an arg-307 to gln polymorphism within the atp-binding site
Post on 05-Jan-2017
220 Views
Preview:
TRANSCRIPT
1
An Arg-307 to Gln Polymorphism within the ATP-binding Site Causes Loss-of-function of the Human P2X7 Receptor
Ben J. Gu‡, Ronald Sluyter‡, Kristen K. Skarratt‡, Anne N. Shemon‡, Lan-
Phuong Dao-Ung‡, Stephen J. Fuller‡, Julian A. Barden║, Alison L. Clarke¶,
Steven Petrou¶ and James S. Wiley‡§,
From the ‡Department of Medicine, University of Sydney at Nepean Hospital,
Penrith, New South Wales 2750, the ║Department of Anatomy and Histology,
University of Sydney, Sydney, New South Wales, 2006, and the ¶Department
of Physiology, University of Melbourne, Parkville, Victoria 3050, Australia.
Running title: A polymorphism within the ATP-binding site of P2X7
§To whom correspondence should be addressed: Level 5, South Block,
Nepean Hospital, Penrith, NSW 2750, Australia. Tel.: 61-2-4734 3277; Fax:
61-2-4734 3432; E-mail: wileyj@medicine.usyd.edu.au
*This work was supported by the National Health and Medical Research
Council, the Cure Cancer Australia Foundation, the Leukemia Foundation of
Australia and a Sesqui Fellowship from the University of Sydney (BJ Gu).
Manuscript includes 2 tables and 11 figures
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
2
ABSTRACT
The P2X7 receptor is a ligand-gated channel which is highly expressed on
mononuclear cells of the immune system and which mediates ATP-induced
apoptosis. Wide variations in the function of the P2X7 receptor have been
observed, explained in part by loss-of-function polymorphisms which change
Glu-496 to Ala (E496A) and Ile-568 to Asn (I568N). In this study, a third
polymorphism which substitutes an uncharged glutamine for the highly
positively charged arginine-307 (R307Q) has been found in heterozygous
dosage in 12 of 420 subjects studied. P2X7 function was measured by ATP-
induced fluxes of Rb+, Ba2+ and ethidium+ into peripheral blood monocytes or
various lymphocyte subsets and was either absent or markedly decreased.
Transfection experiments showed that P2X7 carrying the R307Q mutation
lacked either channel or pore function despite robust protein synthesis and
surface expression of the receptor. The monoclonal antibody (clone L4) which
binds to the extracellular domain of wild type P2X7 and blocks P2X7 function
failed to bind to the R307Q mutant receptor. Differentiation of monocytes to
macrophages upregulated P2X7 function in cells heterozygous for the R307Q
to a value 10-40% of that for wild type macrophages. However, macrophages
from a subject who was double heterozygous for R307Q/I568N remained
totally non-functional for P2X7, and lymphocytes from the same subject also
lacked ATP-stimulated phospholipase D activity. These data identify a third
loss-of-function polymorphism affecting the human P2X7 receptor and since
the affected arginine-307 is homologous to those essential for ATP binding to
P2X1 and P2X2, it is likely that this polymorphism abolishes the binding of ATP
to the extracellular domain of P2X7.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
3
Key Words: P2X7, loss-of-function polymorphism, ATP-binding site,
purinergic receptor, lymphocyte, monocyte/macrophage
The abbreviations used are CLL, chronic lymphocytic leukemia; BSA, bovine serum
albumin; FITC, fluorescein isothiocyanate; PE, phycoerythrin; mAb, monoclonal
antibody; HEK, human embryonic kidney; hP2X7, human P2X7; PCR, polymerase
chain reaction; PBS, phosphate-buffered saline; PLD, phospholipase D; PBut,
phosphatidylbutanol; BzATP, 2’,3’-O-(4-benzoyl)benzoyl ATP
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
4
INTRODUCTION
In cells of the hemopoietic and immune systems, extracellular ATP can induce
cytolysis of lymphocytes (1), monocytes/macrophages (2) and dendritic cells
(3). It is generally accepted that these cytolytic effects of ATP are mediated
by the P2X7 receptor which is a ligand-gated cation channel activated by
extracellular ATP and highly expressed on these cell types (4,5). The P2X7
ionic channel opened by extracellular ATP shows strong selectivity for the
divalent cations Ca2+ and Ba2+ over monovalent cations (6,7). After immediate
(< 1s) channel opening, in the presence of agonist, a second permeability
state develops which allows larger organic cations to pass, a process termed
“pore” formation (8-10) . This larger permeability state allows permeation by
the ethidium+ cation (314 Da) or Yo-Pro-12+ (375 Da) but excludes passage of
propidium2+ (414 Da) into lymphocytes (11) and monocyte-derived dendritic
cells (12). Studies of P2X7 of monocyte-macrophages as well as human
embryonic kidney (HEK)-293 cells expressing the cDNA for P2X7 have shown
this molecule forms part of a membrane complex (13) which activates the
caspase signalling cascade (2,14,15) as well as intracellular phospholipase D
(PLD) (16,17) and various proteinases such as membrane metalloproteases
which shed surface L-selectin and CD23 (18,19).
P2X receptors have an oligomeric structure in the plasma membrane based
on trimeric or larger complexes of identical subunits(20,21). Moreover the
values of Hill coefficients derived from the sigmoid ATP dose–response
curves of the P2X7(P2Z) receptor are consistent with multiple ATP binding
sites in each P2X7 trimer(8,22,23). All seven members of the P2X receptor
family have two transmembrane domains with intracellular amino and
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
5
carboxyl termini. Little is known of the conformation of the extracellular
domain containing the ATP binding site/s. An analysis of the P2X subtype
sequence homology has shown that the two transmembrane domains M1 and
M2 are separated by an extracellular sequence containing a cysteine-rich
region (residues 110-170) followed by a segment from Phe188-Val321 that
may form six antiparallel beta-pleated sheets homologous with members of
the class II aminoacyl-tRNA synthetases (24). The ATP-binding site is very
likely to lie in this beta sheet region since two positively charged residues,
Lys193 and Lys311 have been identified as being associated with the ATP
binding site (25).
Our previous studies have shown that genetic factors play a role in the
functional phenotype of the P2X7 receptor. In around 20% of the population,
a Glu-496 to Ala polymorphism (1513A→C) which is located in an ankyrin
repeat motif of the C-terminus of P2X7 receptor (26) leads to loss-of-function
in homozygous individuals and approximately 50% reduction in heterozygous
individuals (27). A second polymorphism, Ile-568 to Asn (1729T→A), lies in a
trafficking motif of the carboxyl terminus (28) and prevents normal trafficking
and surface expression of this receptor (29). In this study, we report a third
polymorphism within exon 9 of the human P2RX7 gene, which changes
arginine-307 to an uncharged glutamine at the homologous position to Arg305
in P2X1 and Arg304 in P2X2, both of which are essential for the binding of
ATP and activation of these receptors (30,31). Cells carrying the Arg-307 to
Gln polymorphism have reduced or absent P2X7 function due to the failure of
ATP binding to the extracellular domain of P2X7.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
6
EXPERIMENTAL PROCEDURES
Materials―ATP, 2’,3’-O-(4-benzoyl)benzoyl ATP (BzATP), ethidium
bromide, barium chloride, digitonin, D-glucose, bovine serum albumin (BSA),
RPMI-1640 medium, gentamicin, collagen (Type X), glycerol gelatin mounting
medium, 7-aminoactinomycin D, 6-aminocaproic acid, bistris, ε-amino-n-
caproic acid (6-aminocaproic acid), n-dodecyl β-D-maltoside(laurylmaltoside)
were purchased from Sigma. Interferon-γ was from Roche Diagnostics
(Mannheim, Germany). HEPES, fetal calf serum, normal horse serum,
LipofectamineTM2000 reagent, Opti-MEM I medium, Taq DNA polymerase and
pcDNA3 plasmid vector were from Invitrogen. Ficoll-PaqueTM PLUS and a
GFXTMPCR DNA and Gel Band Purification Kit were from Amersham
Biosciences. A Wizard Genomic DNA Purification Kit and pCI plasmid vector
were bought from Promega. A QuickChangeTM Site-Directed Mutagenesis Kit
was purchased from Stratagene. NotI, BsrGI, XhoI were from New England
Biolabs (Beverly, MA), 86RbCl (1.5 mCi/ml; specific radioactivity 3 Ci/mmol)
was purchased from Amersham International (Little Chalfont,
Buckinghamshire, UK) and Perkin Elmer Life Science (Boston, MA). di-n-
butyl phthalate and di-isooctyl phthalate (BDH Chemicals, Poole, England)
were blended 80:20 (v/v) to give a mixture of density 1.030 g/ml. Fura RedTM,
AM was from Molecular Probes. Fluorescein (FITC), phycoerythrin (PE) and
PE-Cy5-conjugated anti-CD monoclonal antibodies (mAb) and horseradish
peroxidase (HRP)-conjugated rabbit anti-sheep and anti-rabbit
immunoglobulin antibody were from Dako. PE-conjugated sheep anti-mouse
immunoglobulin antibody was from Chemicon (Temecula, CA). Cy3-
conjugated donkey anti-sheep IgG antibody and Cy2-conjugated donkey anti-
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
7
rabbit IgG antibody were from Jackson ImmunoResearch (West Grove, PA).
Murine anti-human P2X7 receptor mAb (kindly provided by Drs. Gary Buell
and Ian Chessell) (32) was purified from clone L4 and B2 hybridoma
supernatants by chromatography on Protein A Sepharose Fast Flow and
conjugated to FITC as described previously (33). Sheep anti-human P2X7
polyclonal antibody against a non-homologous extracellular epitope of the
human P2X7 receptor has been described (29). Rabbit anti-rat P2X7
polyclonal antibody cross-reacting with human P2X7 has also been described
previously (34). The Mini-complete Protease Inhibitor cocktail and
phenylmethylsulfonyl fluoride (PMSF) plus were from Roche Applied Science
(Mannheim, Germany). The SuperSignal West Pico Chemiluminescent
Substrate kit was from Pierce Endogen (Rockford, IL).
Source of Human Leukocytes―Peripheral blood was collected and
diluted with an equal volume of RPMI-1640 medium. Mononuclear cells were
separated by density gradient centrifugation over Ficoll-Hypaque and washed
once in RPMI-1640 medium and resuspended in HEPES-buffered NaCl
medium (145 mM NaCl, 5 mM KCl, 10 mM HEPES, 5 mM D-glucose and 1
mg/mL BSA, pH 7.5) containing 1 mM CaCl2 or RPMI-1640 medium
containing 10% fetal calf serum and 5 µg/mL gentamycin (complete RPMI-
1640 medium). For the generation of macrophages, the mononuclear cell
preparation in complete RPMI-1640 medium was incubated for 2 h in plastic
flasks then gently washed to remove non-adherent cells. The plastic-
adherent monocytes were differentiated into macrophages by culturing for 7
days in complete RPMI-1640 medium. Macrophages were activated by
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
8
adding 100 U/mL interferon-γ in the final 24 h of culture, before harvesting by
mechanical scraping for flow cytometric analysis.
86Rb+ Efflux Measurements―Lymphocytes (2.5 X 107/ml) were loaded
with 86RbCl (5 µCi/ml) for 2 h at 37°C in HEPES-buffered NaCl medium
containing 10 µM CaCl2. The cells were then washed three times with ice
cold, isotope-free NaCl medium. Cells were resuspended at 6 X 106/ml in
HEPES-buffered KCl medium (150 mM KCl, 10 mM HEPES, 5 mM D-glucose,
0.1% BSA, pH 7.5); 1 ml was lysed with 20 µl of Triton X-100 and used to
determine the total amount of cellular 86Rb+. 86Rb+ loaded cells (4.5 ml) were
incubated for 5 min at 37°C, before the addition of 1.0 mM ATP for 4 min.
Samples (1.0 ml) were removed at 1 min intervals, overlaid onto 0.3 ml of
phthalate oil mixture and centrifuged at 8000 g for 40 s. The upper layer (0.7
ml) from each tube was removed, as well as 0.7 ml from totals was removed
and the amount of radioactivity detected by Cerenkov counting.
Ba2+ Influx Measurements ― Mononuclear cells (4 X 106) were
incubated with Fura-Red (1 µg/mL) for 30 min at 37°C in HEPES-buffered
NaCl medium. Cells were then washed once and labeled with appropriate
FITC-conjugated anti-CD mAbs for 15 min. Cells were washed once and
resuspended in 1.0 ml HEPES-buffered KCl medium at 37°C. All samples
were stirred and temperature controlled at 37oC using a Time Zero module
(Cytek, Fremont, CA). BaCl2 (1.0 mM) was added, followed 40 s later by
addition of 1.0 mM ATP. Cells were analyzed at 2000 events/s on a
FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA) and were
gated by forward and side scatter and by cell type specific antibodies. The
linear mean channel of fluorescence intensity (0-1023 channel) for each gated
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
9
subpopulation over successive 2-s intervals was analyzed by WinMDI
software (Joseph Trotter, version 2.7) and plotted against time.
Ethidium+ Influx Measurement ― Cells (2 X 106) prelabeled with FITC-
conjugated anti-CD mAb were washed once and resuspended in 1.0 ml
HEPES-buffered KCl medium at 370C. All samples were stirred and
temperature controlled at 37oC using a Time Zero module. Ethidium+ (25 µM)
was added, followed 40 s later by addition of 1.0 mM ATP. Cells were
analyzed at 1000 events/s on a FACSCalibur flow cytometer and were gated
by forward and side scatter and by cell type specific antibodies. The linear
mean channel of fluorescence intensity (0-255 channel) for each gated
subpopulation over successive 5-s intervals was analyzed by WinMDI
software and plotted against time. Due to the increased P2X7 function on
macrophages, ethidium+ uptake in these cells (Fig. 11) was acquired at a
reduced voltage setting for FL-2 (ethidium+ fluorescence) as described
previously (29).
Phospholipase D (PLD) assay ― B lymphocytes (1 x 107 cells/ml) were
cultured at 37°C, 5% CO2 overnight in supplemented RPMI-1640 containing
[3H] Oleic acid (2-5 µCi/ml). Labelled cells were resuspended in KCl medium
and pre-incubated for 5 min in the presence of the primary alcohol, 1-butanol
(30 mM) which yields a stable phophatidylalcohol end product following PLD
stimulation. The cells were then incubated in the presence of ATP (0.5 mM) or
PMA (0.1 µM) for 15 min at 37°C. Membrane lipids were extracted and the
level of phosphatidylbutanol (PBut) was determined as described (17).
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
10
DNA Extraction ― Genomic DNA was extracted from peripheral blood
using the Wizard Genomic DNA Purification Kit according to the
manufacturer’s instructions.
Polymerase Chain Reaction (PCR) and DNA Sequencing of PCR
Products― Twelve primer pairs were designed to amplify the 13 exons of
human P2RX7 gene from genomic DNA (Accession NT_009775.8) (Table I).
These oligonucleotides were designed by using Primer3 (http://www-
genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and synthesized by
PROLIGO (Sydney, Australia). PCR amplifications (39 cycles of
denaturation at 94oC for 45 s, annealing at 58 or 55oC for 20 or 30 s and
extension at 72oC for 15 s ) produced 12 fragments of the expected size.
PCR products were separated in 2% agarose gel and visualised by ethidium
bromide staining. Amplified PCR products were purified using the GFXTMPCR
DNA and Gel Band Purification Kit. Using the AmpliTaq FS Dye Terminator
Cycle Sequencing Kit (PerkinElmer Applied Biosystems), fluorescence-based
cycle sequencing reaction was performed to sequence the PCR products of
P2X7 directly from both ends using specific primers. Sequencing
electrophoresis was carried out on the ABI PRISM 377 DNA Sequencer and
analyzed using ABI PRISM Sequencing Analysis Software (version 3.0) at the
SUPAMAC Facility, Royal Prince Alfred Hospital (Sydney, Australia).
Site Directed Mutagenesis ― The full-length clone of human P2X7
(GenBank accession number Y09561) was used in these studies. hP2X7
cDNA was kindly provided by Dr. Gary Buell as a NotI-NotI insert in pcDNA3.
hP2X7 was removed from pcDNA3 using a NotI-NotI digest and ligated into
pCI, which is a cytomegalovirus driven mammalian expression vector.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
11
Mutated 946G→A was introduced using overlap PCR (Quick ChangeTM Site-
Directed Mutagenesis Kit) and the expression vector pCI-hP2X7 as a template.
The P2RX7 point mutation was constructed using a pair of complementary
mutagenic primers described below, consisting of the mutagenic codon
flanked by sequences homologous to the wild type strand of the template.
After digestion of the parental DNA with DpnI, intact mutation–containing
synthesized DNA was transformed into competent Blue XL cells. All mutations
were confirmed by sequencing. The base change is in bold and underlined.
G946A forward: C AAT GTT GAG AAA CAG ACT CTG ATA AAA GTC TTC
GGG;
G946A reverse: CCC GAA GAC TTT TAT CAG AGT CTG TTT CTC AAC
ATT G.
Transfection of HEK-293 Cells ― HEK-293 cells were cultured in
complete RPMI-1640 medium. The culture was negative for Mycoplasma as
monitored by PCR every 2 to 3 months of culture. Full length (30 µg) P2X7 or
mutated P2X7 cDNA in pCI vector was incubated in serum-free Opti-MEM I
medium for 5 min followed by incubation with LipofectamineTM2000 Reagent
(30 µL, diluted with Opti-MEM I medium) for 20 min at room temperature. The
solution was transfected into nearly confluent monolayer of HEK-293 cells (~5
X 106 in 9 mL complete RPMI-1640 medium without antibiotics). After 40-44
h, cells were collected by mechanical scraping in complete RPMI-1640
medium.
Immunofluorescent Staining and Flow Cytometry―Mononuclear cell
preparations (1 X 107/mL) from healthy or chronic lymphocytic leukemia (CLL)
subjects, or HEK-293 cells were incubated for 20 min at 20oC with FITC-
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
12
conjugated P2X7 mAb (clone L4) plus PE-conjugated CD3 and PE-Cy5-
conjugated CD19 mAb in HEPES-buffered saline containing 10% group AB
human serum. Cells were washed once and analyzed for P2X7 expression on
lymphocyte subpopulations gated for B-lymphocytes (CD19+) or T-
lymphocytes (CD3+) or on HEK-293 gated by forward and side scatter. Dead
cells were excluded by 7-aminoactinomycin D staining. For intracellular
staining, HEK-293 cells were fixed with 1% paraformaldehyde for 15 min at
4°C and labeled with FITC-P2X7 mAb for 15 min in the presence of 0.1%
saponin and 10% group AB human serum. Isotype control values for
lymphocytes ranged from 2±1 mean channels of fluorescence intensity and
were subtracted from the values for each type.
Immunofluorescent Staining and Confocal Microscopy ― Non-
transfected, mock transfected and transfected HEK-293 cells were harvested
and cultured on collagen-coated (50 µg/mL) glass coverslips in 48-well plates
at 2.5 x 105 cells/well for 120 min. Cells were fixed with 2%
paraformaldehyde in phosphate-buffered saline (PBS) for 15 min and washed
three times with PBS. Cells were blocked with 20% normal horse serum in
PBS for 20 min, before incubation with sheep anti-human or rabbit anti-rat
P2X7 polyclonal antibodies or pre-immune serum diluted in PBS for 120 min.
Cells were washed and incubated with Cy3-conjugated donkey anti-sheep or
Cy2-conjugated donkey anti-rabbit IgG antibody diluted in PBS for 60 min.
Washed cells were mounted on glass slides in glycerol gelatin mounting
media and visualized with a Leica TCS NT UV laser confocal microscope
system.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
13
Western Blotting ― HEK-293 cells (5 x 106) transfected with wild type
or R307Q mutant human P2RX7 cDNA were resuspended in digestion buffer
containing mini complete protease inhibitor cocktail, 1 mM PMSF, 750 mM ε-
amino-n-caproic acid and 50 mM bistris (pH 7.0). Cells were lysed with 1% n-
dodecyl β-D-maltoside at 4oC followed by centrifugation at 20,000g for 15 min.
The supernatants were collected and separated by 8~16% SDS-PAGE under
reducing conditions. Proteins were transferred to nitrocellulose membrane
and blocked overnight in TTBS buffer (20 mM Tris, 500 mM NaCl, 0.05%
Tween 20, pH 7.5) containing 5% skim milk powder. The membrane was
washed and incubated with a sheep anti-human or a rabbit anti-rat P2X7
receptor polyclonal antibody (1:1,000) in TTBS buffer for 2 hours. The
membrane was washed and incubated with HRP-conjugated rabbit anti-sheep
or swine anti-rabbit immunoglobulin antibody (1:5,000) for another 1 hour.
The HRP was then detected with SuperSignal kit.
Electrophysiology ― Oocytes from adult female Xenopus laevis were
surgically removed and prepared as outlined previously (28). Stage 5 or
6 oocytes were injected with 50 nl of cRNA-encoding wild type P2RX7 or
mutant P2RX7 R307Q receptors (~1 µg/µl) and were stored at 18oC for 2 days
prior to experimentation. For two electrode voltage clamp recordings, oocytes
were impaled with two glass electrodes containing 3 M KCl and held at a
membrane potential of -70mV with an Axoclamp 2B amplifier (Axon
Instruments, Union City, CA). Oocytes were continually perfused with a ND96
solution (NaCl 96 mM, KCl 2 mM, CaCl2 0.1 mM, HEPES 5 mM, pH 7.5) using
a pump perfusion system. 100 µM ATP dissolved in bath solution was applied
to the oocyte at 18oC until the response reached a plateau or alternatively, if
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
14
no response was observed, for ~1 min. Following ATP application, the oocyte
was again perfused with bath solution and the inward current trace was
monitored until full recovery was observed.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
15
RESULTS
A Single Nucleotide Polymorphism at Position 946 of the P2RX7
Gene ― Both loss-of-function polymorphisms identified to date in the human
P2RX7 gene result from single base substitutions in exon 13. A search was
made for other single nucleotide polymorphisms by sequencing the other 12
exons of P2RX7 gene from genomic DNA of healthy and leukemic subjects.
In two of 110 CLL patients and ten of 310 healthy subjects, a heterozygous
nucleotide substitution (946G→A) was found in exon 9 but no homozygous
substitutions were observed (Table 2). This substitution predicts a change of
arginine-307 to glutamine (R307Q) in the extracellular domain of P2X7
receptor. The overall allele frequency of this single nucleotide polymorphism
was 0.014 in the Caucasian population when healthy subjects and CLL
patients were considered as a single group (n=420). Thus this mutant allele
falls within the definition of a single nucleotide polymorphism (SNP) since its
prevalence is greater than 0.01 (1%) in the population. Of the total 12 subjects
who were heterozygous for 946G→A, three were also heterozygous for other
loss-of-function polymorphisms; one for 1513A→C and two for 1729T→A
(Table 2).
P2X7 Expression and Function in Monocytes and Lymphocytes―
Mononuclear preparations from healthy and CLL subjects with known
residues at position 307, 496 and 568 were pre-incubated with appropriate
FITC-labeled mAbs and ATP-induced uptake of ethidium into gated
lymphocyte and monocyte subpopulations was measured as previously
described (27,33). Absent or very reduced P2X7 function was found in all six
R307Q heterozygous subjects who were tested. In contrast, mononuclear
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
16
cells from subjects who were wild type at all three polymorphic positions
showed robust P2X7 function (Table 2 and Fig. 1). When the anti-human P2X7
mAb (clone L4) was used in this study as previously described (33), the
R307Q heterozygotes also showed decreased binding of this antibody (Table
2).
ATP-induced 86Rb Efflux from Lymphocytes ― The function of the
P2X7 channel/pore was measured by the ATP-induced efflux of isotopic Rb+
from lymphocytes (> 98% purity) isolated from peripheral blood of the two
subjects with CLL. In wild type lymphocytes the loss of 86Rb+ from the cells
over 4 min followed first-order kinetics with a rate constant of 0.03 ± 0.01 min-1
(range 0.01-0.05) in the absence of ATP and 0.34 ± 0.04 min-1 (range 0.24-
0.50) in the presence of ATP (Fig. 2). In subject C1 who was heterozygous
for both R307Q and I568N, ATP-induced Rb+ efflux was absent while in
subject C2, who was heterozygous for R307Q but wild type for E496A and
I568N, the rate constant was reduced to 0.26 min-1. Attempts to measure Rb+
efflux from lymphocytes of healthy subjects were complicated by a 5-10%
monocyte admixture in the preparation and a flow cytometric approach was
adopted to further study P2X7 channel fluxes.
ATP-induced Ba2+ Influx into Lymphocyte Subsets―The permeability
of the P2X7 channel/pore was also studied by two-color flow cytometry in
which the influx of Ba2+ was measured into T lymphocytes identified by
appropriate FITC-conjugated mAb. Fig. 3 shows the ATP-induced uptake of
Ba2+ into T lymphocytes loaded with Fura-Red whose fluorescence emission
measured by flow cytometry decreases on chelating this divalent cation as it
enters the cell. The rate of Ba2+ uptake into lymphocytes from subject N1 who
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
17
was heterozygous for R307Q was markedly decreased compared with a wild
type subject (Fig. 3). Absence of ATP-induced Ba2+ uptake was found in T-
lymphocytes from subject C1 who was double heterozygous for R307Q and
I568N (Fig. 3). Similar results were obtained fort T-lymphocytes, as well as
NK cells and B cells from other heterozygous subjects (data not shown).
ATP-stimulated Phospholipase D (PLD) Activity was Impaired in
Subject Double Heterozygous for R307Q/I568N Polymorphism ― A major
downstream effect of P2X7 receptor activation is stimulation of PLD activity
demonstrated both in macrophages (16) and CLL lymphocytes (17).
Lymphocytes from a CLL patient (>98% purity) were incubated with/without
ATP and the PLD activity was measured by the transphosphatidylation
reaction (17). Fig. 4 shows that lymphocytes from three CLL patients who
were wild type for R307/E496/I568 demonstrated strong ATP-stimulated PLD
activity while lymphocytes from subject C1 who was double heterozygous for
R307Q/I568N failed to show ATP-stimulated PLD activity despite the similar
level of total PLD activity stimulated by PMA.
Expression and Function of Arg-307 to Gln (R307Q) Mutated P2X7 in
HEK-293 cells ― cDNA for wild type P2RX7 or P2RX7 carrying the 946G→A
mutation was transfected into HEK-293 cells and the expression and function
of the receptor was measured. At 44 hours after transfection, an aliquot of the
cells was lysed and proteins separated by SDS-PAGE. Western blotting
using a sheep anti-human P2X7 revealed large amount P2X7 protein
migrating at the predicted 72 kD region for both wild type and R307Q mutant
P2X7 (Fig. 5). Confocal microscopy image of cells stained with the same
polyclonal antibody showed strong expression of R307Q mutated P2X7 on the
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
18
cell surface of the transfected HEK-293 cells while no surface expression was
found in I568N mutant P2X7 or in mock transfected HEK-293 cells (Fig. 6).
Similar results were found for Western blotting and confocal microscopy using
a rabbit anti-rat P2X7 polyclonal antibody (data not shown). Despite strong
P2X7 protein expression on the cell surface, the potent agonist BzATP, at
concentrations up to 1 mM, failed to induce ethidium uptake into HEK-293
cells transfected with R307Q mutant P2X7 (Fig. 7). In contrast, BzATP
induced ethidium uptake into HEK-293 cells transfected with wild type P2X7
with an EC50 of only 2~4 µM and of n value of 2.5 using Hill plot analysis (Fig.
7).
Absent Function of Arg-307 to Gln (R307Q) Mutated P2X7 in Oocytes
― cRNA for wild type P2RX7 or P2RX7 carrying the 946G→A mutation was
injected into oocytes and the channel function of the receptor was measured.
Five oocytes with wild type P2X7 and four oocytes with R307Q mutant P2X7
were tested for responses to ATP. In all oocytes with wild type P2X7
receptors, a clear increase in inward current was observed. In contrast,
oocytes injected with the R307Q mutant receptor P2X7 showed no response
to the application of ATP (Fig. 8)
Failure of L4 Monoclonal Antibody to Bind Arg-307 to Gln (R307Q)-
mutated P2X7― The study of P2X7 has been greatly assisted through the
development of an anti-P2X7 mAb (clone L4) which binds to the extracellular
domain of P2X7 and blocks receptor function (32,33). Moreover, this mAb
binds not only to cell surface P2X7 but also to the far larger intracellular pool
of this receptor when cells are permeabilized to allow access of the antibody
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
19
(33). However, at 44 h after transfection of R307Q mutated P2X7 into HEK-
293 cells, anti-human P2X7 mAb (clone L4) failed to bind either to cell surface
P2X7 or to intracellular P2X7 (Fig. 9). A different anti-P2X7 mAb (clone B2),
which also binds to the extracellular domain of P2X7 but without affecting its
function (27), was chosen to examine the surface expression level. This B2
mAb bound avidly to wild type P2X7 expressed on the surface of transfected
HEK-293 cells and binding of this mAb saturated between 1~10 µg/ml (Fig.
10). The B2 mAb also showed binding to R307Q mutant P2X7 receptor
expressed on the surface of transfected HEK-293, but the binding was of
lower affinity compared with binding to wild type P2X7. Mock transfected cells
failed to bind the B2 mAb.
Absent Macrophage P2X7 Function in Double Heterozygotes ―
Differentiation of monocytes into macrophages increases the expression and
function of P2X7 by many-fold (35). Peripheral blood monocytes were
cultured for 7 days with interferon-γ added for the final 24 h and the P2X7
function was measured by ATP-induced ethidium+ uptake into the CD14+
macrophage population. Macrophages isolated from healthy subjects who
were wild type for R307, E496 and I568 showed at least 10-fold increases of
surface expression and function of P2X7 over values for monocytes (12,27,29).
Although subjects heterozygous for R307Q showed near absent P2X7
function in monocytes, their P2X7 function was partially restored in
macrophages to values 10-40% of wild type (Fig. 11). However, macrophages
from subject N1 who was also heterozygous for R307Q failed to show any
P2X7 function, possibly because of a second unidentified genetic defect (Fig.
11). Three subjects were double heterozygous for loss-of-function
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
20
polymorphisms, two with R307Q combined with the trafficking-defective I568N
allele (subjects N2 and C1), while the third subject (N3) combined R307Q with
the E496A polymorphism. Monocytes and lymphocytes (both T- and B-cell)
from all three subjects showed total absence of P2X7 function in all 3 freshly
isolated cell types (Table 2). Macrophages grown for 7 days from one of
these double heterozygous subjects also showed a total absence of P2X7
function when assayed multiple times (subject C1 in Fig. 11).
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
21
DISCUSSION
The main finding in this study is that the single nucleotide polymorphism
altering the positively charged Arg307 to uncharged Gln in the extracellular
domain of the P2X7 receptor results in a complete loss-of-function. Positively
charged and conserved amino acid residues such as arginine and lysine in
the extracellular domain of P2X receptors usually contribute to the binding of
the negatively charged phosphate groups of ATP (25,30,31). Therefore,
substitution of these residues to less positively charged, uncharged, or
negatively charged residues effectively abolish the binding of agonists.
Arginine in the homologous position of the extracellular domain is conserved
in all members of the P2X receptor family. Evidence from the study of the
residue homologous to Arg307 in both P2X1 (Arg305) and P2X2 (Arg304)
strongly suggest that this conserved residue is critical for activation by ATP
(30,31). Mutation of Arg-305 in human P2X1 to the less positively charged
lysine reduced the ATP evoked channel peak current to one quarter that of
wild type while mutating Arg305 to the mildly hydrophobic alanine completely
abolished the ATP-evoked current (30). In the rat P2X2 receptor, Arg304
substitution to lysine or alanine reduced the ATP sensitivity by about 10-fold
and 1000-fold respectively (31). These data suggest that Arg307 forms part of
an ATP binding pocket which probably also includes Lys311, since mutation
of the latter residue to alanine also abolishes P2X7 function (25). This binding
site may also include contributions from other positive residues since mutation
of the conserved Lys309 and Arg292 in the P2X1 receptor either abolished
function or reduced the potency of ATP binding (30). However, perhaps due
to the fact that ATP binding to P2X7 is two orders of magnitude weaker than to
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
22
P2X1, modification of any of the critical residues of P2X7 causes total loss of
nucleotide binding (25). Further insight into the ATP binding site of P2X7 is
suggested by secondary structure predictions based on homology with the
known structure of class II aminoacyl-tRNA synthetases (24,36). This
indicates a conserved structure of six beta-pleated sheets between Phe188
and Val321 and further modelling reveals that Lys193 and the cluster of
charged groups including Arg307 and Lys311 are located within this sub-
domain of the extracellular loop. Whether the ATP binding site is formed at
the interface between adjacent monomers in the assembled channel/pore or
lies entirely within each monomer remains uncertain.
Two other polymorphisms, E496A and I568N, have been characterized in
healthy and leukemic human subjects and shown to cause loss-of-function of
the P2X7 receptor. Homozygosity for E496A produces the same amount of
P2X7 protein with markedly reduced pore function while the heterozygous
state gives cells with half the pore function of cells with wild type P2X7 protein
(27). Recent studies have found that the E496A polymorphism does not affect
the electrophysiological phenotype of the P2X7 channel in transfected oocytes
and HEK-293 cells (37) and we have confirmed these findings1. However, the
E496A functional defect can be overcome partially when the density of these
receptors on the cell surface is massively increased following differentiation of
monocytes to macrophages (27). A second loss-of-function polymorphism,
I568N, has been described within a trafficking motif in the C-terminus of P2X7
receptor (28) which blocks receptor function by preventing the receptor
trafficking to the cell surface (29). Large amounts of I568N mutated P2X7
protein is found in the intracellular location but none on the cell surface of
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
23
transfected HEK-293. Monocytes from subjects heterozygous for I568N have
near-to-absent P2X7 function, while macrophages from these same subjects
show partial P2X7 function presumably due to P2X7 upregulation from the
normal I568 allele. However, not all individuals with low P2X7 function can be
explained by these two polymorphisms both of which lie in exon 13.
Therefore, an extensive search of the other 12 exons of the P2RX7 gene was
conducted to find other loss-of-function polymorphisms. The mutation
reported in this study, R307Q, has not been reported in any public
polymorphism database, and is the third polymorphism found to cause loss-
of-function of the human P2X7 receptor with an allele frequency 0.014 in the
Caucasian population. Our study shows that subjects who are double
heterozygotes (compound heterozygotes) show the most profound loss of
P2X7 function. Thus subject C1, who was double heterozygous for
R307Q/I568N, failed to show any functional P2X7 in all our functional assays
of all mononuclear cell types including macrophages (Fig. 1, 2, 3, 4 & 11).
Fig. 9 shows that the R307Q mutant P2X7 receptor expressed in HEK-293
cells fails to bind the anti-human mAb (clone L4). Buell and colleagues, and
our laboratory have shown that the L4 mAb binds to an unknown extracellular
epitope and blocks ATP activation of this receptor by acting as a functional
antagonist (32,33). Western blotting showed robust synthesis of the mutant
receptor (Fig. 5) while our confocal images showed that the mutant P2X7
receptor is strongly expressed on the cell surface (Fig. 6). Moreover a second
monoclonal antibody (clone B2) to the extracellular domain of P2X7 was able
to bind to the R307Q mutant receptor, confirming expression of the mutant
receptor on the cell surface (Fig. 10). This failure of L4 mAb binding to the
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
24
R307Q mutant receptor indicates that the arginine-307 is absolutely required
for antibody binding by forming part of the recognition epitope which in turn
suggests that L4 mAb blocks P2X7 function by steric hindrance at the ATP
binding pocket. In contrast, arginine-307 is important but not essential for
binding of the B2 mAb, and this mAb does not block P2X7 function (27),
Dilatation of the P2X7 channel to form a pore under physiological conditions is
recognized as a unique feature of the P2X7 receptor. However, opening of the
ionic channel and formation of the pore are two distinct processes (28,38)
since the C-terminal truncated P2X7 receptor retains channel activity but lacks
pore formation. In this study, monocytes and macrophages from subjects who
were heterozygous R307Q showed variable reduction of ATP-induced
ethidium uptake to values of 0 to 50% of wild type (Fig 1 & 11). The ATP-
induced Ba2+ influx into lymphocytes was also greatly reduced when subsets
were identified using 2-colour flow cytometry (Fig 3). However, the
fluorometric methods used in this study are not sensitive enough to
distinguish the channel and pore function of the P2X7 receptor. Nevertheless,
our electrophysiological study (Fig. 8) clearly shows that the R307Q
polymorphism abolishes P2X7 channel function as expected by the loss of
ATP binding.
Our data is consistent with a role for the P2X7 receptor in the innate immune
response against obligate intracellular pathogens. There is evidence that
activation of the P2X7 receptor is required for fusion of lysosomes with the
phagosomes of the macrophage which contains engulfed mycobacteria or
chlamydiae. The formation of a phagolysosome results in the subsequent
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
25
killing of these pathogens by a process which is dependent on PLD
stimulation (39-42). Thus the results in Fig. 4 are significant since subject C1
who was double heterozygous for R307Q/I568N showed no ATP-stimulated
PLD activity, while the same subject (Fig. 11) showed total absence of P2X7
function in macrophages. Moreover, we have recently shown that ATP-
induced killing of intracellular mycobacteria is impaired in macrophages from
subjects with low P2X7 function due to homozygosity for the E496A
polymorphism (43). Our data raise the possibility that low or absent P2X7
receptor function due to inherited polymorphisms of this receptor may be a
genetic susceptibility factor in a range of infections as diverse as tuberculosis,
toxoplasma or chlamidia. Individuals who carry two loss-of-function
polymorphisms (compound heterozygotes) in P2X7 may have the highest
susceptibility to these infections by intracellular pathogens because of the
central role of macrophages in innate immunity. It is likely that more
polymorphisms affecting function will be found within the coding and non-
coding regions of the P2RX7 gene and their clinical associations will be the
subject of further study.
Footnotes:
1. M.Smart & S.Petrou. Unpublished observation
Acknowledgment:
We thank Dr. Gary Buell for providing B2 mAb and Dr. Diana Williams for
blood collection.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
26
References:
1. Di Virgilio, F., Bronte, V., Collavo, D., and Zanovello, P. (1989) Journal of Immunology 143, 1955-1960
2. Humphreys, B. D., Rice, J., Kertesy, S. B., and Dubyak, G. R. (2000) Journal of Biological Chemistry 275, 26792-26798
3. Coutinho-Silva, R., Persechini, P. M., Bisaggio, R. D., Perfettini, J. L., Neto, A. C., Kanellopoulos, J. M., Motta-Ly, I., Dautry-Varsat, A., and Ojcius, D. M. (1999) American Journal of Physiology 276, C1139-1147
4. Di Virgilio, F., Chiozzi, P., Ferrari, D., Falzoni, S., Sanz, J. M., Morelli, A., Torboli, M., Bolognesi, G., and Baricordi, O. R. (2001) Blood 97, 587-600
5. North, R. A. (2002) Physiological Reviews 82, 1013-1067 6. Bretschneider, F., Klapperstuck, M., Lohn, M., and Markwardt, F. (1995)
Pflugers Archiv - European Journal of Physiology 429, 691-698 7. Naumov, A. P., Kaznacheyeva, E. V., Kiselyov, K. I., Kuryshev, Y. A.,
Mamin, A. G., and Mozhayeva, G. N. (1995) Journal of Physiology 486, 323-337
8. Tatham, P. E., and Lindau, M. (1990) Journal of General Physiology 95, 459-476
9. Wiley, J. S., Gargett, C. E., Zhang, W., Snook, M. B., and Jamieson, G. A. (1998) American Journal of Physiology - Cell Physiology 44, C1224-C1231
10. Nuttle, L. C., and Dubyak, G. R. (1994) Journal of Biological Chemistry 269, 13988-13996
11. Wiley, J. S., Chen, R., and Jamieson, G. P. (1993) Archives of Biochemistry & Biophysics 305, 54-60
12. Sluyter, R., and Wiley, J. S. (2002) International Immunology 14, 1415-1421
13. Kim, M., Jiang, L. H., Wilson, H. L., North, R. A., and Surprenant, A. (2001) EMBO Journal 20, 6347-6358
14. Ferrari, D., Los, M., Bauer, M. K., Vandenabeele, P., Wesselborg, S., and Schulze-Osthoff, K. (1999) FEBS Letters 447, 71-75
15. Wen, L. T., Caldwell, C. C., and Knowles, A. F. (2003) Molecular Pharmacology 63, 706-713
16. el-Moatassim, C., and Dubyak, G. R. (1992) Journal of Biological Chemistry 267, 23664-23673
17. Gargett, C. E., Cornish, E. J., and Wiley, J. S. (1996) Biochemical Journal 313, 529-535
18. Jamieson, G. P., Snook, M. B., Thurlow, P. J., and Wiley, J. S. (1996) Journal of Cellular Physiology 166, 637-642
19. Gu, B., Bendall, L. J., and Wiley, J. S. (1998) Blood 92, 946-951 20. Nicke, A., Baumert, H. G., Rettinger, J., Eichele, A., Lambrecht, G.,
Mutschler, E., and Schmalzing, G. (1998) EMBO Journal 17, 3016-3028
21. Kim, M., Spelta, V., Sim, J., North, R. A., and Surprenant, A. (2001) Journal of Biological Chemistry 276, 23262-23267
22. Wiley, J. S., Chen, R., Wiley, M. J., and Jamieson, G. P. (1992) Archives of Biochemistry & Biophysics 292, 411-418
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
27
23. Klapperstuck, M., Buttner, C., Schmalzing, G., and Markwardt, F. (2001) Journal of Physiology 534, 25-35
24. Freist, W., Verhey, J. F., Stuhmer, W., and Gauss, D. H. (1998) FEBS Letters 434, 61-65
25. Worthington, R. A., Smart, M. L., Gu, B. J., Williams, D. A., Petrou, S., Wiley, J. S., and Barden, J. A. (2002) FEBS Letters 512, 43-46
26. Denlinger, L. C., Fisette, P. L., Sommer, J. A., Watters, J. J., Prabhu, U., Dubyak, G. R., Proctor, R. A., and Bertics, P. J. (2001) Journal of Immunology 167, 1871-1876
27. Gu, B. J., Zhang, W., Worthington, R. A., Sluyter, R., Dao-Ung, P., Petrou, S., Barden, J. A., and Wiley, J. S. (2001) Journal of Biological Chemistry 276, 11135-11142
28. Smart, M. L., Gu, B., Panchal, R. G., Wiley, J., Cromer, B., Williams, D. A., and Petrou, S. (2003) J Biol Chem 278, 8853-8860
29. Wiley, J. S., Dao-Ung, L.-P., Li, C., Shemon, A. N., Gu, B. J., Smart, M. L., Fuller, S. J., Barden, J. A., Petrou, S., and Sluyter, R. (2003) J. Biol. Chem. 278, 17108-17113
30. Ennion, S., Hagan, S., and Evans, R. J. (2000) Journal of Biological Chemistry 275, 29361-29367
31. Jiang, L. H., Rassendren, F., Surprenant, A., and North, R. A. (2000) Journal of Biological Chemistry 275, 34190-34196
32. Buell, G., Chessell, I. P., Michel, A. D., Collo, G., Salazzo, M., Herren, S., Gretener, D., Grahames, C., Kaur, R., Kosco-Vilbois, M. H., and Humphrey, P. P. (1998) Blood 92, 3521-3528
33. Gu, B. J., Zhang, W. Y., Bendall, L. J., Chessell, I. P., Buell, G. N., and Wiley, J. S. (2000) American Journal of Physiology - Cell Physiology 279, C1189-1197
34. Sluyter, R., Barden, J. A., and Wiley, J. S. (2001) Cell & Tissue Research 304, 231-236
35. Hickman, S. E., el Khoury, J., Greenberg, S., Schieren, I., and Silverstein, S. C. (1994) Blood 84, 2452-2456
36. Hansen, M. A., Barden, J. A., Balcar, V. J., Keay, K. A., and Bennett, M. R. (1997) Biochemical & Biophysical Research Communications 236, 670-675
37. Boldt, W., Klapperstuck, M., Buttner, C., Sadtler, S., Schmalzing, G., and Markwardt, F. (2003) Am J Physiol Cell Physiol 284, C749-756
38. Surprenant, A., Rassendren, F., Kawashima, E., North, R. A., and Buell, G. (1996) Science 272, 735-738
39. Molloy, A., Laochumroonvorapong, P., and Kaplan, G. (1994) Journal of Experimental Medicine 180, 1499-1509
40. Fairbairn, I. P., Stober, C. B., Kumararatne, D. S., and Lammas, D. A. (2001) Journal of Immunology 167, 3300-3307
41. Kusner, D. J., and Barton, J. A. (2001) Journal of Immunology 167, 3308-3315
42. Coutinho-Silva, R., Stahl, L., Raymond, M. N., Jungas, T., Verbeke, P., Burnstock, G., Darville, T., and Ojcius, D. M. (2003) Immunity 19, 403-412;
43. Saunders, B. M., Fernando, S. L., Sluyter, R., Britton, W. J., and Wiley, J. S. (2003) J Immunol 171, 5442-5446
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
28
Figure Legends: Fig. 1 ATP-induced ethidium uptake curve in mononuclear cell subsets
from healthy wild type and R307Q heterozygous subjects. 2 x 106 cells
pre-labeled with appropriate FITC-conjugated cell-specific mAb were
incubated in 1 ml KCl medium at 37oC. Ethidium bromide (25 µM) was added
followed 40 s later by 1 mM ATP. Mean channel of cell-associated
fluorescence intensity was measured at 5 s intervals for B-lymphocytes (gated
CD19+), T-lymphocytes (gated CD3+), NK cells (gated CD16+) and monocytes
(gated CD14+).
Fig. 2. ATP-induced Rb+ efflux from lymphocytes from either wild type
or R307Q heterozygous CLL subjects. Lymphocytes were loaded for 2 h
with 86Rb+. Cells were washed, resuspended in KCl medium and incubated
for 5 min at 37°C before incubation in the presence or absence of 1.0 mM
ATP for 4 min. Samples (1 mL) were collected at 1 min intervals. 86Rb+ efflux
is expressed as (1-Nt/No) where Nt was the level of cell-associated
radioactivity at time t and No the amount of cell-associated radioactivity at time
zero. The data have been analysed after log transformation to permit
calculation of efflux rate constants (k). Data from wild type subjects is from 5
experiments; data from mutant subjects is representative two separate
experiments.
Fig. 3. ATP-induced Ba2+ influx into T lymphocytes and NK cells from
healthy wild type subjects or R307Q heterozygotes. Mononuclear cells
were incubated with 1 µg/mL Fura-Red for 30 min and washed once. Cells
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
29
were labeled with FITC-conjugated anti-CD3 mAb and resuspended in KCl
medium at 37°C. Ba2+ (1 mM) was added followed 40 s later by 1 mM ATP.
The mean channel of cell-associated fluorescence intensity was measured at
2-s intervals for gated CD3+ T-lymphocytes.
Fig. 4. ATP-induced phospholipase D activity - B lymphocytes (1 x 107
cells/ml) from 3 CLL subjects with wild type (WT) and 1 CLL subject double
heterozygous for R307Q/I568N (C1) were labelled with [3H] Oleic acid (2-5
µCi/ml) followed and pre-incubated for 5 min in KCl medium with the
presence of the primary alcohol, 1-butanol (30 mM) which yields a stable
phophatidylalcohol end product following PLD stimulation. The cells were then
incubated with/without ATP (0.5 mM) or PMA (0.1 µM) for 15 min at 37°C.
Membrane lipids were extracted and the level of phosphatidylbutanol (PBut)
was determined.
Fig. 5. P2X7 protein synthesis in transfected HEK-293 cells. HEK-293
cells transiently transfected with wild type and R307Q mutant P2X7 were
lysed and proteins were separated by SDS-PAGE under reducing conditions,
followed by a 4-hour transfer to nitrocellulose membrane. The membrane
was blocked and probed using sheep anti-human P2X7 antibody. The
presence of a protein band (~70 KD) corresponding to the P2X7 receptor.
Untransfected HEK-293 cells were used as control. Similar results were
obtained by using the rabbit anti-rat P2X7 antibody (data not shown).
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
30
Fig. 6. Confocal microscope images of P2X7 expression in HEK-293 cells.
HEK-293 cells were transiently transfected with pCI Vector (Mock), wild-type,
R307Q or I568N mutant P2X7 cDNA as indicated. Cells were fixed and
incubated with pre-immune serum or sheep anti-human P2X7 antibody, and
subsequently with Cy3-conjugated anti-sheep IgG antibody before analysis by
confocal microscopy. Similar results were observed using the rabbit anti-rat
P2X7 antibody (data not shown). Pre-immune serum showed no binding.
Fig. 7. BzATP-induced ethidium+ uptake into transfected HEK-293 cells
Cells transiently transfected with pCI vector (Mock), wild-type or R307Q
mutated P2X7 cDNA as indicated. Cells were washed and resuspended in 1
mL of NaCl medium. Ethidium+ (25 µM) was added followed 40 s later by
BzATP. The mean channel of cell-associated fluorescence intensity was
measured at 5-s intervals for gated HEK-293 cells. The area under ethidium
uptake curve in 150 s after addition of BzATP was calculated and normalized.
Results were presented as mean ± S.D. (n=3).
Fig. 8 ATP-invoked current in oocytes. Oocytes from adult female
Xenopus laevis were injected with 50 nl of cRNA-encoding wild type P2RX7
(A) or mutant P2RX7 R307Q receptors (B) (~1 µg/µl) and were stored at 18oC
for 2 days prior to experimentation. For two electrode voltage clamp
recordings, oocytes were impaled with two glass electrodes containing 3 M
KCl and held at 18oC at a membrane potential of 70mV. 100 µM ATP
dissolved in bath solution was applied to the oocyte as indicated. One
representative experiment of four or five.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
31
Fig. 9. Flow cytometric histograms of P2X7 expression in HEK-293 cells
using clone L4 mAb. HEK-293 cells were transiently transfected with wild
type (top panels) or R307Q mutated (bottom panels) P2X7 cDNA. Non-
permeabilized cells (left panels, surface P2X7 expression), and fixed and
permeabilized cells (right panels; intracellular P2X7 expression) were labeled
with FITC-conjugated anti-P2X7 mAb (clone L4) (solid line) or isotype control
mAb (shaded line) and the level of P2X7 expression determined by flow
cytometry. One representative experiment of four.
Fig. 10 Saturation curve of clone B2 mAb. HEK-293 cells were transiently
transfected with pCI Vector (Mock), wild type or R307Q mutated P2X7 cDNA
as indicated. Cells were labeled with mouse anti-human P2X7 mAb (clone B2)
for 20 min at R.T. and washed twice before incubated with PE-conjugated
sheep anti-mouse immunoglobulin antibody. Cells were washed once and
mean channel of cell-associated fluorescence was measured by flow
cytometry. One representative experiment of two.
Fig.11. ATP-induced ethidium+ uptake in monocyte-derived
macrophages. Monocyte-derived macrophages (activated with interferon-γ)
from wild-type subject or R307Q heterozygotes (see table 2) were labeled
with FITC-conjugated anti-CD14 mAb and suspended in KCl medium at 37oC.
Ethidium+ (25 µM) was added, followed 40 s later by the addition of 1 mM
ATP (arrow). Mean channel of cell-associated fluorescence was measured by
time-resolved flow cytometry. The voltage setting for ethidium is reduced in
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
32
order to gain full scale of uptake increasing. Basal ethidium+ uptake measured
in the absence of ATP is shown.
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
33
Table 1. Primers used to screen the P2RX7 gene (accession NT_009775.8)
Region Forward Primer (5’→3’)
Reverse Primer (5’→3’)
Product Size (bp)
Exon 1 tcagaatgtgcacctgaagc ccagtacgtttcattttgcag 315
Exon 2 ggctgtagatcctaggggaag agtcacacggaagcaagtca 379
Exon 3 gtccgcatttctgcttcttc cccagcaagctggattatta 230
Exon 4 tgacctgggcatcacaaat gtgtgcacattctggtggat 241
Exon 5 taggacccaggactttgcag cgggttgagttaatgatgtcc 299
Exon 6 ttcaggcttctgaggtttgg agaagcctctggtcccactg 239
Exon 7 gcctcttggctgtttgacat tggaacctctccaccacact 300
Exon 8 gttgccttggaaaccaaaat ctatgcagggagatgtctgg 300
Exon 9 gccccacagcagtaattagg gctgcagtgagtggtaatcct 279
Exon 10&11 tagaacccagcgacgtatcc ccaacaattgcacgttgaag 499
Exon 12 ggggcataaaagggactcct tgagccagcttgttcaatagtc 399
Exon 13 cagacgtgagccacggtgc gaacctagaacctgagggct 579
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
34
Table 2. P2X7 Expression and Function in Leukocytes with R307Q (946G→A) Polymorphism
Genotype
P2X7 expression (mean channels of fluorescence
intensity)
P2X7 function (arbitrary units of area under ATP-induced
ethidium+ uptake at 5 min)
946 1513 1729 B-lymphocyte T-lymphocyte B-lymphocyte T-lymphocyte Monocyte
Healthy Subjects N1 G/A A/A T/T 6.1 4.3 615 0 319 N2 G/A A/A T/A 2.1 1.5 194 219 149 N3 G/A A/C T/T 2.5 3.8 212 0 58 N4 G/A A/A T/T 1.0 1.8 465 61 913 N5 G/A A/A T/T 3.0 4.8 1075 97 844
B-CLL Subjects
C1 G/A A/A T/A 2.1 1.7 70 68 0 C2
G/A A/A T/T 3.6 5.1 521 129 0
Healthy wild type Subjects (Mean ± S.D.)
(n = 18-20)
G/G
A/A
T/T
10.0±5.0
7.1±3.5
4013±2010
2951±2311
22705±7696
Mononuclear cell preparations (1 x 107/ml) from healthy or CLL subjects were incubated for 20 min at 20oC with FITC-conjugated P2X7 mAb
(clone L4) plus PE-labeled CD3 and PE-Cy5-labeled CD19 surface marker antibody in HEPES buffered saline containing 10% group AB serum.
Cells were washed once and analyzed for P2X7 expression on subpopulations gated for B-lymphocytes (CD19+, CD3-), T-lymphocytes (CD3+,
CD19-). Isotype control values ranged from 2±1 mean channels of fluorescence intensity and were subtracted from the values for each type.
Function of P2X7 was measured by the area under the ATP-induced ethidium uptake curve on gated subpopulations gated by appropriate surface
markers. Uptake of ethidium was negligible in the absence of ATP.
by guest on February 19, 2018 http://www.jbc.org/ Downloaded from
B Lymphocytes
-1 0 1 2 3 4 5
Ethi
dium
Upt
ake
(Lin
ear M
ean
Cha
nnel
/ C
ell)
0
10
20
30
40
50
60 BasalWild TypeN1C2C1
T Lymphocytes
-1 0 1 2 3 4 50
10
20
30
40
50
60 BasalWild TypeN1C2C1
NK Cells
-1 0 1 2 3 4 50
20
40
60
80
BasalWild TypeN1C2
Monocytes
-1 0 1 2 3 4 50
50
100
150
200 BasalWild TypeN1C2C1
Time (min)
ATP
ATPATP
ATP
Fig. 1
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Time (min)0 1 2 3 4
86R
b+ e
fflux
[Log
(1- N
t/Nto
tal)]
0.1
1
BasalWild TypeC1C2
Fig. 2
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
T Lymphocytes
Time (min)-1 0 1 2 3
Fura
-Red
Inte
nsity
(Lin
ear M
ean
Cha
nnel
/ C
ell)
0250
300
350
400
450
500
550
600
650
700
BasalWild TypeN1C1
Fig. 3
ATP
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Control ATP PMA
%PB
ut a
ccum
ulat
ion
ofto
tal l
ipid
s (m
eanS
.D.)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
0.82%
1.82%
C1WT
Fig. 4
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Control R307Q WT
97kDa
66kDa
Fig. 5
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
WT WT
R307Q R307Q
I568N Mock
Fig. 6
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
BzATP Concentration (µM)
0.1 1 10 100 1000
% o
f Max
imum
Res
pons
e
-20
0
20
40
60
80
100
120
MockR307QWild Type
Fig. 7
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
20 s
10 nA
100 M ATPµ
20 nA20 s
100 M ATPµ
Wild TypeA. B. R307Q Mutant
Fig. 8
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Cel
l Cou
nt
Fig. 9
Wild Type
R307Q
IntracellularSurface
FITC-anti-hP2X7 mAb (L4) Fluorescent Intensity
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Concentration of B2 mAb
0 0.1 1 10 100 1000
Fluo
resc
ence
Inte
nsity
(Log
mea
n C
hann
el)
0
50
100
150
200
250 MockR307QWild Type
Fig. 10
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Fig. 11
Time (min)-1 0 1 2 3 4 5
Ethi
dium
Upt
ake
(Lin
ear M
ean
Cha
nnel
/ C
ell)
0
50
100
150
200BasalC1N1N5C2Wild Type
ATP
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
James S. WileyDao-Ung, Stephen J. Fuller, Julian A. Barden, Alison L. Clarke, Steven Petrou and
Ben J. Gu, Ronald Sluyter, Kristen K. Skarratt, Anne N. Shemon, Lan-PhuongLoss-of-function of the human P2X7 receptor
An Arg-307 to Gln polymorphism within the ATP-binding site causes
published online April 27, 2004J. Biol. Chem.
10.1074/jbc.M313902200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
top related