bacterial gene inactivation using pcr products
Post on 18-Jul-2015
1.647 Views
Preview:
TRANSCRIPT
Inactivation of genes in bacteria
using PCR products
Requirements for the method
and adaptations to different models
Luis M. Ramírez Ch.
Why do we inactivate genes?
Is not it just a hobby?
Gene targeting: The classical approach
• Central to an understanding of the in vivo
function of genes is their analysis by mutation,
that is, inactivation or modification of a gene
by mutation and the study of the
consequences of the mutation in the mutant
organism.
Rajewsky et al. J. Clin. Invest. 1996.
Inactivation of genes in bacteria
using PCR products:
step by step
PCR amplify of a FRT-flanked resistance gene
Baba et al. Molecular Systems Biology. 2006.
Transform strain expressing λ Red Recombinase
Select antibiotic resistant transformants
Baba et al. Molecular Systems Biology. 2006.
Eliminate resistance cassette using a
FLP expression plasmid
Baba et al. Molecular Systems Biology. 2006.
Structure of deletions
Baba et al. Molecular Systems Biology. 2006.
Requirements
PCR amplify of a FRT-flanked resistance gene
Baba et al. Molecular Systems Biology. 2006.
Requirements for the step
• A Plasmid carrying a λ Red Recombinase system
Datsenko & Wanner. 2000. Liang & Liu. 2000.
Requirements for the step
• A Plasmid carrying a λ Red Recombinase system
Gust et al. 2004. Chaveroche et al. 2000.
Requirements for the step
• A Plasmid carrying a λ Red Recombinase system
• A template plasmid carrying an antibiotic resistance
gene flanked by FRT recombination sites
Datsenko & Wanner. PNAS. 2000.
Some tips..
• Use pKD3 (Cm) or pKD4 (Kan) if you would like toknockout a gene with minimal polarity effects ondownstream genes.
• Use pKD13 (Kan), pKD32 (Cm), or pKD81 (Kan fromTn903) to knockout entire operons, single genes, or anyother situation in which polarity shouldn’t matter.
Kim. 2001
from: http://falkow.stanford.edu/whatwedo/general/wanner.pdf
Requirements for the step
• Primer design
Datsenko & Wanner. PNAS. 2000. Baba et al. Molecular Systems Biology. 2006.
Requirements for the step
• Primer design (using pKD4 as a template)
Datsenko & Wanner. PNAS. 2000.
Forward:
(47 bp upstream sequence)(ATG)(TGTAGGCTGGAGCTGCTTCG)
Reverse:
(Codons for the
6 C Terminal residues)(Stop codon)(29-nt downstream)(TATGAATATCCTCCTTAG)
Baba et al. Molecular Systems Biology. 2006.
Transform strain expressing λ Red Recombinase
Select antibiotic resistant transformants
Baba et al. Molecular Systems Biology. 2006.
Requirements for the step
• Prepare electrocompetent cells. The media
must contain the inductor (L-Arabinose)
• Electroporate as much as possible DNA you
can, even though the ammount depends on
the species. High, but not enough to cause
arcing. So, to avoid arcing, DNA must be as
clean as possible.
Eliminate resistance cassette using a FLP
expression plasmid
Baba et al. Molecular Systems Biology. 2006.
Structure of deletions
Baba et al. Molecular Systems Biology. 2006.
Adaptation to different models
• Pseudomonas aeruginosa
(Lesic & Rahme. BMC Molecular Biology 2008, 9:20)
• Yersinia spp.
(Derbise, Lesic, Dacheux, Ghigo, Carniel. FEMS
Immunology and Medical Microbiology 2003 38:113-
116)
Pseudomonas aeruginosa
Lesic & Rahme. 2008
Thanks
top related