading dye in each well. The PCR product and the loading dye was pipetted up and down to mix

it. The mixture was pipetted into a well on the gel. The gel was run at 80V for 40 minutes. The

gel was then visualized under a UV light box. The data was analyzed to determine which loci

were SINE positive or SINE negative.

Results:

Table 1: List of Primer Sequences of Designed Primer

Primer Name Primer Sequence B2 F CCATAGTGTCTACATATCAAGAATACTACCACCGB2 R AAGAGTCAACCAGAAAGAGATGAAGGGG

Table 1 presents the primers that were designed to amplify SINEs at the B2 locus. The SINE is

Boxer - and Poodle +. The table shows the sequence of the forward and reverse primers used to

amplify the SINE.

Figure 1: Visualization of Agarose Gel of Designed Primer Test of Controls

Figure 1 shows the visualization of the gel that was run with primers testing the control DNA.

The primers that we designed were run in Wells 5, 6, and 7. There is a band in Well 5 and Well 6

and no band in Well 7.

Table 2: Data of Designed Primer Test of Controls

Primer

Name

Well Numbe

rSample Clean Product

ProducedExpected Size

B2 5 Control Yes- strong band 312bp

B2 6 Poodle Yes- strong band 312bp

B2 7 Boxer No 107bpTable 2 displays what primer and sample were run in which well of the agarose gel. The control

and poodle DNA both displayed a band at the same bp region. The poodle DNA did display a

band at all.

Table 3: Data of Primer Test Using Unknown Dog Breed Identities

Primer Name Order Sample

SINE Status

B2 1 1 -B2 2 5 +B2 3 6 +B2 4 7 +B2 5 8 UnknownB2 6 9 -B2 7 10 +

Table 3 presents the outcome of the designed primers with the unknown dog DNA at the B2

locus and whether or not the sample was positive or negative for the SINE at the locus. Samples

5, 6, 7, and 10 were SINE+ at the B2 locus. Samples 1 and 6 were SINE – at the B2 locus.

Table 4: Testing for SINE+ or SINE- of Each Dog Breed and Every Loci

Wed PM

Thurs AM

Thurs Noon

Thurs PM

Name BreedTube ID B2 P1 P2 B3 P5 P6 B4 B8

Nellie Boxer 1 -/- np np np np np np npDexter Lee Boxer 2 -/- -/- -/- smea

r np ? +/+

MidgeStandard Poodle 3 -/- +/+ -/- np +/+ ? np

OrionMinitaure Poddle 4 +/-

KoKo Toy Poodle 5 +/+ np np np +/+ np -/- +/-

SamBasset Hound/ Beagle 6 +/+ np np +/+ np np -/- -/-

AmicusFlat-Coated Retriever 7 +/+ np np np np np -/- np

Tilly Schnauzer Mix 8smea

r np np np np +/+ np np

TuckerHound/Beagle Mix 9 -/- np np np +/+ np np np

TikiriDoberman Pinscher 10 +/+ np np np +/+ np np np

Phoebe Labradoodle 11 np np np np +/+ np -/- +/+Zoey Labradoodle 12 np np np np np np -/- +/+Bailey Catahoula 13 np np np np +/+ np -/- +/-

Leopard

Googli

Wheaton Terrier Dachsund 14

npnp

np np +/+np -/- +/+

Saluki Beagle Shepard 15 np

ApolloHusky Shepard Mix 16 np

SamsonHound Retriver Mix 17 np np np np -/- np np np

Que

Am. Staf Ter/Bulldog Mix 18 np -/- np -/- np

Cockapoo Cockapoo 19 +/-Lucky Boxer Mix 20 np np np np +/+ +/+ -/- +/-

ZoeyGerman Shepard 21

ZarGerman Shepard 22 np np np np +/- +/+ -/- +/-

SnickersLab Mix Mystery 23 np np np +/+ +/+ +/+ -/- +/+

Carlini Dog Mix 24 np np np np +/- +/+ -/- +/-

SINE - size 107 bp

~120 bp

~125 bp 80bp 90bp

~200 bp 83bp

~75 bp

SINE + size 321 bp

404 bp

374 bp

300 bp

~350 bp

683 bp

~340 bp

304 bp

Table 4 presents the data collected from each class of each sample test for SINE+ or SINE- at

each locus. Np denotes no product, or no amplification. +/+ signifies SINE is present on both

chromosomes. -/- signifies SINE is absent on both chromosomes. +/- SINE is heterozygous,

which means it is present on one of the two diploid chromosomes and absent on the other. An

empty box denotes a sample that was not tested. For most breeds, P1, P2, and P6 showed no

product. P1 was Boxer – and Poodle+. P2 and B2 appear to be negative for both the boxer and

the poodle. Heterozygous SINE products are seen in multiple breeds at the B8 locus.

Figure 2: Visualization of Agarose Gel of Sample at Locus B8 Using Designed Primers.

Figure 2 shows an example gel of how the banding pattern could have looked at locus B8 for the

samples. This gel does not correlate with specific data of this experiment, but it is to show how

the gel turned out for the rest of the samples at the eight loci.

Discussion:The purpose of this experiment was to investigate the SINEs at different loci of different

breeds of dog against the known breeds who are either SINE+ or SINE- at that particular loci to

determine if CanSINEs can be used to identify domestic dog breeds. Boxer and poodle genomes

were used as controls. Eight different locus were tested: B2, P1, P2, B3, P5, P6, B4, and B8. 24

different dogs were tested. Two of which were boxers and 3 were poodles of different sizes.

Our group tested the B2 locus. Other loci data was collected from other groups and other

lab classes and compiled to create the data in Table 4. The primers that were designed are noted

in Table 1. As seen in Figure 1, the designed primers were successful because the SINE at locus

B2 is positive (present) in poodles and negative (absent) in boxers. Well 5 is the designed

primers run with a control DNA. Well 6 is the designed primers run with Boxer DNA. Both Well

5 and 6 show a strong band around 312bp which is the size expected for SINE+. Well 7 is the

designed primers run with Poodle DNA. Well78 did not show a band, signifying there was

nothing to be amplified at that location, meaning it was SINE-. Because the testing of the

designed primers was successful, they could be used to test the unknown dog breed DNAs.

For the next part of the experiment, the designed primers were used to test the DNA

collected from the dogs of the faculty. In Figure 2, an example gel is shown of how the gel

would have looked for the all the samples at the loci they tested for.

Table 3 identifies which samples were tested with our group’s primers for the B2 locus.

Samples 5, 6, 7, and 10 were SINE+ at the B2 locus. Samples 1 and 6 were SINE – at the B2

locus. Using Table 4, the breed of each sample can be identified to determine the success of the

findings displayed in Table 3. Sample 1 was SINE- and a boxer breed, which is the expected

outcome. Based on the control test of the primers, Boxers are SINE+ at locus B2. Sample 5 was

SINE+ and a poodle breed, which is in line with the expected outcome. Based on the control test

of the primers, Poodles are SINE+ at locus B2. There was a smear on sample 8, so the results

could not be read. Sample 6 was a Basset Hound/Beagle mix and sample 7 was a Flat-Coated

Retriever. Both breeds are SINE+ at the B2 locus. This can indicate that samples 6 and 7 are

more closely related to poodles than to boxers.

Looking at Table 4, there are many loci that had no product for many of the samples.

This can indicate that the primers were not exact enough and testing was not successful. Looking

at the lack of amplification seen across all the data, the data from this experiment is inconclusive.

From the data in Table 4 that was collected from other groups, being SINE+ or SINE – is

independent of breed. No conclusions can be drawn at either P1 or P2 loci because too many

samples had no product or no amplification seen. P6 and B4 appear to be random in that there is

no pattern to which breeds are SINE+ or SINE- at either of the two loci. B8 is the most telling of

the loci. At the B8 locus, SINE-, SINE+, and SINE +/- are seen. Because all three genotype are

seen, it is possible to draw conclusions about the evolutionary path of these breeds and the

closeness of relation to one another. No definite conclusions, however, can be draw because it is

only one locus and there needs to be other parts of the genome tested to compare and contrast to

make assumptions on identity and evolutionary paths. P5 appears to be sorted by breed. All

samples that are a poodle breed or poodle mix are SINE+. The B3 locus data is interesting

because no product was found for hardly any breeds except for sample 6, a Basset Hound/Beagle

mix, and sample 23, a Labrador mix mystery, where both were both SINE+ on at least one

chromosome. A possible conclusion draw from this data of this locus is that these breeds are

more related to each other than to any other of the tested breeds of the is experiment.

Overall the data from this experiment is very inconclusive. The conclusion that can be

made from this experiment is that CanSINEs are not well enough understood in function and

significance to identify breeds by their absence or presence. CanSINEs can be used to support

speciation from other breeds and find correlations between breeds. CanSINEs are useful but

cannot be used at determinants in identification of breeds or definite factors when building

phylogenetic trees. CanSINEs are a subclass of SINEs. The usefulness of SINEs was not tested

in this experiment, it was CanSINEs. The information stated in the introduction is not negated by

the findings of this experiment. SINEs are still hereditary and can be used as identification

markers between species. SINEs are informative genetic markers.

Discrepancies in the data and what was expected can be attributed to bad primers and

possible bad buccal swabs. The primers could not be exact enough and therefore not amplify the

SINE correctly. The DNA extraction from the buccal swabs of the dogs could have been done

incorrectly, or not enough DNA was extracted. To determine if CanSINEs can be used as

identification markers or not indefinitely, the experiment should be repeated. As an initial test of

the usefulness of CanSINEs, mixed breeds should not be used because their pedigree cannot be

surely identified. Repeated this experiment would ensure the conclusion of the usefulness of

CanSINEs is determining identity and evolutionary relationships.

References:

Walters-Conte, K., Salcedo, T. Transposable Element Dog Laboratory 2, 2.5, 5, & 6 Handouts. (2015)

Kramerov, D. A., & Vassetzky, N. S. (2011). Origin and evolution of SINEs in eukaryotic genomes. Heredity, 107(6), 487–495. doi:10.1038/hdy.2011.43

Walters-Conte, K. B., Johnson, D. L. E., Allard, M. W., & Pecon-Slattery, J. (2011). Carnivore-Specific SINEs (Can-SINEs): Distribution, Evolution, and Genomic Impact. Journal of Heredity, 102(Suppl 1), S2–S10. doi:10.1093/jhered/esr051

Wang, W., & Kirkness, E. F. (2005). Short interspersed elements (SINEs) are a major source of canine genomic diversity. Genome Research, 15(12), 1798–1808. doi:10.1101/gr.3765505