abcc11 lab report final version
Post on 14-Oct-2014
109 Views
Preview:
TRANSCRIPT
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Introduction
Single nucleotide polymorphisms, known as SNPs, are defined as positions in the
genome in which two or more different bases occur with a frequency of at least 1%. These
changes in single bases represent genetic variation amongst the human population. On
average, SNPs occur every 1200 bases and are useful as genetic markers since they tend to be
conserved through generations. Yoshiura et al. conducted a study in 2006 on the ABCC11 gene.
ABCC11 (ATP-binding cassette transporter sub-family C, member 11), is a protein encoded by
thy super family of ATP-binding cassette (ABC) transporters responsible for transport of various
molecules across intra and extracellular spaces. As a result of the study, the ABCC11 SNP was
determined to be the first of its kind responsible for a phenotype. This experiment showed that
the ABCC11 gene is responsible for the determination of earwax type. The AA genotype
corresponds to dry earwax, and the GA and GG to wet type. A 27 bp-deletion in ABCC11 exon
29 was found in a few individuals of Northeast Asian decent. Cells with the A allele showed a
lower excretory activity for cGMP than those with allele G which lead to decreased export of
fatty acid chains aprocrine excretions of the ear known as cerumen. The purpose of this
experiment was to determine student’s genotypes for this known SNP and use the information
obtained from extracted DNA to determine whether they had wet or dry earwax.
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Methods
To begin the experiment, DNA was extracted from buccal cells following the protocol outlined
by the SIGMA REDExtract-N-Amp Tissue PCR Kit. The experiment began at step B and followed
the guidelines all the way through the 5th instruction for step C. The same PCR cycling
conditions were used and the PCR reaction mix was set up as follows:
Reagent Volume
Water, PCR grade 4 microliters
REDExtract-N-Amp PCR reaction mix 10 microliters
Forward primer 1 microliter
Reverse primer 1 microliter
Tissue extract 4 microliters
Total volume: 20 microliters
To serve as positive control, GAPDH, a well-established “housekeeping gene” was used in this
experiment to ensure participants were using proper laboratory methods and conducting this
experiment without error. These PCR reactions were removed from the thermal cycler and
frozen until the next lab session.
Students were instructed to make two 1.5% agarose gels for the entire class to share. To do
this, .60 grams of agarose powder were added to 40mL of Tris Buffer solution in a 250ml
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Erlenmeyer flask. The flask was then gently covered (not sealed) with plastic wrap, and placed
in the microwave at 50% power for 2 minutes, or until the powder was fully suspended in the
liquid. Ethidium bromide was necessary to visualize the products on the gel, so one drop was
added to the agarose solution while swirling to cool the liquid. Once warm to the touch, the
liquid was poured into a well and two 8-comb wells inserted while it cooled.
10 microliters of both the ABCC11 and GAPDH reactions were added into separate lanes on
their respective gels, as well as 10 microliters of 100bp ladder standard to be used to verify
amplicon size later in the experiment.
If product was seen in both gels (at ~700bp for GAPDH and ~350 for ABCC11), students were
instructed to go forward with the procedure.
A 50 microliter ABCC11 reaction was then prepared as follows:
Red extract: 25 microliters
ABCC11 forward primer: 2.5 microliters
ABCC11 reverse primer: 2.5 microliters
Buccal cell DNA: 4 microliters
Sterile water: 16 microliters
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
The same cycling parameters were followed as listed in the SIGMA PCR kit protocol. The
reactions were placed in the freezer until the next lab session the following week.
One 1.5% agarose gel was prepared for the entire class following the procedure listed
previously in this report. Each group loaded 10 microliters of their ABCC11 reactions onto the
gel. Students were instructed to use the intensity of the product banding pattern to determine
the relative concentration of DNA in their samples. Once this was complete, a 40 microliter PCR
cleanup was performed following the Qiaquick protocol. The product of this procedure was
used to prepare two sequencing reactions, both forward and reverse.
To prepare the sequencing reactions, it was determined from the gel that each microliter
contained 10 nanograms of DNA. Two 20 microliter DNA sequencing reactions were set up as
follows:
ABCC11 primer, either forward or reverse 2 microliters
DNA (10ng/uL) 2.3. microliters
Sterile water 7.7 microliters
DTCS (added last) 8 microliters
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Further preparation of the DNA sequencing reactions followed the protocol outlined by the CEQ
DTCS-Quick Start Kit, with minor changes made to ignore step 2 and to add 200 microliters of
PB in a 1.5mL tube in step 1.
An ethanol precipitation of the sequencing reactions was then performed. The procedure was
followed as outlined by the protocol in the CEQ-8000 Series Genetic Analysis System manual.
Two .5mL tubes were labeled with the group number and sample ID (forward or reverse).
Finger vortexing was performed between steps C and D but great care was taken to keep the
samples on ice. In step H, SLS mixture was added to the samples and they were vortexed briefly
every 5 minutes for a total of 15 minutes. The samples were spun to the bottom using a
desktop centrifuge, then pipetted in their entirety onto the sequencing reaction plate. One drop
of mineral oil was added on top of the samples to prevent them from drying. Each group noted
the location of their forward and reverse reactions so there would be minimal confusion
identifying whose was whose after sequencing was complete.
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Results
Figure 1a: Analysis of ABCC11 Figure 1b: Analysis of GAPDH
Agarose Gel Electrophoretic Analysis of ABCC11
Buccal Swab Isolation
Lane 1—100 bp ladder
Lane 8—Group 9’s ABCC11 amplicon ~350bp
1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Figure 2: Determination of DNA concentration
Figure 3: Semi-log graph of Standards and unknown sample—turned in for previous grade.
Data set 1: Trim Report
101-
9F.E03_10111709J0 E 470 7 7 No
101-
9R.F03_10111709J1 F 326 313 313 Yes
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
Data Set 2: Reverse ABCC11 primer sequence:
>101-9R.F03_10111709J1 313 0 313 CEQ
TTCAAGGCTTCACCGCCTTTGGGAAGAAGAAGTCTCAAGGCGAGGGATTGAAAAAGCTTCAGTGCTTCTGGTGAT
GCTGAGGTTCCAGAGAACAAGGTTGATTTTCGATGCACTTCTGGGCATCTGCTTCTGCATTGCCAGTGTACTCGGG
CCAGTAAGTGGCAGACTTGGTGAGGTTTGGGGGACTCTAGGCTTCAGAGGTTTAGCGATGGAACTGCGGGCATG
TTCAAGTCCATGCCAGGAGTTAGAGATGCATTTGTCTTTCAGTTGCTGTCTAGAAAATGAAGACCTTTTGAGGACA
GTAGAGCATGGT
Discussion:
The isolation of DNA from buccal cell swabs was successful in providing quantifiable
amounts of product to be sequenced and compared to those known in the BLAST database.
After isolation, a PCR reaction was set up and run with the genes of interest: ABCC11 and
GAPDH. Figure 1 shows the analysis of both ABCC11 and GAPDH after being run on agarose gel
through electrophoresis. Lane 1 on both gels contained a 100 bp pair ladder that allowed for
the determination of banding sizes for both genes. The ABCC11 amplicon was the expected size
at 350 bp, and GAPDH was found to be the expected 700 bp in length. Because useable
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
products were successfully obtained and verified through electrophoresis, students were then
able to mix another PCR reaction with the DNA isolated from individual samples. Figure 2
demonstrates the results obtained after running the gel. This gel was used to check the
amlpicon size versus semi-log graph paper to demonstrate the relationship between distance
migrated and size in base pairs. Also, by observing the intensity of the banding pattern,
students were able to determine the relative concentration of DNA in their sample. This 1.5 %
agarose gel was used to determine the concentration (ng/uL) of DNA in the final ABCC11 PCR
products. The bands in the 100bp ladder were compared to the amplicons on the gel. The
intensity of the amplicons was about that of the 400bp standard in the ladder. Since these
reactions were 40uL, it was determined that DNA was in a 10ng/uL concentration. This
determined concentration was used to calculate the appropriate amount of DNA to add to the
sequencing reactions. After the reaction was completed, a trim report was obtained. Data Set 1
summarizes the report: the forward sequence had very few alignments to produce a significant
peak in the Sequencher algorithm, thus only the reverse ABCC11 primer sequence (Data Set 2)
was used. The BLAST (Basic Local Alignment Search Tool) program was used to compare and
contrast the similarities between the group’s individual reverse ABCC11 primer sequence and a
human partial sequence containing the ABCC11 locus. This allowed students to determine what
nucleotide (A or G) was present at the known SNP position in the locus. The ABCC11 primer
sequence contained 313 bases, with 312 appearing in the actual alignment output. This
demonstrated that 99% was identical to the reference sequence, with 0 gaps present. The
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
polymorphic position in the query sequence of the alignment was observed in order to
determine which base (A or G) was in the group’s sample. The SNP base identity was C, the
reverse complement of G, which denotes the wet earwax phenotype.
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
References:
Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-
3402.
Lesk, Arthur. Introduction to Genomics. Oxford University Press. New York. 2007.
Yoshiura,et. Al. "A SNP in the ABCC11 Gene Is the Determinant of Human Earwax Type."
Nature Genetics 38.3 (2006): 324-30. Print
Shawne Thorsen
12/7/2010
ABCC11 Lab Report
top related