bioprocessing of recombinant cho-k1, cho-dg44 and cho...
Post on 18-Nov-2020
7 Views
Preview:
TRANSCRIPT
1
Research Article
Bioprocessing of recombinant CHO-K1, CHO-DG44 and CHO-S: CHO expression hosts
favor either mAb production or biomass synthesis†
David Reinhart1,*, Lukas Damjanovic1, Christian Kaisermayer2, Wolfgang Sommeregger3,
Andreas Gili4, Bernhard Gasselhuber5, Andreas Castan6, Patrick Mayrhofer1, Clemens
Grünwald-Gruber5, Renate Kunert1
1Department of Biotechnology, University of Natural Resources and Life Sciences, Vienna,
Muthgasse 11, 1190 Vienna, Austria
2BioMarin International Limited, Shanbally, Ringaskiddy, County Cork, Ireland
3Bilfinger Industrietechnik Salzburg GmbH, Urstein Nord 31, 5412 Puch bei Hallein, Austria
4Polymun Scientific Immunbiologische Forschung GmbH, Donaustraße 99, 3400
Klosterneuburg, Austria
5Department of Chemistry, University of Natural Resources and Life Sciences, Vienna,
Muthgasse 18, 1190 Vienna, Austria
6GE Healthcare Life Sciences AB, Björkgatan 30, 75184 Uppsala, Sweden
*Correspondence: Dr. David Reinhart
Department of Biotechnology, University of Natural Resources and Life Sciences, Vienna,
Muthgasse 11, 1190 Vienna, Austria
Email: david.reinhart@boku.ac.at
†This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: [10.1002/biot.201700686]. This article is protected by copyright. All rights reserved Received: November 6, 2017 / Revised: April 9, 2018 / Accepted: April 12, 2018
2
Authors
David Reinhart: david.reinhart@boku.ac.at
Lukas Damjanovic: lukas.damjanovic@boku.ac.at
Wolfgang Sommeregger: wolfgang.sommeregger@bilfinger.com
Andreas Gili: andreas.gili@polymun.com
Bernhard Gasselhuber: bernhard.gasselhuber@boku.ac.at
Andreas Castan: andreas.castan@ge.com
Christian Kaisermayer: christian.kaisermayer@bmrn.com
Patrick Mayrhofer: patrick.mayrhofer@boku.ac.at
Clemens Grünwald-Gruber: clemens.gruber@boku.ac.at
Renate Kunert: renate.kunert@boku.ac.at
Keywords: Batch; bioprocess development; Chinese hamster ovary; fed-batch; monoclonal
antibody; perfusion; product quality
Abbreviations: BAC, bacterial artificial chromosome; CHO, Chinese hamster ovary; HC,
heavy chain; LC, light chain; mAb, monoclonal antibody; STY, space-time yield; VCCD,
viable cumulative cell days
3
Abstract
Chinese hamster ovary (CHO) cells comprise a variety of lineages including CHO-DXB11,
CHO-K1, CHO-DG44 and CHO-S. Despite all CHO cell lines sharing a common ancestor,
extensive mutagenesis and clonal selection has resulted in substantial genetic heterogeneity
among them. Data from sequencing shows that different genes are missing in individual CHO
cell lines and each cell line harbors a unique set of mutations with relevance to the bioprocess.
However, not much literature is available about the influence of genetic differences of CHO
on the performance of bioprocess operations. In this study, we examined host cell-specific
differences among three widely used CHO cell lines (CHO-K1, CHO-S and CHO-DG44) and
recombinantly expressed the same monoclonal antibody (mAb) in an isogenic format by using
bacterial artificial chromosomes (BACs) as transfer vector in all cell lines. Cell-specific
growth and product formation were studied in batch, fed-batch and semi-continuous perfusion
cultures. Further, two different cell culture media were used to investigate their effects. We
found CHO cell line-specific preferences for mAb production or biomass synthesis that were
determined by the host cell line. Additionally, quality attributes of the expressed mAb were
influenced by the host cell line and media.
4
1. Introduction
CHO cells comprise a variety of lineages such as CHO-DXB11 (or DUKX), CHO-K1, CHO-
DG44 and CHO-S that share a common ancestor. The original CHO cell line was generated
by Dr. Theodore Puck in 1956 who isolated spontaneously immortalized fibroblasts from a
culture of ovarian cells of a Chinese hamster [1]. CHO-K1 was derived from a subclone of the
original cell line in 1957. In 1980, CHO-DXB11 (or DUKX) was generated through chemical
mutagenesis of CHO-K1 [2]. The dihydrofolate reductase (dhfr) deficiency enabled the stable
introduction of transgenes when co-transfected with a functional copy of the dhfr gene as a
selection marker. In 1983, Urlaub et al. [3] deleted both dhfr alleles by mutagenesis of a
different CHO cell starting population, thus generating CHO-DG44 lineage. In 1991, the
CHO-S cell line was generated from another CHO cell starting population. Nowadays, all
these cell lines are widely used for the production of biopharmaceuticals.
Since the introduction of the original CHO cell line, extensive mutagenesis and clonal
selection has resulted in substantial genetic heterogeneity among the different CHO cell
lineages [4-6]. Karyotyping of various CHO cells underpins this genetic diversity by
highlighting several deletions, translocations or rearrangements of chromosomal segments
[4]. Even within a supposedly monoclonal population of the ancestor of CHO-K1, substantial
heterogeneity was found [7]. Similar observations were made in a karyogram of CHO-DG44
cells [8]. Further evidence concerning phenotypic diversity comes from substantial gene copy
number variations (CNVs), ploidy and small-nucleotide polymorphisms (SNPs) among CHO-
K1, CHO-DG44 and CHO-S lineages [5]. Finally, epigenetic variations (e.g. histone
modifications, chromatin remodeling and DNA methylation) modifying gene expression also
exists for CHO cells [9-11].
In recent years, sequencing data demonstrated genetic differences among different CHO cell
lines leading to speculation on their relevance for bioprocessing [4, 5, 12-14]. However, while
sequencing data increases, studies investigating their biological/technological significance
5
remain scarce. In this study, we examined host cell-specific differences of production clones
among three widely used CHO cell lines (CHO-K1, CHO-S and CHO-DG44). We expressed
the same mAb in all three CHO cell lines to avoid product-related effects on the host cell line
such as the physicochemical properties of the recombinant product [15] or on nutrient
requirements (e.g. amino acid usage). Position effects, which are commonly observed upon
random integration of plasmid DNA, were circumvented by using BACs as genetic transfer
vehicle providing a quasi-isogenic environment of the recombinant gene in different
production clones. These vectors achieve position-independent, but gene copy number
(GCN)-dependent, high and stable product expression even without the need of transgene
amplification [16]. Cell growth and product formation were studied in batch, fed-batch and
semi-continuous perfusion cultures. Two different cell culture media were used for all cell
lines to investigate the effect on the bioprocess and mAb quality. Phenotypic differences
among CHO cell lineages were confirmed in our study demonstrating the effect of genotypic
variations and their relevance for bioprocessing. The combination of CHO sequence-specific
knowledge and lineage-specific cultivation behavior will be a powerful tool for future cell
line engineering and development, as well as improvement of bioprocesses and cell culture
media.
6
2. Materials and methods
2.1. Cell lines and media
2.1.1. Generation of recombinant cell lines
Recombinant mAb (IgG) expressing CHO-K1, CHO-DG44 and CHO-S cell lines were
generated according to a previously described methodology [16]. Briefly, serum-free adapted
host cell lines derived from CHO-K1 (ATCC CCL-61), CHO-DG44 (Life Technologies) and
CHO-S (Life Technologies) were transfected using linearized BAC DNA, containing
antibody light and heavy chain transgenes, and Lipofectin (Life Technologies). In-between
the first thaw of the cells upon acquisition and their transfection, host cells were passaged
under controlled conditions 10 (CHO-S), 62 (CHO-K1) and 89 times (CHO-DG44). The
primary transfectants were seeded as mini-pools (5,000 cells/well in 100 µL) in 96-well
culture plates (Nunc, Thermo Fisher Scientific) and incubated at 37°C and 5% CO2 for 2-3
weeks. Then, wells in which cell growth was observed were screened for mAb production.
Mini-pools with high mAb concentrations were expanded in T-25 cell culture flasks (Greiner
Bio-One). During three consecutive passages, the best clone was selected based on cell-
specific mAb productivity (qP) and cell growth for single-cell dilution sub-cloning (one
cell/well in a 384-well cell culture plate). Grown (monoclonal) wells were expanded and
analyzed as described above to define the final production clone. CHO-DG44 host cell lines
are deficient in the dhfr gene, which is typically co-transfected with the gene of interest
during cell line development. Since CHO-K1 and CHO-S cells produce dhfr, we co-
transfected the CHO-DG44 cells with the BAC and a dhfr-containing plasmid for a fair
evaluation.
2.1.2. Medium adaptation and cell banking
All CHO cell lines were initially grown in CD CHO (Life Technologies) supplemented with 8
mM L-glutamine (Sigma-Aldrich) and 0.5 mg/mL G418 (Sigma-Aldrich) during routine
7
cultivation. Routine cultures were inoculated at a cell concentration of 3×105 c/mL in 125 mL
Erlenmeyer shake flasks (Corning) at a working volume of 35 mL and cultivated in an ISF1-
X incubator shaker (Kuhner) operated at 37°C, 140 rpm, 7% CO2 and 90% relative humidity.
The cells were split every 3 to 4 days.
Adaptation to ActiCHOTM P (GE Healthcare) was performed by direct inoculation into the
alternative medium. When the cells reached similar concentrations and viabilities as in CD
CHO, the homogeneity (absence of subpopulations) of the successfully adapted cell lines was
confirmed by flow cytometry according to a previously published protocol [17]. The absence
of any low or non-producing subpopulations was confirmed by visualization of intracellularly
stained antibody heavy and light chains with FITC-conjugated anti-human γ-chain (Sigma)
and Alexa Fluor-647-conjugated anti-human λ-chain specific antiserum (Thermo Scientific),
respectively. Subsequently, research cell banks were prepared in CryoMaxx II (GE
Healthcare) for all following experiments.
2.2. Bioprocessing in batch, fed-batch and perfusion mode
Batch and fed-batch experiments were performed in a shake incubator at the conditions
described above. 500 mL Erlenmeyer shake flasks (Corning) were inoculated at a starting cell
concentration of 3×105 c/mL and a working volume of 130 mL using ActiCHO P or CD CHO
as basal media. Cultures were terminated once the viability dropped below 60%. All
experiments were conducted as biological triplicates from the same inoculum and operated as
individual cultivations.
Batch experiments were analyzed daily for cell concentration, viability, antibody and
metabolite concentrations, as well as osmolality.
In fed-batch experiments, two strategies were compared using different basal and feed media.
In ActiCHO P, nutrient feeding started on day 3 with daily feed additions of ActiCHOTM Feed
A and ActiCHOTM Feed B (both GE Healthcare) at 3% and 0.3% of the working volume,
8
respectively. In CD CHO, cultures were fed on days 4, 6 and 8 with CHO CD
EfficientFeedTM A and FunctionMAXTM Titer Enhancer (both Life Technologies) at 10% and
3.3% of the working volume, respectively. For both fed-batch strategies, the residual glucose
concentration was maintained above 3 g/L by adding a 250 g/L concentrated glucose solution
(Sigma-Aldrich) to a final concentration of 6 g/L. Sampling was performed as described for
batch experiments. Total RNA was prepared at day 4, 7 and at harvest to analyze intracellular
heavy chain and light chain mRNA levels by qPCR. Product quality was analyzed by mass
spectrometry (glycosylation) and differential scanning calorimetry (thermal stability).
Semi-continuous perfusion experiments were conducted at conditions described above at a
starting cell concentration of 5×106 c/mL. The basal cell culture medium was exchanged once
per day after separating the cells by centrifugation applying 200×g for 10 min. The
centrifugation conditions are commonly applied for routine cultivation and do not impact cell
growth or viability. The semi-continuous perfusion cultures were operated for 11 days at high
viabilities and then terminated.
2.3. Cell concentration and viability
The total cell concentration was quantified using a Z2 Coulter Counter™ (Beckman Coulter)
according to the manufacturer’s instructions. The viability was determined by trypan blue dye
exclusion with a Neubauer improved hemocytometer (MedPro).
2.4. Antibody concentration
Antibody concentrations were determined by Bio-Layer Interferometry on an Octet™ QK
(Pall) as previously described [18].
9
2.5. qPCR
Preparation of cDNA was previously described [19]. qPCR was performed using the
MiniOpticon™ system with 48-well low white PCR plates and microseal B film sealer (all
from BioRad). All primers were designed using the Primer3 web application [20] and
synthesized (Sigma-Aldrich). Primers were designed to amplify fragments of the nt-sequence
in the constant regions of the mAbs heavy and light chain as shown in Tab.1. The genes of β-
actin (ACTB) and the eukaryotic translation initiation factor 3 subunit I (EIF3I) served as
internal reference genes. qPCR was performed with 3 ng of cDNA including non-template
controls, negative controls and no-reverse-transcriptase controls. Next to the template, each
reaction mix contained 10 µL KAPA PROBE Fast Universal (peqlab) and 6 pmol of each
primer. qPCR was performed in 2-step mode and all samples were measured in triplicates of
three biological samples in two technical runs. Data evaluation and calculations based on the
2−ΔΔCq method [21] were previously described [19, 22]. Data normalization was performed
using both reference genes.
2.6. Antibody purification
For analysis of antibody product quality, cell culture supernatants were purified using
HiTrap™ MabSelect SuRe™ 1 mL columns according to the manufacturer’s
recommendations (GE Healthcare).
2.7. Glycan analysis
Glycoprofiling was performed to investigate oligosaccharide distribution of antibody product
upon harvest from fed-batch cultures. The cell suspension was centrifuged at 170×g, the
supernatant clarified using a 0.22 µm filter (Express PLUS, Merck Millipore) and diluted with
PBS to a concentration of 1 to 2 mg/mL. N-glycan profiles of the Fc regions of the
monoclonal antibodies were determined by IdeS proteolytic digestion and electrospray mass
10
spectrometry according to a published protocol [23]. This procedure was modified by
including carboxypeptidase B to remove unprocessed C-terminal lysine residues to improve
the quality of the data obtained for the Fc region of the heavy chain. Also, a reduction step
was introduced to improve the quality of data obtained for the light chain and the heavy chain
Fab region. Analysis was performed using the separation offered by reversed phase liquid
chromatography in combination with detection by electrospray Q-Tof mass spectrometry. Fc
fragment signals having masses corresponding to N glycan isoforms G0, G0F, G0F-Gn, G1F-
Gn, G1F, G2F, G1F+SA1, G2F+SA1, G2F+SA2, Man5 to Man9, Man9+Glc, and Man-
9+2Glc were investigated and their relative abundance estimated from the intensity of these
signals. The small signals for N glycan isoforms G1 and G2 were not amenable to
quantification as their mass is only separated by 6 Da from the sodium adducts of G0F and
G1F isoforms.
2.8. Differential Scanning Calorimetry
Thermal denaturation of antibody samples was analyzed using automated differential
scanning calorimetry (DSC). All DSC measurements were performed on a VP-DSC MicroCal
LLC equipment (GE Healthcare). Protein solutions were sampled from 96-well plates using
the robotic attachment. Protein concentration of all samples was 10 μM. The temperature
profile was recorded between 20°C and 100°C with a scan rate of 1°C/min. The results were
evaluated and fitted with Origin 7.0 software (OriginLab). The unfolding states of the
antibodies were fit using the non-two state unfolding model in the software.
3. Results
3.1. Generation of recombinant CHO cell lines and media adaptation
Unlike randomly integrated plasmid DNA, which often results in transfectants with
substantially differing rates of recombinant protein expression, BAC based vectors enable a
11
more comparable and stable product expression even without the need of transgene
amplification. For this study, three recombinant CHO cell lines were generated by
transfection with the same BAC constructs in CHO-K1, CHO-S and CHO-DG44 host cell
lines. Among all screened mini-pools, the average specific mAb production rates prior to
subcloning were 5.04 ± 2.37 (CHO-K1), 3.29 ± 1.82 (CHO-S) and 1.10 ± 0.73 (CHO-DG44)
picogram mAb per cell and day (pcd).
Cell line development and clone selection was initially performed in CD CHO. To investigate
potential medium-specific effects, all three CHO cell lines were adapted to a second
chemically defined cell culture medium (ActiCHO P). Direct adaptation was successful and
all three recombinant CHO cell lines reached similar or even higher cell concentrations and
viabilities during routine cultivation as in the initial medium (Supplement 1). Furthermore, a
successful medium adaptation was confirmed by affirming the homogeneity of all adapted
cell lines and the absence of any low or non-producing subpopulations (Supplement 2).
3.2. Batch evaluation of CHO-K1, CHO-S and CHO-DG44 cell lines
Batch cultivation revealed higher peak cell concentrations for CHO-S and CHO-DG44 than
for CHO-K1 (Fig.1; Supplement 3). CHO-S cells grew with the highest cell-specific growth
rate (Tab.2), reached the maximum cell concentration first and had the shortest process
duration (Fig.1). Higher cell concentrations were obtained using ActiCHO P. CHO-K1
showed 4 to 6-fold increased cell-specific mAb production rates compared with CHO-S and
CHO-DG44 during batch culture. Consequently, these cell cultures reached the highest
product titers and CHO-S the lowest titers in both media. The diagram plotting the VCCD
against mAb titer (Fig. 1) demonstrated CHO cell-specific preferences for fast growth (CHO-
S) or recombinant protein production (CHO-K1). In batch culture, no major difference in titer
was observed for the two cell culture media tested. The difference between the cell lines was
more pronounced than the difference resulting from cultivation media.
12
3.3. Fed-batch evaluation of CHO-K1, CHO-S and CHO-DG44 cell lines
In fed-batch cultivation, CHO-S cells also grew with the highest cell-specific growth rates
during the initial five days (Tab.2; Supplement 3). The final mAb titer was generally higher in
ActiCHO P with CHO-DG44 reaching 670 mg/L followed by CHO-K1 (460 mg/L) and
CHO-S (370 mg/L). In CD CHO fed-batches, CHO-K1 cells (350 mg/L) produced higher
titers than CHO-S (175 mg/L) and interestingly the lowest mAb concentration was
determined in cultures of CHO-DG44 (115 mg/L) because of poor biomass accumulation and
low mAb production rates (Fig.1, Tab.2). These results demonstrated that the addition of feed
concentrates substantially influenced cell accumulation by favoring one CHO host over the
other regarding their specific nutrient demands. Nevertheless, cell-specific mAb production
rates remained highest in CHO-K1 followed by CHO-DG44 and CHO-S (Tab.2.). This was
also observable from Fig.1 showing CHO cell-specific preferences for either biomass
synthesis (CHO-S) or recombinant protein production (CHO-K1).
Compared to batch cultivation, feed supplementation of CHO-K1 cells in ActiCHO P resulted
in doubling peak cell concentrations but only 10-20% higher titers due to a significant
reduction of cell-specific mAb production rates. Feed supplementation of CHO-S cells did not
significantly impact peak cell concentrations. However, due to a substantially prolonged
process duration by six days, VCCD increased significantly and boosted mAb titers by more
than six-fold. In CD CHO, feed supplementation of CHO-S cells was less effective in
increasing VCCD and process duration than in ActiCHO P. Thus, final titers improved only
2.5-fold compared to batch cultivation. Fed-batch cultivation of CHO-DG44 cells doubled
peak cell concentrations, VCCD and cell-specific production rates compared to batch cultures.
This improved mAb titer more than five-fold. Interestingly, feed supplementation in CD CHO
did not improve the process performance compared to batch cultivation.
13
3.4. Perfusion evaluation of CHO-K1, CHO-S and CHO-DG44 cell lines
To study the CHO cell lines under quasi steady-state conditions we used a lab-scale semi-
continuous perfusion system with daily media exchange (Fig.1; Supplement 3). CHO-S cells
grew with the highest cell-specific growth rate (Tab.2) and cell concentration in theses
cultures peaked first (Fig.1). CHO-K1 cells plateaued among the lowest peak cell
concentrations (~25×106 c/mL) at values comparable to CHO-DG44 cells cultivated in CD
CHO. Interestingly, CHO-DG44 cell concentrations continuously increased to the highest
values of all CHO cells when cultivated in ActiCHO P. These results demonstrated that daily
media exchange considerably affects growth of CHO host cell lines due to their individual
nutrient demands. Upon media exchange every 24 hours, the highest mAb concentrations
were generated by CHO-K1 cells followed by CHO-DG44 cells and CHO-S cells. In both
media, CHO-K1 cells had the highest cell-specific mAb production rates (13-16 pcd), thus
outcompeting CHO-DG44 cells (4-5 pcd) and CHO-S cells (ca. 2 pcd). These results aligned
well with the qP values for the different cell lines in batch and fed-batch cultures (Tab.1).
3.5. Evaluation of mRNA
To investigate if high cell-specific mAb production rates coincided with high heavy and light
chain mRNA levels, we analyzed both parameters on several days during fed-batch
cultivation. For all three CHO cell lines, cell-specific mAb production rates declined
continuously, while HC and LC mRNA accumulated with increasing variability between
biological triplicates (Figure 2). Therefore, we statistically evaluated product-specific mRNA
and qP on day 4 when all clones had comparable cell densities and cultures were still in the
exponential growth phase. Interestingly, HC and LC mRNA in CHO-K1 cells were
significantly influenced by the feed medium and this was reflected in the specific productivity
(Supplement 4). Statistical evaluation gave also evidence that HC mRNA contributed more
directly to a higher qP than LC mRNA.
14
3.6. CHO host cell line and mAb product quality
The observed phenotypic differences during cultivation of the different CHO cell lines
prompted us to analyze the secreted product. We decided to investigate mAb product from
fed-batch cultivation harvest only, first, because most currently executed bioprocesses rely on
this strategy and second, we speculated that due to product accumulation in fed-batch even
minor cell line-specific product-related differences might become more visible compared to
other process modes.
In general, all three CHO cells expressed mainly core fucosylated complex biantennary Fc
glycans with predominantly G0F, G1F and G2F glycoforms (Fig.3), similar to naturally
occurring human serum IgG [24]. The relative abundance of some glycoforms was influenced
by CHO cell line or media. For example, when the media was changed from ActiCHO P to
CD CHO, the amount of galactosylated mAb increased from 17% to 37% for CHO-K1 and
CHO-S, but remained constant for CHO-DG44. The abundance of agalactosylated glycoforms
(G0F) was higher for CHO-S than for CHO-K1 and CHO-DG44 expressed mAb. Product
mannosylation, fucosylation and aglycosylation were less influenced by the media, but merely
an inherent trait of the CHO cell line. CHO-S cells expressed the lowest amount of
mannosylated product (2-3%) relative to CHO-K1 (5-9%) and CHO-DG44 cultures (11-
13%). Product fucosylation was highest in CHO-S (94-96%) followed by CHO-K1 (82-84%)
and CHO-DG44 (71-83%). The amount of aglycosylated mAb was low in CHO-K1 (2-5%)
and CHO-S (1%) and no aglycosylated mAb was detected in CHO-DG44 cultures.
In addition to the Fc glycosylation site, the herein expressed mAb contained a further glycan
moiety in the light chain region. This glycosylation site also contained mainly core
fucosylated complex biantennary glycans with predominantly G0F, G1F and G2F glycoforms,
but occasionally one or two sialic acid residues (Fig.4). CHO-S cells expressed the lowest
amount of mannosylated product (≤ 1.5%) relative to CHO-K1 (4-6%) and CHO-DG44
15
cultures (5-13%). Product fucosylation of the light chain was lowest in CHO-S (~46%)
followed by CHO-DG44 (76-88%) and CHO-K1 (83-90%). The amount of sialylated mAb
was highest in CHO-K1 (21-36%) followed by CHO-DG44 (15-19%) and CHO-S cultures (6-
15%). Despite detectable changes of mAb glycosylation they were subtle and their
pharmacological relevance would need to be evaluated in more detail.
Mammalian cells commonly perform post-translational modifications during protein
production that are essential for protein folding, stability and function [25, 26]. To investigate
conformational stabilities of the same mAb produced by different CHO hosts we analyzed
thermal stabilities of the protein. DSC measurements revealed four unfolding transitions for
the investigated mAbs (Fig.5). Most important, the media used for cultivation did not
influence the thermal stability of expressed mAb. Remarkably, the first mAb unfolding
transition (Tm1) started 1.7 °C earlier when expressed by CHO-S (64.3 °C ± 0.2) compared to
mAb expressed in CHO-K1 or CHO-DG44 (both 66.0 °C ± 0.3). To further investigate
potential reasons for the differences of thermal stability we analyzed the amino acid sequence
of mAb product by mass spectrometry (data not shown) and found that the mAb expressed in
CHO-S (but not CHO-K1 and CHO-DG44) missed the C-terminal serine in the light chain.
4. Discussion
To date, more than 70% of all recombinant biopharmaceuticals are expressed in CHO cells
[27]. However, current literature is scarce in CHO host comparisons, suggesting that such
knowledge can be an advantage. It is not surprising that companies rely on individually
selected host cell line(s) to ensure repeatedly reaching the desired product quantity and
quality attributes of any to-be-expressed biomolecule. To shed more light on this topic, we
investigated growth and recombinant mAb expression of three commonly used CHO cell lines
in different cultivation modes. The herein presented study demonstrated host-specific
physiologic preferences favoring either biomass synthesis or antibody production (Fig.1).
16
4.1. CHO host favors mAb production or biomass synthesis
For a proper comparison of cell lines that were indeed representative for the respective CHO
host, we have applied the same transfection and selection criteria for all three monoclonal cell
lines. Only the best producers with adequate growth properties were selected according to
good practice in cell line generation.
Already during cell line generation and screening of polyclonal mini-pools, CHO-K1 cells
revealed a higher mean qP than CHO-S and CHO-DG44. This observation was persistent
from the initial mini-pools until the finally derived monoclonal cell lines. Combined with the
consistent genetic environment provided by the BAC constructs, we firmly believe that the
reported results are due to phenotypic differences rather than clonal variations.
Cell culture media are complex nutrient solutions that contain up to 100 different components
at varying concentrations. This makes medium adaptation complex and may affect cell
growth, viability, protein expression and even genomic stability [18, 28, 29]. In our case,
direct adaptation was successful for all three CHO cell lines without introducing any lag
phases or lowering the viability (Supplement 1). Despite genetic changes were not
investigated, the absence of low or non-producing subpopulations was confirmed upon
medium adaptation (Supplement 2).
Cell growth and peak cell concentrations were generally higher in ActiCHO P (Tab.2) during
all process strategies (i.e. batch, fed-batch and semi-continuous perfusion cultures) indicating
that a balanced media formulation can influence the performance of the cultivated cell lines
[18]. Independent of medium or process type, CHO-S cells grew with 10-50% higher cell-
specific growth rates than CHO-K1 and CHO-DG44 cells (Tab.2). This highlighted CHO
host-inherent traits towards individual preferences for cell growth. Interestingly, also the non-
transfected CHO-S host cell line reached higher growth rates than CHO-K1 and CHO-DG44
during batch and routine cultivation.
17
CHO-K1 cells had the highest cell-specific productivities as indicated by high mAb titers with
relatively low biomass accumulation. CHO-S showed opposite characteristics (Tab.2, Fig.1).
CHO-DG44 ranked in-between the two other CHO cell lines. Remarkably, this trend was
consistent in all cultivation modes and cell culture media. Determination of GCN showed
between 1-2 LC copies and 2-4 HC copies in the different CHO cell lines despite both cDNAs
were part of the same BAC. This was most likely a result of the underlying logarithmic
calculation. In our dataset, we found no statistically significant correlation of product-related
mRNA to cell-specific mAb production rates over the whole process since both parameters
changed with process time for all three CHO cell lines (Figure 2). Considering the extensive
mutagenesis and clonal selection of the derived CHO host cell lines [4], we assume that the
determined expression differences related to the cellular phenotype and metabolism rather
than differences in product-specific GCN (or mRNA), location of the transgenes [12], or type
of cell cultivation. The influence of GCN and amount of transcript on protein expression
levels is addressed since a long time by several publications and remains controversial [30-
34].
Differing rates of product synthesis among the CHO host cell lines could be due to unequal
capacities and processing efficiencies of their translational machineries. For example, a larger
ER and higher mitochondrial mass of CHO-K1 has recently been associated with a higher qP
compared to CHO-DUXB11 [35]. The ER is important for proper folding and assembly of
secreted proteins. If the amount of irreversibly misfolded proteins in the ER exceeds a certain
limit, cells will trigger the unfolded protein response and eventually apoptosis [36, 37]. A
larger ER thus favors higher secretion rates but also the survival of high-producing cells and
the processing of difficult-to-fold proteins. Mitochondria provide the energy to many cellular
processes including protein folding [38]. A higher mitochondria mass may be advantageous to
cells in order to self-fuel their required energy to cope with the resulting stress of misfolded
proteins in the ER. Since both ER and mitochondria occupy a large proportion of the total
18
cellular volume, capacities for recombinant protein expression may be reflected by cell size.
Interestingly, we observed a larger cell size for high producing CHO-K1 cells (15.7 µm ±0.7)
compared to low producing CHO-DG44 (14.2 µm ±0.5) and CHO-S cells (13.7 µm ±1.1)
during semi-continuous perfusion cultivation.
4.2. CHO host influences mAb glycosylation profile
The glycosylation profile considerably determines mAb safety and efficacy [39]. Changes in
Fc glycosylation can alter Fc conformation, receptor binding and immune effector functions
as reviewed in detail elsewhere [40].
Our study showed that mAb glycosylation was influenced by the applied CHO expression
host (Fig.3 and 4). Mannosylation was higher and fucosylation was lower when mAb was
expressed by CHO-DG44 followed by CHO-K1 and CHO-S. Antibodies with high-mannose
and low-fucose content generally increase ADCC [41, 42]. Galactosylation, which increases
IgG effector functions [43], was merely influenced by the applied cultivation media. Media
constituents that affect mAb galactosylation include uridine, manganese chloride and
galactose [44, 45]. However, their concentrations in the applied cell culture media were not
quantified. In general, CHO-K1 revealed a higher degree of mAb galactosylation than CHO-
DG44 followed by CHO-S. Only carbohydrates of the LC (but not Fc part) contained sialic
acid residues indicating that sialylation was more a consequence of steric accessibility.
Sialylation is often associated with improved serum half-life [46] or anti-inflammatory
activity [47]. Sialylation of mAb was higher for CHO-K1, followed by CHO-DG44 and then
CHO-S cells. Host-specific glycosylation patterns may be related to the heterogeneity of CHO
cells that harbor and express a different set of genes relevant for glyco-processing [5, 13].
Lewis et al. [5] have shown that among 256 enzymes associated with glycosylation in
Cricetulus griseus, 13%, 2% and 25% have non-synonymous SNPs, frame-shifting indels, or
CNVs, respectively, in at least one cell line of CHO-K1, CHO-DG44 and CHO-S. While not
19
all SNPs will have a measurable effect on enzyme activity or substrate preference, glycans are
produced through long, branching pathways, which increases the probability of having a
mutation that changes the final glycoform in any given cell line. This hypothesis supports our
results that different CHO expression systems harbor cell type-specific glycosylation patterns,
which can be exploited depending on the produced protein and its requirements in vivo.
Mammalian cells commonly perform post-translational modifications during protein
production that are essential for protein folding, stability and function [25, 26]. Higher
thermal stabilities improve mAb expression rates [48, 49]. In our study, the least stable mAb
(CHO-S) was expressed at the lowest cell-specific rate (Tab.2). However, the thermal stability
of CHO-DG44 expressed mAb was similar to CHO-K1 despite mAb expression rates were
slightly better than CHO-S. It remains elusive if or to which extent the thermal stability
difference of 1.7 °C (Tm1) contributed to protein expression. A potential reason for lower
stability could be a missing C-terminal serine in the LC of mAb expressed in CHO-S (but not
CHO-K1 and CHO-DG44) as identified by mass spectrometry. If this was due to mAb
processing differences by the CHO host currently remains undetermined. Shen et al. [50]
showed that deletion of the C-terminal serine of the λ LC improved thermal and high pH
stabilities, transient expression, purification yield and ADCC function of an IgG1 without
affecting antigen binding. The herein investigated mAb also was an IgG1 λ, but the thermal
stability was higher when the C-terminal serine was present (Fig.5). The cultivation media did
not influence mAb stability.
5. Conclusion
In recent years, high-throughput technologies have created an ever-increasing amount of
sequencing data that demonstrates the genetic heterogeneity of CHO cell lines. However, the
influence of these genetic differences on the phenotype of different CHO cell lines and finally
the effect on bioprocessing has not yet been investigated in detail. In this study, we found that
20
the cellular phenotype determines CHO cell line-specific preferences for mAb production or
biomass synthesis. CHO-K1 metabolism favored mAb expression, whereas CHO-S
metabolism had a preference for biomass formation and CHO-DG44 ranked in-between the
two. These preferences were independent of process type (i.e. batch, fed-batch, or perfusion)
and cell culture media. Therefore, the choice of the CHO host cell line had a fundamental
impact on the production process. Currently, genomic and phenotypic variations of CHO cells
are not well understood and often not taken into consideration when selecting a host cell line.
Genetic differences between host cell lines should be examined in biological experiments to
better understand their impact on the cellular phenotype and bioprocess. The combination of
CHO sequence-specific knowledge and lineage-specific cultivation behavior will be a
powerful tool for future cell line engineering approaches and cell line development, as well as
improvement of bioprocesses and cell culture media. The results of this study demonstrate
that the genetic background substantially influences the phenotypic properties of the host cell
also affecting productivity and glycosylation. Therefore, the choice of the host cell line is of
key importance to achieve the desired process characteristics and product quality.
6. Disclosure statement
The authors declare no commercial or financial conflict of interest.
7. Acknowledgements
This study was funded by GE Healthcare. We thank Polymun Scientific Immunbiologische
Forschung GmbH for providing the recombinant cell lines.
21
8. References
[1] PUCK, T. T., Cieciura, S. J., Robinson, A., Genetics of somatic mammalian cells. III.
Long-term cultivation of euploid cells from human and animal subjects. J Exp Med 1958,
108, 945-956.
[2] Urlaub, G., Chasin, L. A., Isolation of Chinese hamster cell mutants deficient in
dihydrofolate reductase activity. Proc Natl Acad Sci U S A 1980, 77, 4216-4220.
[3] Urlaub, G., Käs, E., Carothers, A. M., Chasin, L. A., Deletion of the diploid dihydrofolate
reductase locus from cultured mammalian cells. Cell 1983, 33, 405-412.
[4] Wurm, F. M., Hacker, D., First CHO genome. Nat Biotechnol 2011, 29, 718-720.
[5] Lewis, N. E., Liu, X., Li, Y., Nagarajan, H., Yerganian, G., O'Brien, E., Bordbar, A.,
Roth, A. M., Rosenbloom, J., Bian, C., Xie, M., Chen, W., Li, N., Baycin-Hizal, D., Latif, H.,
Forster, J., Betenbaugh, M. J., Famili, I., Xu, X., Wang, J., Palsson, B.O., Genomic
landscapes of Chinese hamster ovary cell lines as revealed by the Cricetulus griseus draft
genome. Nat Biotechnol 2013, 31, 759-765.
[6] Xu, X., Nagarajan, H., Lewis, N. E., Pan, S., Cai, Z., Liu, X., Chen, W., Xie, M., Wang,
W., Hammond, S., Andersen, M. R., Neff, N., Passarelli, B., Koh, W., Fan, H. C., Wang, J.,
Gui, Y., Lee, K. H., Betenbaugh, M.J., Quake, S.R., Famili, I., Palsson, B.O., Wang, J., The
genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line. Nat Biotechnol 2011,
29, 735-741.
[7] Deaven, L. L., Petersen, D. F., The chromosomes of CHO, an aneuploid Chinese hamster
cell line: G-band, C-band, and autoradiographic analyses. Chromosoma 1973, 41, 129-144.
[8] Derouazi, M., Martinet, D., Besuchet Schmutz, N., Flaction, R., Wicht, M., Bertschinger,
M., Hacker, D. L., Beckmann, J. S., Wurm, F. M., Genetic characterization of CHO
production host DG44 and derivative recombinant cell lines. Biochem Biophys Res Commun
2006, 340, 1069-1077.
[9] Bauer, A. P., Leikam, D., Krinner, S., Notka, F., Ludwig, C., Längst, G., Wagner, R., The
impact of intragenic CpG content on gene expression. Nucleic Acids Res 2010, 38, 3891-
3908.
22
[10] Kim, M., O'Callaghan, P. M., Droms, K. A., James, D. C., A Mechanistic Understanding
of Production Instability in CHO Cell Lines Expressing Recombinant Monoclonal
Antibodies. Biotechnol Bioeng 2011, 108, 2434-2446.
[11] Yang, Y. S., Mariati, Chusainow, J., Yap, M. G. S., DNA methylation contributes to loss
in productivity of monoclonal antibody-producing CHO cell lines. J Biotechnol 2010, 147,
180-185.
[12] Kennard, M. L., Goosney, D. L., Monteith, D., Roe, S., Fischer, D., Mott, J., Auditioning
of CHO host cell lines using the artificial chromosome expression (ACE) technology.
Biotechnol Bioeng 2009, 104, 526-539.
[13] Könitzer, J. D., Müller, M. M., Leparc, G., Pauers, M., Bechmann, J., Schulz, P., Schaub,
J., Enenkel, B., Hildebrandt, T., Hampel, M., Tolstrup, A. B., A global RNA-seq-driven
analysis of CHO host and production cell lines reveals distinct differential expression patterns
of genes contributing to recombinant antibody glycosylation. Biotechnol J 2015, 10, 1412-
1423.
[14] Wuest, D. M., Harcum, S. W., Lee, K. H., Genomics in mammalian cell culture
bioprocessing. Biotechnol Adv 2012, 30, 629-638.
[15] Sommeregger, W., Mayrhofer, P., Steinfellner, W., Reinhart, D., Henry, M., Clynes, M.,
Meleady, P., Kunert, R., Proteomic differences in recombinant CHO cells producing two
similar antibody fragments. Biotechnol Bioeng 2016, 113, 1902-1912.
[16] Zboray, K., Sommeregger, W., Bogner, E., Gili, A., Sterovsky, T., Fauland, K., Grabner,
B., Stiedl, P., Moll, H. P., Bauer, A., Kunert, R., Casanova, E., Heterologous protein
production using euchromatin-containing expression vectors in mammalian cells. Nucleic
Acids Res 2015, 43, e102.
[17] Reinhart, D., Sommeregger, W., Debreczeny, M., Gludovacz, E., Kunert, R., In search of
expression bottlenecks in recombinant CHO cell lines-a case study. Appl Microbiol Biot 2014,
98, 5959-5965.
[18] Reinhart, D., Damjanovic, L., Kaisermayer, C., Kunert, R., Benchmarking of
commercially available CHO cell culture media for antibody production. Appl Microbiol
Biotechnol 2015, 99, 4645-4657.
23
[19] Mader, A., Prewein, B., Zboray, K., Casanova, E., Kunert, R., Exploration of BAC
versus plasmid expression vectors in recombinant CHO cells. Appl Microbiol Biotechnol
2013, 97, 4049-4054.
[20] Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., Leunissen, J.A.,
Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 2007, 35, W71-74.
[21] Livak, K. J., Schmittgen, T. D., Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402-408.
[22] Sommeregger, W., Prewein, B., Reinhart, D., Mader, A., Kunert, R., Transgene copy
number comparison in recombinant mammalian cell lines: critical reflection of quantitative
real-time PCR evaluation. Cytotechnology 2013, 65, 811-818.
[23] Chevreux, G., Tilly, N., Bihoreau, N., Fast analysis of recombinant monoclonal
antibodies using IdeS proteolytic digestion and electrospray mass spectrometry. Anal
Biochem 2011, 415, 212-214.
[24] Jefferis, R., Glycosylation of recombinant antibody therapeutics. Biotechnol Prog 2005,
21, 11-16.
[25] Walsh, G., Jefferis, R., Post-translational modifications in the context of therapeutic
proteins. Nat Biotechnol 2006, 24, 1241-1252.
[26] Zheng, K., Yarmarkovich, M., Bantog, C., Bayer, R., Patapoff, T. W., Influence of
glycosylation pattern on the molecular properties of monoclonal antibodies. MAbs 2014, 6,
649-658.
[27] Jayapal, K. R., Wlaschin, K. F., Hu, W. S., Yap, M. G. S., Recombinant protein
therapeutics from CHO cells - 20 years and counting. Chem Eng Prog 2007, 103, 40-47.
[28] Narva, E., Autio, R., Rahkonen, N., Kong, L. J., Harrison, N., Kitsberg, D., Borghese, L.,
Itskovitz-Eldor, J., Rasool, O., Dvorak, P., Hovatta, O., Otonkoski, T., Tuuri, T., Cui, W.,
Brüstle, O., Baker, D., Maltby, E., Moore, H. D., Benvenisty, N., Andrews, P. W., Yli-Harja,
O., Lahesmaa, R., High-resolution DNA analysis of human embryonic stem cell lines reveals
culture-induced copy number changes and loss of heterozygosity. Nature Biotechnology 2010,
28, 371-U103.
24
[29] Laurent, L. C., Ulitsky, I., Slavin, I., Tran, H., Schork, A., Morey, R., Lynch, C.,
Harness, J. V., Lee, S., Barrero, M. J., Ku, S., Martynova, M., Semechkin, R., Galat, V.,
Gottesfeld, J., Izpisua Belmonte, J. C., Murry, C., Keirstead, H. S., Park, H. S., Schmidt, U.,
Laslett, A. L., Muller, F. J., Nievergelt, C. M., Shamir, R., Loring, J. F., Dynamic Changes in
the Copy Number of Pluripotency and Cell Proliferation Genes in Human ESCs and iPSCs
during Reprogramming and Time in Culture. Cell Stem Cell 2011, 8, 106-118.
[30] Vishwanathan, N., Le, H., Jacob, N. M., Tsao, Y. S., Ng, S. W., Loo, B., Liu, Z.,
Kantardjieff, A., Hu, W. S., Transcriptome dynamics of transgene amplification in Chinese
hamster ovary cells. Biotechnol Bioeng 2014, 111, 518-528.
[31] Kantardjieff, A., Jacob, N. M., Yee, J. C., Epstein, E., Kok, Y. J., Philp, R., Betenbaugh,
M., Hu, W. S., Transcriptome and proteome analysis of Chinese hamster ovary cells under
low temperature and butyrate treatment. J Biotechnol 2010, 145, 143-159.
[32] Lee, C. J., Seth, G., Tsukuda, J., Hamilton, R. W., A Clone Screening Method Using
mRNA Levels to Determine Specific Productivity and Product Quality for Monoclonal
Antibodies. Biotechnol Bioeng 2009, 102, 1107-1118.
[33] Reisinger, H., Steinfellner, W., Stern, B., Katinger, H., Kunert, R., The absence of effect
of gene copy number and mRNA level on the amount of mAb secretion from mammalian
cells. Appl Microbiol Biot 2008, 81, 701-710.
[34] Tsuruta, L. R., dos Santos, M. L., Yeda, F. P., Okamoto, O. K., Moro, A. M., Genetic
analyses of Per.C6 cell clones producing a therapeutic monoclonal antibody regarding
productivity and long-term stability. Appl Microbiol Biot 2016, 100, 10031-10041.
[35] Hu, Z., Guo, D., Yip, S. S., Zhan, D., Misaghi, S., Joly, J.C., Snedecor, B. R., Shen, A.
Y., Chinese hamster ovary K1 host cell enables stable cell line development for antibody
molecules which are difficult to express in DUXB11-derived dihydrofolate reductase
deficient host cell. Biotechnol Prog 2013, 29, 980-985.
[36] Reinhart, D., Sommeregger, W., Debreczeny, M., Gludovacz, E., Kunert, R., In search of
expression bottlenecks in recombinant CHO cell lines-a case study. Appl Microbiol
Biotechnol 2014.
25
[37] Ellgaard, L., Helenius, A., Quality control in the endoplasmic reticulum. Nat Rev Mol
Cell Biol 2003, 4, 181-191.
[38] Simmen, T., Lynes, E. M., Gesson, K., Thomas, G., Oxidative protein folding in the
endoplasmic reticulum: tight links to the mitochondria-associated membrane (MAM).
Biochim Biophys Acta 2010, 1798, 1465-1473.
[39] Kunert, R., Reinhart, D., Advances in recombinant antibody manufacturing. Appl
Microbiol Biotechnol 2016, 100, 3451-3461.
[40] Liu, L., Antibody glycosylation and its impact on the pharmacokinetics and
pharmacodynamics of monoclonal antibodies and Fc-fusion proteins. J Pharm Sci 2015, 104,
1866-1884.
[41] Chung, S., Quarmby, V., Gao, X., Ying, Y., Lin, L., Reed, C., Fong, C., Lau, W., Qiu, Z.
J., Shen, A., Vanderlaan, M., Song, A., Quantitative evaluation of fucose reducing effects in a
humanized antibody on Fcγ receptor binding and antibody-dependent cell-mediated
cytotoxicity activities. MAbs 2012, 4, 326-340.
[42] Yu, M., Brown, D., Reed, C., Chung, S., Lutman, J., Stefanich, E., Wong, A., Stephan, J.
P., Bayer, R., Production, characterization, and pharmacokinetic properties of antibodies with
N-linked mannose-5 glycans. MAbs 2012, 4, 475-487.
[43] Jefferis, R., Glycosylation as a strategy to improve antibody-based therapeutics. Nat Rev
Drug Discov 2009, 8, 226-234.
[44] Gramer, M. J., Eckblad, J. J., Donahue, R., Brown, J., Shultz, C., Vickerman, K., Priem,
P., van den Bremer, E. T., Gerritsen, J., van Berkel, P. H., Modulation of Antibody
Galactosylation Through Feeding of Uridine, Manganese Chloride, and Galactose. Biotechnol
Bioeng 2011, 108, 1591-1602.
[45] Grainger, R. K., James, D. C., CHO Cell Line Specific Prediction and Control of
Recombinant Monoclonal Antibody N-Glycosylation. Biotechnol Bioeng 2013, 110, 2970-
2983.
[46] Morell, A. G., Gregoriadis, G., Scheinberg, I. H., Hickman, J., Ashwell, G., The role of
sialic acid in determining the survival of glycoproteins in the circulation. J Biol Chem 1971,
246, 1461-1467.
26
[47] Li, T., DiLillo, D. J., Bournazos, S., Giddens, J. P., Ravetch, J. V., Wang, L. X.,
Modulating IgG effector function by Fc glycan engineering. Proc Natl Acad Sci U S A 2017,
114, 3485-3490.
[48] Buchanan, A., Clementel, V., Woods, R., Harn, N., Bowen, M. A., Mo, W., Popovic, B.,
Bishop, S. M., Dall'Acqua, W., Minter, R., Jermutus, L., Bedian, V., Engineering a
therapeutic IgG molecule to address cysteinylation, aggregation and enhance thermal stability
and expression. MAbs 2013, 5, 255-262.
[49] Garber, E., Demarest, S. J., A broad range of Fab stabilities within a host of therapeutic
IgGs. Biochem Biophys Res Commun 2007, 355, 751-757.
[50] Shen, Y., Zeng, L., Zhu, A., Blanc, T., Patel, D., Pennello, A., Bari, A., Ng, S., Persaud,
K., Kang, Y. K., Balderes, P., Surguladze, D., Hindi, S., Zhou, Q., Ludwig, D. L., Snavely,
M., Removal of a C-terminal serine residue proximal to the inter-chain disulfide bond of a
human IgG1 lambda light chain mediates enhanced antibody stability and antibody dependent
cell-mediated cytotoxicity. MAbs 2013, 5, 418-431.
27
9. List of table captions
Table 1. Primer sequences and qPCR settings. PCR was performed as 2-step protocol with an
initial denaturation step at 95 °C for 3 min followed by 40 cycles of annealing and extension
at described conditions and denaturation at 95 °C for 15 s.
Target Primer sense Primer antisense Amplicon
size [bp]
Annealing,
extension
PG9 HC CTGCAACGTGAATCACAAGC GTGGGCATGTGTGAGTTTTG 86 65°C, 60 s
PG9 LC ACCACACCCTCCAAACAAAG ACCTGGCAGCTGTAGCTTTT 101 65°C, 60 s
EIF3I TGGCCCTACTGAAGACCAAC CACTGGTACCCCATCTGCTT 110 64°C, 90 s
ACTB GATATCGCTGCGCTCGTT CCACGATGGATGGGAAGAC 97 60°C, 60 s
28
Table 2. Summary of process relevant data of CHO-K1, CHO-S and CHO-DG44 batch, fed-batch and semi-continuous perfusion cultures based on
ActiCHO P or CD CHO media. Batch and fed-batch values represent the mean of three replicate experiments, or the mean values after day 3
(perfusion cultures) including one standard deviation.
Cell line CHO K1 CHO S CHO DG44
Medium ActiCHO P CD CHO ActiCHO P CD CHO ActiCHO P CD CHO
Peak cell concentration
(106 cells/mL)
Peak mAb
(mg/L)
Specific growth rate: day 0-5
(d-1)
Specific mAb productivity
(pg/cell/day)
Space time yield
(mg/L/d)
Batch
Fed-batch
Perfusion
Batch
Fed-batch
Perfusion
Batch
Fed-batch
Perfusion
Batch
Fed-batch
Perfusion
Batch
Fed-batch
Perfusion
7.2 (±1.0)
15.7 (±0.9)
25.4
390 (±35)
460 (±20)
365
0.56 (±0.01)
0.61 (±0.01)
n.a.
12.0 (±1.7)
6.9 (±0.4)
12.9 (±3.1)
39 (±4)
42 (±2)
301
5.0 (±0.2)
3.5 (±0.2)
25.0
300 (±5)
350 (±20)
370
0.61 (±0.00)
0.48 (±0.01)
n.a.
14.0 (±0.6)
13.8 (±0.5)
16.2 (±2.8)
38 (±1)
29 (±1)
276
11.4 (±0.8)
13.8 (±2.5)
48.2
55 (±5)
370 (±15)
85
0.76 (±0.01)
0.70 (±0.02)
n.a.
1.9 (±0.2)
3.0 (±0.2)
1.6 (±0.5)
8 (±1)
23 (±1)
48
5.9 (±0.5)
6.6 (±0.7)
41.4
75 (±1)
175 (±5)
95
0.73 (±0.02)
0.66 (±0.02)
n.a.
3.2 (±0.1)
4.2 (±0.2)
2.4 (±0.5)
9 (±0)
16 (±1)
76
10.8 (±1.6)
24.1 (±1.1)
66.0
125 (±5)
670 (±20)
345
0.59 (±0.03)
0.59 (±0.02)
n.a.
2.6 (±0.1)
5.7 (±0.1)
4.8 (±1.1)
12 (±1)
56 (±1)
237
8.9 (±0.9)
9.1 (±0.7)
27.1
105 (±5)
115 (±5)
110
0.64 (±0.01)
0.59 (±0.01)
n.a.
2.5 (±0.3)
2.3 (±0.1)
4.0 (±0.9)
11 (±1)
10 (±1)
81
29
10. Figure legends
Figure 1. Total cell concentrations and viable cumulative cell days (VCCD) versus mAb
concentration of CHO-K1, CHO-S and CHO-DG44 batch, fed-batch and semi-continuous
perfusion cultures in ActiCHO P or CD CHO media. Batch and fed-batch values represent the
mean of three replicate experiments. Error bars show one standard deviation. Perfusion
cultures were operated as single runs, whereas each day represents a replicate. For perfusion
cultures the cumulative mAb titer is shown.
Figure 2. Mean values for (A) heavy chain mRNA, (B) light chain mRNA and (C) cell-
specific mAb production rates during fed-batch cultivation of CHO-K1, CHO-S and CHO-
DG44 cells in ActiCHO P or CD CHO media on days 4, 7 and the day of culture termination
(criterion = viability < 60%). All values represent the mean of three replicate experiments
with error bars showing one standard deviation.
Figure 3. Glycoform distribution of heavy chain of mAb expressed in CHO-K1, CHO-S and
CHO-DG44 fed-batch cultures based on ActiCHO P or CD CHO media. Antibody quality of
(A) G0F, (B) G1F, (C) G2F, (D) G0F-Gn, (E) G0, (F) Man5, (G) non-glycosylated and (H)
total percentage of galactosylated mAb was analyzed of the harvest product fraction after fed-
batch termination. All values represent the mean of three replicate experiments, the error bars
show one standard deviation. Statistical analysis was performed by two-way analysis of
variance (ANOVA) with post-hoc Bonferroni testing (n.s., non-significant, p > 0.05;* p≤
0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001).
Figure 4. Glycoform distribution of light chain of mAb expressed in CHO-K1, CHO-S and
CHO-DG44 fed-batch cultures based on ActiCHO P or CD CHO media. Antibody quality
Antibody quality of (A) G0F, (B) G1F, (C) G2F, (D) G0F-Gn, (E) G0, (F) Man5, (G) total
percentage of galactosylated mAb, (H) G1F+SA1, (I) G2F+SA1, (J) G2F+SA2 was analyzed
30
of the harvest product fraction after fed-batch termination. All values represent the mean of
three replicate experiments, the error bars show one standard deviation. Statistical analysis
was performed by two-way analysis of variance (ANOVA) with post-hoc Bonferroni testing
(n.s., non-significant, p > 0.05;* p≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001).
Figure 5. Thermal stability of mAb expressed in CHO-K1, CHO-S and CHO-DG44 fed-batch
cultures based on ActiCHO P or CD CHO media. Antibody quality was analyzed of the
harvest product fraction after fed-batch termination. All values represent the mean of three
replicate experiments, the error bars show one standard deviation. Statistical analysis was
performed by two-way analysis of variance (ANOVA) with post-hoc Bonferroni testing (n.s.,
non-significant, p > 0.05;* p≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001).
31
Figure 1
32
Figure 2
33
Figure 3
34
Figure 4
35
Figure 5
本文献由“学霸图书馆-文献云下载”收集自网络,仅供学习交流使用。
学霸图书馆(www.xuebalib.com)是一个“整合众多图书馆数据库资源,
提供一站式文献检索和下载服务”的24 小时在线不限IP
图书馆。
图书馆致力于便利、促进学习与科研,提供最强文献下载服务。
图书馆导航:
图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具
top related