a synthetic calvin cycle enables autotrophic growth in yeast · 4 73. arabinose 5.an important step...
Post on 21-Jun-2020
0 Views
Preview:
TRANSCRIPT
1
A synthetic Calvin cycle enables autotrophic growth in yeast 1
2
Thomas Gassler1,2, Michael Sauer1,2,3, Brigitte Gasser1,2, Diethard Mattanovich1,2*, Matthias 3
G. Steiger1,2 4
1) Department of Biotechnology, BOKU-VIBT, University of Natural Resources and 5
Life Sciences Vienna, Vienna, Austria 6
2) Austrian Centre of Industrial Biotechnology (ACIB), Vienna, Austria 7
3) CD-Laboratory for Biotechnology of Glycerol, Department of Biotechnology, 8
BOKU-VIBT, University of Natural Resources and Life Sciences Vienna, Austria 9
10
*Corresponding author 11
Prof. Dr. Diethard Mattanovich 12
Department of Biotechnology 13
University of Natural Resources and Life Sciences, Vienna 14
Muthgasse 18 15
1190 Vienna, Austria 16
diethard.mattanovich@boku.ac.at 17
18
Email addresses 19
D. Mattanovich diethard.mattanovich@boku.ac.at 20
T. Gassler thomas.gassler@boku.ac.at 21
M. Sauer michael.sauer@boku.ac.at 22
B. Gasser brigitte.gasser@boku.ac.at 23
M. G. Steiger matthias.steiger@boku.ac.at 24
25
26
27
28
29
30
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
2
Graphical Abstract 31
32
Abstract 33
The methylotrophic yeast Pichia pastoris is frequently used for heterologous protein 34
production and it assimilates methanol efficiently via the xylulose-5-phosphate pathway. This 35
pathway is entirely localized in the peroxisomes and has striking similarities to the Calvin-36
Benson-Bassham (CBB) cycle, which is used by a plethora of organisms like plants to 37
assimilate CO2 and is likewise compartmentalized in chloroplasts. By metabolic engineering 38
the methanol assimilation pathway of P. pastoris was re-wired to a CO2 fixation pathway 39
resembling the CBB cycle. This new yeast strain efficiently assimilates CO2 into biomass and 40
utilizes it as its sole carbon source, which changes the lifestyle from heterotrophic to 41
autotrophic. 42
In total eight genes, including genes encoding for RuBisCO and phosphoribulokinase, were 43
integrated into the genome of P. pastoris, while three endogenous genes were deleted to 44
block methanol assimilation. The enzymes necessary for the synthetic CBB cycle were 45
targeted to the peroxisome. Methanol oxidation, which yields NADH, is employed for energy 46
generation defining the lifestyle as chemoorganoautotrophic. This work demonstrates that the 47
lifestyle of an organism can be changed from chemoorganoheterotrophic to 48
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
3
chemoorganoautotrophic by metabolic engineering. The resulting strain can grow 49
exponentially and perform multiple cell doublings on CO2 as sole carbon source with a µmax 50
of 0.008 h-1. 51
Keywords 52
Pichia pastoris, synthetic biology, CO2 assimilation, Calvin cycle, CBB cycle, RuBisCO 53
54
1. Introduction 55
Autotrophic organisms have the capability to use inorganic CO2 as a carbon source to build 56
up their biomass. Inorganic carbon assimilation is essential for a closed carbon cycle on earth 57
and thus supplying heterotrophic organisms with organic carbon sources. The excessive use 58
of fossil resources by mankind led to a global imbalance of the carbon cycle leading to 59
increasing atmospheric CO2 concentrations and to global warming. Finding new ways to 60
reduce atmospheric CO2 requires a better understanding and utilization of the metabolic 61
pathways for assimilation of CO2 into biomass. Biotechnological production hosts are almost 62
exclusively heterotrophs and use feedstocks which compete with feed or food production. 63
One of the key tasks for creating sustainable biotechnological processes in the near future is 64
to use CO2 as a carbon feedstock and thereby reducing the atmospheric levels of this 65
greenhouse gas. The Calvin-Benson-Bassham (CBB) cycle 1 is the predominant of the six 66
naturally occurring CO2 fixation pathways 2,3. Its key enzyme ribulose-1,5-bisphosphate 67
carboxylase/oxygenase (RuBisCO) is considered to be the most abundant enzyme found in 68
the biosphere and fixates around 90% of the inorganic carbon converted into biomass 4. 69
Engineering efforts were made to equip heterotrophic model organisms with CBB cycle 70
genes including Escherichia coli and Saccharomyces cerevisiae. Expressing RuBisCO and 71
phosphoribulokinase (Prk) in E. coli led to a decreased exhaust of CO2 when growing on 72
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
4
arabinose 5. An important step was achieved by splitting the carbon metabolism of E. coli 73
into modular subunits: one providing energy and reducing equivalents in the form of ATP 74
and NADH, and the other module carrying out the carbon assimilation. As an energy source 75
Antonovsky and coworkers used pyruvate to fuel a synthetic CBB cycle in E. coli enabling 76
“hemiautotrophic” growth 6. The term hemiautotrophic was introduced because only part of 77
the carbon assimilated originated from CO2 and the rest came from pyruvate. In a follow-up 78
study it was shown which mutations E. coli requires to stabilize the metabolic network in 79
order to host a non-native metabolic pathway as the CBB cycle 7. Implementing parts of the 80
CBB cycle in the yeast species S. cerevisiae 8–11 increased yields in ethanol production by 81
using CO2 as an additional electron acceptor to reoxidize NADH. In a recent study, the 82
assimilatory pathway of Methylobacterium extorquens AM1 was blocked by deleting three 83
native genes (ccrΔ, glyAΔ and ftfLΔ). RuBisCO and Prk were overexpressed, resulting in a 84
strain that can incorporate CO2 into biomass using methanol as energy source, but no 85
continuous growth on CO2 as sole carbon source was observed 12. So far, it was not possible 86
to construct a synthetic autotrophic organism which can readily grow on CO2 as a sole carbon 87
source to form its entire biomass. 88
The methylotrophic yeast Pichia pastoris (syn.: Komagataella phaffii) 13,14 is widely used as 89
a production host for heterologous proteins serving both the biopharmaceutical 15 as well as 90
the technical enzyme markets 16. It has gained increased interest as a chassis host for 91
metabolic engineering 17 and as a model organism for studying peroxisome biogenesis 18,19. 92
P. pastoris is capable of a methylotrophic lifestyle enabling it to use the C1 compound 93
methanol as its sole energy and carbon source. After its oxidation to formaldehyde, methanol 94
utilization is split into two branches: in the assimilatory branch methanol is fixated after 95
oxidation to formaldehyde to finally yield phosphosugars needed for biomass generation, 96
while in the dissimilatory pathway energy is produced in the form of NADH. Steps of the 97
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
5
dissimilatory branch are carried out both in the peroxisome and in the cytosol, while the 98
assimilatory branch is entirely localized in peroxisomes 20. Upon growth on methanol, 99
peroxisomes are highly abundant within the cell and methanol utilization pathway associated 100
enzymes are predominately expressed (e.g. alcohol oxidase 1 (Aox1)). Powerful genetic tools 101
including CRISPR/Cas9 mediated techniques are available for P. pastoris 17,21,22 allowing to 102
re-build and integrate entire metabolic pathways into this host without the use of integrative 103
selection markers. In this work, we use P. pastoris as a chassis cell to de novo engineer a 104
synthetic CBB cycle and to test its capability to promote autotrophic growth on CO2. 105
2. Results 106
The xylulose-monophosphate (XuMP) cycle is used as a template to engineer a synthetic 107
Calvin-Benson-Bassham (CBB) cycle into P. pastoris 108
109
Figure 1. Scheme for engineering chemoorganoautotrophy in Pichia pastoris. (a) Wild type P. 110
pastoris uses methanol (MetOH) for biomass generation in the assimilatory branch of the methanol 111
utilization by fixation of formaldehyde (FA) to xylulose-5-phosphate (Xu5P) which is regenerated 112
in the xylulose monophosphate (XuMP) cycle (purple pathway) and as an energy source in the 113
dissimilatory branch (pink pathway) by oxidation to carbon dioxide (CO 2) under formation of 114
NADH. (b) In an engineered strain methanol assimilation is blocked by deletion of 115
dihydroxyacetone synthase (DAS1 and DAS2) and a synthetic CO2 fixation pathway similar to a 116
Calvin-Benson-Bassham (CBB) cycle is integrated. RuBisCO carboxylates ribulose-1,5-117
bisphosphate (RuBP) which is regenerated in the synthetic CBB cycle; abbreviations: alcohol 118
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
6
oxidase (Aox), formaldehyde dehydrogenase (Fld1), S-formylglutathione hydrolase (Fgh1), formate 119
dehydrogenase (Fdh1), ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), 120
dihydroxyacetone (DHA), glyceraldehyde-3-phosphate (GAP), 3-phosphoglycerate (3PGA), 121
glutathione (GSH), ribulose-1,5-bisphosphate (RuBP); A detailed depiction of the two pathways 122
including all involved enzymes is given in Supplementary Figure 1 . 123
124
The methanol assimilation pathway of P. pastoris is entirely localized in peroxisomes and 125
shares high similarity with the CBB cycle 20. In both pathways a C1 molecule is transferred to 126
a sugar phosphate generating a C-C bond. Methanol is oxidized by alcohol oxidase (Aox1 127
and Aox2 in P. pastoris) to formaldehyde. Subsequently, formaldehyde reacts with xylulose-128
5-phosphate (Xu5P) to dihydroxyacetone (DHA) and glyceraldehyde-3-phosphate (GAP) 129
catalyzed by dihydroxyacetone synthase (Das1 and Das2 in P. pastoris). Xu5P is regenerated 130
by pentose phosphate pathway (PPP) enzyme isoforms specifically enriched in peroxisomes 131
upon cultivation on methanol 20. In total, three mole of methanol are converted to one mole of 132
GAP, which can be used for biomass and energy generation. Likewise, in autotroph 133
organisms, CO2 is added to ribulose-1,5-bisphosphate (RuBP) to form 3-phosphoglycerate (3-134
PGA) in a carboxylation reaction catalyzed by RuBisCO. 3-PGA is then phosphorylated and 135
reduced to GAP. Remarkably, the XuMP cycle can be turned into a synthetic CBB cycle by 136
addition of six enzymatic steps (i.e. all biochemical reactions of the CBB cycle present). The 137
overall engineering strategy is visualized in Fig. 1. We considered a peroxisomal 138
compartmentalization of the synthetic CBB cycle as beneficial, comparable to native C1 139
fixation in plant chloroplasts and in the XuMP cycle. To achieve this localization, a C-140
terminal peroxisomal targeting signal (PTS1) 23 was fused to each of the six engineered CBB 141
enzymes. In a second control setup, all six heterologous genes were expressed in the cytosol 142
without a PTS1 signal. The CBB cycle is split into 3 phases: carboxylation, reduction and 143
regeneration 24. For the carboxylation reaction a RuBisCO form II from Thiobacillus 144
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
7
denitrificans was integrated into the genome. The reduction phase to yield the triose 145
phosphates, glyceraldehyde phosphate (GAP) and dihydroxyacetone phosphate (DHAP) was 146
achieved by integration of the genes encoding for phosphoglycerate kinase (PGK1), 147
glyceraldehyde-3-phosphate dehydrogenase (TDH3) from Ogataea polymorpha and 148
triosephosphate isomerase (TPI1) from Ogataea parapolymorpha. The regeneration phase 149
was completed by the addition of TKL1 (encoding transketolase) from O. parapolymorpha 150
and PRK (encoding phosphoribulokinase) from Spinachia oleracea to the five enzymes from 151
the XuMP cycle (Fbp1, Fba1-2, Shb17, Rki1-2, Rpe1-2) already present in P. pastoris. For 152
each molecule of CO2 fixated by this synthetic CBB cycle, 3 molecules of adenosine 153
triphosphate (ATP) and 2 molecules of NADH are required. The energy is provided by 154
methanol oxidation. The oxidation of one mole methanol yields two mole NADH. In order to 155
separate the synthetic fixation machinery of CO2 from energy generation, we blocked the first 156
steps of the methanol assimilatory pathway by deleting Das1 and Das2. To assist RuBisCO 157
folding two molecular chaperones from E. coli (GroEL and GroES) were integrated into the 158
genome 8. Furthermore, AOX1 was deleted to reduce the formation rate of formaldehyde, 159
which can still be formed by AOX2 (encoding alcohol oxidase 2). In a nutshell, to enable a 160
functional CO2 assimilation cycle in P. pastoris, three native genes were deleted and eight 161
heterologous genes were integrated into the genome. Six of these genes are required for a 162
fully functional CBB cycle and are either targeted to the peroxisome or to the cytosol. Two 163
genes encode chaperones and are expressed in the cytosol. We generated these strains (listed 164
in supplementary Table 1) in a three-step transformation procedure by a CRISPR/Cas9 165
mediated workflow for genome engineering in P. pastoris (see Fig. 2). 166
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
8
167
Figure 2. Engineering scheme for generation of P. pastoris strains with a synthetic CBB cycle. 168
(a-b) Plasmid construction: (a) Genes for the proposed synthetic CBB cycle including CBB – 169
specific (green – source are autotroph organisms), non-specific genes (blue – from Ogataea strains) 170
and chaperones (from Escherichia coli) were amplified by PCR (TDH3, PGK1, TPI1 and TKL1), or 171
synthesized (RuBisCO, PRK, GroEL and GroES, codon optimized). The C-terminal PTS1 tag 172
encoding for –SKL was added by PCR if needed. The entire gene names, source organisms and 173
protein identifiers are summarized in Supplementary Table 4. (b) Generation of linear donor DNA 174
templates and single guide RNA (sgRNA) / Cas9 plasmids; (c – e) Homologous recombination 175
(HR) mediated replacement of the native sequences by co – transformation of a linear donor 176
DNA with a sgRNA / Cas9 plasmid; replacement of (c) AOX1 by an expression cassette for TDH3, 177
PRK and PGK1, (d) DAS1 by RuBisCO, GroEL and GroES and (e) DAS2 by TKL1 and TPI1 was 178
done consecutively in three transformation steps and is drawn schematically. The strains lacking 179
one or more heterologous gene were constructed accordingly with altered donor DNA fragments. 180
All strains constructed by this workflow are listed in Supplementary Table 1. 181
182
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
9
Peroxisomal targeting of the CBB cycle leads to a higher growth rate on CO2 compared 183
to a cytosolic localization 184
Strains expressing a cytosolic (CBBc+RuBisCO) and a peroxisomal (CBBp+RuBisCO) 185
version of the CBB cycle were obtained. In order to test the ability of these strains to grow on 186
CO2 as a carbon source, shake flask cultures were carried out in the presence of 5 % (v/v) 187
CO2 (Fig. 3). A strain having the same genetic setup as the CBBp+RuBisCO strain but 188
lacking RuBisCO (CBBpΔRuBisCO) served as a negative control. This strain showed no 189
growth over the entire cultivation phase, whereas the CBBc+RubisCO and CBBp+RuBisCO 190
strains were able to grow (Fig. 3). Furthermore, it was observed that the strains with a 191
peroxisomal CBB pathway (CBBp+RuBisCO) grew significantly faster increasing from 192
0.35 ± 0.00 to 0.8 ± 0.08 g L-1 CDW in 164 hours compared to the strains with a cytosolic 193
CBB cycle, which grew from 0.36 ± 0.02 to 0.5 ± 0.12 g L-1 CDW within the same 194
timeframe. 195
196
Figure 3. Peroxisomal targeting of the CBB pathway leads to increased growth. Cultivation of 197
strains with cytosolic (CBBc+RuBisCO) and peroxisomal (CBBp+RuBisCO) pathway expression; 198
Cell Dry Weight (CDW) values are calculated from OD 600 measurements (correlation: 1 OD600 unit 199
= 0.191 g L-1CDW), for CBBpΔRuBisCO the mean of two technical replicates including single 200
values is shown (blue line plus signs) , for CBBp+RuBisCO (black line) and CBBc+RuBisCO (pink 201
line) the means of at least three biological replicates (independent transformations) with single 202
values (black and pink signs) is shown. 203
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
10
204
This experiment showed that strains expressing a complete CBB cycle can grow in the 205
presence of CO2 and methanol, which indicates that the integrated CBB cycle is functional 206
(Fig. 3). The superior growth behavior of the CBBp+RuBisCO strain confirmed that it is 207
beneficial to compartmentalize the CBB cycle by targeting it to the peroxisome and thereby 208
replacing the native XuMP cycle. As expected the negative control (CBBpΔRuBisCO) did 209
not grow on media containing methanol and CO2. In this strain, the deletion of DAS1 and 210
DAS2 prevents the methanol assimilation capability of P. pastoris and the RuBisCO is 211
missing to complete a full CBB cycle. These results confirm that a deletion of DAS1/DAS2 is 212
sufficient to block the assimilation of methanol into biomass. The transketolase 1 (Tkl1) 213
which is responsible for the conversion of GAP and S7P into R5P and Xu5P is a homolog of 214
Das1 and Das2. Thus, Tkl1 might exhibit also a promiscuous activity for the reaction 215
catalyzed by Das1/Das2, which is the conversion of formaldehyde and Xu5P to GAP and 216
DHAP. However, since CBBpΔRuBisCO were not able to grow when supplemented with 217
methanol, Tkl1 cannot substitute for Das1/Das2. 218
P. pastoris strains expressing a functional CBB cycle in the peroxisome require CO2 for 219
growth and biomass formation 220
In the following experiments the CO2 incorporation characteristics of the strains expressing a 221
peroxisomal CBB cycle (CBBp+RubisCO) together with the negative control strain having a 222
disrupted CBB cycle (CBBpΔRuBisCO) were tested in controlled bioreactor cultivations. 223
After accumulation of biomass in a batch phase on glycerol, CBBp+RuBisCO and 224
CBBpΔRuBisCO cells were fed with CO2 and/or methanol. Thereby, two different CO2 225
feeding regimes were used: in regime A, a set of both strains were first fed with methanol 226
only and 0% (v/v) CO2 in the inlet gas and after 135 hours the CO2 was increased to 5 % 227
(v/v). In regime B, a set of both strains was fed first with methanol and 5% CO2 and switched 228
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
11
to 0% CO2 after 135 hours (Fig. 4). The bioreactors were operated at a high stirring- and 229
gasflow- rate (1000 rpm and 35 sL h-1 respectively) to blow out CO2 formed by methanol 230
oxidation. With these experimental settings, the CO2 concentration measured at the off-gas 231
analyzer was below the detection limit of 0.1 % (v/v) also in cultures oxidizing methanol. 232
Thus, a defined CO2 supply of the cells was controlled by changing the CO2 content of the 233
inlet gas flow. 234
235
Figure 4. Growth in enginered CBBp+RuBisCO (A and B) depends on the supply of CO 2 as a 236
carbon source. Biomass formation in engineered CBBp+RuBisCO (solid (regime A) and dashed 237
(regime B) black line) is shown compared to the control strain, which lack RuBisCO, GroEL and 238
GroES (CBBpΔRuBisCO solid (A) and dashed (B) blue line. Cells were cultivated in batch phase on 239
16.0 g L-1 glycerol to a CDW of ~ 10 g L-1 and then induced with 0.5 % methanol (v/v) and 1 % 240
CO2, afterwards methanol concentration was adjusted to 1 % (v/v) (arrows). After induction only 241
CBBp+RuBisCO B and CBBpΔRuBisCO B were co-fed with 5 % CO2. After 3 days and occurrence 242
of pronounced growth, the CO2 supply was set to 0 % for CBBp+RuBisCO B and 243
CBBpΔRuBisCO B and increased to 5 % for CBBp+RuBisCO A and CBBpΔRuBisCO A. Cell Dry 244
Weight (CDW) values were calculated from OD600 measurements (correlation: 1 OD600 unit = 0.191 245
g L-1 CDW). 246
247
The two strains (CBBp+RuBisCO and CBBpΔRuBisCO) growing under the CO2 feeding 248
regime A (Fig. 4) did not grow without the addition of CO2. After commencing to feed with 249
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
12
CO2 the strain CBBp+RuBisCO began to grow with a biomass formation rate of 0.029 g L-250
1 h-1 CDW. No growth was detected for the control strain CBBpΔRuBisCO. In regime B (Fig. 251
4), where CO2 is fed in the first phase, the CBBp+RuBisCO strain could grow with a rate of 252
0.036 g L-1 h-1 CDW and again no growth was detected for the negative control strain 253
CBBpΔRuBisCO. In the second phase of this cultivation, where no CO2 was present in the 254
inlet gas supply, no growth was detected for both strains. These results demonstrate that the 255
CBBp+RuBisCO strains can take up and grow on CO2 as a carbon source and thus have a 256
functional CO2 assimilation pathway. As energy source methanol can be oxidized by all 257
strains (Supplementary Fig. 2). The control strains (CBBpΔRuBisCO) are lacking the 258
essential step of the CBB cycle catalyzed by RuBisCO and thus the energy generated by 259
methanol oxidation can only be used to sustain the energy requirements of cellular 260
maintenance. In accordance, the methanol oxidation rate in CBBpΔRuBisCO strains with 261
0.027 g (MetOH) g (CDW)-1 h-1 was lower compared to CBBp+RuBisCO strains which have 262
a methanol oxidation rate of 0.046 g (MetOH) g (CDW)-1 h-1 (Supplementary Fig. 2). The 263
CBBp+RuBisCO strains only grew in the presence of both methanol and CO2. Even after a 264
prolonged period on methanol as an energy carrier cells could start growing again, when CO2 265
is present in the inlet gas. Taken together these data demonstrate that the growth of the 266
engineered strains expressing a synthetic CBB cycle in the peroxisomes of P. pastoris is 267
dependent on the supply of CO2 as carbon source. 268
Incorporation of CO2 into biomass is verified by 13C labelling 269
The dependency of CBBp+RuBisCO cells on the supply of gaseous CO2 for growth was 270
shown in the previous experiment. However, to obtain further evidence that CO2 is taken up 271
and incorporated into biomass, a study in which the labelling of biomass with 13C and 12C is 272
measured by Elemental Analysis - Isotope Ratio Mass Spectrometry (EA-IRMS) was 273
designed. The biomass of the engineered cells (CBBp+RuBisCO and CBBpΔRuBisCO) was 274
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
13
enriched with 13C carbon by batch cultivation on minimal medium containing fully labelled 275
13C glycerol as the sole carbon source (Fig. 5 a). The 13C content in the biomass samples was 276
measured by EA-IRMS. After the batch phase, the 13C enrichment reached 95 ± 0.5 % for the 277
cultivation with CBBpΔRuBisCO and 97 ± 0.3 % for the CBBp+RuBisCO (Fig. 5 c). 100% 278
13C labelling cannot be reached, due to 12C carried over from the inoculum and the trace 12C 279
contamination of the utilized 13C glycerol (13C enrichment >99 %). After the glycerol was 280
consumed, the feeding regime was shifted to gaseous CO2 with a natural isotopologue 281
distribution (98.901 12C, 1.109 % 13C) and to methanol either with a natural isotopologue 282
distribution or with 13C enrichment (>99 % 13C). 283
284
Figure 5. Labelling of engineered P. pastoris cells with 13C glycerol and 12C carbon dioxide. (a) 285
CBBpΔRuBisCO and CBBp+RuBisCO (three technical replicates) cells were enriched for 13C by 286
cultivation on fully labelled 13C glycerol as the sole carbon source to around 8.0 g L-1 CDW. White-287
to-black color schematically indicates the 13C [%] of the biomass; (b) After the batch phase the 288
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
14
cells were fed with methanol (0.5 -1.0 % (v/v) and 5 % CO2 which led to growth in 289
CBBp+RuBisCO and no growth for the CBBpΔRuBisCO. 13C methanol was used for two reactors 290
containing CBBp+RuBisCO (black) and one reactor CBBpΔRuBisCO (blue), while 12C methanol 291
was used for one reactor with CBBp+RuBisCO (pink). Incorporation of 12CO2 leads to a decrease of 292
the total 13C content in the biomass. (c – d) Bar charts show total 13C content after the batch phase 293
(45 h) (c) and after 158 h of cultivation (d), open bars show calculated values and filled bars show 294
measured values obtained by EA-IRMS (error bars show s.e.m and for calculated values CDW 295
s.e.m. was included). 296
297
As expected, CBBp+RuBisCO strains grew under the conditions with a mean biomass 298
formation rate of 0.040 ± 0.003 g L-1 h-1 CDW, whereas CBBpΔRuBisCO strains showed no 299
growth but still consumed methanol. During growth on CO2 and methanol the cells carried 300
out approximately one cell doubling. Growth of the CBBp+RuBisCO strain was 301
accompanied with a reduction of the 13C content in the biomass (Fig. 5 d). After 158 hours 302
the 13C labelling content of the CBBp+RuBisCO fed with 12CO2 and 13C methanol reached 303
52 ± 0.3% or 48 ± 0.2% in a technical replicate. These data matched with the predicted values 304
based on the measurement of accumulated biomass. The non-growing CBBpΔRuBisCO 305
showed no change in the 13C labelling content over the entire cultivation period. In the fourth 306
experiment, the CBBp+RuBisCO was cultivated with 12CO2 and 12C methanol. Also in this 307
case the 13C labelling content decreased according to predicted values based on the biomass 308
measurements. All values obtained in this experiment are shown in Supplementary Table 2. 309
These data show that the carbon coming from CO2 is incorporated into the biomass of a strain 310
expressing a functional CBB cycle. The carbon from methanol is oxidized to CO2, but due to 311
the high gas-flow rate, it is efficiently removed from the bioreactor. The negative control 312
strain (CBBpΔRuBisCO), which can oxidize methanol but cannot incorporate CO2 into the 313
biomass, showed consequently no change in the overall 13C labelling pattern. Taken together 314
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
15
these data confirm that a P. pastoris strain containing a functional CBB cycle can utilize CO2 315
as a sole carbon source and methanol as energy source. Per definitionem the lifestyle of this 316
strain can be described as chemoorganoautotrophic. 317
Multiple cell doublings are possible by CBBp+RuBisCO strains using CO2 as the sole 318
carbon source 319
In order to show that the chemoorganoautotrophic lifestyle of the engineered 320
CBBp+RuBisCO can be maintained for multiple cell doublings, the strain was inoculated 321
with a low cell density of 0.2 g L-1 CDW in a bioreactor and cultivated for 470 hours with a 322
constant supply of methanol and CO2. 323
324
Figure 6. Bioreactor cultivation of CBBp+RuBisCO and CBBpΔRuBisCO strains inoculated at 325
low cell density and grown in the presence of CO2. During cultivation, cells were fed with 5 % 326
CO2 and methanol. Values for a single cultivation are shown for CBBpΔRuBisCO cells. For 327
CBBp+RuBisCO cells (a - black, b - orange and c - green) CDW values of three biological 328
replicates are shown. The insert shows the logarithmic mean CDW value of these three individual 329
clones in purple (red dotted line shows linear fitting). 330
331
The growth profile is shown in Fig. 6. After induction, the cells quickly started to grow with 332
an initial growth rate of µ = 0.020 ± 0.0014 h-1 in the first 20 h after inoculation. In the 333
following the growth was reduced, but a continuous exponential growth phase between 100 334
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
16
up to 235 hours with a µ of 0.008 ± 0.0001 h-1 and a doubling time of 92 ± 1.7 h was 335
observed. The higher initial growth rate could be attributed to the utilization of intracellular 336
storage compounds, enzymes and metabolites which were accumulated during growth on the 337
pre-medium. 338
Therefore, the growth rate achieved in the prolonged exponential phase is determined as the 339
µmax of the culture under the given batch conditions. Over the entire observed 450 h of 340
cultivation the cells performed a mean of 4.3 cell doublings. These data show that the 341
engineered CBBp+RuBisCO strain can perform multiple cell doublings growing with a 342
chemoorganoautotrophic lifestyle. The growth performance of the strains presented here is 343
comparable to autotrophic organisms (Supplementary Table 3). 344
3. Conclusion 345
In this work, we reengineer yeast metabolism to enable a synthetic chemoorganoautotrophic 346
lifestyle. Following a rational engineering strategy, a synthetic CBB cycle was introduced 347
into the methylotrophic yeast P. pastoris. This enables the cell to utilize CO2 as a carbon 348
source and to grow as an autotrophic organism. By splitting the metabolism into an energy 349
generation module and a carbon fixation module, it is possible to decouple energy generation 350
from carbon fixation 6,12. This modular design is crucial to demonstrate CO2 fixation by the 351
engineered P. pastoris strains. In our design, methanol is used as an electron donor and is 352
oxidized via formaldehyde to CO2 and NADH, which defines the lifestyle as 353
chemoorganoautotrophic. Via the respiratory chain ATP is generated. The assimilatory 354
pathway for methanol was blocked by deleting DAS1 and DAS2. The obtained strain has the 355
capability to perform multiple cell doublings on CO2 as sole carbon source. Our work 356
demonstrates that the lifestyle of an organism can be switched from a 357
chemoorganoheterotroph to a chemoorganoautotroph by metabolic engineering. 358
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
17
The synthetic CBB cycle is localized to the peroxisomes by targeting of the enzymes via 359
PTS1 signals. This peroxisomal localization of the pathway enables superior growth on CO2 360
compared to a cytosolic localization. In contrast to E. coli, containing a cytosolic CBB 361
pathway 6, no laboratory evolution was necessary to enable a functional CBB cycle. 362
Engineering a CBB cycle into the yeast S. cerevisiae was shown to enable CO2 incorporation 363
into ethanol but not into biomass 8. By supplementing the native methanol utilization pathway 364
of P. pastoris, compartmentalization of the entire synthetic CBB cycle into the peroxisome 365
was achieved, which can explain why CO2 fixation in P. pastoris can be achieved 366
successfully, whereas it remains more challenging in other microorganisms. Thus P. pastoris 367
is a promising chassis cell to incorporate and test CO2 fixation pathways in vivo including 368
synthetic pathways like the malonyl-CoA-oxaloacetate-glyoxylate (MOG) pathway 25 or the 369
crotonyl–coenzyme A (CoA)/ethylmalonyl-CoA/hydroxybutyryl-CoA (CETCH) cycle 26. 370
371
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
18
4. Materials and methods 372
Plasmid construction 373
All expression cassettes and sgRNA / hCas9 plasmids were constructed by Golden Gate 374
cloning 22,27,28. Three native genes of P. pastoris (AOX1, DAS1 and DAS2) were replaced by 375
the coding sequences of the genes listed in Supplementary Table 4. A CRISPR/Cas9 376
mediated homologous recombination (HR) directed system was used to construct the strains 377
29. Flanking regions needed for replacing the CDSs of AOX1, DAS1 and DAS2 were amplified 378
from CBS7435 wt genomic DNA (gDNA) (Promega, Wizard® Genomic DNA Purification 379
Kit) by PCR (NEB, Q5® High-Fidelity DNA Polymerase). The other promoters (PALD4, 380
PFDH1, PSHB17, PPDC1 and PRPP1B) and terminators (TIDP1, TRPB1t, TRPS2t, TRPS3t and TRPBS17Bt) 381
were prepared accordingly and derived from genomic DNA of strain CBS7435 382
(Supplementary Table 5). CDSs of TDH3 and PGK1 were amplified from gDNA from 383
Ogataea polymporpha (CBS 4732) and TKL1 and TPI1 from gDNA from Ogataea 384
parapolymorpha (CBS 11895) according to the procedure described above and a C-terminal 385
peroxisome targeting signal 1 (PTS1) 23encoding for SKL was added by amplification with 386
primers carrying the additional nucleotides. The sequences encoding Prk (Spinacia oleracea), 387
RuBisCO - cbbM (Thiobacillus denitrificans) and the chaperones GroEL and GroES (E. coli) 388
were codon optimized (GeneArt, Regensburg, Germany). Final plasmids were digested with 389
BpiI (BbsI), (ThermoFischer Scientific, USA) to obtain linear donor DNA templates used for 390
replacement of the three native loci. Specific single guide RNAs (sgRNAs) were designed 30 391
and cloned into CRISPi plasmids 29. The genomic recognition sites for targeting the different 392
loci with CRSIPR/Cas9 were CTAGGATATCAAACTCTTCG for AOX1, 393
TGGAGAATAATCGAACAAAA for DAS1 and CGACAAACTATAAGTAGATT for 394
DAS2. The final sgRNA / Cas9 plasmids were checked by enzymatic digestion and by Sanger 395
sequencing. 396
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
19
Strain Construction 397
For cell engineering, Komagataella phaffii (Pichia pastoris) CBS7435 31,32 was used as a 398
host. Transformations were carried out as previously described 15,29,33. Primers listed in 399
Supplementary Table 6 were used for detection of the correct replacement events of AOX1, 400
DAS1 and DAS2 loci and correct integration was further verified by Sanger sequencing. All 401
strains used in this study are listed in Supplementary Table 1. 402
Cultivations in shake flask 403
Cultures were inoculated with a starting OD600 of 2.0 in YNB medium supplemented with 404
10 g L-1 (NH4)2SO4. The flasks were incubated in a CO2 controlled incubator (5% CO2) 405
shaking at 180 rpm at 30°C. The methanol concentration was adjusted up to 0.5 % (v/v) after 406
the batch phase for induction and from there on maintained at 1% (v/v). Cell growth (OD600 407
and Cell Dry Weight (CDW) measurements) and metabolite profiles (HPLC analysis) were 408
monitored 34. 409
Bioreactor Cultivations 410
Single colonies were picked and used for inoculation of 100 mL pre-cultures in YPD medium 411
(28°C o/n and 180 rpm). Bioreactors were inoculated with a starting OD600 of 1.0 or 0.19 g L-412
1 CDW. A defined medium consisting of citrate monohydrate (2 g L-1), glycerol (16 g L-1), 413
MgSO4 7H2O (0.5 g L-1), (NH4)2HPO4 (12.6 g L-1) KCL (0.9 g L-1) and biotin (0.0004 g L-1) 414
was used. For the labelling experiment a medium containing H3PO4 (19.3 g L-1), CaCl2 2H2O 415
(0.025 g L-1), MgSO4 7H2O (2.5 g L-1), KOH (2.0 g L-1), NaCl (0.22 g L-1), EDTA (0.6 g L-416
1), biotin (0.0004 g L-1) and fully labelled 13C glycerol (8.0 g L-1) was used. Both media were 417
supplemented with trace elements. For the continuous growth fermentation YNB medium 418
supplemented with 10 g L-1 (NH4)2SO4 was used. 419
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
20
The bioreactor cultivations were carried out in 1.4 L DASGIP reactors (Eppendorf, 420
Germany). Cultivation temperature was controlled at 28 °C, pH at 5.0 by addition of 12.5 % 421
ammonium hydroxide or with 5 M NaOH and 2 M HCl in case of YNB medium. The 422
dissolved oxygen concentration was maintained above 20 % saturation. OD600 and cell dry 423
weight (CDW) measurements as well as HPLC analysis to routinely measure glycerol, 424
glucose, methanol and citrate concentrations 34 were carried out at every sample point. 425
Induction was done by the addition of 0.5% methanol (v/v). The CO2 in the inlet gas was set 426
to 1% during induction phase. After induction phase, the methanol concentration was 427
adjusted to 1 - 1.5% (v/v) by bolus feeding and the CO2 concentration was set to 5 % 428
throughout the cultivations. For the labelling experiment, the gas flow rate was set to 35 sL h-429
1 and the stirrer speed to 1000 rpm until the end of the fermentation. 430
Elemental Analysis - Isotope Ratio Mass Spectrometry (EA-IRMS) 431
For the measurement of the biomass 13C content, the samples were taken during fermentation 432
and processed at 4 °C. Volumes of cell suspension corresponding to approximately 0.5 mg of 433
dried biomass was firstly washed with 0.1 M HCL and then twice with RO-H2O. Until 434
analysis, the biomass samples were stored at -20 °C. The biomass material was homogenized 435
and weighed in tin capsules. The 13C/12C ratio was measured with an Isotope Ratio Mass 436
Spectrometer coupled to an Elemental Analyzer (EA-IRMS). EA-IRMS measurements were 437
carried out by Imprint Analytics, Neutal, Austria. 438
439
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
21
5. Acknowledgements 440
This work has been supported by the Federal Ministry for Digital and Economic Affairs 441
(bmwd), the Federal Ministry for Transport, Innovation and Technology (bmvit), the Styrian 442
Business Promotion Agency SFG, the Standortagentur Tirol, Government of Lower Austria 443
and ZIT - Technology Agency of the City of Vienna through the COMET-Funding Program 444
managed by the Austrian Research Promotion Agency FFG. We also thank the Austrian 445
Science Fund (FWF W1224—Doctoral Program on Biomolecular Technology of Proteins—446
BioToP). The funding agencies had no influence on the conduct of this research. EQ BOKU 447
VIBT GmbH is acknowledged for providing fermentation equipment. We also kindly thank 448
Hannes Rußmayer for help during labelling experiments. 449
6. Author Contributions 450
DM conceived and initiated the project. DM, MGS, TG, MS, and BG designed the 451
experiments. TG carried out the experiments and together with MGS, MS and DM analyzed 452
the data. TG, MGS and DM wrote the manuscript. 453
7. Competing interests 454
The authors are inventors of a patent application (application number PCT/EP2018/064158.) 455
based on the results reported in this publication. 456
457
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
22
8. References 458
1. Bassham, J. A. et al. The Path of Carbon in Photosynthesis. XXI. The Cyclic 459
Regeneration of Carbon Dioxide Acceptor 1. J. Am. Chem. Soc. 76, 1760–1770 460
(1954). 461
2. Berg, I. A. Ecological aspects of the distribution of different autotrophic CO2 fixation 462
pathways. Appl. Environ. Microbiol. 77, 1925–36 (2011). 463
3. Claassens, N. J., Sousa, D. Z., dos Santos, V. A. P. M., de Vos, W. M. & van der Oost, 464
J. Harnessing the power of microbial autotrophy. Nat. Rev. Microbiol. 14, 692–706 465
(2016). 466
4. Erb, T. J. & Zarzycki, J. A short history of RubisCO: the rise and fall (?) of Nature’s 467
predominant CO2 fixing enzyme. Curr. Opin. Biotechnol. 49, 100–107 (2018). 468
5. Zhuang, Z.-Y. & Li, S.-Y. Rubisco-based engineered Escherichia coli for in situ 469
carbon dioxide recycling. Bioresour. Technol. 150, 79–88 (2013). 470
6. Antonovsky, N. et al. Sugar Synthesis from CO2 in Escherichia coli. Cell 166, 115–471
125 (2016). 472
7. Herz, E. et al. The genetic basis for the adaptation of E. coli to sugar synthesis from 473
CO2. Nat. Commun. 8, 1705 (2017). 474
8. Guadalupe-Medina, V. et al. Carbon dioxide fixation by Calvin-Cycle enzymes 475
improves ethanol yield in yeast. Biotechnol. Biofuels 6, 125 (2013). 476
9. Li, Y.-J. et al. Engineered yeast with a CO2-fixation pathway to improve the bio-477
ethanol production from xylose-mixed sugars. Sci. Rep. 7, 43875 (2017). 478
10. Xia, P.-F. et al. Recycling Carbon Dioxide during Xylose Fermentation by Engineered 479
Saccharomyces cerevisiae. ACS Synth. Biol. 6, 276–283 (2017). 480
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
23
11. Papapetridis, I. et al. Optimizing anaerobic growth rate and fermentation kinetics in 481
Saccharomyces cerevisiae strains expressing Calvin-cycle enzymes for improved 482
ethanol yield. Biotechnol. Biofuels 11, 17 (2018). 483
12. Schada von Borzyskowski, L. et al. An engineered Calvin-Benson-Bassham cycle for 484
carbon dioxide fixation in Methylobacterium extorquens AM1. Metab. Eng. 47, 423–485
433 (2018). 486
13. Phaff, H. J., Miller, M. W. & Shifrine, M. The taxonomy of yeasts isolated from 487
Drosophila in the Yosemite region of California. Antonie Van Leeuwenhoek 22, 145–488
161 (1956). 489
14. Kurtzman, C. P. Description of Komagataella phaffii sp. nov. and the transfer of 490
Pichia pseudopastoris to the methylotrophic yeast genus Komagataella. Int. J. Syst. 491
Evol. Microbiol. 55, 973–976 (2005). 492
15. Gasser, B. et al. Pichia pastoris: protein production host and model organism for 493
biomedical research. Future Microbiol. 8, 191–208 (2013). 494
16. Liu, L. et al. How to achieve high-level expression of microbial enzymes. 495
Bioengineered 4, 212–223 (2013). 496
17. Peña, D. A., Gasser, B., Zanghellini, J., Steiger, M. G. & Mattanovich, D. Metabolic 497
engineering of Pichia pastoris. Metab. Eng. (2018). 498
doi:10.1016/J.YMBEN.2018.04.017 499
18. Agrawal, G., Shang, H. H., Xia, Z.-J. & Subramani, S. Functional regions of the 500
peroxin Pex19 necessary for peroxisome biogenesis. J. Biol. Chem. 292, 11547–11560 501
(2017). 502
19. Ma, C., Agrawal, G. & Subramani, S. Peroxisome assembly: matrix and membrane 503
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
24
protein biogenesis. J. Cell Biol. 193, 7–16 (2011). 504
20. Rußmayer, H. et al. Systems-level organization of yeast methylotrophic lifestyle. BMC 505
Biol. 13, 80 (2015). 506
21. Weninger, A., Hatzl, A.-M., Schmid, C., Vogl, T. & Glieder, A. Combinatorial 507
optimization of CRISPR/Cas9 expression enables precision genome engineering in the 508
methylotrophic yeast Pichia pastoris. J. Biotechnol. (2016). 509
doi:10.1016/j.jbiotec.2016.03.027 510
22. Prielhofer, R. et al. GoldenPiCS: a Golden Gate-derived modular cloning system for 511
applied synthetic biology in the yeast Pichia pastoris. BMC Syst. Biol. 11, 123 (2017). 512
23. Lee, P. C. Peroxisome targeting of lycopene pathway enzymes in Pichia pastoris. 513
Methods Mol. Biol. 898, 161–9 (2012). 514
24. Raines, C. A., Lloyd, J. C. & Dyer, T. A. New insights into the structure and function 515
of sedoheptulose-1,7-bisphosphatase; an important but neglected Calvin cycle enzyme. 516
J. Exp. Bot. 50, 1–8 (1999). 517
25. Bar-Even, A., Noor, E., Lewis, N. E. & Milo, R. Design and analysis of synthetic 518
carbon fixation pathways. Proc. Natl. Acad. Sci. 107, 8889–8894 (2010). 519
26. Schwander, T., Schada von Borzyskowski, L., Burgener, S., Cortina, N. S. & Erb, T. J. 520
A synthetic pathway for the fixation of carbon dioxide in vitro. Science (80-. ). 354, 521
900–904 (2016). 522
27. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden gate shuffling: a one-523
pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4, e5553 524
(2009). 525
28. Sarkari, P., Marx, H., Blumhoff, M. L., Mattanovich, D. & Steiger, M. G. An efficient 526
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
25
tool for metabolic pathway construction and gene integration for Aspergillus niger. 527
Bioresour. Technol. 245, 1327–1333 (2017). 528
29. Gassler, T., Heistinger, L., Mattanovich, D., Gasser, B. & Prielhofer, R. in Methods 529
Mol Biol. 1923, (in press) (2018). 530
30. Gao, Y. & Zhao, Y. Self-processing of ribozyme-flanked RNAs into guide RNAs in 531
vitro and in vivo for CRISPR-mediated genome editing. J. Integr. Plant Biol. 56, 343–532
349 (2014). 533
31. Küberl, A. et al. High-quality genome sequence of Pichia pastoris CBS7435. J. 534
Biotechnol. 154, 312–320 (2011). 535
32. Valli, M. et al. Curation of the genome annotation of Pichia pastoris ( Komagataella 536
phaffii ) CBS7435 from gene level to protein function. FEMS Yeast Res. 16, fow051 537
(2016). 538
33. Cregg, J. M. & Russell, K. A. in Pichia Protocols 27–40 (Humana Press). 539
doi:10.1385/0-89603-421-6:27 540
34. Blumhoff, M. L., Steiger, M. G., Mattanovich, D. & Sauer, M. Targeting enzymes to 541
the right compartment: Metabolic engineering for itaconic acid production by 542
Aspergillus niger. Metab. Eng. 19, 26–32 (2013). 543
544
.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint
top related