clinical cancer research · web viewfigure s2: validation of variants according to sift and cadd...
Post on 01-Apr-2021
2 Views
Preview:
TRANSCRIPT
Next Generation Sequencing in Diffuse Large B Cell Lymphoma Highlights Molecular Divergence and Therapeutic Opportunities: a LYSA Study Dubois et al.
Summary
Next Generation Sequencing in Diffuse Large B Cell Lymphoma Highlights Molecular Divergence and Therapeutic Opportunities: a LYSA Study............................1
Supplemental Methods..................................................................................................................................2Patient and tumor sample selection...........................................................................................................2COO molecular classification....................................................................................................................2Variant analysis and bioinformatics pipeline.............................................................................................2AID mutation analysis...............................................................................................................................2Protein representations...............................................................................................................................3
Supplemental Figures....................................................................................................................................4Figure S1: Variant filters applied to Lymphopanel NGS data...................................................................4Figure S2: Validation of variants according to SIFT and CADD scores...................................................5Figure S3: PMBL samples harbor more mutations than other DLBCL subtypes.....................................6Figure S4: Role of AID-induced SHM in DLBCL....................................................................................7Figure S5: Mutation frequency by subtype................................................................................................8Figure S6: Clustering of gene mutations according to subtype.................................................................9Figure S7: Protein representations of observed mutations......................................................................15Figure S8: Correlations between age and specific gene mutations.........................................................16Figure S9: Prognosis according to IPI and subtype.................................................................................18Figure S10: Prognostic impact of gene mutations among the Lymphopanel..........................................19
Supplemental Tables....................................................................................................................................20Table S1: Clinical characteristics of patients in our cohort.....................................................................20Table S2: Overview of the Lymphopanel used for NGS analysis...........................................................21Table S3: Overview of pathway selection...............................................................................................22Table S4: Validation of variant filtering by an independent study of seven non-tumoral samples from DLBCL patients.......................................................................................................................................23Table S5: Validated variants....................................................................................................................47Table S6: Lymphopanel NGS detection of genes with high AID target frequencies..............................48Table S7: Prognostic impact of mutations in Lymphopanel genes.........................................................63
Supplemental MethodsPatient and tumor sample selectionPatients were stratified according to age and age-adjusted International Prognosis Index (aaIPI) and assigned to the following trials: LNH03-1B (aaIPI = 0, < 60 years old), LNH03-2B (aaIPI = 1, age < 60 years old), LNH03-3B and 39B (aaIPI = 2-3, age < 60 years old), LNH03-6B (aaIPI=0-3, age=60-80 years old), LNH03-7B (age > 80 years old), and LNH 01-5B (aaIPI = 2-3, age 60-65 years old). Details regarding the design and data management of the LNH 03-2B, 03-3B, 03-6B and 03-7B trials have been published (Ketterer et al, Ann Oncol, 2013; Molina et al, J Clin Oncol, 2014; Récher et al, Lancet, 2011; Fitoussi et al, Haematologica, 2011; Delarue et al, Lancet Oncol, 2013; Peyrade et al, Lancet Oncol, 2011).
COO molecular classificationSamples were analyzed with HGU133+2.0 Affymetrix GeneChip arrays (Affymetrix). The chips were scanned with an Affymetrix GeneChip Scanner 3000 and subsequent images were analyzed using Gene Chip® Operating Software (GCOS) 1.4. Raw feature normalization and quality check were handled using Bioconductor software (affy, affyQCReport, GCRMA), excluding multi-gene probesets (x). PMBL signature was established using hierarchical clustering (complete distance, Ward agglomeration) of a previously published gene signature (Rosenwald et al, J Exp Med, 2003), excluding TCL1A and E2F2 that could not be reliably measured on U133+2.0 arrays. The “other” subgroup was defined as samples not significantly determined as ABC or GCB subtype.
Variant analysis and bioinformatics pipelineTorrent Suite™ version 4.0 (Life Technologies) software was used to perform primary analysis, including signal processing, base calling, sequence alignment to the reference genome (hg19) and generation of Binary Alignment/Map (BAM) files. BAM files were used by Torrent Suite™’s Variant Caller (TVC) to detect point mutations as well as short insertions and deletions using the PGM Somatic Low Stringency profile. VCF files generated by Variant Caller were annotated by ANNOVAR (Wang et al, Nucleic Acids Res, 2010). Genes were identified using the Refseq database (version hg19_refGene). Variants were filtered according to mutation type: only frameshift and non-frameshift deletions, insertions or substitutions, splicing, nonsynonymous, stopgain or stoploss Single Nucleotide Variations (SNVs), and UTR3 or UTR5 were kept. Stopgain, frameshift and/or splicing SNVs are referred to in the article as truncating mutations. A normal probability plot defined thresholds separating true positives (confirmed by Sanger sequencing, TVC score ≥ 22) from true negatives (discredited by Sanger sequencing, TVC score < 9.5) and highlighted a gray zone (9.5 < TVC score < 22) in which variants must be confirmed by Sanger sequencing. When possible, insertion-deletions in homopolymeric regions were verified as well, regardless of TVC score. Highly recurrent variants (n ≥ 30) validated at least twice by Sanger sequencing were confirmed without further validation for all samples. Variants described as “nonpathogenic” or “probably nonpathogenic” in the ClinVar database (version hg19_clinvar_20140211) were discarded, as were those with predictive SIFT (version hg19_ljb23_sift) or CADD (version hg19_ljb26_cadd) scores >0.05 or <1.5 respectively, or with a frequency ≥ 1% in the 1000genomes database (version hg19_ALL.sites.2012_04) (detailed in Figures S1 and S2) (Kumar et al, Nat Protocols, 2009). We achieved a median uniformity of 92% [80%-94%] and a median on-target read percentage of 95% [86%-97%]. Further verification by Sanger sequencing was performed using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Life Technologies) and an ABI PRISM 3130 analyzer (Life Technologies).
AID mutation analysisFor AID mutation analysis, synonymous variants were also included, and the Functional filter was not applied. Preferential DGYW/WRCH AID target sites were targeted (Rogozin et al, J. Immunol, 2004).
Protein representationsProtein representations were created using R software version 3.1.2. Domains were imported from the Pfam database and motifs from the Uniprot database. Exons were located using the CCDS database. Uniprot/Ensembl IDs used were as follows: BCL2 (P10415), B2M (P61769), BRAF (P15056), CARD11 (Q9BXL7), CD58 (P19256), CD79A (P11912), CD79B (P40259), CDKN2A p16 (P42771), CDKN2A p14 (Q8N726), CDKN2B (P42772), CIITA (P33076), CREBBP (Q92793), EP300 (Q09472), EZH2 (Q15910), FOXO1 (Q12778), GNA13 (Q14344), ID3 (Q02535), IRF4 (Q15306), ITPKB (P27987), MEF2B (Q02080), MFHAS1 (Q9Y4C4), KMT2D (O14686), MYC (P01106), MYD88 isoforms 67 (ENSP00000401399) and 69 (ENSP00000390565), NOTCH1 (P46531), NOTCH2 (Q04721), PIM1 (ENSP00000362608), PRDM1 (O75626), SOCS1 (O15524), STAT6 (P42226), TCF3 (ENSP00000344375), TNFAIP3 (P21580), TNFRSF14 (Q92956), TP53 (P04637), XPO1 (O14980). All protein representations are available in Figure S3.
Supplemental Figures
Figure S1: Variant filters applied to Lymphopanel NGS data.The numbers in the Venn diagram correspond to the number of variants left after filtering. The Quality Filter eliminated variants based on TVC score and Sanger sequencing confirmation when performed. The SNP Filter eliminated variants based on their type, their frequency in the 1000genomes database and their description in the ClinVar database. The Functional Filter eliminated variants based on their CADD or SIFT scores. A total of 1064 validated variants remained after applying all three filters.
Figure S2: Validation of variants according to SIFT and CADD scores.(A) The CADD scores of the RELYSE study variants are compared to the CADD scores of different ClinVar annotations. Using a CADD score threshold of 1.5 enables the filtering of most non-pathogenic variants, while maintaining all pathogenic and probably pathogenic variants. B: The CADD scores of variants present in the dbSNP and COSMIC databases are plotted, as is the 1.5 CADD score threshold. Using the threshold at 1.5 filters the majority of dbSNP variants, while maintaining the majority of COSMIC variants. (C) CADD versus SIFT scores of variants are plotted. We eliminated double negative variants (blue) and conserved variants with CADD and/or SIFT scores above the defined thresholds (orange and red).
A
B
C
Figure S3: PMBL samples harbor more mutations than other DLBCL subtypes.The number of variants was calculated for each sample and a boxplot of number of variants per sample according to subtype was generated. PMBL samples are significantly more frequently mutated than ABC, GCB or “other” subtypes combined (DLBCL).
Figure S4: Role of AID-induced SHM in DLBCL.(A) The percentage of transition and transversion variants per gene are plotted as a stacked bar chart, with a pie chart representing the percentage of transition, transversion and other variants among the total Lymphopanel. (B) AID mutation frequency (percentage of total variants located at preferential DGYW/WRCH AID target sites) was calculated for each gene in the Lymphopanel. (C) AID target site mutation rate (percentage of sequenced DGYW/WRCH AID target sites in each gene that were effectively mutated) was calculated for each gene in the Lymphopanel. Genes in the gray box are genes which have a significantly higher (PIM1, SOCS1, BCL2, MYC, GNA13 and ITPKB) or lower (KMT2D, EP300, CREBBP and TP53) AID target site mutation rate than expected, compared to the average of the Lymphopanel. PIM1, SOCS1 and BCL2 (pink) seem to represent a separate group with higher AID target site mutation rates than MYC, GNA13 and ITPKB (orange).
A
B
C
Figure S5: Mutation frequency by subtype. Gene mutation frequency by subtype is represented for ABC patients (A), GCB patients (B), PMBL patients (C) and “other” patients (D).
A B
C D
Figure S6: Clustering of gene mutations according to subtype.Unsupervised clustering was performed for ABC subtype patients (A), GCB subtype patients (B), “other” patients (C) and PMBL patients (D). Presence of a mutation in a given gene for a given patient is plotted as a filled-in square. Genes (rows) and samples (columns) are arranged according to hierarchical clustering.
Figure S7: Protein representations of observed mutations.Protein representations were rendered using domains imported from the Pfam database (green) and motifs from the Uniprot database (orange). Exons were located using the CCDS database and were numbered automatically, not counting non-coding and spliced exons. Blue shadowing indicated regions sequenced by Lymphopanel NGS. Substitutions are depicted as diamonds, insertions as triangles and deletions as rectangles whose length varies according to the deletion size. A color code is also applied, with blue indicating non-synonymous substitutions or non-frameshift insertions, yellow indicating insertions and frameshift deletions, and pink indicating stop-gain and stop-loss mutations. Blue shading indicates sequenced regions. IRF4, GNA13, B2M, ITPKB, MFHAS1 and XPO1 representations are shown in Figure 4.
Figure S8: Correlations between age and specific gene mutations.Box-plots representing age at diagnosis according to the mutated or WT status of a given gene are shown.
Figure S9: Prognosis according to IPI and subtype.Survival analysis was performed on patients treated with either R-ACVBP (A, C, E, G) or R-CHOP (B, D, F, H). OS and PFS were measured according to IPI (A, B and C, D) or subtype (E, F and G, H). OS and PFS were significantly decreased in both treatment groups for patients with an IPI of 3-5 as compared to patients with an IPI of 0-2. ABC subtype presented significantly worse OS and PFS than GCB in the R-CHOP treated group, but not in the R-ACVBP treated group.
Figure S10: Prognostic impact of gene mutations among the Lymphopanel.Survival curves were generated for gene mutations with uncorrected p-values < 0.05 (indicated in Table 1).
Supplemental TablesClinical Parameter Patients at diagnosis
(n=215)Gender M/F, n 108/107Age (years), median (range) 60 (19–87)IPI, n (%)
0 30 (14)1 40 (18.6)2 44 (20.5)3 51 (23.7)4 36 (16.7)5 14 (6.5)
Adverse prognostic factors, n (%)Age > 60 years 103 (47.9)Ann Arbor Stage III-IV 147 (68.4)
Performance status ≥ 2 35 (16.3)LDH > N 138 (64.2)Bulky mass ≥ 10cm 32 (14.9)
Subtype, n (%)ABC 81 (37.7)GCB 83 (38.6)Other 33 (15.4)PMBL 18 (8.4)
Treatment, n (%)ACVBP + Consolidation 16 (7.4)R-ACVBP + ASCT 11 (5.1)R-ACVBP + Consolidation 72 (33.5)R-CHOP14 33 (15.3)R-CHOP21 72 (33.5)R-miniCHOP21 11 (5.1)
Study inclusion, n (%)LNH01-5B 20 (9.3)LNH03-1B 31 (14.4)LNH03-2B 46 (21.4)LNH03-3B 23 (10.7)LNH03-6B 73 (34)LNH03-7B 11 (5.1)LNH03-39B 11 (5.1)
Table S1: Clinical characteristics of patients in our cohort.
Gene Transcript Reference Hotspots / Exons partially sequenced Location Sequenced
Base pairs References
B2M NM_000633 Hotspots exons 1 & 2, exon 3 15q21.1 360 Challa-Malladi, Cancer Cell, 2011BCL2 NM_004048 Hotspot exon 2 18q21.33 585 Schuetz, Leukemia, 2012BRAF NM_004333 Exon 15 7q34 119 Lohr, PNAS, 2012CARD11 NM_032415 Coiled-coil domain exons 4-9 7p22.2 1121 Lenz, Science, 2008; Davis, Nature, 2010CD58 NM_001779 Exons 1-6 1p13.1 753 Challa-Malladi, Cancer Cell, 2011CD79A NM_001783 ITAM domain exons 4 & 5 19q13.2 183 Davis, Nature, 2010CD79B NM_000626 ITAM domain exons 5 & 6 17q23.3 141 Davis, Nature, 2010CDKN2A NM_058197 Exons 1, 2A, 2B, 3, 4 & 5 9p21.3 1737 Pasqualucci, Nat Genetics, 2011CDKN2B NM_004936 Exons 1A, 1B & 2 9p21.3 1289 Pasqualucci, Nat Genetics, 2011CIITA NM_000246 Exons 1-19 16p13.13 3393 Steidl, Nature, 2011CREBBP NM_004380 Exons 1-31 16p13.3 7323 Pasqualucci, Nature, 2011EP300 NM_001429 Exons 1-31 22q13.2 7245 Pasqualucci, Nature, 2011EZH2 NM_001203247 SET domain, hotspots exon 16 & 18 7q36.1 177 Morin, Nat Genetics, 2010; Bödor, Blood,
2013FOXO1 NM_002015 Hotspots exon 1 & FH domain exon 2 13q14.11 780 Morin, Nature, 2011; Trinh, Blood, 2013GNA13 NM_006572 Exons 1-4 17q24.1 1134 Morin, Nature, 2011; Muppidi, Nature,
2014ID3 NM_002167 Exons 1 & 2 1p36.12 360 Love, Nature Genetics, 2012; Schmitz,
Nature, 2012IRF4/MUM1 NM_002460 Exons 2-9 6p25.3 1356 Bea, Blood, 2005; Khodabakhshi,
Oncotarget, 2012ITPKB NM_002221 Exons 2-8 1q42.12 2830 Mareschal (submitted)KMT2D/MLL2 NM_003482 Exons 1-54 12q13.12 16614 Pasqualucci, Nat Genetics, 2011; Morin,
Nature, 2011MEF2B NM_005919 Exons 2-9 19p13.11 1107 Morin, Nature, 2011MFHAS1 NM_004225 Exons 1-3 8p23.1 3159 Mareschal (submitted)MYC NM_002467 Exons 1-3 8q24.21 1365 Pasqualucci, Nature, 2001MYD88 NM_001172567 Exons 2-5 3p22.2 587 Ngo, Nature, 2011NOTCH1 NM_017617 PEST domain exon 34 9q34.3 1488 Lohr, PNAS, 2012NOTCH2 NM_024408 Exons 26-28 & 34 (HD/PEST domains) 1p12-p11.2 2091 Lee, Cancer Sci, 2009PIM1 NM_001243186 Exons 1-6 6p21.2 942 Pasqualucci, Nature, 2001PRDM1/BLIMP1 NM_001198 Exons 1-7 6q21 2478 Pasqualucci, JEM, 2006SOCS1 NM_003745 Exon 2 16p13.13 636 Melzner, Blood, 2005; Mottok, Blood, 2009STAT6 NM_001178078 Exons 9-14 (DNA binding domain
hotspot)12q13.3 795 Ritz, Blood, 2009
TCF3 NM_001136139 B-HLH domain of E47 isoform exons 17 & 18
19p13.3 370 Schmitz, Nature, 2012
TNFAIP3 NM_001270507 Exons 2-9 6q23.3 2373 Compagno, Nature, 2009TNFRSF14 NM_003820 Exons 1-8 1p36.32 852 Lohr, PNAS, 2012TP53 NM_000546 Mutation hotspots exons 4-10 17p13.1 1004 Young, Blood, 2007; Xu-Monette, Blood,
2012XPO1 NM_003400 Exons 15-18 2p15 640 Mareschal (submitted)
Table S2: Overview of the Lymphopanel used for NGS analysis.
Gene Transcript Reference Pathway References
B2M NM_000633 Immunity Bjorkman, Nature 1987; Peaper, Annu Rev Cell Dev Biol. 2008; Hicklin, J Clin Invest. 1998
BCL2 NM_004048 Apoptosis/Cell Cycle Czabotar, Nature Reviews Molecular Cell Biology 2013; Burlacu, J Cell Mol Med. 2003
BRAF NM_004333 MAP Kinase Dhillon, Oncogene 2007CARD11 NM_032415 NFkB Staudt, Cold Spring Harb Perspect Biol. 2010CD58 NM_001779 Immunity Springer, Annu Rev Immunol.1987 ; Kanner, J Immunol.1992 ;
Sanchez-Madrid, PNAS 1982CD79A NM_001783 BCR Weiss, Cell 1994; Monroe, Nat Rev Immunol 2006; Kraus, Cell 2004CD79B NM_000626 BCR Weiss, Cell 1994; Monroe, Nat Rev Immunol 2006; Kraus, Cell 2004CDKN2A NM_058197 Apoptosis/Cell Cycle Pucci, Neoplasia 2000CDKN2B NM_004936 Apoptosis/Cell Cycle Pucci, Neoplasia 2000CIITA NM_000246 Immunity Mach, Annu Rev Immunol. 1996; Steimle, Cell 1993; Masternak, Genes
and Dev 2000;CREBBP NM_004380 Epigenetic Regulation Shaknovich & Melnick, Curr Opin Hematol. 2011; Pasqualucci, Nature
2011EP300 NM_001429 Epigenetic Regulation Shaknovich & Melnick, Curr Opin Hematol. 2011; Gu, Cell 1997;
Cerchietti, J Clin Invest. 2010; Pasqualucci, Nature 2011EZH2 NM_001203247 Epigenetic Regulation Shaknovich & Melnick, Curr Opin Hematol. 2011; Yap, Blood 2011;
Sneeringer, PNAS 2010FOXO1 NM_002015 Apoptosis/Cell Cycle Zhang, Molecular Cell Research 2011; Lam, Biochem Soc Trans. 2006GNA13 NM_006572 Apoptosis/Cell Cycle Morin, Blood 2013; Muppidi, Nature 2014ID3 NM_002167 BCR Pan, Mol Cell Biol. 1999; Richter, Nature Genetics 2012IRF4/MUM1 NM_002460 NFkB Shaffer, Clin Cancer Res. 2009; Grumont, J Exp Med. 2000ITPKB NM_002221 BCR Maréchal, PNAS 2007KMT2D/MLL2 NM_003482 Epigenetic Regulation Shaknovich & Melnick, Curr Opin Hematol. 2011; Morin, Nature 2011MEF2B NM_005919 Epigenetic Regulation Morin, Nature 2011MFHAS1 NM_004225 Apoptosis/Cell Cycle Sakabe, Cancer Res 1999; Tagawa, Oncogene 2004MYC NM_002467 Apoptosis/Cell Cycle Pucci, Neoplasia 2000; Conzen, Mol Cell Biol. 2000; Hoffman,
Oncogene 2008MYD88 NM_001172567 NFkB Muzio, Science 1997; Wesche, Immunity 1997NOTCH1 NM_017617 NOTCH Baron, Semin Cell Dev Biol. 2003NOTCH2 NM_024408 NOTCH Baron, Semin Cell Dev Biol. 2003PIM1 NM_001243186 NFkB Blanco-Aparicio, Biochem Pharmacol. 2013PRDM1/BLIMP1 NM_001198 NFkB Shaffer, Clin Cancer Res. 2009SOCS1 NM_003745 JAK-STAT Rawlings, J Cell Sci. 2004STAT6 NM_001178078 JAK-STAT Rawlings, J Cell Sci. 2004TCF3 NM_001136139 BCR Richter, Nature Genetics 2012TNFAIP3 NM_001270507 NFkB Shembade, Science 2010; Coornaert, J Biol Chem. 2009TNFRSF14 NM_003820 Immunity Steinberg, Immunol Rev. 2011TP53 NM_000546 Apoptosis/Cell Cycle Pucci, Neoplasia 2000; Levine, Cell 1997XPO1 NM_003400 Apoptosis/Cell Cycle Fukuda, Nature 1997; Stade, Cell 1997
Table S3: Overview of pathway selection
Non-Tumoral Sample Number of variants identi-fied
Number of variants post-fil-ter
Error rate (%)
HEN-22_002 76 1 1.3HEN-22_004 88 2 2.3HEN-22_006 74 0 0.0HEN-22_008 79 0 0.0HEN-22_012 71 1 1.4HEN-22_014 71 0 0.0HEN-22_016 77 0 0.0
Table S4: Validation of variant filtering by an independent study of seven non-tumoral samples from DLBCL patients
genomicHGVS Gene Mutation type VAF SIFT CADD TVC Score sampleName cDnaHGVS proteinHGVS
chr15:g.45007622TACTCCAAAGATTCAGGTT>- B2M frameshift deletion 28.6 NA NA 177 RELYSE_GHE0002
_PHR03B014 NM_004048:exon2:c.69_87del p.23_29del
chr15:g.45003773T>G B2M nonsynonymous SNV 22.5 0.00 3.06 152 RELYSE_GHE0047
_PHR39B020 NM_004048:exon1:c.T29G p.L10R
chr15:g.45007741GA>- B2M frameshift deletion 56.6 NA NA 519 RELYSE_GHE0061_PHR06B078 NM_004048:exon2:c.188_189del p.63_63del
chr15:g.45003746T>C B2M nonsynonymous SNV 47.1 0.00 3.54 293 RELYSE_GHE0092
_PHR02B009 NM_004048:exon1:c.T2C p.M1T
chr15:g.45007811C>G B2M stopgain SNV 30.2 0.11 2.91 499 RELYSE_GHE0114_PHR39B001 NM_004048:exon2:c.C258G p.Y86X
chr15:g.45003746T>A B2M nonsynonymous SNV 19.4 0.00 4.09 82 RELYSE_GHE0194
_PHR02B023 NM_004048:exon1:c.T2A p.M1K
chr15:g.45003746T>G B2M nonsynonymous SNV 29.3 0.00 3.45 290 RELYSE_GHE0197
_PHR02B075 NM_004048:exon1:c.T2G p.M1R
chr15:g.45007643C>G B2M stopgain SNV 20.0 1.00 2.51 118 RELYSE_GHE0197_PHR02B075 NM_004048:exon2:c.C90G p.Y30X
chr15:g.45003766G>- B2M frameshift deletion 19.6 NA NA 109 RELYSE_GHE0219_PHR03B037 NM_004048:exon1:c.22delG p.A8fs
chr15:g.45003746T>G B2M nonsynonymous SNV 60.4 0.00 3.45 652 RELYSE_GHE0358
_PHR01B039 NM_004048:exon1:c.T2G p.M1R
chr15:g.45003746T>G B2M nonsynonymous SNV 38.5 0.00 3.45 863 RELYSE_GHE0368
_PHR02B054.2 NM_004048:exon1:c.T2G p.M1R
chr15:g.45007639T>A B2M nonsynonymous SNV 35.8 0.00 3.16 349 RELYSE_GHE0368
_PHR02B054.2 NM_004048:exon2:c.T86A p.V29D
chr15:g.45003747G>A B2M nonsynonymous SNV 43.8 0.00 4.57 483 RELYSE_GHE0427
_PHR06B96 NM_004048:exon1:c.G3A p.M1I
chr15:g.45003812G>C B2M splicing 44.6 NA 1.82 878 RELYSE_GHE0535_PHR02B68 NA NA
chr15:g.45003765AG>- B2M frameshift deletion 50.0 NA NA 344 RELYSE_GHE0536_PHR02B069 NM_004048:exon1:c.21_22del p.7_8del
chr15:g.45003767C>G B2M nonsynonymous SNV 81.1 0.00 1.90 1564 RELYSE_GHE0547
_PHR02B066 NM_004048:exon1:c.C23G p.A8G
chr15:g.45003770T>A B2M nonsynonymous SNV 81.1 0.00 2.50 1563 RELYSE_GHE0547
_PHR02B066 NM_004048:exon1:c.T26A p.V9E
chr15:g.45003746T>A B2M nonsynonymous SNV 11.0 0.00 4.09 57 RELYSE_GHE0604
_PHR01B015 NM_004048:exon1:c.T2A p.M1K
chr15:g.45007863->A B2M frameshift insertion 54.6 NA NA 702 RELYSE_GHE0624
_PHR39B005 NM_004048:exon2:c.311dupA p.H104fs
chr15:g.45003746T>G B2M nonsynonymous SNV 27.0 0.00 3.45 291 RELYSE_GHE0629
_PHR01B024 NM_004048:exon1:c.T2G p.M1R
chr15:g.45003747G>A B2M nonsynonymous SNV 31.7 0.00 4.57 440 RELYSE_GHE0635
_PHR01B032 NM_004048:exon1:c.G3A p.M1I
chr15:g.45007673A>- B2M frameshift deletion 31.5 NA NA 168 RELYSE_GHE0635_PHR01B032 NM_004048:exon2:c.120delA p.S40fs
chr15:g.45003767C>A B2M nonsynonymous SNV 17.6 0.00 2.41 119 RELYSE_GHE0645
_PHR02B008 NM_004048:exon1:c.C23A p.A8D
chr15:g.45003764T>A B2M stopgain SNV 31.4 0.83 4.37 410 RELYSE_GHE0705_PHR02B034 NM_004048:exon1:c.T20A p.L7X
chr15:g.45003812G>A B2M splicing 74.3 NA 1.94 1666 RELYSE_GHE0708_PHR02B082 NA NA
chr15:g.45007873T>A B2M stopgain SNV 36.5 1.00 4.07 1119 RELYSE_GHE0721_PHR39B015 NM_004048:exon2:c.T320A p.L107X
chr15:g.45003745A>G B2M nonsynonymous SNV 26.0 0.00 3.84 137 RELYSE_GHE0809
_PHR06B004 NM_004048:exon1:c.A1G p.M1V
chr15:g.45003745A>G B2M nonsynonymous SNV 30.1 0.00 3.84 248 RELYSE_GHE0852
_PHR06B010 NM_004048:exon1:c.A1G p.M1V
chr15:g.45003812G>A B2M splicing 6.1 NA 1.94 18 RELYSE_GHE0976_PHR01B035 NA NA
chr15:g.45003745A>T B2M nonsynonymous SNV 9.9 0.00 4.24 97 RELYSE_GHE0997
_PHR07B012 NM_004048:exon1:c.A1T p.M1L
chr15:g.45003781CT>- B2M frameshift deletion 31.4 NA NA 591 RELYSE_GHE1009_PHR01B044 NM_004048:exon1:c.37_38del p.13_13del
chr15:g.45007806TT>- B2M frameshift deletion 29.4 NA NA 491 RELYSE_GHE1009_PHR01B044 NM_004048:exon2:c.253_254del p.85_85del
chr15:g.45003773T>G B2M nonsynonymous SNV 46.1 0.00 3.06 661 RELYSE_GHE1046
_PHR01B040 NM_004048:exon1:c.T29G p.L10R
chr15:g.45007718TGAAGTTGACTTAC>- B2M frameshift deletion 18.2 NA NA 73 RELYSE_GHE1192
_PHR02B073 NM_004048:exon2:c.165_178del p.55_60del
chr15:g.45003746T>G B2M nonsynonymous SNV 39.3 0.00 3.45 868 RELYSE_GHE1311
_PHR02B050 NM_004048:exon1:c.T2G p.M1R
chr15:g.45003746T>C B2M nonsynonymous SNV 9.0 0.00 3.54 51 RELYSE_GHE1352
_PHR01B034 NM_004048:exon1:c.T2C p.M1T
chr15:g.45003770T>G B2M nonsynonymous SNV 8.9 0.00 2.29 39 RELYSE_GHE1374
_PHR01B005 NM_004048:exon1:c.T26G p.V9G
chr15:g.45003745A>G B2M nonsynonymous SNV 11.0 0.00 3.84 73 RELYSE_GHE1409
_PHR02B070 NM_004048:exon1:c.A1G p.M1V
chr15:g.45007634TCAGGTTTAC>- B2M frameshift deletion 13.2 NA NA 34 RELYSE_GHE1536
_PHR02B030 NM_004048:exon2:c.81_90del p.27_30del
chr15:g.45003788T>C B2M nonsynonymous SNV 35.8 0.01 3.23 447 RELYSE_GHE1553
_PHR02B046 NM_004048:exon1:c.T44C p.L15P
chr15:g.45003740C>G B2M UTR5 10.3 NA NA 50 RELYSE_GHE1554_PHR02B045 NA NA
chr15:g.45003764T>G B2M stopgain SNV 10.3 0.83 4.26 50 RELYSE_GHE1554_PHR02B045 NM_004048:exon1:c.T20G p.L7X
chr15:g.45003812G>A B2M splicing 5.7 NA 1.94 18 RELYSE_GHE1558_PHR02B017 NA NA
chr15:g.45003746T>A B2M nonsynonymous SNV 14.2 0.00 4.09 101 RELYSE_GHE2096
_PHR05B016 NM_004048:exon1:c.T2A p.M1K
chr15:g.45003781CT>- B2M frameshift deletion 13.7 NA NA 94 RELYSE_GHE2096_PHR05B016 NM_004048:exon1:c.37_38del p.13_13del
chr15:g.45003747G>A B2M nonsynonymous SNV 26.7 0.00 4.57 197 RELYSE_GHE2121
_PHR05B003 NM_004048:exon1:c.G3A p.M1I
chr18:g.60985574C>T BCL2 nonsynonymous SNV 56.4 0.00 2.86 1093 RELYSE_GHE0015
_PHR01B045 NM_000633:exon2:c.G326A p.R109H
chr18:g.60985861C>A BCL2 nonsynonymous SNV 6.4 0.07 1.88 39 RELYSE_GHE0218
_PHR03B032 NM_000633:exon2:c.G39T p.E13D
chr18:g.60985872C>T BCL2 nonsynonymous SNV 6.4 0.46 3.31 39 RELYSE_GHE0218
_PHR03B032 NM_000633:exon2:c.G28A p.D10N
chr18:g.60985562G>C BCL2 nonsynonymous SNV 33.6 0.02 0.87 286 RELYSE_GHE0241
_PHR06B041 NM_000633:exon2:c.C338G p.A113G
chr18:g.60985847T>A BCL2 nonsynonymous SNV 26.2 0.81 1.86 333 RELYSE_GHE0241
_PHR06B041 NM_000633:exon2:c.A53T p.Y18F
chr18:g.60985526G>A BCL2 nonsynonymous SNV 56.8 0.00 2.48 2242 RELYSE_GHE0358
_PHR01B039 NM_000633:exon2:c.C374T p.T125I
chr18:g.60985362A>T BCL2 nonsynonymous SNV 30.5 0.00 3.29 295 RELYSE_GHE0423
_PHR06B045 NM_000633:exon2:c.T538A p.Y180N
chr18:g.60985879TG>CA BCL2 nonframeshift substitution 59.2 NA NA 3429 RELYSE_GHE0440
_PHR06B97 NM_000633:exon2:c.20_21TG
chr18:g.60985879TG>CG BCL2 nonframeshift substitution 59.2 NA NA 3429 RELYSE_GHE0440
_PHR06B97 NM_000633:exon2:c.20_21CG
chr18:g.60985692A>G BCL2 nonsynonymous SNV 37.5 0.05 1.52 66 RELYSE_GHE0463
_PHR06B070 NM_000633:exon2:c.T208C p.S70P
chr18:g.60985880G>A BCL2 nonsynonymous SNV 42.5 0.13 1.56 693 RELYSE_GHE0519
_PHRC03B020 NM_000633:exon2:c.C20T p.T7I
chr18:g.60985883C>G BCL2 nonsynonymous SNV 42.5 0.09 2.52 693 RELYSE_GHE0519
_PHRC03B020 NM_000633:exon2:c.G17C p.R6T
chr18:g.60985840A>C BCL2 nonsynonymous SNV 20.1 0.15 2.67 160 RELYSE_GHE0622
_PHRC03B016 NM_000633:exon2:c.T60G p.H20Q
chr18:g.60985866G>A BCL2 nonsynonymous SNV 20.3 0.00 4.22 161 RELYSE_GHE0622
_PHRC03B016 NM_000633:exon2:c.C34T p.R12W
chr18:g.60985872C>T BCL2 nonsynonymous SNV 20.6 0.46 3.31 162 RELYSE_GHE0622
_PHRC03B016 NM_000633:exon2:c.G28A p.D10N
chr18:g.60985817T>A BCL2 nonsynonymous SNV 33.1 0.00 3.64 361 RELYSE_GHE0733
_PHR06B054 NM_000633:exon2:c.A83T p.Y28F
chr18:g.60985647C>G BCL2 nonsynonymous SNV 59.5 0.02 0.50 235 RELYSE_GHE0777
_PHR02B036 NM_000633:exon2:c.G253C p.A85P
chr18:g.60985508GC>CT BCL2 nonframeshift substitution 46.0 NA NA 1846 RELYSE_GHE0923
_PHR06B064NM_000633:exon2:c.391_392AG
chr18:g.60985861C>G BCL2 nonsynonymous SNV 17.8 0.07 1.82 199 RELYSE_GHE0993
_PHR06B085 NM_000633:exon2:c.G39C p.E13D
chr18:g.60985877C>G BCL2 nonsynonymous SNV 17.9 0.26 4.32 200 RELYSE_GHE0993
_PHR06B085 NM_000633:exon2:c.G23C p.G8A
chr18:g.60985833GC>AT BCL2 nonframeshift substitution 71.2 NA NA 472 RELYSE_GHE1028
_PHR06B017 NM_000633:exon2:c.66_67AT
chr18:g.60985879TG>CA BCL2 nonframeshift substitution 16.7 NA NA 614 RELYSE_GHE1028
_PHR06B017 NM_000633:exon2:c.20_21TG
chr18:g.60985879TG>CG BCL2 nonframeshift substitution 16.7 NA NA 614 RELYSE_GHE1028
_PHR06B017 NM_000633:exon2:c.20_21CG
chr18:g.60985507GG>TT BCL2 nonframeshift substitution 23.1 NA NA 592 RELYSE_GHE1036
_PHR07B004.2NM_000633:exon2:c.392_393AA
chr18:g.60985644G>A BCL2 nonsynonymous SNV 22.2 0.46 1.96 21 RELYSE_GHE1222
_PHR02B047 NM_000633:exon2:c.C256T p.L86F
chr18:g.60985546C>G BCL2 nonsynonymous SNV 31.9 0.00 2.59 1230 RELYSE_GHE1392
_PHR03B024 NM_000633:exon2:c.G354C p.Q118H
chr18:g.60985542G>A BCL2 nonsynonymous SNV 14.9 0.00 1.91 187 RELYSE_GHE1437
_PHR06B018 NM_000633:exon2:c.C358T p.H120Y
chr18:g.60985883C>G BCL2 nonsynonymous SNV 14.3 0.09 2.52 78 RELYSE_GHE1437
_PHR06B018 NM_000633:exon2:c.G17C p.R6T
chr18:g.60985514C>T BCL2 nonsynonymous SNV 31.0 0.01 3.28 390 RELYSE_GHE1438
_PHR06B103 NM_000633:exon2:c.G386A p.R129H
chr18:g.60985542G>T BCL2 nonsynonymous SNV 29.8 0.00 2.74 366 RELYSE_GHE1438
_PHR06B103 NM_000633:exon2:c.C358A p.H120N
chr18:g.60795838T>C BCL2 UTR3 19.7 NA NA 337 RELYSE_GHE1553_PHR02B046 NA NA
chr18:g.60795898C>G BCL2 nonsynonymous SNV 20.5 1.00 3.73 365 RELYSE_GHE1553
_PHR02B046 NM_000633:exon3:c.G680C p.G227A
chr18:g.60985508G>T BCL2 nonsynonymous SNV 26.7 0.05 1.53 849 RELYSE_GHE1553
_PHR02B046 NM_000633:exon2:c.C392A p.A131D
chr18:g.60985514C>T BCL2 nonsynonymous SNV 29.8 0.01 3.28 1075 RELYSE_GHE1553
_PHR02B046 NM_000633:exon2:c.G386A p.R129H
chr18:g.60985870A>T BCL2 nonsynonymous SNV 30.3 0.08 3.55 342 RELYSE_GHE2023
_PHR05B032 NM_000633:exon2:c.T30A p.D10E
chr18:g.60985361T>A BCL2 nonsynonymous SNV 14.3 0.00 3.68 192 RELYSE_GHE2096
_PHR05B016 NM_000633:exon2:c.A539T p.Y180F
chr18:g.60985508G>T BCL2 nonsynonymous SNV 15.5 0.05 1.53 156 RELYSE_GHE2096
_PHR05B016 NM_000633:exon2:c.C392A p.A131D
chr7:g.140453136A>T BRAF nonsynonymous SNV 24.2 0.00 4.49 52 RELYSE_GHE0463
_PHR06B070 NM_004333:exon15:c.T1799A p.V600E
chr7:g.2978320C>T CARD11 nonsynonymous SNV 83.3 0.01 5.22 308 RELYSE_GHE0275
_PHR06B99 NM_032415:exon7:c.G1010A p.R337Q
chr7:g.2979534T>G CARD11 nonsynonymous SNV 27.6 0.10 4.95 384 RELYSE_GHE0395
_PHRC39B003 NM_032415:exon6:c.A713C p.K238T
chr7:g.2983958T>C CARD11 nonsynonymous SNV 61.0 0.79 2.81 2062 RELYSE_GHE0400
_PHRC06B015 NM_032415:exon5:c.A572G p.N191S
chr7:g.2979483TTC>- CARD11 nonframeshift deletion 26.7 NA NA 152 RELYSE_GHE0463
_PHR06B070 NM_032415:exon6:c.762_764del p.254_255del
chr7:g.2984141A>T CARD11 nonsynonymous SNV 22.9 0.02 4.58 525 RELYSE_GHE0463
_PHR06B070 NM_032415:exon5:c.T389A p.F130Y
chr7:g.2985462T>G CARD11 nonsynonymous SNV 24.4 0.05 3.54 134 RELYSE_GHE0563
_PHR06B031 NM_032415:exon4:c.A349C p.T117P
chr7:g.2985468A>G CARD11 nonsynonymous SNV 45.7 0.33 3.23 349 RELYSE_GHE0629
_PHR01B024 NM_032415:exon4:c.T343C p.F115L
chr7:g.2979501T>G CARD11 nonsynonymous SNV 65.6 0.05 4.33 1192 RELYSE_GHE0685
_PHRC06B021 NM_032415:exon6:c.A746C p.Q249P
chr7:g.2985545A>T CARD11 nonsynonymous SNV 61.3 0.13 2.34 1545 RELYSE_GHE0685
_PHRC06B021 NM_032415:exon4:c.T266A p.V89E
chr7:g.2983958T>C CARD11 nonsynonymous SNV 35.4 0.79 2.81 518 RELYSE_GHE0690
_PHR06B057 NM_032415:exon5:c.A572G p.N191S
chr7:g.2985465A>G CARD11 nonsynonymous SNV 56.0 0.01 4.49 925 RELYSE_GHE0693
_PHR01B028 NM_032415:exon4:c.T346C p.S116P
chr7:g.2977665T>C CARD11 nonsynonymous SNV 55.6 0.16 2.71 1771 RELYSE_GHE0842
_PHR03B033 NM_032415:exon8:c.A1019G p.Y340C
chr7:g.2985466G>T CARD11 nonsynonymous SNV 34.5 0.33 2.27 398 RELYSE_GHE0857
_PHR06B038 NM_032415:exon4:c.C345A p.F115L
chr7:g.2984142A>C CARD11 nonsynonymous SNV 43.1 0.09 4.07 1974 RELYSE_GHE0988
_PHR06B086.2 NM_032415:exon5:c.T388G p.F130V
chr7:g.2978320C>T CARD11 nonsynonymous SNV 21.7 0.01 5.22 93 RELYSE_GHE1009
_PHR01B044 NM_032415:exon7:c.G1010A p.R337Q
chr7:g.2979559C>T CARD11 nonsynonymous SNV 34.6 0.05 3.99 584 RELYSE_GHE1009
_PHR01B044 NM_032415:exon6:c.G688A p.D230N
chr7:g.2978320C>T CARD11 nonsynonymous SNV 48.1 0.01 5.22 746 RELYSE_GHE1225
_PHR02B038 NM_032415:exon7:c.G1010A p.R337Q
chr7:g.2985462T>G CARD11 nonsynonymous SNV 19.9 0.05 3.54 340 RELYSE_GHE1302
_PHR01B049 NM_032415:exon4:c.A349C p.T117P
chr7:g.2977613G>T CARD11 nonsynonymous SNV 16.5 0.21 4.55 282 RELYSE_GHE1349
_PHR02B086 NM_032415:exon8:c.C1071A p.D357E
chr7:g.2976810T>G CARD11 nonsynonymous SNV 59.6 0.03 4.82 1382 RELYSE_GHE1352
_PHR01B034 NM_032415:exon9:c.A1202C p.D401A
chr7:g.2979559C>T CARD11 nonsynonymous SNV 31.5 0.05 3.99 376 RELYSE_GHE1352
_PHR01B034 NM_032415:exon6:c.G688A p.D230N
chr7:g.2977614T>A CARD11 nonsynonymous SNV 41.2 0.01 4.57 981 RELYSE_GHE1373
_PHR07B017 NM_032415:exon8:c.A1070T p.D357V
chr7:g.2979559C>T CARD11 nonsynonymous SNV 28.0 0.05 3.99 325 RELYSE_GHE1437
_PHR06B018 NM_032415:exon6:c.G688A p.D230N
chr7:g.2977652CTT>- CARD11 nonframeshift deletion 32.6 NA NA 386 RELYSE_GHE2030
_PHR05B005NM_032415:exon8:c.1030_1032del p.344_344del
chr7:g.2984147G>A CARD11 nonsynonymous SNV 27.7 0.07 3.19 713 RELYSE_GHE2030
_PHR05B005 NM_032415:exon5:c.C383T p.T128M
chr1:g.117078637A>C CD58 stopgain SNV 26.4 0.69 2.82 699 RELYSE_GHE0057_PHR06B077 NM_001779:exon3:c.T578G p.L193X
chr1:g.117078761G>A CD58 stopgain SNV 8.9 0.69 2.23 73 RELYSE_GHE0228_PHR39B022 NM_001779:exon3:c.C454T p.R152X
chr1:g.117087145A>- CD58 stopgain SNV 81.0 NA NA 655 RELYSE_GHE0236_PHR06B043 NM_001779:exon2:c.152delT p.L51X
chr1:g.117087180C>- CD58 frameshift deletion 41.3 NA NA 733 RELYSE_GHE0368_PHR02B054.2 NM_001779:exon2:c.117delG p.G39fs
chr1:g.117113597C>G CD58 UTR5 21.4 NA NA 92 RELYSE_GHE0368_PHR02B054.2 NA NA
chr1:g.117078761G>A CD58 stopgain SNV 40.7 0.69 2.23 1381 RELYSE_GHE0415_PHRC06B013 NM_001779:exon3:c.C454T p.R152X
chr1:g.117113592C>T CD58 nonsynonymous SNV 7.7 0.00 2.51 37 RELYSE_GHE0426
_PHR06B98 NM_001779:exon1:c.G3A p.M1I
chr1:g.117078817A>T CD58 stopgain SNV 14.6 0.75 1.96 321 RELYSE_GHE0430_PHR06B94 NM_001779:exon3:c.T398A p.L133X
chr1:g.117086932C>T CD58 splicing 21.0 NA 1.81 105 RELYSE_GHE0430_PHR06B94 NA NA
chr1:g.117087215AGCTGAT>- CD58 frameshift deletion 87.8 NA NA 1099 RELYSE_GHE0436
_PHR06B95 NM_001779:exon2:c.76_82del p.26_28del
chr1:g.117086990A>T CD58 nonsynonymous SNV 30.7 0.00 1.98 1403 RELYSE_GHE0491
_PHR02B025 NM_001779:exon2:c.T307A p.Y103N
chr1:g.117078654A>T CD58 stopgain SNV 12.4 1.00 3.05 112 RELYSE_GHE0501_PHR06B062 NM_001779:exon3:c.T561A p.C187X
chr1:g.117113567C>T CD58 nonsynonymous SNV 22.2 0.00 2.08 174 RELYSE_GHE0507
_PHRC01B020 NM_001779:exon1:c.G28A p.A10T
chr1:g.117113542CAGAC>- CD58 frameshift deletion 24.6 NA NA 112 RELYSE_GHE0645
_PHR02B008 NM_001779:exon1:c.49_53del p.17_18del
chr1:g.117086994A>- CD58 frameshift deletion 74.3 NA NA 1375 RELYSE_GHE0685_PHRC06B021 NM_001779:exon2:c.303delT p.D101fs
chr1:g.117078739C>T CD58 stopgain SNV 19.7 1.00 3.11 314 RELYSE_GHE0705_PHR02B034 NM_001779:exon3:c.G476A p.W159X
chr1:g.117086990A>T CD58 nonsynonymous SNV 22.7 0.00 1.98 665 RELYSE_GHE0705
_PHR02B034 NM_001779:exon2:c.T307A p.Y103N
chr1:g.117086990A>T CD58 nonsynonymous SNV 28.2 0.00 1.98 1327 RELYSE_GHE0721
_PHR39B015 NM_001779:exon2:c.T307A p.Y103N
chr1:g.117087215A>G CD58 nonsynonymous SNV 60.0 0.27 2.02 1336 RELYSE_GHE0771
_PHR02B035 NM_001779:exon2:c.T82C p.C28R
chr1:g.117113594T>C CD58 nonsynonymous SNV 31.7 0.00 2.08 104 RELYSE_GHE0771
_PHR02B035 NM_001779:exon1:c.A1G p.M1V
chr1:g.117087118TT>- CD58 frameshift deletion 36.5 NA NA 488 RELYSE_GHE0908_PHR03B035 NM_001779:exon2:c.178_179del p.60_60del
chr1:g.117087123T>G CD58 nonsynonymous SNV 89.7 0.33 2.49 1710 RELYSE_GHE1104
_PHR03B036 NM_001779:exon2:c.A174C p.K58N
chr1:g.117113534GCAGCAG>- CD58 frameshift deletion 38.7 NA NA 97 RELYSE_GHE1287
_PHR03B027 NM_001779:exon1:c.55_61del p.19_21del
chr1:g.117087059T>- CD58 frameshift deletion 16.8 NA NA 264 RELYSE_GHE1390_PHR03B022 NM_001779:exon2:c.238delA p.R80fs
chr1:g.117086942AAAG>- CD58 frameshift deletion 40.0 NA NA 148 RELYSE_GHE1553
_PHR02B046 NM_001779:exon2:c.352_355del p.118_119del
chr1:g.117113594T>C CD58 nonsynonymous SNV 30.9 0.00 2.08 154 RELYSE_GHE1553
_PHR02B046 NM_001779:exon1:c.A1G p.M1V
chr1:g.117087007G>T CD58 stopgain SNV 11.3 0.84 2.62 188 RELYSE_GHE1554_PHR02B045 NM_001779:exon2:c.C290A p.S97X
chr1:g.117087012T>G CD58 nonsynonymous SNV 10.8 0.01 2.16 124 RELYSE_GHE1554
_PHR02B045 NM_001779:exon2:c.A285C p.L95F
chr19:g.42385043C>T CD79A nonsynonymous SNV 42.2 0.00 3.70 961 RELYSE_GHE0733
_PHR06B054 NM_001783:exon5:c.C677T p.P226L
chr19:g.42385020AGG>- CD79A nonframeshift deletion 47.4 NA NA 2273 RELYSE_GHE1225
_PHR02B038 NM_001783:exon5:c.654_656del p.218_219del
chr17:g.62006798T>A CD79B nonsynonymous SNV 27.7 0.00 2.93 376 RELYSE_GHE0061
_PHR06B078 NM_000626:exon5:c.A587T p.Y196F
chr17:g.62006659->T CD79B frameshift insertion 30.2 NA NA 345 RELYSE_GHE0134
_PHR06B019 NM_000626:exon6:c.616dupA p.T206fs
chr17:g.62006663C>T CD79B nonsynonymous SNV 30.4 0.01 4.07 577 RELYSE_GHE0134
_PHR06B019 NM_000626:exon6:c.G613A p.A205T
chr17:g.62006798T>C CD79B nonsynonymous SNV 40.4 0.00 2.15 360 RELYSE_GHE0150
_PHR06B082 NM_000626:exon5:c.A587G p.Y196C
chr17:g.62006826T>A CD79B stopgain SNV 37.9 1.00 1.64 792 RELYSE_GHE0300_PHR07B007 NM_000626:exon5:c.A559T p.K187X
chr17:g.62006620T>C CD79B nonsynonymous SNV 44.2 0.03 4.06 1265 RELYSE_GHE0454
_PHR07B15 NM_000626:exon6:c.A656G p.K219R
chr17:g.62006798T>G CD79B nonsynonymous SNV 39.3 0.00 2.33 633 RELYSE_GHE0454
_PHR07B15 NM_000626:exon5:c.A587C p.Y196S
chr17:g.62006794C>G CD79B nonsynonymous SNV 27.9 NA 2.94 509 RELYSE_GHE0459
_PHR02B080 NM_000626:exon5:c.G591C p.E197D
chr17:g.62006670GT>- CD79B frameshift deletion 75.4 NA NA 3245 RELYSE_GHE0717_PHR39B016 NM_000626:exon6:c.605_606del p.202_202del
chr17:g.62006799A>T CD79B nonsynonymous SNV 28.8 0.00 2.54 425 RELYSE_GHE0808
_PHR06B053 NM_000626:exon5:c.T586A p.Y196N
chr17:g.62006799A>T CD79B nonsynonymous SNV 40.4 0.00 2.54 324 RELYSE_GHE0811
_PHR06B003 NM_000626:exon5:c.T586A p.Y196N
chr17:g.62006799A>T CD79B nonsynonymous SNV 30.8 0.00 2.54 146 RELYSE_GHE0837
_PHR02B005 NM_000626:exon5:c.T586A p.Y196N
chr17:g.62006799A>G CD79B nonsynonymous SNV 41.0 0.00 2.48 494 RELYSE_GHE0842
_PHR03B033 NM_000626:exon5:c.T586C p.Y196H
chr17:g.62006798T>C CD79B nonsynonymous SNV 38.5 0.00 2.15 652 RELYSE_GHE0855
_PHR06B049 NM_000626:exon5:c.A587G p.Y196C
chr17:g.62006805->AT CD79B frameshift insertion 25.1 NA NA 486 RELYSE_GHE0860
_PHR06B050NM_000626:exon5:c.579_580insAT p.H194fs
chr17:g.62006558G>C CD79B UTR3 61.5 NA NA 4656 RELYSE_GHE0925_PHR06B067 NA NA
chr17:g.62006799A>G CD79B nonsynonymous SNV 60.0 0.00 2.48 1411 RELYSE_GHE0925
_PHR06B067 NM_000626:exon5:c.T586C p.Y196H
chr17:g.62006799A>T CD79B nonsynonymous SNV 54.8 0.00 2.54 2102 RELYSE_GHE1036
_PHR07B004.2 NM_000626:exon5:c.T586A p.Y196N
chr17:g.62006799A>G CD79B nonsynonymous SNV 60.9 0.00 2.48 2702 RELYSE_GHE1189
_PHR07B009.2 NM_000626:exon5:c.T586C p.Y196H
chr17:g.62006798T>C CD79B nonsynonymous SNV 31.6 0.00 2.15 93 RELYSE_GHE1192
_PHR02B073 NM_000626:exon5:c.A587G p.Y196C
chr17:g.62006798T>G CD79B nonsynonymous SNV 57.5 0.00 2.33 1846 RELYSE_GHE1413
_PHR06B081 NM_000626:exon5:c.A587C p.Y196S
chr17:g.62006655A>T CD79B stopgain SNV 38.2 1.00 1.97 1056 RELYSE_GHE1553_PHR02B046 NM_000626:exon6:c.T621A p.Y207X
chr17:g.62006799A>G CD79B nonsynonymous SNV 54.6 0.00 2.48 1466 RELYSE_GHE2026
_PHR05B022.2 NM_000626:exon5:c.T586C p.Y196H
chr17:g.62006799A>C CD79B nonsynonymous SNV 21.9 0.00 2.34 145 RELYSE_GHE2030
_PHR05B005 NM_000626:exon5:c.T586G p.Y196D
chr17:g.62006680A>C CD79B nonsynonymous SNV 81.9 0.00 3.23 3437 RELYSE_GHE2037
_PHR05B009 NM_000626:exon6:c.T596G p.L199R
chr17:g.62006799A>G CD79B nonsynonymous SNV 24.1 0.00 2.48 125 RELYSE_GHE2121
_PHR05B003 NM_000626:exon5:c.T586C p.Y196H
chr9:g.21968652G>C CDKN2A UTR3 52.2 NA NA 593 RELYSE_GHE0522_PHRC06B025 NA NA
chr9:g.21968652G>C CDKN2A UTR3 49.3 NA NA 658 RELYSE_GHE0810_PHR06B002 NA NA
chr9:g.21968652G>C CDKN2A UTR3 94.0 NA NA 1839 RELYSE_GHE2019_PHR05B030 NA NA
chr9:g.22008933C>T CDKN2B nonsynonymous SNV 69.4 0.02 3.00 426 RELYSE_GHE0501
_PHR06B062 NM_004936:exon1:c.G20A p.G7D
chr9:g.22008814C>G CDKN2B nonsynonymous SNV 36.0 0.00 4.80 315 RELYSE_GHE0877
_PHR01B026.2 NM_004936:exon1:c.G139C p.G47R
chr16:g.11003041AG>- CIITA frameshift deletion 67.6 NA NA 1522 RELYSE_GHE0061_PHR06B078
NM_000246:exon12:c.2813_2814del p.938_938del
chr16:g.10971131G>A CIITA UTR5 6.3 NA NA 25 RELYSE_GHE0202_PHR02B85 NA NA
chr16:g.10997716C>T CIITA nonsynonymous SNV 83.1 0.04 3.55 1610 RELYSE_GHE0236
_PHR06B043 NM_000246:exon9:c.C901T p.P301S
chr16:g.11000395A>T CIITA nonsynonymous SNV 13.0 0.63 2.26 202 RELYSE_GHE0293
_PHR02B042 NM_000246:exon11:c.A1046T p.Y349F
chr16:g.11000517CG>- CIITA frameshift deletion 30.8 NA NA 471 RELYSE_GHE0356_PHR01B011
NM_000246:exon11:c.1168_1169del p.390_390del
chr16:g.11001748CACTGCGGGCGCGGCAGCTGCTGGAGCTGCTGCACTGCGCC>-
CIITA frameshift deletion 44.4 NA NA 50 RELYSE_GHE0356_PHR01B011
NM_000246:exon11:c.2399_2439del p.800_813del
chr16:g.10971204C>T CIITA nonsynonymous SNV 63.8 0.48 2.52 2186 RELYSE_GHE0368
_PHR02B054.2 NM_000246:exon1:c.C17T p.P6L
chr16:g.10971213C>T CIITA nonsynonymous SNV 66.5 0.03 0.93 1725 RELYSE_GHE0368
_PHR02B054.2 NM_000246:exon1:c.C26T p.A9V
chr16:g.11001588T>- CIITA frameshift deletion 30.7 NA NA 172 RELYSE_GHE0427_PHR06B96 NM_000246:exon11:c.2239delT p.Y747fs
chr16:g.11016266T>A CIITA nonsynonymous SNV 9.9 0.00 2.34 67 RELYSE_GHE0427
_PHR06B96 NM_000246:exon18:c.T3236A p.V1079D
chr16:g.11016271T>A CIITA nonsynonymous SNV 10.4 0.55 2.03 74 RELYSE_GHE0427
_PHR06B96 NM_000246:exon18:c.T3241A p.Y1081N
chr16:g.11017092A>G CIITA nonsynonymous SNV 9.4 0.08 2.39 45 RELYSE_GHE0430
_PHR06B94 NM_000246:exon19:c.A3325G p.T1109A
chr16:g.10971160G>A CIITA UTR5 30.3 NA NA 242 RELYSE_GHE0491_PHR02B025 NA NA
chr16:g.10971239G>C CIITA nonsynonymous SNV 20.9 0.01 2.33 235 RELYSE_GHE0536
_PHR02B069 NM_000246:exon1:c.G52C p.G18R
chr16:g.10971190G>A CIITA nonsynonymous SNV 5.3 0.00 1.58 23 RELYSE_GHE0602
_PHRC01B017 NM_000246:exon1:c.G3A p.M1I
chr16:g.10971192G>A CIITA nonsynonymous SNV 5.7 0.00 2.05 27 RELYSE_GHE0602
_PHRC01B017 NM_000246:exon1:c.G5A p.R2H
chr16:g.11016331C>T CIITA nonsynonymous SNV 32.9 0.23 1.61 547 RELYSE_GHE0624
_PHR39B005 NM_000246:exon18:c.C3301T p.H1101Y
chr16:g.10971104C>T CIITA UTR5 64.9 NA NA 720 RELYSE_GHE0629_PHR01B024 NA NA
chr16:g.11016281T>G CIITA nonsynonymous SNV 33.9 0.01 3.72 681 RELYSE_GHE0635
_PHR01B032 NM_000246:exon18:c.T3251G p.F1084C
chr16:g.10971124G>A CIITA UTR5 31.4 NA NA 287 RELYSE_GHE0645_PHR02B008 NA NA
chr16:g.10971239G>C CIITA nonsynonymous SNV 25.4 0.01 2.33 312 RELYSE_GHE0645
_PHR02B008 NM_000246:exon1:c.G52C p.G18R
chr16:g.10989612G>A CIITA nonsynonymous SNV 66.0 0.05 2.41 1526 RELYSE_GHE0659
_PHR39B010 NM_000246:exon3:c.G286A p.A96T
chr16:g.10971219CCTACC>- CIITA nonframeshift
deletion 81.5 NA NA 873 RELYSE_GHE0708_PHR02B082 NM_000246:exon1:c.32_37del p.11_13del
chr16:g.10971104C>T CIITA UTR5 54.7 NA NA 415 RELYSE_GHE0810_PHR06B002 NA NA
chr16:g.10971142G>A CIITA UTR5 50.8 NA NA 279 RELYSE_GHE0955_PHR06B036 NA NA
chr16:g.11000658T>C CIITA nonsynonymous SNV 32.5 0.00 2.87 508 RELYSE_GHE0992
_PHR06B084 NM_000246:exon11:c.T1309C p.W437R
chr16:g.11001304->C CIITA frameshift insertion 39.0 NA NA 172 RELYSE_GHE1009
_PHR01B044 NM_000246:exon11:c.1956dupC p.S652fs
chr16:g.11000940G>A CIITA nonsynonymous SNV 53.6 0.26 3.15 1453 RELYSE_GHE1302
_PHR01B049 NM_000246:exon11:c.G1591A p.G531S
chr16:g.10971160G>A CIITA UTR5 8.3 NA NA 29 RELYSE_GHE1311_PHR02B050 NA NA
chr16:g.11016045CG>TG CIITA nonframeshift substitution 37.1 NA NA 1422 RELYSE_GHE1374
_PHR01B005NM_000246:exon17:c.3171_3172TG
chr16:g.10971191C>T CIITA nonsynonymous SNV 33.8 0.00 2.80 177 RELYSE_GHE1376
_PHR03B002 NM_000246:exon1:c.C4T p.R2C
chr16:g.10971096C>T CIITA UTR5 16.7 NA NA 128 RELYSE_GHE1390_PHR03B022 NA NA
chr16:g.10998665G>A CIITA stopgain SNV 12.9 0.40 3.57 20 RELYSE_GHE1390_PHR03B022 NM_000246:exon10:c.G1002A p.W334X
chr16:g.10971165T>G CIITA UTR5 24.2 NA NA 188 RELYSE_GHE1424_PHR06B029 NA NA
chr16:g.10971104C>T CIITA UTR5 39.4 NA NA 357 RELYSE_GHE1558_PHR02B017 NA NA
chr16:g.11012361G>A CIITA nonsynonymous SNV 22.3 0.21 1.92 149 RELYSE_GHE2023
_PHR05B032 NM_000246:exon16:c.G3127A p.A1043T
chr16:g.11000890C>T CIITA nonsynonymous SNV 26.3 0.03 1.27 486 RELYSE_GHE2030
_PHR05B005 NM_000246:exon11:c.C1541T p.T514M
chr16:g.11010256A>- CIITA frameshift deletion 27.1 NA NA 309 RELYSE_GHE2106_PHR05B018 NM_000246:exon15:c.3002delA p.D1001fs
chr16:g.11010259A>G CIITA nonsynonymous SNV 28.0 0.02 3.42 249 RELYSE_GHE2106
_PHR05B018 NM_000246:exon15:c.A3005G p.E1002G
chr16:g.3842075G>A CREBBP stopgain SNV 46.9 1.00 12.11 674 RELYSE_GHE0049_PHR06B089.2 NM_004380:exon5:c.C1237T p.R413X
chr16:g.3786146A>G CREBBP nonsynonymous SNV 13.2 0.01 3.83 289 RELYSE_GHE0052
_PHR06B074 NM_004380:exon28:c.T4619C p.F1540S
chr16:g.3820762G>A CREBBP stopgain SNV 26.4 0.43 13.27 615 RELYSE_GHE0057_PHR06B077 NM_004380:exon14:c.C2689T p.Q897X
chr16:g.3778744T>A CREBBP stopgain SNV 5.9 1.00 17.36 43 RELYSE_GHE0202_PHR02B85 NM_004380:exon31:c.A6304T p.K2102X
chr16:g.3788645T>A CREBBP nonsynonymous SNV 14.1 0.00 3.33 101 RELYSE_GHE0202
_PHR02B85 NM_004380:exon26:c.A4309T p.I1437F
chr16:g.3900384C>G CREBBP nonsynonymous SNV 59.6 0.83 3.94 1413 RELYSE_GHE0216
_PHR03B021 NM_004380:exon2:c.G712C p.V238L
chr16:g.3790515C>T CREBBP nonsynonymous SNV 26.4 0.50 1.52 273 RELYSE_GHE0229
_PHR39B007 NM_004380:exon24:c.G4018A p.D1340N
chr16:g.3788666A>C CREBBP nonsynonymous SNV 35.4 0.00 3.64 459 RELYSE_GHE0241
_PHR06B041 NM_004380:exon26:c.T4288G p.Y1430D
chr16:g.3786787G>A CREBBP nonsynonymous SNV 30.8 0.00 4.27 343 RELYSE_GHE0423
_PHR06B045 NM_004380:exon27:c.C4424T p.P1475L
chr16:g.3788648T>A CREBBP nonsynonymous SNV 34.5 0.00 4.07 407 RELYSE_GHE0423
_PHR06B045 NM_004380:exon26:c.A4306T p.S1436C
chr16:g.3786649A>G CREBBP splicing 31.0 NA 3.18 104 RELYSE_GHE0440_PHR06B97 NA NA
chr16:g.3786787G>A CREBBP nonsynonymous SNV 48.9 0.00 4.27 643 RELYSE_GHE0463
_PHR06B070 NM_004380:exon27:c.C4424T p.P1475L
chr16:g.3786707A>G CREBBP nonsynonymous SNV 28.7 0.00 3.72 325 RELYSE_GHE0469
_PHR06B006 NM_004380:exon27:c.T4504C p.W1502R
chr16:g.3807376T>A CREBBP nonsynonymous SNV 55.1 0.06 2.79 893 RELYSE_GHE0495
_PHR06B063 NM_004380:exon19:c.A3611T p.Y1204F
chr16:g.3820806G>A CREBBP nonsynonymous SNV 36.9 0.20 2.73 1247 RELYSE_GHE0495
_PHR06B063 NM_004380:exon14:c.C2645T p.P882L
chr16:g.3820908A>G CREBBP nonsynonymous SNV 36.9 1.00 3.59 666 RELYSE_GHE0519
_PHRC03B020 NM_004380:exon14:c.T2543C p.V848A
chr16:g.3786137T>A CREBBP nonsynonymous SNV 25.7 0.00 3.72 641 RELYSE_GHE0535
_PHR02B68 NM_004380:exon28:c.A4628T p.D1543V
chr16:g.3820723T>C CREBBP nonsynonymous SNV 54.3 0.84 1.61 727 RELYSE_GHE0562
_PHR06B030 NM_004380:exon14:c.A2728G p.T910A
chr16:g.3820836G>A CREBBP nonsynonymous SNV 52.6 0.11 1.82 747 RELYSE_GHE0645
_PHR02B008 NM_004380:exon14:c.C2615T p.T872M
chr16:g.3781775A>G CREBBP splicing 41.7 NA 4.51 134 RELYSE_GHE0689_PHR06B056 NA NA
chr16:g.3801739G>A CREBBP nonsynonymous SNV 12.9 0.05 2.85 127 RELYSE_GHE0708
_PHR02B082 NM_004380:exon20:c.C3767T p.S1256L
chr16:g.3786703T>C CREBBP nonsynonymous SNV 34.6 0.00 3.70 1018 RELYSE_GHE0733
_PHR06B054 NM_004380:exon27:c.A4508G p.Y1503C
chr16:g.3817750G>C CREBBP stopgain SNV 66.3 0.27 14.36 725 RELYSE_GHE0733_PHR06B054 NM_004380:exon16:c.C3221G p.S1074X
chr16:g.3843409A>T CREBBP stopgain SNV 35.9 1.00 12.58 1490 RELYSE_GHE0771_PHR02B035 NM_004380:exon4:c.T1194A p.C398X
chr16:g.3786797A>G CREBBP nonsynonymous SNV 77.4 0.00 3.46 1106 RELYSE_GHE0807
_PHR06B001 NM_004380:exon27:c.T4414C p.W1472R
chr16:g.3790421A>T CREBBP nonsynonymous SNV 44.4 0.00 4.14 1155 RELYSE_GHE0834
_PHR01B043 NM_004380:exon24:c.T4112A p.V1371D
chr16:g.3860607A>T CREBBP nonsynonymous SNV 43.4 0.05 2.70 1428 RELYSE_GHE0834
_PHR01B043 NM_004380:exon3:c.T972A p.N324K
chr16:g.3786703T>C CREBBP nonsynonymous SNV 71.9 0.00 3.70 2101 RELYSE_GHE0857
_PHR06B038 NM_004380:exon27:c.A4508G p.Y1503C
chr16:g.3789586T>G CREBBP nonsynonymous SNV 73.9 0.00 3.69 860 RELYSE_GHE0883
_PHR01B042.2 NM_004380:exon25:c.A4273C p.N1425H
chr16:g.3842042G>A CREBBP stopgain SNV 42.8 1.00 12.77 607 RELYSE_GHE0923_PHR06B064 NM_004380:exon5:c.C1270T p.R424X
chr16:g.3781324AGG>- CREBBP nonframeshift deletion 41.9 NA NA 239 RELYSE_GHE0976
_PHR01B035NM_004380:exon30:c.5039_5041del p.1680_1681del
chr16:g.3807330A>T CREBBP stopgain SNV 36.7 1.00 15.67 174 RELYSE_GHE1028_PHR06B017 NM_004380:exon19:c.T3657A p.C1219X
chr16:g.3817719A>T CREBBP splicing 40.0 NA 2.06 97 RELYSE_GHE1028_PHR06B017 NA NA
chr16:g.3788646A>T CREBBP nonsynonymous SNV 32.0 0.00 3.79 547 RELYSE_GHE1053
_PHR02B081 NM_004380:exon26:c.T4308A p.S1436R
chr16:g.3832811G>A CREBBP stopgain SNV 26.1 1.00 12.78 36 RELYSE_GHE1066_PHR06B059 NM_004380:exon6:c.C1447T p.R483X
chr16:g.3781775A>G CREBBP splicing 35.5 NA 4.51 85 RELYSE_GHE1069_PHR06B058 NA NA
chr16:g.3832757G>A CREBBP stopgain SNV 38.3 0.45 13.40 542 RELYSE_GHE1393_PHR03B023 NM_004380:exon6:c.C1501T p.Q501X
chr16:g.3819201C>A CREBBP stopgain SNV 16.5 0.42 12.61 154 RELYSE_GHE1437_PHR06B018 NM_004380:exon15:c.G3034T p.E1012X
chr16:g.3786703T>C CREBBP nonsynonymous SNV 33.0 0.00 3.70 507 RELYSE_GHE1438
_PHR06B103 NM_004380:exon27:c.A4508G p.Y1503C
chr16:g.3786791A>G CREBBP nonsynonymous SNV 15.6 0.00 3.58 123 RELYSE_GHE1450
_PHR02B044 NM_004380:exon27:c.T4420C p.C1474R
chr16:g.3820723T>C CREBBP nonsynonymous SNV 44.1 0.84 1.61 225 RELYSE_GHE1558
_PHR02B017 NM_004380:exon14:c.A2728G p.T910A
chr16:g.3781324AGG>- CREBBP nonframeshift deletion 37.7 NA NA 348 RELYSE_GHE2002
_PHR05B029NM_004380:exon30:c.5039_5041del p.1680_1681del
chr16:g.3820970A>- CREBBP frameshift deletion 60.0 NA NA 562 RELYSE_GHE2023_PHR05B032 NM_004380:exon14:c.2481delT p.A827fs
chr16:g.3808046A>G CREBBP nonsynonymous SNV 25.1 0.00 2.20 302 RELYSE_GHE2030
_PHR05B005 NM_004380:exon18:c.T3373C p.Y1125H
chr16:g.3807292T>- CREBBP frameshift deletion 38.4 NA NA 716 RELYSE_GHE2098_PHR05B031 NM_004380:exon19:c.3695delA p.N1232fs
chr16:g.3786696->T CREBBP frameshift insertion 30.4 NA NA 200 RELYSE_GHE2100
_PHR05B015 NM_004380:exon27:c.4514dupA p.K1505fs
chr16:g.3820684G>A CREBBP stopgain SNV 17.4 0.92 15.26 124 RELYSE_GHE2109_PHR05B025 NM_004380:exon14:c.C2767T p.Q923X
chr22:g.41542780T>G EP300 nonsynonymous SNV 59.1 0.28 3.36 855 RELYSE_GHE0061
_PHR06B078 NM_001429:exon11:c.T2091G p.S697R
chr22:g.41566522T>A EP300 nonsynonymous SNV 19.3 0.00 4.33 227 RELYSE_GHE0134
_PHR06B019 NM_001429:exon27:c.T4399A p.Y1467N
chr22:g.41574310C>T EP300 nonsynonymous SNV 46.9 0.38 1.65 1446 RELYSE_GHE0169
_PHR01B023 NM_001429:exon31:c.C6595T p.P2199S
chr22:g.41551061G>A EP300 nonsynonymous SNV 18.2 0.00 4.36 21 RELYSE_GHE0197
_PHR02B075 NM_001429:exon17:c.G3205A p.D1069N
chr22:g.41554488T>G EP300 nonsynonymous SNV 22.7 0.00 3.95 28 RELYSE_GHE0197
_PHR02B075 NM_001429:exon19:c.T3574G p.Y1192D
chr22:g.41546158C>A EP300 nonsynonymous SNV 51.4 0.39 2.19 1114 RELYSE_GHE0228
_PHR39B022 NM_001429:exon14:c.C2773A p.P925T
chr22:g.41542780T>G EP300 nonsynonymous SNV 45.3 0.28 3.36 214 RELYSE_GHE0262
_PHR06B040.2 NM_001429:exon11:c.T2091G p.S697R
chr22:g.41546158C>A EP300 nonsynonymous SNV 44.7 0.39 2.19 960 RELYSE_GHE0352
_PHR01B007 NM_001429:exon14:c.C2773A p.P925T
chr22:g.41573216G>A EP300 nonsynonymous SNV 12.2 0.24 2.86 128 RELYSE_GHE0371
_PHR02B84 NM_001429:exon31:c.G5501A p.S1834N
chr22:g.41566520G>C EP300 nonsynonymous SNV 19.3 0.00 3.70 333 RELYSE_GHE0397
_PHRC06B014 NM_001429:exon27:c.G4397C p.W1466S
chr22:g.41542780T>G EP300 nonsynonymous SNV 52.4 0.28 3.36 1242 RELYSE_GHE0426
_PHR06B98 NM_001429:exon11:c.T2091G p.S697R
chr22:g.41566496CCA>- EP300 nonframeshift deletion 44.6 NA NA 264 RELYSE_GHE0440
_PHR06B97NM_001429:exon27:c.4373_4375del p.1458_1459del
chr22:g.41566522T>A EP300 nonsynonymous SNV 10.7 0.00 4.33 71 RELYSE_GHE0501
_PHR06B062 NM_001429:exon27:c.T4399A p.Y1467N
chr22:g.41542780T>G EP300 nonsynonymous SNV 46.4 0.28 3.36 1704 RELYSE_GHE0515
_PHR02B058 NM_001429:exon11:c.T2091G p.S697R
chr22:g.41525969T>C EP300 nonsynonymous SNV 47.5 0.04 4.75 446 RELYSE_GHE0547
_PHR02B066 NM_001429:exon5:c.T1244C p.L415P
chr22:g.41572937C>T EP300 nonsynonymous SNV 6.2 0.02 3.81 31 RELYSE_GHE0604
_PHR01B015 NM_001429:exon31:c.C5222T p.S1741F
chr22:g.41533775A>C EP300 nonsynonymous SNV 15.2 0.06 4.96 188 RELYSE_GHE0609
_PHR02B014 NM_001429:exon8:c.A1741C p.N581H
chr22:g.41546152T>C EP300 nonsynonymous SNV 24.6 0.27 2.71 504 RELYSE_GHE0721
_PHR39B015 NM_001429:exon14:c.T2767C p.S923P
chr22:g.41545914C>A EP300 nonsynonymous SNV 50.6 0.30 1.61 407 RELYSE_GHE0811
_PHR06B003 NM_001429:exon14:c.C2529A p.H843Q
chr22:g.41513727G>A EP300 nonsynonymous SNV 46.8 0.23 3.35 1345 RELYSE_GHE0849
_PHR06B039 NM_001429:exon2:c.G631A p.G211S
chr22:g.41546158C>A EP300 nonsynonymous SNV 47.8 0.39 2.19 1378 RELYSE_GHE0860
_PHR06B050 NM_001429:exon14:c.C2773A p.P925T
chr22:g.41574561->C EP300 frameshift insertion 95.8 NA NA 2184 RELYSE_GHE0865
_PHR06B061 NM_001429:exon31:c.6847dupC p.Q2282fs
chr22:g.41574561G>C EP300 nonsynonymous SNV 95.8 0.03 2.50 2184 RELYSE_GHE0865
_PHR06B061 NM_001429:exon31:c.G6846C p.Q2282H
chr22:g.41546158C>A EP300 nonsynonymous SNV 51.6 0.39 2.19 1606 RELYSE_GHE0873
_PHR01B027 NM_001429:exon14:c.C2773A p.P925T
chr22:g.41546158C>A EP300 nonsynonymous SNV 49.3 0.39 2.19 2227 RELYSE_GHE0877
_PHR01B026.2 NM_001429:exon14:c.C2773A p.P925T
chr22:g.41489103G>C EP300 splicing 38.8 NA 4.34 344 RELYSE_GHE0908_PHR03B035 NA NA
chr22:g.41551092T>C EP300 nonsynonymous SNV 41.2 0.00 4.28 507 RELYSE_GHE0923
_PHR06B064 NM_001429:exon17:c.T3236C p.V1079A
chr22:g.41543839A>C EP300 splicing 31.0 NA 3.54 295 RELYSE_GHE0992_PHR06B084 NA NA
chr22:g.41565564G>T EP300 nonsynonymous SNV 36.6 0.00 3.19 1043 RELYSE_GHE1036
_PHR07B004.2 NM_001429:exon26:c.G4230T p.R1410S
chr22:g.41525969T>C EP300 nonsynonymous SNV 25.0 0.04 4.75 114 RELYSE_GHE1053
_PHR02B081 NM_001429:exon5:c.T1244C p.L415P
chr22:g.41537191C>T EP300 nonsynonymous SNV 46.3 0.03 4.51 1440 RELYSE_GHE1390
_PHR03B022 NM_001429:exon10:c.C2018T p.P673L
chr22:g.41565524A>C EP300 nonsynonymous SNV 31.2 0.00 4.71 505 RELYSE_GHE1392
_PHR03B024 NM_001429:exon26:c.A4190C p.Y1397S
chr22:g.41574561->C EP300 frameshift insertion 96.4 NA NA 2972 RELYSE_GHE1560
_PHR07B002 NM_001429:exon31:c.6847dupC p.Q2282fs
chr22:g.41574561G>C EP300 nonsynonymous SNV 96.4 0.03 2.50 2972 RELYSE_GHE1560
_PHR07B002 NM_001429:exon31:c.G6846C p.Q2282H
chr22:g.41566459T>C EP300 nonsynonymous SNV 47.8 0.00 4.14 1378 RELYSE_GHE2106
_PHR05B018 NM_001429:exon27:c.T4336C p.Y1446H
chr22:g.41542780T>G EP300 nonsynonymous SNV 54.5 0.28 3.36 604 RELYSE_GHE2109
_PHR05B025 NM_001429:exon11:c.T2091G p.S697R
chr22:g.41562653A>G EP300 nonsynonymous SNV 11.8 0.02 3.98 32 RELYSE_GHE2109
_PHR05B025 NM_001429:exon23:c.A3857G p.N1286S
chr7:g.148508728A>T EZH2 nonsynonymous SNV 20.0 0.00 4.94 233 RELYSE_GHE0114
_PHR39B001NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508727T>A EZH2 nonsynonymous SNV 27.0 0.00 4.91 664 RELYSE_GHE0218
_PHR03B032NM_001203247:exon16:c.A1922T p.Y641F
chr7:g.148508727T>G EZH2 nonsynonymous SNV 4.5 0.00 4.62 22 RELYSE_GHE0294
_PHR02B055NM_001203247:exon16:c.A1922C p.Y641S
chr7:g.148508727T>A EZH2 nonsynonymous SNV 27.7 0.00 4.91 1137 RELYSE_GHE0440
_PHR06B97NM_001203247:exon16:c.A1922T p.Y641F
chr7:g.148506437G>A EZH2 nonsynonymous SNV 21.6 0.08 5.46 403 RELYSE_GHE0463
_PHR06B070NM_001203247:exon18:c.C2060T p.A687V
chr7:g.148508728A>T EZH2 nonsynonymous SNV 27.0 0.00 4.94 771 RELYSE_GHE0501
_PHR06B062NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508727T>A EZH2 nonsynonymous SNV 24.6 0.00 4.91 395 RELYSE_GHE0563
_PHR06B031NM_001203247:exon16:c.A1922T p.Y641F
chr7:g.148508728A>T EZH2 nonsynonymous SNV 23.9 0.00 4.94 461 RELYSE_GHE0622
_PHRC03B016NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508728A>T EZH2 nonsynonymous SNV 56.5 0.00 4.94 3403 RELYSE_GHE0771
_PHR02B035NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508728A>T EZH2 nonsynonymous SNV 45.3 0.00 4.94 2170 RELYSE_GHE0777
_PHR02B036NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508728A>T EZH2 nonsynonymous SNV 42.4 0.00 4.94 898 RELYSE_GHE0923
_PHR06B064NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148506437G>A EZH2 nonsynonymous SNV 27.3 0.08 5.46 383 RELYSE_GHE0993
_PHR06B085NM_001203247:exon18:c.C2060T p.A687V
chr7:g.148508728A>G EZH2 nonsynonymous SNV 15.5 0.00 4.90 288 RELYSE_GHE1009
_PHR01B044NM_001203247:exon16:c.T1921C p.Y641H
chr7:g.148508728A>T EZH2 nonsynonymous SNV 53.4 0.00 4.94 2072 RELYSE_GHE1046
_PHR01B040NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508728A>T EZH2 nonsynonymous SNV 26.1 0.00 4.94 962 RELYSE_GHE1066
_PHR06B059NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508727T>G EZH2 nonsynonymous SNV 39.4 0.00 4.62 1288 RELYSE_GHE1393
_PHR03B023NM_001203247:exon16:c.A1922C p.Y641S
chr7:g.148508728A>T EZH2 nonsynonymous SNV 36.0 0.00 4.94 1641 RELYSE_GHE1423
_PHR06B028NM_001203247:exon16:c.T1921A p.Y641N
chr7:g.148508727T>G EZH2 nonsynonymous SNV 10.3 0.00 4.62 77 RELYSE_GHE1450
_PHR02B044NM_001203247:exon16:c.A1922C p.Y641S
chr7:g.148508727T>G EZH2 nonsynonymous SNV 40.9 0.00 4.62 1034 RELYSE_GHE1553
_PHR02B046NM_001203247:exon16:c.A1922C p.Y641S
chr13:g.41240286A>G FOXO1 nonsynonymous SNV 50.0 0.01 2.88 16 RELYSE_GHE0004
_PHR06B022 NM_002015:exon1:c.T64C p.S22P
chr13:g.41240279G>A FOXO1 nonsynonymous SNV 34.8 0.00 3.69 139 RELYSE_GHE0241
_PHR06B041 NM_002015:exon1:c.C71T p.T24I
chr13:g.41240281G>C FOXO1 nonsynonymous SNV 34.8 0.00 1.91 139 RELYSE_GHE0241
_PHR06B041 NM_002015:exon1:c.C69G p.C23W
chr13:g.41239826C>G FOXO1 nonsynonymous SNV 14.2 0.00 4.75 333 RELYSE_GHE0258
_PHR06B100 NM_002015:exon1:c.G524C p.S175T
chr13:g.41133830T>C FOXO1 nonsynonymous SNV 48.8 0.00 3.60 1373 RELYSE_GHE0294
_PHR02B055 NM_002015:exon2:c.A1798G p.S600G
chr13:g.41239736C>G FOXO1 nonsynonymous SNV 33.5 0.04 3.41 752 RELYSE_GHE0358
_PHR01B039 NM_002015:exon1:c.G614C p.S205T
chr13:g.41240280T>C FOXO1 nonsynonymous SNV 17.4 0.00 3.36 50 RELYSE_GHE0430
_PHR06B94 NM_002015:exon1:c.A70G p.T24A
chr13:g.41240273G>C FOXO1 nonsynonymous SNV 38.7 0.00 2.63 97 RELYSE_GHE0733
_PHR06B054 NM_002015:exon1:c.C77G p.P26R
chr13:g.41134502C>G FOXO1 nonsynonymous SNV 37.6 0.00 4.36 645 RELYSE_GHE0822
_PHR07B005 NM_002015:exon2:c.G1126C p.D376H
chr13:g.41240130G>C FOXO1 nonsynonymous SNV 45.7 0.40 1.89 146 RELYSE_GHE0883
_PHR01B042.2 NM_002015:exon1:c.C220G p.L74V
chr13:g.41133872C>T FOXO1 nonsynonymous SNV 50.2 0.52 4.44 1288 RELYSE_GHE1017
_PHR02B071 NM_002015:exon2:c.G1756A p.G586S
chr13:g.41240294C>T FOXO1 nonsynonymous SNV 30.8 0.00 4.51 22 RELYSE_GHE1018
_PHR02B072 NM_002015:exon1:c.G56A p.R19Q
chr13:g.41240324T>C FOXO1 nonsynonymous SNV 30.8 0.03 2.64 22 RELYSE_GHE1018
_PHR02B072 NM_002015:exon1:c.A26G p.E9G
chr13:g.41240342T>A FOXO1 nonsynonymous SNV 30.8 0.00 1.79 22 RELYSE_GHE1018
_PHR02B072 NM_002015:exon1:c.A8T p.E3V
chr13:g.41240279G>A FOXO1 nonsynonymous SNV 73.1 0.00 3.69 206 RELYSE_GHE1028
_PHR06B017 NM_002015:exon1:c.C71T p.T24I
chr13:g.41240286A>G FOXO1 nonsynonymous SNV 35.7 0.01 2.88 75 RELYSE_GHE1376
_PHR03B002 NM_002015:exon1:c.T64C p.S22P
chr13:g.41240294C>T FOXO1 nonsynonymous SNV 23.5 0.00 4.51 21 RELYSE_GHE1379
_PHR03B003 NM_002015:exon1:c.G56A p.R19Q
chr13:g.41240289G>C FOXO1 nonsynonymous SNV 23.8 0.00 3.39 71 RELYSE_GHE2023
_PHR05B032 NM_002015:exon1:c.C61G p.R21G
chr17:g.63052631C>G GNA13 nonsynonymous SNV 44.0 0.00 3.84 88 RELYSE_GHE0001
_PHR01B013 NM_006572:exon1:c.G81C p.Q27H
chr17:g.63010848C>G GNA13 nonsynonymous SNV 45.0 0.01 4.19 717 RELYSE_GHE0002
_PHR03B014 NM_006572:exon4:c.G661C p.V221L
chr17:g.63010948C>T GNA13 splicing 12.2 NA 2.28 62 RELYSE_GHE0293_PHR02B042 NA NA
chr17:g.63052509A>T GNA13 nonsynonymous SNV 88.5 0.00 3.21 4805 RELYSE_GHE0368
_PHR02B054.2 NM_006572:exon1:c.T203A p.M68K
chr17:g.63052511C>G GNA13 nonsynonymous SNV 48.2 0.00 2.96 509 RELYSE_GHE0427
_PHR06B96 NM_006572:exon1:c.G201C p.Q67H
chr17:g.63052554A>G GNA13 nonsynonymous SNV 47.7 0.00 2.92 496 RELYSE_GHE0427
_PHR06B96 NM_006572:exon1:c.T158C p.L53P
chr17:g.63052633G>A GNA13 stopgain SNV 19.2 0.01 7.33 27 RELYSE_GHE0609_PHR02B014 NM_006572:exon1:c.C79T p.Q27X
chr17:g.63049784G>A GNA13 stopgain SNV 71.3 0.89 4.24 682 RELYSE_GHE0624_PHR39B005 NM_006572:exon2:c.C346T p.Q116X
chr17:g.63049822C>G GNA13 nonsynonymous SNV 20.6 0.00 4.88 80 RELYSE_GHE0635
_PHR01B032 NM_006572:exon2:c.G308C p.R103P
chr17:g.63049685T>C GNA13 nonsynonymous SNV 49.7 0.03 3.39 761 RELYSE_GHE0659
_PHR39B010 NM_006572:exon2:c.A445G p.I149V
chr17:g.63010848C>G GNA13 nonsynonymous SNV 54.8 0.01 4.19 1714 RELYSE_GHE0689
_PHR06B056 NM_006572:exon4:c.G661C p.V221L
chr17:g.63052533C>T GNA13 nonsynonymous SNV 38.9 0.00 2.77 654 RELYSE_GHE0705
_PHR02B034 NM_006572:exon1:c.G179A p.G60D
chr17:g.63052633G>A GNA13 stopgain SNV 75.0 0.01 7.33 76 RELYSE_GHE0708_PHR02B082 NM_006572:exon1:c.C79T p.Q27X
chr17:g.63010848C>G GNA13 nonsynonymous SNV 50.7 0.01 4.19 1017 RELYSE_GHE0808
_PHR06B053 NM_006572:exon4:c.G661C p.V221L
chr17:g.63010719G>A GNA13 nonsynonymous SNV 6.9 0.00 5.06 26 RELYSE_GHE0842
_PHR03B033 NM_006572:exon4:c.C790T p.R264C
chr17:g.63049823G>A GNA13 stopgain SNV 7.7 0.21 5.87 25 RELYSE_GHE0853_PHR06B068 NM_006572:exon2:c.C307T p.R103X
chr17:g.63010535A>C GNA13 nonsynonymous SNV 26.2 0.00 4.36 271 RELYSE_GHE0857
_PHR06B038 NM_006572:exon4:c.T974G p.F325C
chr17:g.63010562G>T GNA13 nonsynonymous SNV 17.1 0.00 3.24 313 RELYSE_GHE0857
_PHR06B038 NM_006572:exon4:c.C947A p.P316H
chr17:g.63049720A>- GNA13 frameshift deletion 40.5 NA NA 576 RELYSE_GHE0992_PHR06B084 NM_006572:exon2:c.410delT p.V137fs
chr17:g.63052630G>A GNA13 stopgain SNV 45.0 0.76 6.85 67 RELYSE_GHE0992_PHR06B084 NM_006572:exon1:c.C82T p.Q28X
chr17:g.63052492G>A GNA13 stopgain SNV 56.7 0.20 6.44 1212 RELYSE_GHE1009_PHR01B044 NM_006572:exon1:c.C220T p.Q74X
chr17:g.63010877->AGTCGTATTCATGGATGCCTTT
GNA13 stopgain SNV 19.7 NA NA 50 RELYSE_GHE1069_PHR06B058
NM_006572:exon4:c.631_632insAAAGGCATCCATGAATACGACT
p.F211_E212delinsX
chr17:g.63010859G>A GNA13 nonsynonymous SNV 46.4 0.33 3.82 664 RELYSE_GHE1104
_PHR03B036 NM_006572:exon4:c.C650T p.P217L
chr17:g.63049625G>A GNA13 stopgain SNV 47.2 0.00 6.17 1086 RELYSE_GHE1104_PHR03B036 NM_006572:exon2:c.C505T p.Q169X
chr17:g.63049619C>A GNA13 splicing 32.7 NA 4.15 417 RELYSE_GHE1209_PHR06B072 NA NA
chr17:g.63052626CGTTGCTGCTCGGCCT>- GNA13 frameshift deletion 16.7 NA NA 34 RELYSE_GHE1209
_PHR06B072 NM_006572:exon1:c.71_86del p.24_29del
chr17:g.63052535G>T GNA13 nonsynonymous SNV 31.8 0.01 2.63 482 RELYSE_GHE1352
_PHR01B034 NM_006572:exon1:c.C177A p.S59R
chr17:g.63052633G>A GNA13 stopgain SNV 20.0 0.01 7.33 42 RELYSE_GHE1352_PHR01B034 NM_006572:exon1:c.C79T p.Q27X
chr17:g.63010766G>A GNA13 nonsynonymous SNV 40.9 0.00 4.78 721 RELYSE_GHE1376
_PHR03B002 NM_006572:exon4:c.C743T p.S248F
chr17:g.63010781A>T GNA13 nonsynonymous SNV 40.8 0.00 4.56 732 RELYSE_GHE1376
_PHR03B002 NM_006572:exon4:c.T728A p.I243K
chr17:g.63052533C>T GNA13 nonsynonymous SNV 23.4 0.00 2.77 209 RELYSE_GHE1379
_PHR03B003 NM_006572:exon1:c.G179A p.G60D
chr17:g.63010806C>G GNA13 nonsynonymous SNV 18.7 0.00 1.78 204 RELYSE_GHE1390
_PHR03B022 NM_006572:exon4:c.G703C p.E235Q
chr17:g.63010821T>C GNA13 nonsynonymous SNV 18.6 0.00 3.40 203 RELYSE_GHE1390
_PHR03B022 NM_006572:exon4:c.A688G p.R230G
chr17:g.63014369A>C GNA13 splicing 31.5 NA 4.26 262 RELYSE_GHE1393_PHR03B023 NA NA
chr17:g.63014387T>C GNA13 nonsynonymous SNV 30.9 0.01 3.02 252 RELYSE_GHE1393
_PHR03B023 NM_006572:exon3:c.A545G p.D182G
chr17:g.63049675A>G GNA13 nonsynonymous SNV 31.9 0.00 4.23 346 RELYSE_GHE1393
_PHR03B023 NM_006572:exon2:c.T455C p.L152S
chr17:g.63049706A>G GNA13 nonsynonymous SNV 32.6 0.66 5.10 359 RELYSE_GHE1393
_PHR03B023 NM_006572:exon2:c.T424C p.F142L
chr17:g.63052573G>A GNA13 nonsynonymous SNV 35.7 0.01 2.46 29 RELYSE_GHE1438
_PHR06B103 NM_006572:exon1:c.C139T p.R47W
chr17:g.63052626C>T GNA13 nonsynonymous SNV 57.1 0.00 4.41 60 RELYSE_GHE1438
_PHR06B103 NM_006572:exon1:c.G86A p.R29H
chr17:g.63052633G>A GNA13 stopgain SNV 21.4 0.01 7.33 15 RELYSE_GHE1438_PHR06B103 NM_006572:exon1:c.C79T p.Q27X
chr17:g.63052671C>G GNA13 nonsynonymous SNV 57.1 0.01 3.00 60 RELYSE_GHE1438
_PHR06B103 NM_006572:exon1:c.G41C p.C14S
chr17:g.63010848C>G GNA13 nonsynonymous SNV 41.6 0.01 4.19 724 RELYSE_GHE1560
_PHR07B002 NM_006572:exon4:c.G661C p.V221L
chr17:g.63010710C>T GNA13 nonsynonymous SNV 13.1 0.00 5.55 91 RELYSE_GHE2096
_PHR05B016 NM_006572:exon4:c.G799A p.E267K
chr17:g.63010895C>T GNA13 nonsynonymous SNV 16.3 0.00 4.67 328 RELYSE_GHE2096
_PHR05B016 NM_006572:exon4:c.G614A p.G205D
chr17:g.63010416T>A GNA13 nonsynonymous SNV 61.9 0.00 4.66 3229 RELYSE_GHE2100
_PHR05B015 NM_006572:exon4:c.A1093T p.T365S
chr1:g.23885707G>A ID3 stopgain SNV 16.8 0.00 8.10 195 RELYSE_GHE0024_PHR02B062 NM_002167:exon1:c.C211T p.Q71X
chr1:g.23885709A>T ID3 nonsynonymous SNV 14.6 0.00 4.59 144 RELYSE_GHE0024
_PHR02B062 NM_002167:exon1:c.T209A p.L70Q
chr1:g.23885622A>T ID3 nonsynonymous SNV 28.7 0.00 1.14 353 RELYSE_GHE0491
_PHR02B025 NM_002167:exon1:c.T296A p.I99N
chr1:g.23885754A>C ID3 nonsynonymous SNV 28.8 0.03 4.51 337 RELYSE_GHE0491
_PHR02B025 NM_002167:exon1:c.T164G p.V55G
chr1:g.23885863C>A ID3 stopgain SNV 33.3 0.06 6.90 84 RELYSE_GHE0491_PHR02B025 NM_002167:exon1:c.G55T p.E19X
chr1:g.23885761C>T ID3 nonsynonymous SNV 13.9 0.10 4.73 95 RELYSE_GHE0501
_PHR06B062 NM_002167:exon1:c.G157A p.E53K
chr1:g.23885835C>T ID3 nonsynonymous SNV 49.8 0.06 3.29 1244 RELYSE_GHE0535
_PHR02B68 NM_002167:exon1:c.G83A p.R28Q
chr1:g.23885749C>T ID3 nonsynonymous SNV 68.7 0.09 4.32 1238 RELYSE_GHE0547
_PHR02B066 NM_002167:exon1:c.G169A p.G57R
chr1:g.23885752G>A ID3 nonsynonymous SNV 11.0 0.00 4.94 69 RELYSE_GHE0690
_PHR06B057 NM_002167:exon1:c.C166T p.P56S
chr1:g.23885674CC>GT ID3 nonframeshift substitution 32.4 NA NA 850 RELYSE_GHE0721
_PHR39B015NM_002167:exon1:c.243_244AC
chr1:g.23885773A>T ID3 nonsynonymous SNV 40.5 0.08 4.23 426 RELYSE_GHE0856
_PHR06B048 NM_002167:exon1:c.T145A p.S49T
chr1:g.23885441C>G ID3 UTR3 30.1 NA NA 660 RELYSE_GHE1553_PHR02B046 NA NA
chr1:g.23885662C>G ID3 nonsynonymous SNV 39.5 0.09 2.44 517 RELYSE_GHE2132
_PHR05B019 NM_002167:exon1:c.G256C p.E86Q
chr6:g.393222C>G IRF4 nonsynonymous SNV 8.9 0.01 4.12 55 RELYSE_GHE0024
_PHR02B062 NM_002460:exon2:c.C70G p.L24V
chr6:g.393142G>A IRF4 UTR5 16.7 NA 3.71 27 RELYSE_GHE0219_PHR03B037 NA NA
chr6:g.394899T>C IRF4 nonsynonymous SNV 41.7 0.00 3.01 1166 RELYSE_GHE0228
_PHR39B022 NM_002460:exon3:c.T295C p.C99R
chr6:g.407531T>G IRF4 stopgain SNV 38.2 1.00 3.36 329 RELYSE_GHE0275_PHR06B99 NM_002460:exon9:c.T1289G p.L430X
chr6:g.393222C>T IRF4 nonsynonymous SNV 10.3 0.28 4.38 94 RELYSE_GHE0371
_PHR02B84 NM_002460:exon2:c.C70T p.L24F
chr6:g.393102G>A IRF4 UTR5 45.8 NA NA 222 RELYSE_GHE0454_PHR07B15 NA NA
chr6:g.393206C>G IRF4 nonsynonymous SNV 94.0 0.31 4.06 2984 RELYSE_GHE0454
_PHR07B15 NM_002460:exon2:c.C54G p.S18R
chr6:g.394899T>C IRF4 nonsynonymous SNV 30.3 0.00 3.01 631 RELYSE_GHE0536
_PHR02B069 NM_002460:exon3:c.T295C p.C99R
chr6:g.394899T>C IRF4 nonsynonymous SNV 20.7 0.00 3.01 264 RELYSE_GHE0705
_PHR02B034 NM_002460:exon3:c.T295C p.C99R
chr6:g.393211G>T IRF4 nonsynonymous SNV 11.7 0.06 5.26 76 RELYSE_GHE0822
_PHR07B005 NM_002460:exon2:c.G59T p.G20V
chr6:g.393279G>A IRF4 nonsynonymous SNV 39.5 0.08 5.78 517 RELYSE_GHE0822
_PHR07B005 NM_002460:exon2:c.G127A p.E43K
chr6:g.393211G>A IRF4 nonsynonymous SNV 8.6 0.14 5.53 56 RELYSE_GHE0846
_PHR06B046 NM_002460:exon2:c.G59A p.G20D
chr6:g.393222C>T IRF4 nonsynonymous SNV 16.5 0.28 4.38 82 RELYSE_GHE0955
_PHR06B036 NM_002460:exon2:c.C70T p.L24F
chr6:g.393330C>A IRF4 nonsynonymous SNV 17.7 0.27 5.40 64 RELYSE_GHE0955
_PHR06B036 NM_002460:exon2:c.C178A p.Q60K
chr6:g.393102G>A IRF4 UTR5 20.7 NA NA 76 RELYSE_GHE1302_PHR01B049 NA NA
chr6:g.393205G>C IRF4 nonsynonymous SNV 34.9 0.39 5.17 485 RELYSE_GHE1369
_PHR07B014 NM_002460:exon2:c.G53C p.S18T
chr6:g.394899T>C IRF4 nonsynonymous SNV 18.3 0.00 3.01 317 RELYSE_GHE1437
_PHR06B018 NM_002460:exon3:c.T295C p.C99R
chr6:g.394946C>G IRF4 nonsynonymous SNV 19.7 0.01 4.13 412 RELYSE_GHE1440
_PHR07B003.2 NM_002460:exon3:c.C342G p.S114R
chr6:g.393215C>A IRF4 nonsynonymous SNV 65.0 0.69 2.91 781 RELYSE_GHE2012
_PHR05B008 NM_002460:exon2:c.C63A p.N21K
chr6:g.393183G>A IRF4 nonsynonymous SNV 25.8 0.16 3.98 53 RELYSE_GHE2017
_PHR05B027 NM_002460:exon2:c.G31A p.E11K
chr6:g.393211G>A IRF4 nonsynonymous SNV 28.6 0.14 5.53 115 RELYSE_GHE2017
_PHR05B027 NM_002460:exon2:c.G59A p.G20D
chr1:g.226923322T>C ITPKB nonsynonymous SNV 20.5 0.00 3.82 199 RELYSE_GHE0025
_PHR02B079 NM_002221:exon2:c.A1838G p.E613G
chr1:g.226923676G>T ITPKB nonsynonymous SNV 42.1 0.05 3.34 475 RELYSE_GHE0028
_PHR02B063 NM_002221:exon2:c.C1484A p.P495H
chr1:g.226923779G>A ITPKB nonsynonymous SNV 53.4 0.17 1.60 983 RELYSE_GHE0028
_PHR02B063 NM_002221:exon2:c.C1381T p.P461S
chr1:g.226923714CC>TT ITPKB nonframeshift substitution 78.2 NA NA 1746 RELYSE_GHE0150
_PHR06B082NM_002221:exon2:c.1445_1446AA
chr1:g.226924051C>A ITPKB nonsynonymous SNV 24.7 0.22 2.09 143 RELYSE_GHE0197
_PHR02B075 NM_002221:exon2:c.G1109T p.G370V
chr1:g.226924163G>A ITPKB nonsynonymous SNV 34.5 0.74 2.76 154 RELYSE_GHE0197
_PHR02B075 NM_002221:exon2:c.C997T p.L333F
chr1:g.226924948C>A ITPKB nonsynonymous SNV 34.0 0.01 2.65 278 RELYSE_GHE0197
_PHR02B075 NM_002221:exon2:c.G212T p.S71I
chr1:g.226924900C>T ITPKB nonsynonymous SNV 33.7 0.62 2.06 277 RELYSE_GHE0202
_PHR02B85 NM_002221:exon2:c.G260A p.G87D
chr1:g.226924247C>A ITPKB stopgain SNV 13.7 0.50 8.21 127 RELYSE_GHE0219_PHR03B037 NM_002221:exon2:c.G913T p.E305X
chr1:g.226924453G>C ITPKB nonsynonymous SNV 15.4 0.27 2.01 93 RELYSE_GHE0219
_PHR03B037 NM_002221:exon2:c.C707G p.P236R
chr1:g.226924663C>G ITPKB nonsynonymous SNV 14.4 0.03 3.99 79 RELYSE_GHE0219
_PHR03B037 NM_002221:exon2:c.G497C p.S166T
chr1:g.226924691G>A ITPKB stopgain SNV 9.6 0.08 9.60 33 RELYSE_GHE0219_PHR03B037 NM_002221:exon2:c.C469T p.Q157X
chr1:g.226924745G>A ITPKB stopgain SNV 29.8 0.03 9.23 124 RELYSE_GHE0219_PHR03B037 NM_002221:exon2:c.C415T p.Q139X
chr1:g.226924147GGCT>- ITPKB frameshift deletion 55.3 NA NA 392 RELYSE_GHE0228
_PHR39B022NM_002221:exon2:c.1010_1013del p.337_338del
chr1:g.226924645GC>GA ITPKB nonframeshift substitution 17.6 NA NA 2429 RELYSE_GHE0293
_PHR02B042NM_002221:exon2:c.514_515TC
chr1:g.226924646C>- ITPKB frameshift deletion 82.4 NA NA 2429 RELYSE_GHE0293_PHR02B042 NM_002221:exon2:c.514delG p.A172fs
chr1:g.226924310C>A ITPKB stopgain SNV 41.1 0.02 7.97 722 RELYSE_GHE0393_PHRC39B004 NM_002221:exon2:c.G850T p.G284X
chr1:g.226924864C>T ITPKB nonsynonymous SNV 18.6 0.36 2.07 50 RELYSE_GHE0491
_PHR02B025 NM_002221:exon2:c.G296A p.S99N
chr1:g.226924900C>A ITPKB nonsynonymous SNV 25.6 0.65 1.81 136 RELYSE_GHE0491
_PHR02B025 NM_002221:exon2:c.G260T p.G87V
chr1:g.226923779G>A ITPKB nonsynonymous SNV 51.1 0.17 1.60 728 RELYSE_GHE0501
_PHR06B062 NM_002221:exon2:c.C1381T p.P461S
chr1:g.226924345G>A ITPKB nonsynonymous SNV 19.5 0.27 2.64 335 RELYSE_GHE0519
_PHRC03B020 NM_002221:exon2:c.C815T p.A272V
chr1:g.226923473G>A ITPKB nonsynonymous SNV 49.5 0.21 2.26 494 RELYSE_GHE0536
_PHR02B069 NM_002221:exon2:c.C1687T p.P563S
chr1:g.226924291G>A ITPKB nonsynonymous SNV 28.8 0.43 3.42 446 RELYSE_GHE0536
_PHR02B069 NM_002221:exon2:c.C869T p.A290V
chr1:g.226829777G>A ITPKB nonsynonymous SNV 5.0 0.00 4.19 21 RELYSE_GHE0614
_PHRC02B016 NM_002221:exon5:c.C2296T p.R766W
chr1:g.226834996A>T ITPKB nonsynonymous SNV 11.5 0.04 4.20 77 RELYSE_GHE0614
_PHRC02B016 NM_002221:exon4:c.T2118A p.D706E
chr1:g.226924637GCGAGCGAGCCCTGCCCAAACGCGGGCTGCGGGGCGCTTGAATGGCGGA>-
ITPKB frameshift deletion 45.2 NA NA 50 RELYSE_GHE0635_PHR01B032 NM_002221:exon2:c.475_523del p.159_175del
chr1:g.226923242GCTGGTCCAGGGTATGCAGGAAG>-
ITPKB frameshift deletion 21.2 NA NA 50 RELYSE_GHE0645_PHR02B008
NM_002221:exon2:c.1896_1918del p.632_640del
chr1:g.226924264C>G ITPKB nonsynonymous SNV 28.8 0.58 1.65 320 RELYSE_GHE0645
_PHR02B008 NM_002221:exon2:c.G896C p.S299T
chr1:g.226924581C>G ITPKB nonsynonymous SNV 28.6 0.06 1.59 115 RELYSE_GHE0645
_PHR02B008 NM_002221:exon2:c.G579C p.Q193H
chr1:g.226924694C>T ITPKB nonsynonymous SNV 24.2 0.01 4.87 168 RELYSE_GHE0645
_PHR02B008 NM_002221:exon2:c.G466A p.A156T
chr1:g.226924810C>T ITPKB nonsynonymous SNV 16.3 0.21 1.54 89 RELYSE_GHE0645
_PHR02B008 NM_002221:exon2:c.G350A p.G117D
chr1:g.226924856A>T ITPKB nonsynonymous SNV 22.9 0.57 1.52 155 RELYSE_GHE0705
_PHR02B034 NM_002221:exon2:c.T304A p.W102R
chr1:g.226924345G>A ITPKB nonsynonymous SNV 40.1 0.27 2.64 538 RELYSE_GHE0708
_PHR02B082 NM_002221:exon2:c.C815T p.A272V
chr1:g.226924687C>G ITPKB nonsynonymous SNV 22.1 0.28 1.56 281 RELYSE_GHE0721
_PHR39B015 NM_002221:exon2:c.G473C p.S158T
chr1:g.226822473C>T ITPKB nonsynonymous SNV 61.7 0.25 2.57 2161 RELYSE_GHE0776
_PHR02B037 NM_002221:exon8:c.G2740A p.V914I
chr1:g.226924745G>A ITPKB stopgain SNV 93.4 0.03 9.23 1008 RELYSE_GHE0842_PHR03B033 NM_002221:exon2:c.C415T p.Q139X
chr1:g.226924583G>A ITPKB stopgain SNV 46.8 0.70 7.77 551 RELYSE_GHE1036_PHR07B004.2 NM_002221:exon2:c.C577T p.Q193X
chr1:g.226923473G>A ITPKB nonsynonymous SNV 49.4 0.21 2.26 1224 RELYSE_GHE1046
_PHR01B040 NM_002221:exon2:c.C1687T p.P563S
chr1:g.226923577G>A ITPKB nonsynonymous SNV 41.2 0.33 1.52 367 RELYSE_GHE1287
_PHR03B027 NM_002221:exon2:c.C1583T p.S528L
chr1:g.226924382C>T ITPKB nonsynonymous SNV 37.5 0.16 2.01 472 RELYSE_GHE1287
_PHR03B027 NM_002221:exon2:c.G778A p.G260S
chr1:g.226822380G>C ITPKB nonsynonymous SNV 42.4 0.00 2.56 595 RELYSE_GHE1360
_PHR03B009 NM_002221:exon8:c.C2833G p.L945V
chr1:g.226923653G>A ITPKB nonsynonymous SNV 17.5 0.10 3.53 60 RELYSE_GHE1380
_PHR06B007 NM_002221:exon2:c.C1507T p.P503S
chr1:g.226923779G>A ITPKB nonsynonymous SNV 49.2 0.17 1.60 1227 RELYSE_GHE1380
_PHR06B007 NM_002221:exon2:c.C1381T p.P461S
chr1:g.226924267G>T ITPKB nonsynonymous SNV 44.6 0.39 2.19 1110 RELYSE_GHE1438
_PHR06B103 NM_002221:exon2:c.C893A p.A298D
chr1:g.226924346C>T ITPKB nonsynonymous SNV 26.9 0.66 1.86 475 RELYSE_GHE1438
_PHR06B103 NM_002221:exon2:c.G814A p.A272T
chr1:g.226924133C>T ITPKB nonsynonymous SNV 46.4 0.23 1.56 291 RELYSE_GHE1498
_PHR06B087 NM_002221:exon2:c.G1027A p.V343M
chr1:g.226924264C>G ITPKB nonsynonymous SNV 13.1 0.58 1.65 128 RELYSE_GHE1554
_PHR02B045 NM_002221:exon2:c.G896C p.S299T
chr1:g.226923779G>A ITPKB nonsynonymous SNV 55.5 0.17 1.60 1350 RELYSE_GHE2119
_PHR05B001 NM_002221:exon2:c.C1381T p.P461S
chr12:g.49420034->CCGCC KMT2D frameshift
insertion 13.0 NA NA 170 RELYSE_GHE0028_PHR02B063
NM_003482:exon48:c.15714_15715insGGCGG p.P5239fs
chr12:g.49426691G>A KMT2D stopgain SNV 28.1 0.00 15.15 870 RELYSE_GHE0049_PHR06B089.2 NM_003482:exon39:c.C11797T p.Q3933X
chr12:g.49434544G>A KMT2D stopgain SNV 66.8 0.00 13.35 1609 RELYSE_GHE0049_PHR06B089.2 NM_003482:exon31:c.C7009T p.Q2337X
chr12:g.49428629G>A KMT2D stopgain SNV 20.2 0.00 18.66 282 RELYSE_GHE0050_PHR06B073 NM_003482:exon35:c.C10321T p.Q3441X
chr12:g.49425474GGGA>- KMT2D frameshift deletion 21.6 NA NA 146 RELYSE_GHE0052
_PHR06B074NM_003482:exon39:c.13011_13014del p.4337_4338del
chr12:g.49445971C>A KMT2D stopgain SNV 13.6 0.00 5.22 272 RELYSE_GHE0052_PHR06B074 NM_003482:exon10:c.G1495T p.E499X
chr12:g.49434851G>- KMT2D frameshift deletion 31.8 NA NA 315 RELYSE_GHE0134_PHR06B019 NM_003482:exon31:c.6702delC p.P2234fs
chr12:g.49444145C>A KMT2D stopgain SNV 29.2 0.00 6.70 533 RELYSE_GHE0134_PHR06B019 NM_003482:exon11:c.G3226T p.E1076X
chr12:g.49444210G>A KMT2D nonsynonymous SNV 46.7 0.00 0.13 1108 RELYSE_GHE0194
_PHR02B023 NM_003482:exon11:c.C3161T p.P1054L
chr12:g.49419964C>T KMT2D splicing 19.9 NA 4.22 202 RELYSE_GHE0202_PHR02B85 NA NA
chr12:g.49420248GCTA>- KMT2D frameshift deletion 46.1 NA NA 780 RELYSE_GHE0206
_PHR02B87NM_003482:exon48:c.15498_15501del p.5166_5167del
chr12:g.49437566C>T KMT2D splicing 41.4 NA 3.36 2809 RELYSE_GHE0206_PHR02B87 NA NA
chr12:g.49420078C>T KMT2D nonsynonymous SNV 52.5 0.00 2.09 852 RELYSE_GHE0216
_PHR03B021 NM_003482:exon48:c.G15671A p.R5224H
chr12:g.49420654C>T KMT2D nonsynonymous SNV 39.7 0.00 2.05 701 RELYSE_GHE0218
_PHR03B032 NM_003482:exon48:c.G15095A p.C5032Y
chr12:g.49426323AG>- KMT2D frameshift deletion 37.1 NA NA 627 RELYSE_GHE0218_PHR03B032
NM_003482:exon39:c.12164_12165del p.4055_4055del
chr12:g.49438016C>T KMT2D nonsynonymous SNV 13.3 0.00 3.13 82 RELYSE_GHE0219
_PHR03B037 NM_003482:exon21:c.G5155A p.E1719K
chr12:g.49433701G>A KMT2D nonsynonymous SNV 24.4 0.00 0.97 551 RELYSE_GHE0228
_PHR39B022 NM_003482:exon31:c.C7852T p.P2618S
chr12:g.49436617C>T KMT2D nonsynonymous SNV 59.4 0.00 2.43 3708 RELYSE_GHE0236
_PHR06B043 NM_003482:exon26:c.G5689A p.D1897N
chr12:g.49424702C>A KMT2D stopgain SNV 51.0 0.00 22.67 2098 RELYSE_GHE0241_PHR06B041 NM_003482:exon40:c.G13645T p.E4549X
chr12:g.49420688G>A KMT2D stopgain SNV 22.7 0.00 24.01 869 RELYSE_GHE0258_PHR06B100 NM_003482:exon48:c.C15061T p.R5021X
chr12:g.49424535G>A KMT2D nonsynonymous SNV 11.4 0.00 1.94 138 RELYSE_GHE0293
_PHR02B042 NM_003482:exon41:c.C13688T p.P4563L
chr12:g.49440448TG>- KMT2D frameshift deletion 28.4 NA NA 480 RELYSE_GHE0300_PHR07B007
NM_003482:exon15:c.4361_4362del p.1454_1454del
chr12:g.49444175C>T KMT2D nonsynonymous SNV 50.6 0.00 -0.44 1186 RELYSE_GHE0352
_PHR01B007 NM_003482:exon11:c.G3196A p.D1066N
chr12:g.49416098AT>- KMT2D frameshift deletion 38.7 NA NA 1393 RELYSE_GHE0358_PHR01B039
NM_003482:exon52:c.16376_16377del p.5459_5459del
chr12:g.49433388G>A KMT2D stopgain SNV 34.6 0.00 15.95 365 RELYSE_GHE0358_PHR01B039 NM_003482:exon32:c.C8059T p.R2687X
chr12:g.49440101T>C KMT2D nonsynonymous SNV 63.7 0.00 1.73 2542 RELYSE_GHE0368
_PHR02B054.2 NM_003482:exon16:c.A4525G p.I1509V
chr12:g.49418670G>A KMT2D stopgain SNV 39.2 0.00 26.60 1087 RELYSE_GHE0436_PHR06B95 NM_003482:exon49:c.C15844T p.R5282X
chr12:g.49431301G>A KMT2D stopgain SNV 29.3 0.00 16.02 1115 RELYSE_GHE0440_PHR06B97 NM_003482:exon34:c.C9838T p.Q3280X
chr12:g.49436390T>C KMT2D nonsynonymous SNV 47.0 0.00 1.18 1309 RELYSE_GHE0440
_PHR06B97 NM_003482:exon27:c.A5821G p.M1941V
chr12:g.49437673->CCTC KMT2D frameshift insertion 32.0 NA NA 54 RELYSE_GHE0440
_PHR06B97NM_003482:exon22:c.5296_5297insGAGG p.D1766fs
chr12:g.49420688G>A KMT2D stopgain SNV 64.8 0.00 24.01 4983 RELYSE_GHE0454_PHR07B15 NM_003482:exon48:c.C15061T p.R5021X
chr12:g.49438067G>A KMT2D stopgain SNV 28.4 0.00 11.43 832 RELYSE_GHE0459_PHR02B080 NM_003482:exon21:c.C5104T p.R1702X
chr12:g.49426973G>A KMT2D stopgain SNV 25.0 0.00 19.05 328 RELYSE_GHE0463_PHR06B070 NM_003482:exon39:c.C11515T p.Q3839X
chr12:g.49432767A>- KMT2D frameshift deletion 18.6 NA NA 148 RELYSE_GHE0463_PHR06B070 NM_003482:exon34:c.8372delT p.L2791fs
chr12:g.49433849G>- KMT2D frameshift deletion 15.2 NA NA 71 RELYSE_GHE0470_PHR06B005 NM_003482:exon31:c.7704delC p.P2568fs
chr12:g.49434742G>A KMT2D nonsynonymous SNV 44.7 0.00 0.94 801 RELYSE_GHE0470
_PHR06B005 NM_003482:exon31:c.C6811T p.P2271S
chr12:g.49428260C>T KMT2D splicing 33.0 NA 3.49 508 RELYSE_GHE0519_PHRC03B020 NA NA
chr12:g.49446735G>A KMT2D nonsynonymous SNV 54.4 0.00 -0.76 561 RELYSE_GHE0519
_PHRC03B020 NM_003482:exon8:c.C1075T p.R359C
chr12:g.49425644G>A KMT2D stopgain SNV 29.0 0.00 20.63 447 RELYSE_GHE0535_PHR02B68 NM_003482:exon39:c.C12844T p.R4282X
chr12:g.49433060G>A KMT2D stopgain SNV 27.8 0.00 15.94 858 RELYSE_GHE0535_PHR02B68 NM_003482:exon33:c.C8311T p.R2771X
chr12:g.49426637G>A KMT2D stopgain SNV 58.6 0.00 16.27 4267 RELYSE_GHE0563_PHR06B031 NM_003482:exon39:c.C11851T p.Q3951X
chr12:g.49426688G>A KMT2D stopgain SNV 6.5 0.00 16.15 38 RELYSE_GHE0563_PHR06B031 NM_003482:exon39:c.C11800T p.Q3934X
chr12:g.49432396G>A KMT2D stopgain SNV 37.0 0.00 14.95 252 RELYSE_GHE0563_PHR06B031 NM_003482:exon34:c.C8743T p.R2915X
chr12:g.49444960G>T KMT2D nonsynonymous SNV 41.9 0.00 0.90 965 RELYSE_GHE0602
_PHRC01B017 NM_003482:exon10:c.C2506A p.Q836K
chr12:g.49420237C>T KMT2D nonsynonymous SNV 52.1 0.00 3.24 874 RELYSE_GHE0604
_PHR01B015 NM_003482:exon48:c.G15512A p.R5171Q
chr12:g.49420493G>A KMT2D stopgain SNV 35.8 0.00 25.17 1423 RELYSE_GHE0659_PHR39B010 NM_003482:exon48:c.C15256T p.R5086X
chr12:g.49426310T>C KMT2D nonsynonymous SNV 56.2 0.00 0.37 540 RELYSE_GHE0685
_PHRC06B021 NM_003482:exon39:c.A12178G p.T4060A
chr12:g.49421811C>A KMT2D nonsynonymous SNV 47.5 0.00 1.51 1575 RELYSE_GHE0689
_PHR06B056 NM_003482:exon46:c.G14496T p.K4832N
chr12:g.49443611C>A KMT2D stopgain SNV 45.0 0.00 9.99 1293 RELYSE_GHE0689_PHR06B056 NM_003482:exon11:c.G3760T p.E1254X
chr12:g.49437493T>G KMT2D nonsynonymous SNV 43.5 0.00 1.16 1643 RELYSE_GHE0693
_PHR01B028 NM_003482:exon23:c.A5392C p.S1798R
chr12:g.49437527ACGG>- KMT2D frameshift deletion 42.2 NA NA 1162 RELYSE_GHE0693
_PHR01B028NM_003482:exon23:c.5355_5358del p.1785_1786del
chr12:g.49437532T>A KMT2D nonsynonymous SNV 42.2 0.00 1.42 1162 RELYSE_GHE0693
_PHR01B028 NM_003482:exon23:c.A5353T p.S1785C
chr12:g.49416461A>G KMT2D nonsynonymous SNV 36.7 0.00 2.12 665 RELYSE_GHE0714
_PHR39B014 NM_003482:exon51:c.T16250C p.L5417P
chr12:g.49444501A>C KMT2D stopgain SNV 60.3 0.00 7.05 4571 RELYSE_GHE0714_PHR39B014 NM_003482:exon11:c.T2870G p.L957X
chr12:g.49438728CGAAG>- KMT2D frameshift deletion 41.1 NA NA 1118 RELYSE_GHE0717
_PHR39B016NM_003482:exon19:c.4758_4762del p.1586_1588del
chr12:g.49432597G>A KMT2D stopgain SNV 38.3 0.00 13.27 629 RELYSE_GHE0733_PHR06B054 NM_003482:exon34:c.C8542T p.Q2848X
chr12:g.49427936->T KMT2D frameshift insertion 46.8 NA NA 984 RELYSE_GHE0777
_PHR02B036NM_003482:exon38:c.10653dupA p.A3552fs
chr12:g.49434136G>A KMT2D stopgain SNV 52.5 0.00 13.25 619 RELYSE_GHE0777_PHR02B036 NM_003482:exon31:c.C7417T p.Q2473X
chr12:g.49447305G>A KMT2D nonsynonymous SNV 36.0 0.00 1.49 622 RELYSE_GHE0811
_PHR06B003 NM_003482:exon6:c.C793T p.R265C
chr12:g.49434075C>T KMT2D nonsynonymous SNV 38.1 0.00 0.75 655 RELYSE_GHE0837
_PHR02B005 NM_003482:exon31:c.G7478A p.G2493E
chr12:g.49427022GCCCTGGGGGC>- KMT2D frameshift deletion 19.8 NA NA 50 RELYSE_GHE0842
_PHR03B033NM_003482:exon39:c.11456_11466del p.3819_3822del
chr12:g.49420606C>T KMT2D nonsynonymous SNV 22.1 0.00 2.83 501 RELYSE_GHE0855
_PHR06B049 NM_003482:exon48:c.G15143A p.R5048H
chr12:g.49420214G>- KMT2D frameshift deletion 43.5 NA NA 562 RELYSE_GHE0857_PHR06B038
NM_003482:exon48:c.15535delC p.R5179fs
chr12:g.49431003TGTGATAGCACTGGCTG>- KMT2D frameshift deletion 24.6 NA NA 50 RELYSE_GHE0857
_PHR06B038NM_003482:exon34:c.10120_10136del p.3374_3379del
chr12:g.49434075C>T KMT2D nonsynonymous SNV 51.3 0.00 0.75 1419 RELYSE_GHE0857
_PHR06B038 NM_003482:exon31:c.G7478A p.G2493E
chr12:g.49445320->GAGC KMT2D frameshift
insertion 24.6 NA NA 99 RELYSE_GHE0860_PHR06B050
NM_003482:exon10:c.2145_2146insGCTC p.M716fs
chr12:g.49420844C>T KMT2D nonsynonymous SNV 40.0 0.00 2.68 711 RELYSE_GHE0865
_PHR06B061 NM_003482:exon48:c.G14905A p.E4969K
chr12:g.49420203->C KMT2D frameshift insertion 29.7 NA NA 414 RELYSE_GHE0923
_PHR06B064NM_003482:exon48:c.15545dupG p.G5182fs
chr12:g.49420606C>T KMT2D nonsynonymous SNV 43.6 0.00 2.83 2874 RELYSE_GHE0923
_PHR06B064 NM_003482:exon48:c.G15143A p.R5048H
chr12:g.49432297G>A KMT2D nonsynonymous SNV 73.3 0.00 -0.71 660 RELYSE_GHE0925
_PHR06B067 NM_003482:exon34:c.C8842T p.P2948S
chr12:g.49438738G>C KMT2D stopgain SNV 9.6 0.00 10.70 36 RELYSE_GHE0955_PHR06B036 NM_003482:exon19:c.C4752G p.Y1584X
chr12:g.49443707C>T KMT2D nonsynonymous SNV 54.6 0.00 2.63 2209 RELYSE_GHE0978
_PHR01B038.2 NM_003482:exon11:c.G3664A p.G1222S
chr12:g.49420288C>T KMT2D nonsynonymous SNV 17.0 0.00 3.10 411 RELYSE_GHE0986
_PHR02B048 NM_003482:exon48:c.G15461A p.R5154Q
chr12:g.49426688G>A KMT2D stopgain SNV 11.6 0.00 16.15 179 RELYSE_GHE0986_PHR02B048 NM_003482:exon39:c.C11800T p.Q3934X
chr12:g.49445010G>A KMT2D nonsynonymous SNV 39.0 0.00 0.89 1273 RELYSE_GHE0988
_PHR06B086.2 NM_003482:exon10:c.C2456T p.P819L
chr12:g.49444933G>- KMT2D frameshift deletion 19.4 NA NA 91 RELYSE_GHE0993_PHR06B085 NM_003482:exon10:c.2533delC p.R845fs
chr12:g.49428392CTGCAGATCAC>- KMT2D frameshift deletion 10.2 NA NA 73 RELYSE_GHE0997
_PHR07B012NM_003482:exon36:c.10403_10413del p.3468_3471del
chr12:g.49435467C>- KMT2D frameshift deletion 66.0 NA NA 1085 RELYSE_GHE1028_PHR06B017 NM_003482:exon30:c.6205delG p.A2069fs
chr12:g.49415864T>C KMT2D nonsynonymous SNV 51.6 0.00 2.65 1153 RELYSE_GHE1066
_PHR06B059 NM_003482:exon53:c.A16483G p.I5495V
chr12:g.49425287G>- KMT2D frameshift deletion 30.6 NA NA 146 RELYSE_GHE1066_PHR06B059
NM_003482:exon39:c.13201delC p.Q4401fs
chr12:g.49435306G>A KMT2D stopgain SNV 32.6 0.00 11.97 485 RELYSE_GHE1066_PHR06B059 NM_003482:exon31:c.C6247T p.Q2083X
chr12:g.49420688G>A KMT2D stopgain SNV 31.8 0.00 24.01 1484 RELYSE_GHE1069_PHR06B058 NM_003482:exon48:c.C15061T p.R5021X
chr12:g.49444494G>C KMT2D stopgain SNV 25.6 0.00 7.13 826 RELYSE_GHE1071_PHR06B060 NM_003482:exon11:c.C2877G p.Y959X
chr12:g.49422934G>A KMT2D nonsynonymous SNV 40.2 0.00 2.55 593 RELYSE_GHE1104
_PHR03B036 NM_003482:exon44:c.C14161T p.R4721C
chr12:g.49425524G>A KMT2D stopgain SNV 37.6 0.00 21.02 1488 RELYSE_GHE1209_PHR06B072 NM_003482:exon39:c.C12964T p.Q4322X
chr12:g.49425896G>A KMT2D stopgain SNV 24.3 0.00 20.84 429 RELYSE_GHE1229_PHR06B044 NM_003482:exon39:c.C12592T p.R4198X
chr12:g.49431349G>A KMT2D stopgain SNV 41.1 0.00 17.18 1500 RELYSE_GHE1229_PHR06B044 NM_003482:exon34:c.C9790T p.Q3264X
chr12:g.49440135GTGT>- KMT2D frameshift deletion 25.6 NA NA 376 RELYSE_GHE1302_PHR01B049
NM_003482:exon16:c.4488_4491del p.1496_1497del
chr12:g.49440141G>T KMT2D stopgain SNV 32.9 0.00 9.75 390 RELYSE_GHE1369_PHR07B014 NM_003482:exon16:c.C4485A p.Y1495X
chr12:g.49426793G>A KMT2D stopgain SNV 33.0 0.00 18.12 274 RELYSE_GHE1380_PHR06B007 NM_003482:exon39:c.C11695T p.Q3899X
chr12:g.49434391G>A KMT2D stopgain SNV 69.3 0.00 12.04 603 RELYSE_GHE1385_PHR01B025 NM_003482:exon31:c.C7162T p.Q2388X
chr12:g.49431873->C KMT2D frameshift insertion 26.2 NA NA 111 RELYSE_GHE1392
_PHR03B024 NM_003482:exon34:c.9265dupG p.V3089fs
chr12:g.49447259C>T KMT2D nonsynonymous SNV 37.7 NA 2.40 970 RELYSE_GHE1392
_PHR03B024 NM_003482:exon6:c.G839A p.R280K
chr12:g.49432396G>A KMT2D stopgain SNV 62.2 0.00 14.95 1130 RELYSE_GHE1393_PHR03B023 NM_003482:exon34:c.C8743T p.R2915X
chr12:g.49445056->C KMT2D frameshift insertion 38.6 NA NA 793 RELYSE_GHE1413
_PHR06B081NM_003482:exon10:c.2409_2410insG p.L804fs
chr12:g.49443774GA>- KMT2D frameshift deletion 31.8 NA NA 115 RELYSE_GHE1437_PHR06B018
NM_003482:exon11:c.3596_3597del p.1199_1199del
chr12:g.49425038G>A KMT2D stopgain SNV 54.1 0.00 23.11 1696 RELYSE_GHE1438_PHR06B103 NM_003482:exon39:c.C13450T p.R4484X
chr12:g.49442545T>A KMT2D nonsynonymous SNV 24.9 0.00 1.74 443 RELYSE_GHE1438
_PHR06B103 NM_003482:exon13:c.A4028T p.D1343V
chr12:g.49447793C>T KMT2D nonsynonymous SNV 24.4 0.00 2.06 338 RELYSE_GHE1438
_PHR06B103 NM_003482:exon5:c.G641A p.C214Y
chr12:g.49427015T>C KMT2D nonsynonymous SNV 41.6 0.00 0.76 590 RELYSE_GHE1440
_PHR07B003.2 NM_003482:exon39:c.A11473G p.R3825G
chr12:g.49426654T>- KMT2D frameshift deletion 20.1 NA NA 184 RELYSE_GHE1450_PHR02B044
NM_003482:exon39:c.11834delA p.Q3945fs
chr12:g.49427294G>A KMT2D stopgain SNV 7.1 0.00 18.30 37 RELYSE_GHE1450_PHR02B044 NM_003482:exon39:c.C11194T p.Q3732X
chr12:g.49435884G>A KMT2D stopgain SNV 20.3 0.00 12.53 241 RELYSE_GHE1450_PHR02B044 NM_003482:exon28:c.C6097T p.Q2033X
chr12:g.49420121A>C KMT2D nonsynonymous SNV 40.2 0.00 2.20 2830 RELYSE_GHE1498
_PHR06B087 NM_003482:exon48:c.T15628G p.Y5210D
chr12:g.49426924G>T KMT2D nonsynonymous SNV 4.9 0.00 0.97 32 RELYSE_GHE1521
_PHR03B034 NM_003482:exon39:c.C11564A p.A3855D
chr12:g.49418717C>T KMT2D nonsynonymous SNV 60.1 0.00 2.27 1606 RELYSE_GHE1536
_PHR02B030 NM_003482:exon49:c.G15797A p.R5266H
chr12:g.49428410->C KMT2D frameshift insertion 7.7 NA NA 12 RELYSE_GHE1537
_PHR01B018NM_003482:exon36:c.10394dupG p.G3465fs
chr12:g.49436356A>C KMT2D nonsynonymous SNV 22.0 0.00 1.85 83 RELYSE_GHE1537
_PHR01B018 NM_003482:exon27:c.T5855G p.F1952C
chr12:g.49440501A>- KMT2D frameshift deletion 38.0 NA NA 1207 RELYSE_GHE1537_PHR01B018 NM_003482:exon15:c.4309delT p.S1437fs
chr12:g.49433388G>A KMT2D stopgain SNV 44.9 0.00 15.95 800 RELYSE_GHE1553_PHR02B046 NM_003482:exon32:c.C8059T p.R2687X
chr12:g.49420466A>C KMT2D nonsynonymous SNV 54.9 0.00 1.83 3258 RELYSE_GHE2002
_PHR05B029 NM_003482:exon48:c.T15283G p.C5095G
chr12:g.49432560C>T KMT2D nonsynonymous SNV 22.6 0.00 1.46 199 RELYSE_GHE2012
_PHR05B008 NM_003482:exon34:c.G8579A p.R2860H
chr12:g.49420119G>C KMT2D stopgain SNV 42.9 0.00 23.89 1860 RELYSE_GHE2019_PHR05B030 NM_003482:exon48:c.C15630G p.Y5210X
chr12:g.49432146T>- KMT2D frameshift deletion 24.9 NA NA 337 RELYSE_GHE2023_PHR05B032 NM_003482:exon34:c.8993delA p.D2998fs
chr12:g.49432148A>C KMT2D nonsynonymous SNV 24.8 0.00 1.49 336 RELYSE_GHE2023
_PHR05B032 NM_003482:exon34:c.T8991G p.F2997L
chr12:g.49431813G>T KMT2D nonsynonymous SNV 48.0 0.00 0.93 578 RELYSE_GHE2084
_PHR05B014 NM_003482:exon34:c.C9326A p.P3109H
chr12:g.49422842A>C KMT2D splicing 12.8 NA 4.08 145 RELYSE_GHE2096_PHR05B016 NA NA
chr12:g.49446470C>T KMT2D nonsynonymous SNV 38.0 0.00 0.49 1713 RELYSE_GHE2098
_PHR05B031 NM_003482:exon9:c.G1135A p.D379N
chr12:g.49420288C>T KMT2D nonsynonymous SNV 47.8 0.00 3.10 930 RELYSE_GHE2106
_PHR05B018 NM_003482:exon48:c.G15461A p.R5154Q
chr12:g.49426733G>A KMT2D stopgain SNV 46.3 0.00 15.53 1275 RELYSE_GHE2106_PHR05B018 NM_003482:exon39:c.C11755T p.Q3919X
chr12:g.49415652T>A KMT2D nonsynonymous SNV 55.2 0.00 1.48 2122 RELYSE_GHE2109
_PHR05B025 NM_003482:exon54:c.A16525T p.T5509S
chr12:g.49427395C>- KMT2D frameshift deletion 12.9 NA NA 37 RELYSE_GHE2109_PHR05B025
NM_003482:exon39:c.11093delG p.G3698fs
chr12:g.49416101TTCA>- KMT2D frameshift deletion 22.9 NA NA 280 RELYSE_GHE2119_PHR05B001
NM_003482:exon52:c.16371_16374del p.5457_5458del
chr12:g.49420814G>- KMT2D frameshift deletion 21.6 NA NA 236 RELYSE_GHE2121_PHR05B003
NM_003482:exon48:c.14935delC p.L4979fs
chr19:g.19261490C>G MEF2B splicing 30.9 NA 3.01 480 RELYSE_GHE2012_PHR05B008 NA NA
chr19:g.19261497A>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 14.6 0.00 2.50 169 RELYSE_GHE0024
_PHR02B062 NM_005919:exon4:c.T48G p.N16K
chr19:g.19260223G>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 33.0 0.00 2.42 529 RELYSE_GHE0061
_PHR06B078 NM_005919:exon5:c.C70T p.R24W
chr19:g.19256727C>- MEF2B,MEF2BNB-MEF2B frameshift deletion 58.8 NA NA 61 RELYSE_GHE0150
_PHR06B082 NM_005919:exon10:c.874delG p.A292fs
chr19:g.19260202T>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 11.9 0.00 4.76 144 RELYSE_GHE0202
_PHR02B85 NM_005919:exon5:c.A91G p.K31E
chr19:g.19256727C>- MEF2B,MEF2BNB-MEF2B frameshift deletion 26.5 NA NA 31 RELYSE_GHE0400
_PHRC06B015 NM_005919:exon10:c.874delG p.A292fs
chr19:g.19260064C>G MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 31.8 0.02 5.12 775 RELYSE_GHE0427
_PHR06B96 NM_005919:exon5:c.G229C p.E77Q
chr19:g.19261505G>A MEF2B,MEF2BNB-MEF2B stopgain SNV 8.2 0.41 5.84 29 RELYSE_GHE0430
_PHR06B94 NM_005919:exon4:c.C40T p.Q14X
chr19:g.19257646T>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 43.8 0.01 3.12 633 RELYSE_GHE0515
_PHR02B058 NM_005919:exon8:c.A580T p.S194C
chr19:g.19260132A>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 34.2 0.00 4.62 630 RELYSE_GHE0534
_PHR02B67 NM_005919:exon5:c.T161G p.L54R
chr19:g.19260124A>T MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 47.1 0.00 4.66 873 RELYSE_GHE0563
_PHR06B031 NM_005919:exon5:c.T169A p.Y57N
chr19:g.19260062C>G MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 11.6 0.00 4.39 181 RELYSE_GHE0614
_PHRC02B016 NM_005919:exon5:c.G231C p.E77D
chr19:g.19260226T>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 14.9 0.00 3.54 186 RELYSE_GHE0615
_PHR02B052 NM_005919:exon5:c.A67G p.K23E
chr19:g.19261513A>G MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 36.9 0.00 3.75 586 RELYSE_GHE0622
_PHRC03B016 NM_005919:exon4:c.T32C p.I11T
chr19:g.19256727C>- MEF2B,MEF2BNB-MEF2B frameshift deletion 51.1 NA NA 103 RELYSE_GHE0635
_PHR01B032 NM_005919:exon10:c.874delG p.A292fs
chr19:g.19256727C>- MEF2B,MEF2BNB-MEF2B frameshift deletion 22.0 NA NA 40 RELYSE_GHE0645
_PHR02B008 NM_005919:exon10:c.874delG p.A292fs
chr19:g.19260064C>T MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 41.3 0.09 5.65 1084 RELYSE_GHE0685
_PHRC06B021 NM_005919:exon5:c.G229A p.E77K
chr19:g.19261541C>T MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 75.0 0.00 3.97 2208 RELYSE_GHE0776
_PHR02B037 NM_005919:exon4:c.G4A p.G2R
chr19:g.19260045T>G MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 52.5 0.05 3.92 1078 RELYSE_GHE0777
_PHR02B036 NM_005919:exon5:c.A248C p.D83A
chr19:g.19257946A>C MEF2B,MEF2BNB-MEF2B stopgain SNV 31.4 NA 2.72 246 RELYSE_GHE0811
_PHR06B003 NM_005919:exon7:c.T440G p.L147X
chr19:g.19261529T>- MEF2B,MEF2BNB-MEF2B frameshift deletion 16.5 NA NA 42 RELYSE_GHE0976
_PHR01B035 NM_005919:exon4:c.16delA p.I6fs
chr19:g.19257571G>A MEF2B,MEF2BNB-MEF2B stopgain SNV 16.2 0.47 2.55 246 RELYSE_GHE0986
_PHR02B048 NM_005919:exon8:c.C655T p.R219X
chr19:g.19260045T>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 13.6 0.01 4.19 46 RELYSE_GHE0993
_PHR06B085 NM_005919:exon5:c.A248T p.D83V
chr19:g.19261535T>A MEF2B,MEF2BNB-MEF2B stopgain SNV 37.0 0.00 6.01 787 RELYSE_GHE1009
_PHR01B044 NM_005919:exon4:c.A10T p.K4X
chr19:g.19260045T>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 39.8 0.01 4.19 358 RELYSE_GHE1066
_PHR06B059 NM_005919:exon5:c.A248T p.D83V
chr19:g.19260045T>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 17.0 0.01 4.19 146 RELYSE_GHE1222
_PHR02B047 NM_005919:exon5:c.A248T p.D83V
chr19:g.19260055T>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 31.3 0.06 4.80 925 RELYSE_GHE1352
_PHR01B034 NM_005919:exon5:c.A238G p.T80A
chr19:g.19260084G>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 31.1 0.00 4.68 675 RELYSE_GHE1393
_PHR03B023 NM_005919:exon5:c.C209G p.T70R
chr19:g.19260170A>T MEF2B,MEF2BNB-MEF2B stopgain SNV 37.8 NA 4.90 934 RELYSE_GHE1393
_PHR03B023 NM_005919:exon5:c.T123A p.C41X
chr19:g.19260146G>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 29.6 0.00 3.89 590 RELYSE_GHE1424
_PHR06B029 NM_005919:exon5:c.C147G p.N49K
chr19:g.19260088A>G MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 27.6 0.01 4.58 302 RELYSE_GHE1438
_PHR06B103 NM_005919:exon5:c.T205C p.Y69H
chr19:g.19260045T>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 40.3 0.01 4.19 672 RELYSE_GHE1553
_PHR02B046 NM_005919:exon5:c.A248T p.D83V
chr19:g.19257890G>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 13.9 0.02 4.30 103 RELYSE_GHE2012
_PHR05B008 NM_005919:exon7:c.C496T p.R166C
chr19:g.19260165A>T MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 51.6 0.00 4.60 2182 RELYSE_GHE2019
_PHR05B030 NM_005919:exon5:c.T128A p.I43K
chr19:g.19260184C>A MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 51.8 0.00 4.94 2221 RELYSE_GHE2019
_PHR05B030 NM_005919:exon5:c.G109T p.V37L
chr19:g.19260219T>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 51.6 0.33 3.14 2191 RELYSE_GHE2019
_PHR05B030 NM_005919:exon5:c.A74G p.K25R
chr19:g.19260087T>C MEF2B,MEF2BNB-MEF2B
nonsynonymous SNV 12.6 0.00 4.31 90 RELYSE_GHE2096
_PHR05B016 NM_005919:exon5:c.A206G p.Y69C
chr8:g.8750370C>T MFHAS1 nonsynonymous SNV 14.3 0.58 3.58 26 RELYSE_GHE0004
_PHR06B022 NM_004225:exon1:c.G199A p.A67T
chr8:g.8748032G>C MFHAS1 nonsynonymous SNV 47.4 0.42 2.55 911 RELYSE_GHE0034
_PHR02B064 NM_004225:exon1:c.C2537G p.A846G
chr8:g.8749316T>A MFHAS1 nonsynonymous SNV 35.0 0.09 3.43 591 RELYSE_GHE0092
_PHR02B009 NM_004225:exon1:c.A1253T p.K418M
chr8:g.8750465G>A MFHAS1 nonsynonymous SNV 8.8 0.84 2.53 44 RELYSE_GHE0202
_PHR02B85 NM_004225:exon1:c.C104T p.T35I
chr8:g.8749334AGCTT>- MFHAS1 frameshift deletion 22.1 NA NA 249 RELYSE_GHE0219_PHR03B037
NM_004225:exon1:c.1231_1235del p.411_412del
chr8:g.8749359G>A MFHAS1 nonsynonymous SNV 17.5 0.13 4.03 211 RELYSE_GHE0219
_PHR03B037 NM_004225:exon1:c.C1210T p.P404S
chr8:g.8749531C>G MFHAS1 nonsynonymous SNV 18.4 0.51 2.37 258 RELYSE_GHE0219
_PHR03B037 NM_004225:exon1:c.G1038C p.E346D
chr8:g.8750301G>C MFHAS1 nonsynonymous SNV 18.1 0.36 3.11 86 RELYSE_GHE0219
_PHR03B037 NM_004225:exon1:c.C268G p.R90G
chr8:g.8748834C>T MFHAS1 nonsynonymous SNV 49.7 0.30 3.44 1850 RELYSE_GHE0292
_PHR01B041 NM_004225:exon1:c.G1735A p.A579T
chr8:g.8750333G>C MFHAS1 nonsynonymous SNV 43.7 0.00 4.96 275 RELYSE_GHE0292
_PHR01B041 NM_004225:exon1:c.C236G p.P79R
chr8:g.8749635G>A MFHAS1 nonsynonymous SNV 14.7 0.01 4.36 113 RELYSE_GHE0293
_PHR02B042 NM_004225:exon1:c.C934T p.P312S
chr8:g.8749886G>A MFHAS1 nonsynonymous SNV 11.1 0.28 1.84 69 RELYSE_GHE0293
_PHR02B042 NM_004225:exon1:c.C683T p.A228V
chr8:g.8654984G>C MFHAS1 nonsynonymous SNV 7.3 0.47 4.72 33 RELYSE_GHE0397
_PHRC06B014 NM_004225:exon2:c.C3016G p.P1006A
chr8:g.8747722T>A MFHAS1 nonsynonymous SNV 26.7 0.56 2.73 302 RELYSE_GHE0491
_PHR02B025 NM_004225:exon1:c.A2847T p.L949F
chr8:g.8747732T>A MFHAS1 nonsynonymous SNV 26.8 0.07 2.23 303 RELYSE_GHE0491
_PHR02B025 NM_004225:exon1:c.A2837T p.H946L
chr8:g.8748659C>T MFHAS1 nonsynonymous SNV 40.9 0.22 2.26 326 RELYSE_GHE0491
_PHR02B025 NM_004225:exon1:c.G1910A p.R637H
chr8:g.8749949T>C MFHAS1 nonsynonymous SNV 17.1 0.13 2.83 106 RELYSE_GHE0609
_PHR02B014 NM_004225:exon1:c.A620G p.E207G
chr8:g.8750283T>A MFHAS1 nonsynonymous SNV 21.7 0.02 3.52 152 RELYSE_GHE0609
_PHR02B014 NM_004225:exon1:c.A286T p.R96W
chr8:g.8747739C>T MFHAS1 nonsynonymous SNV 26.6 0.53 2.72 378 RELYSE_GHE0807
_PHR06B001 NM_004225:exon1:c.G2830A p.A944T
chr8:g.8750275GCGGTTCCTGC>- MFHAS1 frameshift deletion 52.6 NA NA 536 RELYSE_GHE0834
_PHR01B043 NM_004225:exon1:c.284_294del p.95_98del
chr8:g.8748903G>A MFHAS1 nonsynonymous SNV 16.7 0.03 3.14 341 RELYSE_GHE0982
_PHR02B043 NM_004225:exon1:c.C1666T p.R556C
chr8:g.8750157G>A MFHAS1 nonsynonymous SNV 19.0 0.00 3.22 212 RELYSE_GHE0986
_PHR02B048 NM_004225:exon1:c.C412T p.R138W
chr8:g.8749734T>A MFHAS1 nonsynonymous SNV 32.8 0.91 3.22 143 RELYSE_GHE1376
_PHR03B002 NM_004225:exon1:c.A835T p.N279Y
chr8:g.8749764A>G MFHAS1 nonsynonymous SNV 36.7 0.65 4.02 362 RELYSE_GHE1376
_PHR03B002 NM_004225:exon1:c.T805C p.F269L
chr8:g.8747611C>G MFHAS1 nonsynonymous SNV 13.7 0.16 3.72 335 RELYSE_GHE1390
_PHR03B022 NM_004225:exon1:c.G2958C p.K986N
chr8:g.8750162T>C MFHAS1 nonsynonymous SNV 8.0 0.35 2.48 24 RELYSE_GHE1390
_PHR03B022 NM_004225:exon1:c.A407G p.E136G
chr8:g.8749651G>C MFHAS1 nonsynonymous SNV 43.5 0.00 3.14 417 RELYSE_GHE1438
_PHR06B103 NM_004225:exon1:c.C918G p.N306K
chr8:g.128750677C>T MYC nonsynonymous SNV 49.1 0.02 5.02 773 RELYSE_GHE0001
_PHR01B013 NM_002467:exon2:c.C214T p.P72S
chr8:g.128750625G>C MYC nonsynonymous SNV 20.9 0.18 1.90 266 RELYSE_GHE0197
_PHR02B075 NM_002467:exon2:c.G162C p.E54D
chr8:g.128748829C>T MYC UTR5 26.1 NA NA 203 RELYSE_GHE0219_PHR03B037 NA NA
chr8:g.128750616G>T MYC nonsynonymous SNV 26.3 0.07 1.82 381 RELYSE_GHE0241
_PHR06B041 NM_002467:exon2:c.G153T p.Q51H
chr8:g.128750625G>T MYC nonsynonymous SNV 25.9 0.18 1.96 371 RELYSE_GHE0241
_PHR06B041 NM_002467:exon2:c.G162T p.E54D
chr8:g.128750783G>A MYC nonsynonymous SNV 40.1 0.34 2.54 804 RELYSE_GHE0241
_PHR06B041 NM_002467:exon2:c.G320A p.S107N
chr8:g.128750849G>A MYC nonsynonymous SNV 19.1 0.03 4.59 274 RELYSE_GHE0258
_PHR06B100 NM_002467:exon2:c.G386A p.S129N
chr8:g.128750952G>C MYC nonsynonymous SNV 17.1 0.00 4.18 185 RELYSE_GHE0258
_PHR06B100 NM_002467:exon2:c.G489C p.K163N
chr8:g.128751032G>A MYC nonsynonymous SNV 17.6 0.03 2.93 192 RELYSE_GHE0258
_PHR06B100 NM_002467:exon2:c.G569A p.S190N
chr8:g.128751244C>T MYC nonsynonymous SNV 25.0 0.08 3.64 240 RELYSE_GHE0258
_PHR06B100 NM_002467:exon2:c.C781T p.P261S
chr8:g.128752872G>A MYC nonsynonymous SNV 21.3 0.07 3.08 211 RELYSE_GHE0258
_PHR06B100 NM_002467:exon3:c.G1033A p.V345I
chr8:g.128753107C>T MYC nonsynonymous SNV 19.6 0.03 1.69 230 RELYSE_GHE0258
_PHR06B100 NM_002467:exon3:c.C1268T p.A423V
chr8:g.128753157G>C MYC nonsynonymous SNV 17.6 0.51 2.31 57 RELYSE_GHE0258
_PHR06B100 NM_002467:exon3:c.G1318C p.E440Q
chr8:g.128748829C>T MYC UTR5 28.3 NA NA 728 RELYSE_GHE0491_PHR02B025 NA NA
chr8:g.128750695C>T MYC nonsynonymous SNV 52.9 0.02 5.15 189 RELYSE_GHE0519
_PHRC03B020 NM_002467:exon2:c.C232T p.P78S
chr8:g.128750686C>T MYC nonsynonymous SNV 14.1 0.01 5.15 50 RELYSE_GHE0622
_PHRC03B016 NM_002467:exon2:c.C223T p.P75S
chr8:g.128750613GCAGCAGAGCGAGCT>- MYC nonframeshift
deletion 29.6 NA NA 50 RELYSE_GHE0685_PHRC06B021 NM_002467:exon2:c.150_164del p.50_55del
chr8:g.128751016G>A MYC nonsynonymous SNV 22.5 0.12 2.90 409 RELYSE_GHE0721
_PHR39B015 NM_002467:exon2:c.G553A p.V185I
chr8:g.128750616G>T MYC nonsynonymous SNV 22.3 0.07 1.82 416 RELYSE_GHE0822
_PHR07B005 NM_002467:exon2:c.G153T p.Q51H
chr8:g.128750649G>C MYC nonsynonymous SNV 42.3 0.00 2.43 193 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.G186C p.E62D
chr8:g.128750696C>G MYC nonsynonymous SNV 43.8 0.00 2.77 207 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.C233G p.P78R
chr8:g.128750728T>A MYC nonsynonymous SNV 42.6 0.20 2.65 193 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.T265A p.Y89N
chr8:g.128750771G>A MYC nonsynonymous SNV 31.5 0.26 2.66 262 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.G308A p.G103D
chr8:g.128750783G>A MYC nonsynonymous SNV 29.0 0.34 2.54 222 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.G320A p.S107N
chr8:g.128750821C>G MYC nonsynonymous SNV 37.3 0.08 3.88 651 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.C358G p.L120V
chr8:g.128750920T>C MYC nonsynonymous SNV 10.3 0.00 5.57 58 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.T457C p.F153L
chr8:g.128750953C>G MYC nonsynonymous SNV 31.2 0.04 4.05 295 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.C490G p.L164V
chr8:g.128751015C>A MYC nonsynonymous SNV 8.1 0.02 2.49 33 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.C552A p.S184R
chr8:g.128751043C>G MYC nonsynonymous SNV 14.5 0.08 4.25 56 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.C580G p.Q194E
chr8:g.128751117C>G MYC nonsynonymous SNV 17.4 0.33 2.18 21 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon2:c.C654G p.S218R
chr8:g.128752968T>G MYC nonsynonymous SNV 36.8 0.03 4.16 231 RELYSE_GHE0883
_PHR01B042.2 NM_002467:exon3:c.T1129G p.L377V
chr8:g.128748828G>A MYC UTR5 5.2 NA NA 23 RELYSE_GHE2030_PHR05B005 NA NA
chr8:g.128750677C>A MYC nonsynonymous SNV 24.8 0.00 7.14 183 RELYSE_GHE2100
_PHR05B015 NM_002467:exon2:c.C214A p.P72T
chr3:g.38182292G>A MYD88 nonsynonymous SNV 28.1 0.01 4.72 578 RELYSE_GHE0047
_PHR39B020 NM_001172569:exon3:c.G547A p.A183T
chr3:g.38182641T>C MYD88 stoploss SNV 82.1 0.00 3.71 2670 RELYSE_GHE0150_PHR06B082 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182337C>T MYD88 stopgain SNV 41.7 1.00 5.15 2082 RELYSE_GHE0169_PHR01B023 NM_001172569:exon3:c.C592T p.Q198X
chr3:g.38182292G>A MYD88 nonsynonymous SNV 33.7 0.01 4.72 521 RELYSE_GHE0358
_PHR01B039 NM_001172569:exon3:c.G547A p.A183T
chr3:g.38182638G>T MYD88 nonsynonymous SNV 12.6 0.00 4.84 136 RELYSE_GHE0415
_PHRC06B013 NM_001172569:exon4:c.G610T p.D204Y
chr3:g.38182641T>C MYD88 stoploss SNV 43.5 0.00 3.71 1044 RELYSE_GHE0415_PHRC06B013 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182032C>G MYD88 nonsynonymous SNV 32.6 0.02 5.18 841 RELYSE_GHE0423
_PHR06B045 NM_001172567:exon3:c.C656G p.S219C
chr3:g.38182292G>A MYD88 nonsynonymous SNV 36.6 0.01 4.72 989 RELYSE_GHE0427
_PHR06B96 NM_001172569:exon3:c.G547A p.A183T
chr3:g.38182641T>C MYD88 stoploss SNV 45.5 0.00 3.71 1240 RELYSE_GHE0436_PHR06B95 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182032C>G MYD88 nonsynonymous SNV 33.0 0.02 5.18 1327 RELYSE_GHE0440
_PHR06B97 NM_001172567:exon3:c.C656G p.S219C
chr3:g.38182641T>C MYD88 stoploss SNV 60.3 0.00 3.71 2849 RELYSE_GHE0454_PHR07B15 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182641T>C MYD88 stoploss SNV 43.6 0.00 3.71 2172 RELYSE_GHE0459_PHR02B080 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182042T>A MYD88 nonsynonymous SNV 14.1 0.03 4.15 131 RELYSE_GHE0469
_PHR06B006 NM_001172567:exon3:c.T666A p.S222R
chr3:g.38182641T>C MYD88 stoploss SNV 29.5 0.00 3.71 383 RELYSE_GHE0495_PHR06B063 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182641T>C MYD88 stoploss SNV 19.8 0.00 3.71 292 RELYSE_GHE0659_PHR39B010 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182032C>G MYD88 nonsynonymous SNV 36.4 0.02 5.18 1097 RELYSE_GHE0693
_PHR01B028 NM_001172567:exon3:c.C656G p.S219C
chr3:g.38182292G>A MYD88 nonsynonymous SNV 42.9 0.01 4.72 914 RELYSE_GHE0743
_PHR06B092 NM_001172569:exon3:c.G547A p.A183T
chr3:g.38182641T>C MYD88 stoploss SNV 57.4 0.00 3.71 1194 RELYSE_GHE0809_PHR06B004 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182641T>C MYD88 stoploss SNV 20.7 0.00 3.71 180 RELYSE_GHE0810_PHR06B002 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182025G>T MYD88 nonsynonymous SNV 95.3 0.77 3.90 4267 RELYSE_GHE0822
_PHR07B005 NM_001172567:exon3:c.G649T p.V217F
chr3:g.38182641T>C MYD88 stoploss SNV 46.2 0.00 3.71 1130 RELYSE_GHE0842_PHR03B033 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182641T>C MYD88 stoploss SNV 41.2 0.00 3.71 1294 RELYSE_GHE0855_PHR06B049 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182292G>A MYD88 nonsynonymous SNV 32.5 0.01 4.72 511 RELYSE_GHE0909
_PHR03B007 NM_001172569:exon3:c.G547A p.A183T
chr3:g.38182641T>C MYD88 stoploss SNV 52.4 0.00 3.71 2034 RELYSE_GHE0925_PHR06B067 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182025G>T MYD88 nonsynonymous SNV 30.5 0.77 3.90 815 RELYSE_GHE0988
_PHR06B086.2 NM_001172567:exon3:c.G649T p.V217F
chr3:g.38182641T>C MYD88 stoploss SNV 58.4 0.00 3.71 3255 RELYSE_GHE1036_PHR07B004.2 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182025G>T MYD88 nonsynonymous SNV 46.5 0.77 3.90 1494 RELYSE_GHE1099
_PHR02B057 NM_001172567:exon3:c.G649T p.V217F
chr3:g.38182641T>C MYD88 stoploss SNV 43.9 0.00 3.71 2074 RELYSE_GHE1189_PHR07B009.2 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182641T>C MYD88 stoploss SNV 22.8 0.00 3.71 490 RELYSE_GHE1302_PHR01B049 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182259T>C MYD88 nonsynonymous SNV 45.2 0.11 3.13 1827 RELYSE_GHE1352
_PHR01B034 NM_001172569:exon3:c.T514C p.W172R
chr3:g.38182032C>G MYD88 nonsynonymous SNV 33.1 0.02 5.18 655 RELYSE_GHE1393
_PHR03B023 NM_001172567:exon3:c.C656G p.S219C
chr3:g.38182292G>A MYD88 nonsynonymous SNV 28.2 0.01 4.72 862 RELYSE_GHE1409
_PHR02B070 NM_001172569:exon3:c.G547A p.A183T
chr3:g.38182641T>C MYD88 stoploss SNV 60.7 0.00 3.71 2609 RELYSE_GHE1413_PHR06B081 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182641T>C MYD88 stoploss SNV 64.5 0.00 3.71 4180 RELYSE_GHE2026_PHR05B022.2 NM_001172569:exon4:c.T613C p.X205R
chr3:g.38182032C>G MYD88 nonsynonymous SNV 31.5 0.02 5.18 1071 RELYSE_GHE2036
_PHR05B007 NM_001172567:exon3:c.C656G p.S219C
chr3:g.38181418T>C MYD88 nonsynonymous SNV 40.2 0.12 4.65 731 RELYSE_GHE2037
_PHR05B009 NM_001172569:exon2:c.T431C p.V144A
chr3:g.38182641T>C MYD88 stoploss SNV 40.0 0.00 3.71 729 RELYSE_GHE2127_PHR05B010 NM_001172569:exon4:c.T613C p.X205R
chr9:g.139391211C>T NOTCH1 nonsynonymous SNV 86.9 0.31 2.74 5435 RELYSE_GHE0275
_PHR06B99 NM_017617:exon34:c.G6980A p.R2327Q
chr9:g.139391593C>T NOTCH1 nonsynonymous SNV 54.4 0.03 4.19 1124 RELYSE_GHE0293
_PHR02B042 NM_017617:exon34:c.G6598A p.V2200M
chr9:g.139390653G>A NOTCH1 nonsynonymous SNV 15.2 0.00 3.99 187 RELYSE_GHE0426
_PHR06B98 NM_017617:exon34:c.C7538T p.S2513F
chr9:g.139391254G>A NOTCH1 nonsynonymous SNV 50.5 0.01 2.03 470 RELYSE_GHE0470
_PHR06B005 NM_017617:exon34:c.C6937T p.R2313W
chr9:g.139390975G>A NOTCH1 stopgain SNV 16.0 0.94 11.04 70 RELYSE_GHE0690_PHR06B057 NM_017617:exon34:c.C7216T p.Q2406X
chr9:g.139391145G>A NOTCH1 nonsynonymous SNV 44.6 0.44 1.71 345 RELYSE_GHE0708
_PHR02B082 NM_017617:exon34:c.C7046T p.P2349L
chr9:g.139391544G>A NOTCH1 nonsynonymous SNV 43.6 0.12 4.49 2354 RELYSE_GHE0822
_PHR07B005 NM_017617:exon34:c.C6647T p.P2216L
chr9:g.139390517C>T NOTCH1 UTR3 51.6 NA NA 1140 RELYSE_GHE0873_PHR01B027 NA NA
chr9:g.139390747G>- NOTCH1 stopgain SNV 41.5 NA NA 769 RELYSE_GHE1034_PHR07B010.2 NM_017617:exon34:c.7444delC p.L2482X
chr9:g.139390747G>- NOTCH1 stopgain SNV 30.7 NA NA 388 RELYSE_GHE1560_PHR07B002 NM_017617:exon34:c.7444delC p.L2482X
chr1:g.120458120G>A NOTCH2 stopgain SNV 13.7 0.25 14.49 572 RELYSE_GHE0006_PHR01B048 NM_024408:exon34:c.C7225T p.Q2409X
chr1:g.120459214C>T NOTCH2 nonsynonymous SNV 55.3 0.00 4.28 2391 RELYSE_GHE0015
_PHR01B045 NM_024408:exon34:c.G6131A p.R2044H
chr1:g.120458587C>T NOTCH2 stopgain SNV 26.5 1.00 12.81 1746 RELYSE_GHE0047_PHR39B020 NM_024408:exon34:c.G6758A p.W2253X
chr1:g.120458150C>A NOTCH2 stopgain SNV 91.4 0.04 14.44 7759 RELYSE_GHE0049_PHR06B089.2 NM_024408:exon34:c.G7195T p.E2399X
chr1:g.120458147G>A NOTCH2 stopgain SNV 30.9 0.67 14.01 467 RELYSE_GHE0811_PHR06B003 NM_024408:exon34:c.C7198T p.R2400X
chr1:g.120458122A>T NOTCH2 nonsynonymous SNV 49.2 0.00 2.72 2443 RELYSE_GHE0857
_PHR06B038 NM_024408:exon34:c.T7223A p.L2408H
chr1:g.120458147G>A NOTCH2 stopgain SNV 28.3 0.67 14.01 1101 RELYSE_GHE0909_PHR03B007 NM_024408:exon34:c.C7198T p.R2400X
chr1:g.120458147G>A NOTCH2 stopgain SNV 14.6 0.67 14.01 380 RELYSE_GHE0986_PHR02B048 NM_024408:exon34:c.C7198T p.R2400X
chr1:g.120458147G>A NOTCH2 stopgain SNV 6.2 0.67 14.01 77 RELYSE_GHE0997_PHR07B012 NM_024408:exon34:c.C7198T p.R2400X
chr1:g.120458122A>T NOTCH2 nonsynonymous SNV 47.5 0.00 2.72 2107 RELYSE_GHE1225
_PHR02B038 NM_024408:exon34:c.T7223A p.L2408H
chr1:g.120458147G>A NOTCH2 stopgain SNV 14.3 0.67 14.01 435 RELYSE_GHE1349_PHR02B086 NM_024408:exon34:c.C7198T p.R2400X
chr1:g.120457933G>A NOTCH2 nonsynonymous SNV 41.3 0.00 2.90 271 RELYSE_GHE1438
_PHR06B103 NM_024408:exon34:c.C7412T p.A2471V
chr1:g.120458196G>C NOTCH2 stopgain SNV 42.3 1.00 13.56 3639 RELYSE_GHE2019_PHR05B030 NM_024408:exon34:c.C7149G p.Y2383X
chr1:g.120458424->A NOTCH2 frameshift insertion 43.0 NA NA 418 RELYSE_GHE2019
_PHR05B030 NM_024408:exon34:c.6920dupT p.F2307fs
chr1:g.120458831A>T NOTCH2 nonsynonymous SNV 45.3 0.07 4.11 487 RELYSE_GHE2100
_PHR05B015 NM_024408:exon34:c.T6514A p.S2172T
chr1:g.120458147G>A NOTCH2 stopgain SNV 26.7 0.67 14.01 1314 RELYSE_GHE2109_PHR05B025 NM_024408:exon34:c.C7198T p.R2400X
chr6:g.37139247C>T PIM1 nonsynonymous SNV 40.6 0.02 4.22 459 RELYSE_GHE0150
_PHR06B082 NM_001243186:exon4:c.C860T p.T287I
chr6:g.37138642C>G PIM1 nonsynonymous SNV 13.3 0.19 2.42 10 RELYSE_GHE0197
_PHR02B075 NM_001243186:exon2:c.C449G p.S150C
chr6:g.37138950G>A PIM1 nonsynonymous SNV 8.8 0.36 3.20 28 RELYSE_GHE0258
_PHR06B100 NM_001243186:exon4:c.G563A p.S188N
chr6:g.37139111G>A PIM1 nonsynonymous SNV 21.4 0.00 4.22 205 RELYSE_GHE0258
_PHR06B100 NM_001243186:exon4:c.G724A p.V242M
chr6:g.37141856C>A PIM1 nonsynonymous SNV 50.2 0.01 0.55 1005 RELYSE_GHE0262
_PHR06B040.2NM_001243186:exon6:c.C1204A p.P402T
chr6:g.37138908G>A PIM1 nonsynonymous SNV 31.8 0.12 3.51 115 RELYSE_GHE0275
_PHR06B99 NM_001243186:exon4:c.G521A p.G174D
chr6:g.37139131CTGCCACAACTG>- PIM1 nonframeshift
deletion 47.6 NA NA 1256 RELYSE_GHE0300_PHR07B007
NM_001243186:exon4:c.744_755del p.248_252del
chr6:g.37138653C>A PIM1 nonsynonymous SNV 41.8 0.01 4.44 387 RELYSE_GHE0358
_PHR01B039 NM_001243186:exon2:c.C460A p.P154T
chr6:g.37139059C>G PIM1 nonsynonymous SNV 14.8 0.00 2.34 129 RELYSE_GHE0371
_PHR02B84 NM_001243186:exon4:c.C672G p.I224M
chr6:g.37139210C>G PIM1 nonsynonymous SNV 12.3 0.03 4.60 40 RELYSE_GHE0395
_PHRC39B003 NM_001243186:exon4:c.C823G p.L275V
chr6:g.37138804G>- PIM1 frameshift deletion 32.3 NA NA 450 RELYSE_GHE0397_PHRC06B014
NM_001243186:exon3:c.510delG p.E170fs
chr6:g.37139210C>T PIM1 nonsynonymous SNV 37.2 0.00 4.93 274 RELYSE_GHE0397
_PHRC06B014 NM_001243186:exon4:c.C823T p.L275F
chr6:g.37138772G>A PIM1 nonsynonymous SNV 20.5 0.00 5.02 59 RELYSE_GHE0436
_PHR06B95 NM_001243186:exon3:c.G478A p.V160M
chr6:g.37138615G>C PIM1 nonsynonymous SNV 69.2 0.01 4.53 74 RELYSE_GHE0459
_PHR02B080 NM_001243186:exon2:c.G422C p.G141A
chr6:g.37138656G>C PIM1 splicing 49.3 NA 3.97 320 RELYSE_GHE0459_PHR02B080 NA NA
chr6:g.37138916G>A PIM1 nonsynonymous SNV 50.3 0.05 4.30 751 RELYSE_GHE0459
_PHR02B080 NM_001243186:exon4:c.G529A p.V177M
chr6:g.37139237C>T PIM1 nonsynonymous SNV 27.6 0.03 4.90 239 RELYSE_GHE0459
_PHR02B080 NM_001243186:exon4:c.C850T p.L284F
chr6:g.37139030G>C PIM1 nonsynonymous SNV 36.4 0.37 2.65 191 RELYSE_GHE0507
_PHRC01B020 NM_001243186:exon4:c.G643C p.E215Q
chr6:g.37138808G>C PIM1 splicing 37.7 NA 3.26 485 RELYSE_GHE0562_PHR06B030 NA NA
chr6:g.37138928G>A PIM1 nonsynonymous SNV 34.1 0.00 3.70 116 RELYSE_GHE0562
_PHR06B030 NM_001243186:exon4:c.G541A p.V181M
chr6:g.37138950G>A PIM1 nonsynonymous SNV 38.1 0.36 3.20 141 RELYSE_GHE0562
_PHR06B030 NM_001243186:exon4:c.G563A p.S188N
chr6:g.37138419C>T PIM1 nonsynonymous SNV 25.0 0.17 1.58 36 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon1:c.C341T p.T114I
chr6:g.37138769C>T PIM1 nonsynonymous SNV 30.9 1.00 1.50 252 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon3:c.C475T p.H159Y
chr6:g.37138950G>A PIM1 nonsynonymous SNV 34.4 0.36 3.20 162 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon4:c.G563A p.S188N
chr6:g.37139004G>A PIM1 nonsynonymous SNV 33.3 0.15 3.43 152 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon4:c.G617A p.S206N
chr6:g.37139033C>T PIM1 nonsynonymous SNV 33.3 0.12 2.00 152 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon4:c.C646T p.P216S
chr6:g.37139063G>A PIM1 nonsynonymous SNV 26.2 0.01 2.72 299 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon4:c.G676A p.E226K
chr6:g.37139150C>T PIM1 nonsynonymous SNV 27.5 0.01 3.94 356 RELYSE_GHE0659
_PHR39B010 NM_001243186:exon4:c.C763T p.L255F
chr6:g.37139237CTCAAGGACACCGT>- PIM1 frameshift deletion 14.6 NA NA 61 RELYSE_GHE0659
_PHR39B010NM_001243186:exon4:c.850_863del p.284_288del
chr6:g.37138630G>A PIM1 nonsynonymous SNV 83.3 0.01 4.90 35 RELYSE_GHE0685
_PHRC06B021 NM_001243186:exon2:c.G437A p.G146D
chr6:g.37139073C>G PIM1 nonsynonymous SNV 74.2 0.19 2.41 575 RELYSE_GHE0685
_PHRC06B021 NM_001243186:exon4:c.C686G p.A229G
chr6:g.37139180C>G PIM1 nonsynonymous SNV 25.9 0.15 3.14 44 RELYSE_GHE0685
_PHRC06B021 NM_001243186:exon4:c.C793G p.L265V
chr6:g.37139210C>T PIM1 nonsynonymous SNV 33.3 0.00 4.93 74 RELYSE_GHE0685
_PHRC06B021 NM_001243186:exon4:c.C823T p.L275F
chr6:g.37139021G>A PIM1 nonsynonymous SNV 24.4 0.00 5.36 134 RELYSE_GHE0717
_PHR39B016 NM_001243186:exon4:c.G634A p.E212K
chr6:g.37138808G>C PIM1 splicing 27.0 NA 3.26 202 RELYSE_GHE0837_PHR02B005 NA NA
chr6:g.37139063G>A PIM1 nonsynonymous SNV 64.8 0.01 2.72 749 RELYSE_GHE0837
_PHR02B005 NM_001243186:exon4:c.G676A p.E226K
chr6:g.37139204C>T PIM1 nonsynonymous SNV 40.9 0.01 3.73 349 RELYSE_GHE0837
_PHR02B005 NM_001243186:exon4:c.C817T p.L273F
chr6:g.37139258G>A PIM1 nonsynonymous SNV 37.4 0.05 4.74 296 RELYSE_GHE0837
_PHR02B005 NM_001243186:exon4:c.G871A p.D291N
chr6:g.37140918CAGGTTTTCTT>- PIM1 frameshift deletion 37.1 NA NA 482 RELYSE_GHE0846
_PHR06B046NM_001243186:exon5:c.1027_1037del p.343_346del
chr6:g.37138950G>A PIM1 nonsynonymous SNV 50.0 0.36 3.20 213 RELYSE_GHE0873
_PHR01B027 NM_001243186:exon4:c.G563A p.S188N
chr6:g.37138930G>- PIM1 frameshift deletion 18.6 NA NA 31 RELYSE_GHE0955_PHR06B036
NM_001243186:exon4:c.543delG p.V181fs
chr6:g.37139110G>C PIM1 nonsynonymous SNV 16.5 0.00 4.57 89 RELYSE_GHE0955
_PHR06B036 NM_001243186:exon4:c.G723C p.Q241H
chr6:g.37138804G>C PIM1 nonsynonymous SNV 10.4 0.19 1.94 60 RELYSE_GHE0986
_PHR02B048 NM_001243186:exon3:c.G510C p.E170D
chr6:g.37138950G>A PIM1 nonsynonymous SNV 13.0 0.36 3.20 45 RELYSE_GHE0986
_PHR02B048 NM_001243186:exon4:c.G563A p.S188N
chr6:g.37138951C>G PIM1 nonsynonymous SNV 39.3 0.16 1.85 181 RELYSE_GHE0988
_PHR06B086.2 NM_001243186:exon4:c.C564G p.S188R
chr6:g.37138908G>A PIM1 nonsynonymous SNV 77.7 0.12 3.51 980 RELYSE_GHE1189
_PHR07B009.2 NM_001243186:exon4:c.G521A p.G174D
chr6:g.37139097G>A PIM1 nonsynonymous SNV 51.4 0.49 1.57 1849 RELYSE_GHE1189
_PHR07B009.2 NM_001243186:exon4:c.G710A p.S237N
chr6:g.37138653C>G PIM1 nonsynonymous SNV 25.2 0.05 3.53 270 RELYSE_GHE1302
_PHR01B049 NM_001243186:exon2:c.C460G p.P154A
chr6:g.37138656G>A PIM1 splicing 14.0 NA 4.09 109 RELYSE_GHE1302_PHR01B049 NA NA
chr6:g.37138769C>G PIM1 nonsynonymous SNV 17.1 0.11 4.53 203 RELYSE_GHE1302
_PHR01B049 NM_001243186:exon3:c.C475G p.H159D
chr6:g.37138797G>A PIM1 stopgain SNV 11.1 1.00 8.02 65 RELYSE_GHE1302_PHR01B049 NM_001243186:exon3:c.G503A p.W168X
chr6:g.37138901C>G PIM1 nonsynonymous SNV 21.4 NA 1.87 56 RELYSE_GHE1302
_PHR01B049 NM_001243186:exon4:c.C514G p.P172A
chr6:g.37139063G>A PIM1 nonsynonymous SNV 28.1 0.01 2.72 334 RELYSE_GHE1302
_PHR01B049 NM_001243186:exon4:c.G676A p.E226K
chr6:g.37139078C>T PIM1 stopgain SNV 29.0 0.16 6.04 354 RELYSE_GHE1302_PHR01B049 NM_001243186:exon4:c.C691T p.Q231X
chr6:g.37139110GGTGCTGGAGG>- PIM1 frameshift deletion 28.7 NA NA 212 RELYSE_GHE1302
_PHR01B049NM_001243186:exon4:c.723_733del p.241_245del
chr6:g.37139221C>A PIM1 nonsynonymous SNV 27.0 0.00 4.41 139 RELYSE_GHE1302
_PHR01B049 NM_001243186:exon4:c.C834A p.F278L
chr6:g.37140870G>A PIM1 nonsynonymous SNV 22.2 0.00 5.40 282 RELYSE_GHE1302
_PHR01B049 NM_001243186:exon5:c.G979A p.V327M
chr6:g.37138804G>C PIM1 nonsynonymous SNV 12.2 0.19 1.94 77 RELYSE_GHE1311
_PHR02B050 NM_001243186:exon3:c.G510C p.E170D
chr6:g.37139063G>A PIM1 nonsynonymous SNV 30.2 0.01 2.72 361 RELYSE_GHE1369
_PHR07B014 NM_001243186:exon4:c.G676A p.E226K
chr6:g.37139030G>C PIM1 nonsynonymous SNV 41.2 0.37 2.65 187 RELYSE_GHE1424
_PHR06B029 NM_001243186:exon4:c.G643C p.E215Q
chr6:g.37139063G>A PIM1 nonsynonymous SNV 46.7 0.01 2.72 738 RELYSE_GHE1424
_PHR06B029 NM_001243186:exon4:c.G676A p.E226K
chr6:g.37138950G>A PIM1 nonsynonymous SNV 24.0 0.36 3.20 36 RELYSE_GHE1438
_PHR06B103 NM_001243186:exon4:c.G563A p.S188N
chr6:g.37139082AGGAGCTGGCCCGCAGCT>AGGAATTGGCCCGCAGTT
PIM1 nonframeshift substitution 32.5 NA NA 1122 RELYSE_GHE1438
_PHR06B103NM_001243186:exon4:c.695_712AGGAATTGGCCCGCAGTT
chr6:g.37139083GGAGCTGGCCCGCAGCT>- PIM1 frameshift deletion 43.9 NA NA 1122 RELYSE_GHE1438
_PHR06B103NM_001243186:exon4:c.696_712del p.232_238del
chr6:g.37138424C>G PIM1 nonsynonymous SNV 9.1 0.52 1.63 14 RELYSE_GHE1536
_PHR02B030NM_001243186:exon1:c.C346G p.L116V
chr6:g.37139189C>G PIM1 nonsynonymous SNV 34.3 0.04 4.61 281 RELYSE_GHE2017
_PHR05B027NM_001243186:exon4:c.C802G p.L268V
chr6:g.37138976C>T PIM1 nonsynonymous SNV 58.6 0.00 4.25 425 RELYSE_GHE2019
_PHR05B030NM_001243186:exon4:c.C589T p.L197F
chr6:g.37138987G>C PIM1 nonsynonymous SNV 40.7 0.00 3.45 87 RELYSE_GHE2026
_PHR05B022.2NM_001243186:exon4:c.G600C p.W200C
chr6:g.37139063G>A PIM1 nonsynonymous SNV 50.8 0.01 2.72 1285 RELYSE_GHE2026
_PHR05B022.2NM_001243186:exon4:c.G676A p.E226K
chr6:g.37139210C>G PIM1 nonsynonymous SNV 30.4 0.03 4.60 45 RELYSE_GHE2026
_PHR05B022.2NM_001243186:exon4:c.C823G p.L275V
chr6:g.37139268G>A PIM1 splicing 21.7 NA 3.78 28 RELYSE_GHE2026_PHR05B022.2 NA NA
chr6:g.37138951C>G PIM1 nonsynonymous SNV 20.9 0.16 1.85 85 RELYSE_GHE2030
_PHR05B005NM_001243186:exon4:c.C564G p.S188R
chr6:g.37138769C>T PIM1 nonsynonymous SNV 22.7 1.00 1.50 169 RELYSE_GHE2121
_PHR05B003NM_001243186:exon3:c.C475T p.H159Y
chr6:g.37138937C>G PIM1 nonsynonymous SNV 46.3 0.00 3.12 223 RELYSE_GHE2127
_PHR05B010NM_001243186:exon4:c.C550G p.L184V
chr6:g.37138949A>T PIM1 nonsynonymous SNV 49.1 0.09 2.25 240 RELYSE_GHE2127
_PHR05B010NM_001243186:exon4:c.A562T p.S188C
chr6:g.37138953C>T PIM1 nonsynonymous SNV 45.5 0.03 3.67 220 RELYSE_GHE2127
_PHR05B010NM_001243186:exon4:c.C566T p.S189L
chr6:g.37138973A>G PIM1 nonsynonymous SNV 45.5 0.01 2.81 220 RELYSE_GHE2127
_PHR05B010NM_001243186:exon4:c.A586G p.R196G
chr6:g.37139033C>G PIM1 nonsynonymous SNV 46.3 0.10 2.10 223 RELYSE_GHE2127
_PHR05B010NM_001243186:exon4:c.C646G p.P216A
chr6:g.37139150C>T PIM1 nonsynonymous SNV 21.8 0.01 3.94 279 RELYSE_GHE2127
_PHR05B010NM_001243186:exon4:c.C763T p.L255F
chr6:g.37140854C>- PIM1 frameshift deletion 27.8 NA NA 111 RELYSE_GHE2127_PHR05B010
NM_001243186:exon5:c.963delC p.I321fs
chr6:g.106553231C>A PRDM1 nonsynonymous SNV 21.3 0.04 0.98 140 RELYSE_GHE0057
_PHR06B077NM_001198:exon5:c.C1196A p.P399Q
chr6:g.106547325A>G PRDM1 nonsynonymous SNV 47.0 0.00 4.28 671 RELYSE_GHE0061
_PHR06B078NM_001198:exon4:c.A562G p.K188E
chr6:g.106554816A>G PRDM1 nonsynonymous SNV 58.9 0.02 4.08 6427 RELYSE_GHE0169
_PHR01B023NM_001198:exon7:c.A1933G p.N645D
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 27.6 0.09 3.66 331 RELYSE_GHE0262
_PHR06B040.2NM_001198:exon5:c.G1061A p.S354N
chr6:g.106555195G>A PRDM1 nonsynonymous SNV 49.4 0.02 1.28 1534 RELYSE_GHE0292
_PHR01B041NM_001198:exon7:c.G2312A p.G771D
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 32.7 0.09 3.66 519 RELYSE_GHE0395
_PHRC39B003NM_001198:exon5:c.G1061A p.S354N
chr6:g.106536325G>A PRDM1 splicing 83.3 NA 2.24 1160 RELYSE_GHE0454_PHR07B15 NA NA
chr6:g.106554967A>T PRDM1 nonsynonymous SNV 30.1 0.02 1.88 301 RELYSE_GHE0470
_PHR06B005NM_001198:exon7:c.A2084T p.N695I
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 36.0 0.09 3.66 599 RELYSE_GHE0690
_PHR06B057NM_001198:exon5:c.G1061A p.S354N
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 22.7 0.09 3.66 411 RELYSE_GHE0705
_PHR02B034NM_001198:exon5:c.G1061A p.S354N
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 45.1 0.09 3.66 904 RELYSE_GHE0721
_PHR39B015NM_001198:exon5:c.G1061A p.S354N
chr6:g.106543488A>C PRDM1 splicing 38.5 NA 4.01 398 RELYSE_GHE0808_PHR06B053 NA NA
chr6:g.106536281T>G PRDM1 stopgain SNV 38.8 1.00 8.24 431 RELYSE_GHE0809_PHR06B004
NM_001198:exon2:c.T248G p.L83X
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 64.9 0.09 3.66 980 RELYSE_GHE0809
_PHR06B004NM_001198:exon5:c.G1061A p.S354N
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 45.8 0.09 3.66 1535 RELYSE_GHE0855
_PHR06B049NM_001198:exon5:c.G1061A p.S354N
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 50.7 0.09 3.66 1544 RELYSE_GHE0925
_PHR06B067NM_001198:exon5:c.G1061A p.S354N
chr6:g.106553096G>A PRDM1 nonsynonymous SNV 56.0 0.09 3.66 855 RELYSE_GHE1369
_PHR07B014NM_001198:exon5:c.G1061A p.S354N
chr6:g.106554273C>G PRDM1 nonsynonymous SNV 48.6 0.00 4.08 1223 RELYSE_GHE1369
_PHR07B014NM_001198:exon6:c.C1801G p.R601G
chr6:g.106536324G>C PRDM1 nonsynonymous SNV 61.5 0.14 2.80 824 RELYSE_GHE1413
_PHR06B081NM_001198:exon2:c.G291C p.E97D
chr6:g.106536121G>A PRDM1 nonsynonymous SNV 27.1 0.19 1.86 955 RELYSE_GHE2026
_PHR05B022.2NM_001198:exon2:c.G88A p.A30T
chr6:g.106536284C>G PRDM1 nonsynonymous SNV 30.7 0.00 4.01 663 RELYSE_GHE2026
_PHR05B022.2NM_001198:exon2:c.C251G p.P84R
chr6:g.106536300C>G PRDM1 nonsynonymous SNV 26.4 0.64 2.77 521 RELYSE_GHE2026
_PHR05B022.2NM_001198:exon2:c.C267G p.F89L
chr6:g.106553202C>A PRDM1 stopgain SNV 53.2 1.00 5.28 1414 RELYSE_GHE2026_PHR05B022.2
NM_001198:exon5:c.C1167A p.Y389X
chr6:g.106552770->A PRDM1 frameshift insertion 31.2 NA NA 341 RELYSE_GHE2121
_PHR05B003NM_001198:exon5:c.736dupA p.K245fs
chr16:g.11348946AAAGTGCACGCGGAT>- SOCS1 nonframeshift
deletion 36.6 NA NA 511 RELYSE_GHE0002_PHR03B014
NM_003745:exon2:c.376_390del p.126_130del
chr16:g.11348989C>T SOCS1 nonsynonymous SNV 13.1 0.00 3.99 241 RELYSE_GHE0024
_PHR02B062NM_003745:exon2:c.G347A p.S116N
chr16:g.11349146A>G SOCS1 nonsynonymous SNV 24.2 0.34 3.72 52 RELYSE_GHE0047
_PHR39B020NM_003745:exon2:c.T190C p.Y64H
chr16:g.11348888G>C SOCS1 nonsynonymous SNV 20.1 0.00 3.28 253 RELYSE_GHE0197
_PHR02B075NM_003745:exon2:c.C448G p.L150V
chr16:g.11348960T>A SOCS1 nonsynonymous SNV 23.5 0.01 2.76 332 RELYSE_GHE0197
_PHR02B075NM_003745:exon2:c.A376T p.I126F
chr16:g.11349286G>A SOCS1 nonsynonymous SNV 33.3 0.23 2.41 16 RELYSE_GHE0197
_PHR02B075NM_003745:exon2:c.C50T p.A17V
chr16:g.11349301G>A SOCS1 nonsynonymous SNV 33.3 0.11 3.19 16 RELYSE_GHE0197
_PHR02B075NM_003745:exon2:c.C35T p.A12V
chr16:g.11349310G>C SOCS1 nonsynonymous SNV 33.3 0.87 3.40 16 RELYSE_GHE0197
_PHR02B075NM_003745:exon2:c.C26G p.A9G
chr16:g.11349314C>G SOCS1 nonsynonymous SNV 33.3 0.27 2.63 16 RELYSE_GHE0197
_PHR02B075NM_003745:exon2:c.G22C p.A8P
chr16:g.11349139C>T SOCS1 nonsynonymous SNV 10.8 0.16 3.23 33 RELYSE_GHE0202
_PHR02B85NM_003745:exon2:c.G197A p.R66H
chr16:g.11348965G>A SOCS1 nonsynonymous SNV 20.0 0.10 2.35 203 RELYSE_GHE0219
_PHR03B037NM_003745:exon2:c.C371T p.T124M
chr16:g.11348989C>T SOCS1 nonsynonymous SNV 20.9 0.00 3.99 253 RELYSE_GHE0219
_PHR03B037NM_003745:exon2:c.G347A p.S116N
chr16:g.11348972C>T SOCS1 nonsynonymous SNV 46.9 0.59 3.51 586 RELYSE_GHE0228
_PHR39B022NM_003745:exon2:c.G364A p.G122R
chr16:g.11349037G>A SOCS1 nonsynonymous SNV 54.0 0.00 4.45 299 RELYSE_GHE0228
_PHR39B022NM_003745:exon2:c.C299T p.T100I
chr16:g.11349147A>T SOCS1 nonsynonymous SNV 31.0 0.27 2.76 63 RELYSE_GHE0228
_PHR39B022NM_003745:exon2:c.T189A p.D63E
chr16:g.11349310G>A SOCS1 nonsynonymous SNV 30.6 0.10 4.50 83 RELYSE_GHE0229
_PHR39B007NM_003745:exon2:c.C26T p.A9V
chr16:g.11348875T>G SOCS1 nonsynonymous SNV 44.0 0.18 4.69 88 RELYSE_GHE0293
_PHR02B042NM_003745:exon2:c.A461C p.Y154S
chr16:g.11349144G>T SOCS1 stopgain SNV 21.7 1.00 5.98 28 RELYSE_GHE0293_PHR02B042
NM_003745:exon2:c.C192A p.Y64X
chr16:g.11348915GGCTGCCATCCA>- SOCS1 nonframeshift
deletion 40.8 NA NA 686 RELYSE_GHE0368_PHR02B054.2
NM_003745:exon2:c.410_421del p.137_141del
chr16:g.11348928G>C SOCS1 nonsynonymous SNV 40.3 0.04 2.39 1056 RELYSE_GHE0368
_PHR02B054.2NM_003745:exon2:c.C408G p.H136Q
chr16:g.11349029C>A SOCS1 nonsynonymous SNV 17.2 0.46 2.82 90 RELYSE_GHE0371
_PHR02B84NM_003745:exon2:c.G307T p.V103L
chr16:g.11349037G>C SOCS1 nonsynonymous SNV 17.2 0.46 3.60 90 RELYSE_GHE0371
_PHR02B84NM_003745:exon2:c.C299G p.T100S
chr16:g.11349103C>T SOCS1 nonsynonymous SNV 52.0 0.00 3.83 114 RELYSE_GHE0371
_PHR02B84NM_003745:exon2:c.G233A p.G78E
chr16:g.11349155G>A SOCS1 nonsynonymous SNV 65.2 0.02 2.98 354 RELYSE_GHE0371
_PHR02B84NM_003745:exon2:c.C181T p.H61Y
chr16:g.11349162G>C SOCS1 nonsynonymous SNV 63.6 0.46 4.05 328 RELYSE_GHE0371
_PHR02B84NM_003745:exon2:c.C174G p.F58L
chr16:g.11348800C>T SOCS1 nonsynonymous SNV 12.5 0.00 4.86 43 RELYSE_GHE0491
_PHR02B025NM_003745:exon2:c.G536A p.R179H
chr16:g.11349059G>T SOCS1 nonsynonymous SNV 37.7 0.00 4.17 212 RELYSE_GHE0491
_PHR02B025NM_003745:exon2:c.C277A p.L93M
chr16:g.11349260A>G SOCS1 nonsynonymous SNV 38.2 0.32 2.29 107 RELYSE_GHE0491
_PHR02B025NM_003745:exon2:c.T76C p.S26P
chr16:g.11349281G>A SOCS1 nonsynonymous SNV 19.0 0.41 1.82 67 RELYSE_GHE0507
_PHRC01B020NM_003745:exon2:c.C55T p.P19S
chr16:g.11348888G>C SOCS1 nonsynonymous SNV 33.3 0.00 3.28 637 RELYSE_GHE0624
_PHR39B005NM_003745:exon2:c.C448G p.L150V
chr16:g.11349277CGGGGCTCTGCTGC>- SOCS1 frameshift deletion 70.3 NA NA 305 RELYSE_GHE0635
_PHR01B032NM_003745:exon2:c.46_59del p.16_20del
chr16:g.11349011G>C SOCS1 nonsynonymous SNV 20.5 0.19 2.22 59 RELYSE_GHE0645
_PHR02B008NM_003745:exon2:c.C325G p.R109G
chr16:g.11349035A>C SOCS1 nonsynonymous SNV 15.9 0.00 4.85 41 RELYSE_GHE0645
_PHR02B008NM_003745:exon2:c.T301G p.F101V
chr16:g.11349289G>A SOCS1 nonsynonymous SNV 37.5 0.25 2.46 129 RELYSE_GHE0645
_PHR02B008NM_003745:exon2:c.C47T p.A16V
chr16:g.11349290C>T SOCS1 nonsynonymous SNV 15.0 0.60 1.71 33 RELYSE_GHE0645
_PHR02B008NM_003745:exon2:c.G46A p.A16T
chr16:g.11349310G>C SOCS1 nonsynonymous SNV 42.9 0.87 3.40 142 RELYSE_GHE0645
_PHR02B008NM_003745:exon2:c.C26G p.A9G
chr16:g.11348951GCACGCGGATGCTCGTG>- SOCS1 frameshift deletion 32.2 NA NA 502 RELYSE_GHE0705
_PHR02B034NM_003745:exon2:c.369_385del p.123_129del
chr16:g.11349085AGGGGCCCCCAGT>- SOCS1 frameshift deletion 47.8 NA NA 152 RELYSE_GHE0705
_PHR02B034NM_003745:exon2:c.239_251del p.80_84del
chr16:g.11349104C>A SOCS1 stopgain SNV 45.8 0.00 6.05 89 RELYSE_GHE0705_PHR02B034
NM_003745:exon2:c.G232T p.G78X
chr16:g.11348875T>A SOCS1 nonsynonymous SNV 50.0 0.02 5.05 244 RELYSE_GHE0733
_PHR06B054NM_003745:exon2:c.A461T p.Y154F
chr16:g.11349094C>G SOCS1 nonsynonymous SNV 57.6 0.00 4.66 193 RELYSE_GHE0733
_PHR06B054NM_003745:exon2:c.G242C p.W81S
chr16:g.11349148T>G SOCS1 nonsynonymous SNV 62.3 0.01 3.34 460 RELYSE_GHE0733
_PHR06B054NM_003745:exon2:c.A188C p.D63A
chr16:g.11349167T>A SOCS1 nonsynonymous SNV 61.8 0.61 2.49 446 RELYSE_GHE0733
_PHR06B054NM_003745:exon2:c.A169T p.T57S
chr16:g.11349162G>C SOCS1 nonsynonymous SNV 31.1 0.46 4.05 114 RELYSE_GHE0807
_PHR06B001NM_003745:exon2:c.C174G p.F58L
chr16:g.11349146A>T SOCS1 nonsynonymous SNV 45.5 0.19 3.67 78 RELYSE_GHE0908
_PHR03B035NM_003745:exon2:c.T190A p.Y64N
chr16:g.11348813G>A SOCS1 stopgain SNV 27.4 0.02 6.40 117 RELYSE_GHE0976_PHR01B035
NM_003745:exon2:c.C523T p.Q175X
chr16:g.11348907G>C SOCS1 nonsynonymous SNV 5.7 0.34 2.57 30 RELYSE_GHE0982
_PHR02B043NM_003745:exon2:c.C429G p.S143R
chr16:g.11349006G>C SOCS1 nonsynonymous SNV 21.6 0.47 3.11 152 RELYSE_GHE0982
_PHR02B043NM_003745:exon2:c.C330G p.N110K
chr16:g.11349141C>- SOCS1 frameshift deletion 48.4 NA NA 104 RELYSE_GHE1018_PHR02B072
NM_003745:exon2:c.195delG p.R65fs
chr16:g.11349287C>T SOCS1 nonsynonymous SNV 38.5 0.34 2.27 30 RELYSE_GHE1028
_PHR06B017NM_003745:exon2:c.G49A p.A17T
chr16:g.11349146A>T SOCS1 nonsynonymous SNV 31.6 0.19 3.67 37 RELYSE_GHE1066
_PHR06B059NM_003745:exon2:c.T190A p.Y64N
chr16:g.11349003G>C SOCS1 nonsynonymous SNV 41.2 0.02 2.46 239 RELYSE_GHE1099
_PHR02B057NM_003745:exon2:c.C333G p.C111W
chr16:g.11349139C>G SOCS1 nonsynonymous SNV 100.0 0.28 2.53 160 RELYSE_GHE1104
_PHR03B036NM_003745:exon2:c.G197C p.R66P
chr16:g.11348807G>C SOCS1 nonsynonymous SNV 40.0 0.00 4.07 257 RELYSE_GHE1287
_PHR03B027NM_003745:exon2:c.C529G p.L177V
chr16:g.11348988G>T SOCS1 nonsynonymous SNV 42.9 0.00 3.41 812 RELYSE_GHE1287
_PHR03B027NM_003745:exon2:c.C348A p.S116R
chr16:g.11349144G>T SOCS1 stopgain SNV 33.3 1.00 5.98 46 RELYSE_GHE1287_PHR03B027
NM_003745:exon2:c.C192A p.Y64X
chr16:g.11349158A>C SOCS1 nonsynonymous SNV 52.2 0.53 3.01 103 RELYSE_GHE1287
_PHR03B027NM_003745:exon2:c.T178G p.S60A
chr16:g.11348812T>A SOCS1 nonsynonymous SNV 37.5 0.00 4.66 169 RELYSE_GHE1376
_PHR03B002NM_003745:exon2:c.A524T p.Q175L
chr16:g.11349076T>C SOCS1 nonsynonymous SNV 46.4 0.36 2.65 291 RELYSE_GHE1376
_PHR03B002NM_003745:exon2:c.A260G p.H87R
chr16:g.11349176G>T SOCS1 nonsynonymous SNV 42.3 0.29 3.72 87 RELYSE_GHE1376
_PHR03B002NM_003745:exon2:c.C160A p.H54N
chr16:g.11349241G>T SOCS1 stopgain SNV 31.6 0.85 4.93 93 RELYSE_GHE1376_PHR03B002
NM_003745:exon2:c.C95A p.S32X
chr16:g.11348853C>T SOCS1 nonsynonymous SNV 53.8 0.08 1.88 270 RELYSE_GHE2002
_PHR05B029NM_003745:exon2:c.G483A p.M161I
chr16:g.11349289GCTG>- SOCS1 frameshift deletion 29.7 NA NA 79 RELYSE_GHE2026
_PHR05B022.2NM_003745:exon2:c.44_47del p.15_16del
chr16:g.11348956C>G SOCS1 nonsynonymous SNV 8.1 0.00 3.98 71 RELYSE_GHE2030
_PHR05B005NM_003745:exon2:c.G380C p.R127P
chr12:g.57496654A>T STAT6 nonsynonymous SNV 28.2 0.00 4.18 487 RELYSE_GHE0002
_PHR03B014NM_001178078:exon12:c.T1263A p.N421K
chr12:g.57496668T>A STAT6 nonsynonymous SNV 27.8 0.00 4.69 469 RELYSE_GHE0002
_PHR03B014NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496661T>C STAT6 nonsynonymous SNV 15.8 0.00 4.84 177 RELYSE_GHE0052
_PHR06B074NM_001178078:exon12:c.A1256G p.D419G
chr12:g.57498344T>G STAT6 nonsynonymous SNV 42.6 0.00 4.97 984 RELYSE_GHE0092
_PHR02B009NM_001178078:exon11:c.A1115C p.E372A
chr12:g.57496667T>C STAT6 nonsynonymous SNV 28.1 0.43 2.77 516 RELYSE_GHE0114
_PHR39B001NM_001178078:exon12:c.A1250G p.N417S
chr12:g.57493830T>C STAT6 nonsynonymous SNV 19.8 0.19 2.46 189 RELYSE_GHE0176
_PHR01B022NM_001178078:exon14:c.A1556G p.D519G
chr12:g.57498330C>T STAT6 nonsynonymous SNV 17.6 0.01 5.49 391 RELYSE_GHE0202
_PHR02B85NM_001178078:exon11:c.G1129A p.E377K
chr12:g.57496255C>T STAT6 nonsynonymous SNV 19.7 0.00 5.69 83 RELYSE_GHE0219
_PHR03B037NM_001178078:exon13:c.G1330A p.E444K
chr12:g.57496668T>A STAT6 nonsynonymous SNV 16.4 0.00 4.69 121 RELYSE_GHE0219
_PHR03B037NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496662C>G STAT6 nonsynonymous SNV 28.4 0.00 4.90 480 RELYSE_GHE0228
_PHR39B022NM_001178078:exon12:c.G1255C p.D419H
chr12:g.57496668T>A STAT6 nonsynonymous SNV 28.4 0.00 4.69 480 RELYSE_GHE0228
_PHR39B022NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496668T>A STAT6 nonsynonymous SNV 7.6 0.00 4.69 65 RELYSE_GHE0293
_PHR02B042NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496255C>T STAT6 nonsynonymous SNV 28.4 0.00 5.69 452 RELYSE_GHE0368
_PHR02B054.2NM_001178078:exon13:c.G1330A p.E444K
chr12:g.57496668T>A STAT6 nonsynonymous SNV 47.6 0.00 4.69 2026 RELYSE_GHE0368
_PHR02B054.2NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496671C>G STAT6 nonsynonymous SNV 55.3 0.00 5.08 1939 RELYSE_GHE0423
_PHR06B045NM_001178078:exon12:c.G1246C p.G416R
chr12:g.57496655T>C STAT6 nonsynonymous SNV 50.0 0.01 4.77 1032 RELYSE_GHE0536
_PHR02B069NM_001178078:exon12:c.A1262G p.N421S
chr12:g.57496657G>T STAT6 nonsynonymous SNV 17.2 0.08 3.91 187 RELYSE_GHE0536
_PHR02B069NM_001178078:exon12:c.C1260A p.N420K
chr12:g.57496668T>A STAT6 nonsynonymous SNV 50.0 0.00 4.69 1032 RELYSE_GHE0536
_PHR02B069NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57493818T>C STAT6 nonsynonymous SNV 12.3 0.00 4.53 106 RELYSE_GHE0604
_PHR01B015NM_001178078:exon14:c.A1568G p.D523G
chr12:g.57498589T>G STAT6 nonsynonymous SNV 25.6 0.01 2.75 227 RELYSE_GHE0609
_PHR02B014NM_001178078:exon10:c.A1009C p.T337P
chr12:g.57493839T>C STAT6 nonsynonymous SNV 64.7 0.04 4.69 1442 RELYSE_GHE0624
_PHR39B005NM_001178078:exon14:c.A1547G p.Q516R
chr12:g.57493831C>T STAT6 nonsynonymous SNV 54.0 0.37 2.17 1773 RELYSE_GHE0635
_PHR01B032NM_001178078:exon14:c.G1555A p.D519N
chr12:g.57496255C>T STAT6 nonsynonymous SNV 25.5 0.00 5.69 90 RELYSE_GHE0708
_PHR02B082NM_001178078:exon13:c.G1330A p.E444K
chr12:g.57498345C>T STAT6 nonsynonymous SNV 20.9 0.00 5.78 196 RELYSE_GHE0708
_PHR02B082NM_001178078:exon11:c.G1114A p.E372K
chr12:g.57498330C>G STAT6 nonsynonymous SNV 18.9 0.00 4.96 433 RELYSE_GHE0976
_PHR01B035NM_001178078:exon11:c.G1129C p.E377Q
chr12:g.57496662C>A STAT6 nonsynonymous SNV 67.5 0.00 4.84 2313 RELYSE_GHE1104
_PHR03B036NM_001178078:exon12:c.G1255T p.D419Y
chr12:g.57496668T>A STAT6 nonsynonymous SNV 68.1 0.00 4.69 2328 RELYSE_GHE1104
_PHR03B036NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496661T>A STAT6 nonsynonymous SNV 59.8 0.00 4.72 1740 RELYSE_GHE1376
_PHR03B002NM_001178078:exon12:c.A1256T p.D419V
chr12:g.57496668T>A STAT6 nonsynonymous SNV 59.9 0.00 4.69 1763 RELYSE_GHE1376
_PHR03B002NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57493819C>T STAT6 nonsynonymous SNV 73.3 0.01 5.23 2368 RELYSE_GHE1393
_PHR03B023NM_001178078:exon14:c.G1567A p.D523N
chr12:g.57496661T>G STAT6 nonsynonymous SNV 13.3 0.00 4.76 111 RELYSE_GHE1450
_PHR02B044NM_001178078:exon12:c.A1256C p.D419A
chr12:g.57498330C>T STAT6 nonsynonymous SNV 41.8 0.01 5.49 1130 RELYSE_GHE1537
_PHR01B018NM_001178078:exon11:c.G1129A p.E377K
chr12:g.57496668T>A STAT6 nonsynonymous SNV 17.4 0.00 4.69 371 RELYSE_GHE1554
_PHR02B045NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57496670C>A STAT6 nonsynonymous SNV 17.4 0.00 4.91 372 RELYSE_GHE1554
_PHR02B045NM_001178078:exon12:c.G1247T p.G416V
chr12:g.57496654A>C STAT6 nonsynonymous SNV 6.5 0.00 4.08 28 RELYSE_GHE1558
_PHR02B017NM_001178078:exon12:c.T1263G p.N421K
chr12:g.57496668T>A STAT6 nonsynonymous SNV 6.5 0.00 4.69 28 RELYSE_GHE1558
_PHR02B017NM_001178078:exon12:c.A1249T p.N417Y
chr12:g.57498315C>T STAT6 nonsynonymous SNV 32.7 0.03 5.40 706 RELYSE_GHE2023
_PHR05B032NM_001178078:exon11:c.G1144A p.E382K
chr12:g.57496662C>T STAT6 nonsynonymous SNV 42.8 0.00 5.57 584 RELYSE_GHE2106
_PHR05B018NM_001178078:exon12:c.G1255A p.D419N
chr19:g.1612366A>T TCF3 nonsynonymous SNV 8.2 0.00 4.18 45 RELYSE_GHE0519
_PHRC03B020NM_001136139:exon17:c.T1653A p.N551K
chr19:g.1612366A>T TCF3 nonsynonymous SNV 12.6 0.00 4.18 156 RELYSE_GHE2096
_PHR05B016NM_001136139:exon17:c.T1653A p.N551K
chr19:g.1612366A>T TCF3 nonsynonymous SNV 16.0 0.00 4.18 193 RELYSE_GHE2119
_PHR05B001NM_001136139:exon17:c.T1653A p.N551K
chr6:g.138198372CTCAT>- TNFAIP3 frameshift deletion 16.8 NA NA 195 RELYSE_GHE0016
_PHR01B046NM_001270507:exon6:c.965_969del p.322_323del
chr6:g.138201339G>T TNFAIP3 stopgain SNV 21.0 0.53 7.74 156 RELYSE_GHE0028_PHR02B063
NM_001270507:exon8:c.G2038T p.E680X
chr6:g.138198322->TACT TNFAIP3 frameshift insertion 10.7 NA NA 63 RELYSE_GHE0052
_PHR06B074NM_001270507:exon6:c.915_916insTACT p.E305fs
chr6:g.138202199C>T TNFAIP3 stopgain SNV 22.6 0.96 7.69 215 RELYSE_GHE0114_PHR39B001
NM_001270507:exon9:c.C2116T p.R706X
chr6:g.138197226G>A TNFAIP3 nonsynonymous SNV 9.9 0.00 3.78 59 RELYSE_GHE0202
_PHR02B85NM_001270507:exon5:c.G728A p.C243Y
chr6:g.138199586->A TNFAIP3 frameshift insertion 37.0 NA NA 255 RELYSE_GHE0228
_PHR39B022NM_001270507:exon7:c.1005dupA p.L335fs
chr6:g.138199825CAAAA>- TNFAIP3 frameshift deletion 78.1 NA NA 707 RELYSE_GHE0236
_PHR06B043NM_001270507:exon7:c.1243_1247del p.415_416del
chr6:g.138199720C>T TNFAIP3 nonsynonymous SNV 13.3 0.07 3.29 357 RELYSE_GHE0293
_PHR02B042NM_001270507:exon7:c.C1138T p.L380F
chr6:g.138198257G>T TNFAIP3 stopgain SNV 23.2 0.07 7.25 524 RELYSE_GHE0356_PHR01B011
NM_001270507:exon6:c.G850T p.E284X
chr6:g.138192601C>- TNFAIP3 frameshift deletion 47.0 NA NA 515 RELYSE_GHE0368_PHR02B054.2
NM_001270507:exon2:c.237delC p.S79fs
chr6:g.138201240A>C TNFAIP3 nonsynonymous SNV 48.1 0.20 2.21 2354 RELYSE_GHE0414
_PHRC06B012NM_001270507:exon8:c.A1939C p.T647P
chr6:g.138202418T>C TNFAIP3 nonsynonymous SNV 44.1 0.00 4.55 225 RELYSE_GHE0427
_PHR06B96NM_001270507:exon9:c.T2335C p.C779R
chr6:g.138198218C>T TNFAIP3 stopgain SNV 48.1 1.00 6.29 713 RELYSE_GHE0436_PHR06B95
NM_001270507:exon6:c.C811T p.R271X
chr6:g.138198316AA>- TNFAIP3 frameshift deletion 41.2 NA NA 537 RELYSE_GHE0491_PHR02B025
NM_001270507:exon6:c.909_910del p.303_304del
chr6:g.138196134C>T TNFAIP3 stopgain SNV 36.4 0.06 6.10 773 RELYSE_GHE0535_PHR02B68
NM_001270507:exon3:c.C448T p.Q150X
chr6:g.138199805->A TNFAIP3 frameshift insertion 75.6 NA NA 2721 RELYSE_GHE0547
_PHR02B066NM_001270507:exon7:c.1224dupA p.S408fs
chr6:g.138195981G>A TNFAIP3 splicing 20.1 NA 4.52 260 RELYSE_GHE0609_PHR02B014 NA NA
chr6:g.138200459TG>- TNFAIP3 frameshift deletion 19.2 NA NA 225 RELYSE_GHE0609_PHR02B014
NM_001270507:exon7:c.1877_1878del p.626_626del
chr6:g.138196001G>A TNFAIP3 nonsynonymous SNV 22.8 0.03 4.11 343 RELYSE_GHE0645
_PHR02B008NM_001270507:exon3:c.G315A p.M105I
chr6:g.138197226G>A TNFAIP3 nonsynonymous SNV 17.6 0.00 3.78 200 RELYSE_GHE0645
_PHR02B008NM_001270507:exon5:c.G728A p.C243Y
chr6:g.138198323T>G TNFAIP3 nonsynonymous SNV 46.2 0.00 3.97 736 RELYSE_GHE0705
_PHR02B034NM_001270507:exon6:c.T916G p.Y306D
chr6:g.138199690C>T TNFAIP3 stopgain SNV 67.7 0.07 2.51 1317 RELYSE_GHE0708_PHR02B082
NM_001270507:exon7:c.C1108T p.Q370X
chr6:g.138198231T>C TNFAIP3 nonsynonymous SNV 18.0 0.00 4.41 180 RELYSE_GHE0721
_PHR39B015NM_001270507:exon6:c.T824C p.L275P
chr6:g.138201240A>C TNFAIP3 nonsynonymous SNV 49.1 0.20 2.21 1566 RELYSE_GHE0743
_PHR06B092NM_001270507:exon8:c.A1939C p.T647P
chr6:g.138196002C>T TNFAIP3 nonsynonymous SNV 35.0 0.00 5.01 1330 RELYSE_GHE0908
_PHR03B035NM_001270507:exon3:c.C316T p.H106Y
chr6:g.138197195T>A TNFAIP3 nonsynonymous SNV 37.8 0.00 4.91 978 RELYSE_GHE0908
_PHR03B035NM_001270507:exon5:c.T697A p.Y233N
chr6:g.138198327T>G TNFAIP3 stopgain SNV 15.6 1.00 6.75 150 RELYSE_GHE0986_PHR02B048
NM_001270507:exon6:c.T920G p.L307X
chr6:g.138192626G>T TNFAIP3 stopgain SNV 77.2 0.10 5.41 1966 RELYSE_GHE0992_PHR06B084
NM_001270507:exon2:c.G262T p.E88X
chr6:g.138199944->G TNFAIP3 frameshift insertion 29.8 NA NA 262 RELYSE_GHE1209
_PHR06B072NM_001270507:exon7:c.1363dupG p.T454fs
chr6:g.138192660G>A TNFAIP3 splicing 34.5 NA 3.30 298 RELYSE_GHE1287_PHR03B027 NA NA
chr6:g.138196160C>A TNFAIP3 stopgain SNV 43.9 0.03 4.78 701 RELYSE_GHE1287_PHR03B027
NM_001270507:exon3:c.C474A p.C158X
chr6:g.138198345C>G TNFAIP3 nonsynonymous SNV 22.6 0.00 4.61 613 RELYSE_GHE1302
_PHR01B049NM_001270507:exon6:c.C938G p.P313R
chr6:g.138199944->G TNFAIP3 frameshift insertion 25.7 NA NA 282 RELYSE_GHE1349
_PHR02B086NM_001270507:exon7:c.1363dupG p.T454fs
chr6:g.138196174T>A TNFAIP3 splicing 40.2 NA 4.42 425 RELYSE_GHE1376_PHR03B002 NA NA
chr6:g.138197199T>G TNFAIP3 nonsynonymous SNV 35.8 0.00 4.84 690 RELYSE_GHE1376
_PHR03B002NM_001270507:exon5:c.T701G p.L234W
chr6:g.138200489G>A TNFAIP3 splicing 46.7 NA 4.38 326 RELYSE_GHE1380_PHR06B007 NA NA
chr6:g.138195986C>- TNFAIP3 frameshift deletion 13.3 NA NA 149 RELYSE_GHE1390_PHR03B022
NM_001270507:exon3:c.300delC p.D100fs
chr6:g.138200340CCCT>- TNFAIP3 frameshift deletion 68.8 NA NA 1256 RELYSE_GHE1521_PHR03B034
NM_001270507:exon7:c.1758_1761del p.586_587del
chr6:g.138197296->G TNFAIP3 frameshift insertion 12.0 NA NA 46 RELYSE_GHE1554
_PHR02B045NM_001270507:exon5:c.799dupG p.S266fs
chr6:g.138196835ATGA>- TNFAIP3 frameshift deletion 54.2 NA NA 1014 RELYSE_GHE1560
_PHR07B002NM_001270507:exon4:c.497_500del p.166_167del
chr6:g.138192455A>T TNFAIP3 stopgain SNV 44.3 1.00 4.67 1017 RELYSE_GHE2037_PHR05B009
NM_001270507:exon2:c.A91T p.K31X
chr6:g.138196122TC>- TNFAIP3 frameshift deletion 15.7 NA NA 158 RELYSE_GHE2109_PHR05B025
NM_001270507:exon3:c.436_437del p.146_146del
chr1:g.2489827G>A TNFRSF14 nonsynonymous SNV 29.3 0.00 2.68 373 RELYSE_GHE0004
_PHR06B022NM_003820:exon3:c.G224A p.C75Y
chr1:g.2492097C>A TNFRSF14 stopgain SNV 48.8 1.00 4.88 1449 RELYSE_GHE0015_PHR01B045
NM_003820:exon5:c.C495A p.C165X
chr1:g.2492074C>T TNFRSF14 stopgain SNV 31.5 0.89 3.13 173 RELYSE_GHE0047_PHR39B020
NM_003820:exon5:c.C472T p.Q158X
chr1:g.2489881G>A TNFRSF14 nonsynonymous SNV 23.4 0.00 2.14 166 RELYSE_GHE0052
_PHR06B074NM_003820:exon3:c.G278A p.C93Y
chr1:g.2489273G>C TNFRSF14 nonsynonymous SNV 12.3 0.00 -0.55 83 RELYSE_GHE0202
_PHR02B85NM_003820:exon2:c.G178C p.G60R
chr1:g.2493158C>T TNFRSF14 nonsynonymous SNV 46.4 0.03 0.55 111 RELYSE_GHE0219
_PHR03B037NM_003820:exon6:c.C598T p.H200Y
chr1:g.2489846C>- TNFRSF14 frameshift deletion 26.2 NA NA 547 RELYSE_GHE0229_PHR39B007
NM_003820:exon3:c.243delC p.G81fs
chr1:g.2491312T>G TNFRSF14 nonsynonymous SNV 30.1 0.00 1.53 301 RELYSE_GHE0292
_PHR01B041NM_003820:exon4:c.T355G p.C119G
chr1:g.2488174T>A TNFRSF14 splicing 27.9 NA 1.54 324 RELYSE_GHE0426_PHR06B98 NA NA
chr1:g.2493180C>A TNFRSF14 stopgain SNV 72.7 1.00 3.47 556 RELYSE_GHE0440_PHR06B97
NM_003820:exon6:c.C620A p.S207X
chr1:g.2488139G>A TNFRSF14 stopgain SNV 26.4 1.00 4.77 102 RELYSE_GHE0469_PHR06B006
NM_003820:exon1:c.G36A p.W12X
chr1:g.2489782G>A TNFRSF14 nonsynonymous SNV 26.1 NA 3.71 421 RELYSE_GHE0469
_PHR06B006NM_003820:exon3:c.G179A p.G60D
chr1:g.2491319G>A TNFRSF14 nonsynonymous SNV 65.7 0.04 1.36 2326 RELYSE_GHE0622
_PHRC03B016NM_003820:exon4:c.G362A p.C121Y
chr1:g.2489256G>A TNFRSF14 nonsynonymous SNV 89.0 0.01 1.64 4737 RELYSE_GHE0689
_PHR06B056NM_003820:exon2:c.G161A p.C54Y
chr1:g.2488105T>G TNFRSF14 nonsynonymous SNV 86.2 0.00 2.27 631 RELYSE_GHE0777
_PHR02B036NM_003820:exon1:c.T2G p.M1R
chr1:g.2493194A>T TNFRSF14 nonsynonymous SNV 56.2 0.03 0.51 897 RELYSE_GHE0908
_PHR03B035NM_003820:exon6:c.A634T p.I212F
chr1:g.2492096->C TNFRSF14 frameshift insertion 56.3 NA NA 259 RELYSE_GHE0909
_PHR03B007NM_003820:exon5:c.495dupC p.C165fs
chr1:g.2488152AA>AG TNFRSF14 nonframeshift substitution 12.5 NA NA 4624 RELYSE_GHE0997
_PHR07B012NM_003820:exon1:c.49_50AG
chr1:g.2488152AA>CG TNFRSF14 nonframeshift substitution 12.5 NA NA 4624 RELYSE_GHE0997
_PHR07B012NM_003820:exon1:c.49_50CG
chr1:g.2488173G>C TNFRSF14 splicing 12.3 NA 1.67 152 RELYSE_GHE0997_PHR07B012 NA NA
chr1:g.2491337G>A TNFRSF14 nonsynonymous SNV 17.1 0.00 2.32 77 RELYSE_GHE1450
_PHR02B044NM_003820:exon4:c.G380A p.C127Y
chr1:g.2494645C>T TNFRSF14 nonsynonymous SNV 47.1 0.00 2.42 1417 RELYSE_GHE1536
_PHR02B030NM_003820:exon8:c.C785T p.P262L
chr1:g.2489232A>T TNFRSF14 nonsynonymous SNV 60.7 0.00 1.94 1711 RELYSE_GHE1553
_PHR02B046NM_003820:exon2:c.A137T p.E46V
chr1:g.2489907G>- TNFRSF14 frameshift deletion 10.2 NA NA 23 RELYSE_GHE1554_PHR02B045
NM_003820:exon3:c.304delG p.A102fs
chr1:g.2493158C>T TNFRSF14 nonsynonymous SNV 42.9 0.03 0.55 67 RELYSE_GHE2030
_PHR05B005NM_003820:exon6:c.C598T p.H200Y
chr1:g.2488104A>G TNFRSF14 nonsynonymous SNV 20.2 0.00 2.73 103 RELYSE_GHE2096
_PHR05B016NM_003820:exon1:c.A1G p.M1V
chr1:g.2488105T>A TNFRSF14 nonsynonymous SNV 9.5 0.00 2.57 32 RELYSE_GHE2096
_PHR05B016NM_003820:exon1:c.T2A p.M1K
chr1:g.2489827G>A TNFRSF14 nonsynonymous SNV 44.0 0.00 2.68 1854 RELYSE_GHE2098
_PHR05B031NM_003820:exon3:c.G224A p.C75Y
chr17:g.7577094G>A TP53 nonsynonymous SNV 51.7 0.00 4.06 292 RELYSE_GHE0050
_PHR06B073NM_000546:exon8:c.C844T p.R282W
chr17:g.7578217GT>- TP53 frameshift deletion 37.3 NA NA 177 RELYSE_GHE0134_PHR06B019
NM_000546:exon6:c.631_632del p.211_211del
chr17:g.7578503C>A TP53 nonsynonymous SNV 24.6 0.07 2.39 221 RELYSE_GHE0197
_PHR02B075NM_000546:exon5:c.G427T p.V143L
chr17:g.7577538C>T TP53 nonsynonymous SNV 53.7 0.01 4.82 1691 RELYSE_GHE0242
_PHR06B042.2NM_000546:exon7:c.G743A p.R248Q
chr17:g.7577094G>A TP53 nonsynonymous SNV 13.3 0.00 4.06 122 RELYSE_GHE0262
_PHR06B040.2NM_000546:exon8:c.C844T p.R282W
chr17:g.7577154C>T TP53 nonsynonymous SNV 50.7 0.00 5.27 771 RELYSE_GHE0395
_PHRC39B003NM_000546:exon8:c.G784A p.G262S
chr17:g.7577117A>G TP53 nonsynonymous SNV 14.0 0.00 4.42 65 RELYSE_GHE0470
_PHR06B005NM_000546:exon8:c.T821C p.V274A
chr17:g.7577538C>T TP53 nonsynonymous SNV 21.8 0.01 4.82 345 RELYSE_GHE0470
_PHR06B005NM_000546:exon7:c.G743A p.R248Q
chr17:g.7577117A>C TP53 nonsynonymous SNV 28.0 0.00 4.26 214 RELYSE_GHE0507
_PHRC01B020NM_000546:exon8:c.T821G p.V274G
chr17:g.7578530A>C TP53 nonsynonymous SNV 33.8 0.00 4.82 195 RELYSE_GHE0536
_PHR02B069NM_000546:exon5:c.T400G p.F134V
chr17:g.7577548C>T TP53 nonsynonymous SNV 63.9 0.00 5.26 2214 RELYSE_GHE0547
_PHR02B066NM_000546:exon7:c.G733A p.G245S
chr17:g.7578222TC>- TP53 frameshift deletion 44.1 NA NA 395 RELYSE_GHE0563_PHR06B031
NM_000546:exon6:c.626_627del p.209_209del
chr17:g.7577538C>T TP53 nonsynonymous SNV 74.2 0.01 4.82 2562 RELYSE_GHE0624
_PHR39B005NM_000546:exon7:c.G743A p.R248Q
chr17:g.7578406C>T TP53 nonsynonymous SNV 42.0 0.00 5.08 958 RELYSE_GHE0701
_PHR02B031NM_000546:exon5:c.G524A p.R175H
chr17:g.7574003G>A TP53 stopgain SNV 69.1 0.73 6.06 1609 RELYSE_GHE0717_PHR39B016
NM_000546:exon10:c.C1024T p.R342X
chr17:g.7577539G>A TP53 nonsynonymous SNV 71.8 0.00 3.71 1600 RELYSE_GHE0807
_PHR06B001NM_000546:exon7:c.C742T p.R248W
chr17:g.7577114C>T TP53 nonsynonymous SNV 24.3 0.00 4.61 61 RELYSE_GHE0810
_PHR06B002NM_000546:exon8:c.G824A p.C275Y
chr17:g.7577575A>C TP53 nonsynonymous SNV 45.8 0.00 3.97 1523 RELYSE_GHE0842
_PHR03B033NM_000546:exon7:c.T706G p.Y236D
chr17:g.7578535T>C TP53 nonsynonymous SNV 66.2 0.00 4.07 1119 RELYSE_GHE0849
_PHR06B039NM_000546:exon5:c.A395G p.K132R
chr17:g.7577550C>T TP53 nonsynonymous SNV 70.0 0.00 4.84 2956 RELYSE_GHE0925
_PHR06B067NM_000546:exon7:c.G731A p.G244D
chr17:g.7578280G>A TP53 nonsynonymous SNV 21.6 0.00 2.47 51 RELYSE_GHE0986
_PHR02B048NM_000546:exon6:c.C569T p.P190L
chr17:g.7577538C>T TP53 nonsynonymous SNV 18.6 0.01 4.82 463 RELYSE_GHE1017
_PHR02B071NM_000546:exon7:c.G743A p.R248Q
chr17:g.7578532A>T TP53 nonsynonymous SNV 56.1 0.00 3.83 370 RELYSE_GHE1018
_PHR02B072NM_000546:exon5:c.T398A p.M133K
chr17:g.7577114C>T TP53 nonsynonymous SNV 52.2 0.00 4.61 349 RELYSE_GHE1071
_PHR06B060NM_000546:exon8:c.G824A p.C275Y
chr17:g.7578404A>C TP53 nonsynonymous SNV 28.8 0.00 4.72 218 RELYSE_GHE1209
_PHR06B072NM_000546:exon5:c.T526G p.C176G
chr17:g.7578508C>T TP53 nonsynonymous SNV 47.0 0.00 2.72 598 RELYSE_GHE1222
_PHR02B047NM_000546:exon5:c.G422A p.C141Y
chr17:g.7577594A>T TP53 stopgain SNV 61.7 0.83 4.74 1607 RELYSE_GHE1380_PHR06B007
NM_000546:exon7:c.T687A p.C229X
chr17:g.7577520A>G TP53 nonsynonymous SNV 24.4 0.00 3.31 551 RELYSE_GHE1424
_PHR06B029NM_000546:exon7:c.T761C p.I254T
chr17:g.7577097C>A TP53 nonsynonymous SNV 72.7 0.00 4.89 556 RELYSE_GHE1498
_PHR06B087NM_000546:exon8:c.G841T p.D281Y
chr17:g.7578471G>- TP53 frameshift deletion 12.1 NA NA 27 RELYSE_GHE1554_PHR02B045
NM_000546:exon5:c.459delC p.P153fs
chr17:g.7577091G>A TP53 nonsynonymous SNV 60.4 0.00 2.12 326 RELYSE_GHE1560
_PHR07B002NM_000546:exon8:c.C847T p.R283C
chr17:g.7577530T>G TP53 nonsynonymous SNV 75.7 0.00 4.00 3627 RELYSE_GHE2106
_PHR05B018NM_000546:exon7:c.A751C p.I251L
chr17:g.7577563T>C TP53 nonsynonymous SNV 75.3 0.00 3.25 3603 RELYSE_GHE2106
_PHR05B018NM_000546:exon7:c.A718G p.S240G
chr17:g.7577538C>T TP53 nonsynonymous SNV 13.1 0.01 4.82 343 RELYSE_GHE2109
_PHR05B025NM_000546:exon7:c.G743A p.R248Q
chr2:g.61719472C>T XPO1 nonsynonymous SNV 18.8 0.02 5.63 34 RELYSE_GHE0002
_PHR03B014NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 21.4 0.02 5.63 60 RELYSE_GHE0293
_PHR02B042NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 7.9 0.02 5.63 14 RELYSE_GHE0491
_PHR02B025NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 30.0 0.02 5.63 16 RELYSE_GHE0536
_PHR02B069NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 8.0 0.02 5.63 19 RELYSE_GHE0609
_PHR02B014NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 32.0 0.02 5.63 54 RELYSE_GHE0708
_PHR02B082NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719471T>C XPO1 nonsynonymous SNV 29.4 0.00 4.90 120 RELYSE_GHE0721
_PHR39B015NM_003400:exon15:c.A1712G p.E571G
chr2:g.61719472C>T XPO1 nonsynonymous SNV 10.6 0.02 5.63 55 RELYSE_GHE1287
_PHR03B027NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 23.8 0.02 5.63 70 RELYSE_GHE1385
_PHR01B025NM_003400:exon15:c.G1711A p.E571K
chr2:g.61719472C>T XPO1 nonsynonymous SNV 15.4 0.02 5.63 48 RELYSE_GHE1390
_PHR03B022NM_003400:exon15:c.G1711A p.E571K
Table S5: Validated variants.
Gene AID target frequency (%) Multiple mutation frequency (%)
MYC 60.7 66.7
PIM1 59 71.6
CDKN2B 50 0 (only 2 variants)
MFHAS1 44.6 63.0
IRF4 42.4 38.1
PRDM1 40 32.0
BCL2 34.1 70.3
GNA13 33.3 57.8
SOCS1 32.2 70.3
MYD88 26.1 41.3
CIITA 21.7 38.5
ITPKB 19.7 60.4
NOTCH2 19 12.5
Table S6: Lymphopanel NGS detection of genes with high AID target frequencies.Genes included in this table present AID target frequencies superior to the average for the Lymphopanel. Boldface indicates genes previously identified as SHM targets in DLBCL. The multiple mutation frequency refers to the percentage of variants present in association with at least one other variant of the same gene for a given patient.
Gene Subtype Cohort Type Mutant (n) WT (n) HR p FDR
B2M ABC R-ACVBP OS 3 19 NA 5.69E-01 7.72E-01B2M ABC R-ACVBP PFS 3 19 1.01 [0.12-8.69] 9.95E-01 9.95E-01B2M ABC R-CHOP OS 4 50 NA 5.86E-02 7.72E-01B2M ABC R-CHOP PFS 4 50 NA 6.29E-02 8.30E-01B2M all R-ACVBP OS 20 63 0.37 [0.04-3.19] 3.68E-01 9.74E-01B2M all R-ACVBP PFS 20 63 0.66 [0.18-2.40] 5.29E-01 8.66E-01B2M all R-CHOP OS 16 100 0.11 [0.01-0.82] 3.13E-02 5.43E-01B2M all R-CHOP PFS 16 100 0.12 [0.03-0.55] 6.24E-03 3.25E-01B2M GC R-ACVBP OS 8 29 NA 2.93E-01 7.72E-01B2M GC R-ACVBP PFS 8 29 NA 1.77E-01 8.30E-01B2M GC R-CHOP OS 6 34 NA 1.85E-01 7.72E-01B2M GC R-CHOP PFS 6 34 NA 1.34E-01 8.30E-01B2M Other R-ACVBP OS 4 10 NA NA NAB2M Other R-ACVBP PFS 4 10 2.16 [0.13-34.61] 5.77E-01 8.97E-01B2M Other R-CHOP OS 3 14 NA 5.50E-01 7.72E-01B2M Other R-CHOP PFS 3 14 NA 3.68E-01 8.30E-01B2M PMBL R-ACVBP OS 5 5 1.12 [0.07-17.95] 9.37E-01 9.59E-01B2M PMBL R-ACVBP PFS 5 5 1.12 [0.07-17.95] 9.37E-01 9.89E-01B2M PMBL R-CHOP OS 3 2 NA NA NAB2M PMBL R-CHOP PFS 3 2 NA NA NABCL2 ABC R-ACVBP OS 0 22 1.50 [0.16-14.45] NA NABCL2 ABC R-ACVBP PFS 0 22 0.93 [0.11-8.00] NA NABCL2 ABC R-CHOP OS 1 53 2.35 [0.67-8.22] NA NABCL2 ABC R-CHOP PFS 1 53 2.57 [0.81-8.15] NA NABCL2 all R-ACVBP OS 7 76 1.50 [0.16-14.40] 7.27E-01 9.99E-01BCL2 all R-ACVBP PFS 7 76 0.98 [0.11-8.41] 9.83E-01 9.98E-01BCL2 all R-CHOP OS 15 101 1.60 [0.54-4.78] 3.98E-01 9.85E-01BCL2 all R-CHOP PFS 15 101 2.01 [0.78-5.14] 1.46E-01 7.20E-01BCL2 GC R-ACVBP OS 7 30 1.50 [0.16-14.45] 7.25E-01 8.76E-01BCL2 GC R-ACVBP PFS 7 30 0.93 [0.11-8.00] 9.51E-01 9.89E-01BCL2 GC R-CHOP OS 13 27 2.35 [0.67-8.22] 1.68E-01 7.72E-01BCL2 GC R-CHOP PFS 13 27 2.57 [0.81-8.15] 9.64E-02 8.30E-01BCL2 Other R-ACVBP OS 0 14 1.50 [0.16-14.45] NA NABCL2 Other R-ACVBP PFS 0 14 0.93 [0.11-8.00] NA NABCL2 Other R-CHOP OS 1 16 2.35 [0.67-8.22] NA NABCL2 Other R-CHOP PFS 1 16 2.57 [0.81-8.15] NA NABCL2 PMBL R-ACVBP OS 0 10 1.50 [0.16-14.45] NA NABCL2 PMBL R-ACVBP PFS 0 10 0.93 [0.11-8.00] NA NABCL2 PMBL R-CHOP OS 0 5 2.35 [0.67-8.22] NA NABCL2 PMBL R-CHOP PFS 0 5 2.57 [0.81-8.15] NA NABRAF ABC R-ACVBP OS 0 22 NA NA NABRAF ABC R-ACVBP PFS 0 22 NA NA NABRAF ABC R-CHOP OS 0 54 NA NA NABRAF ABC R-CHOP PFS 0 54 NA NA NABRAF all R-ACVBP OS 0 83 NA NA NABRAF all R-ACVBP PFS 0 83 NA NA NABRAF all R-CHOP OS 1 115 NA NA NA
BRAF all R-CHOP PFS 1 115 NA NA NABRAF GC R-ACVBP OS 0 37 NA NA NABRAF GC R-ACVBP PFS 0 37 NA NA NABRAF GC R-CHOP OS 0 40 NA NA NABRAF GC R-CHOP PFS 0 40 NA NA NABRAF Other R-ACVBP OS 0 14 NA NA NABRAF Other R-ACVBP PFS 0 14 NA NA NABRAF Other R-CHOP OS 1 16 NA NA NABRAF Other R-CHOP PFS 1 16 NA NA NABRAF PMBL R-ACVBP OS 0 10 NA NA NABRAF PMBL R-ACVBP PFS 0 10 NA NA NABRAF PMBL R-CHOP OS 0 5 NA NA NABRAF PMBL R-CHOP PFS 0 5 NA NA NACARD11 ABC R-ACVBP OS 5 17 NA 4.36E-01 7.72E-01CARD11 ABC R-ACVBP PFS 5 17 0.60 [0.07-5.13] 6.35E-01 9.07E-01CARD11 ABC R-CHOP OS 6 48 0.65 [0.15-2.75] 5.54E-01 7.72E-01CARD11 ABC R-CHOP PFS 6 48 0.55 [0.13-2.32] 4.08E-01 8.30E-01CARD11 all R-ACVBP OS 7 76 0.00 [0.00-Inf] 9.99E-01 9.99E-01CARD11 all R-ACVBP PFS 7 76 0.49 [0.06-3.86] 4.94E-01 8.66E-01CARD11 all R-CHOP OS 12 104 0.66 [0.20-2.16] 4.95E-01 9.99E-01CARD11 all R-CHOP PFS 12 104 0.76 [0.27-2.12] 5.94E-01 9.35E-01CARD11 GC R-ACVBP OS 1 36 0.00 [0.00-Inf] NA NACARD11 GC R-ACVBP PFS 1 36 0.49 [0.06-3.86] NA NACARD11 GC R-CHOP OS 5 35 0.81 [0.10-6.42] 8.42E-01 9.45E-01CARD11 GC R-CHOP PFS 5 35 0.66 [0.09-5.16] 6.93E-01 9.07E-01CARD11 Other R-ACVBP OS 1 13 NA NA NACARD11 Other R-ACVBP PFS 1 13 0.60 [0.07-5.13] NA NACARD11 Other R-CHOP OS 1 16 0.65 [0.15-2.75] NA NACARD11 Other R-CHOP PFS 1 16 0.55 [0.13-2.32] NA NACARD11 PMBL R-ACVBP OS 0 10 NA NA NACARD11 PMBL R-ACVBP PFS 0 10 0.60 [0.07-5.13] NA NACARD11 PMBL R-CHOP OS 0 5 0.65 [0.15-2.75] NA NACARD11 PMBL R-CHOP PFS 0 5 0.55 [0.13-2.32] NA NACD58 ABC R-ACVBP OS 0 22 NA NA NACD58 ABC R-ACVBP PFS 0 22 NA NA NACD58 ABC R-CHOP OS 4 50 2.27 [0.68-7.61] 1.71E-01 7.72E-01CD58 ABC R-CHOP PFS 4 50 2.12 [0.63-7.09] 2.12E-01 8.30E-01CD58 all R-ACVBP OS 9 74 0.55 [0.05-5.72] 6.14E-01 9.99E-01CD58 all R-ACVBP PFS 9 74 0.49 [0.05-4.66] 5.33E-01 8.66E-01CD58 all R-CHOP OS 12 104 2.13 [0.87-5.23] 9.92E-02 9.31E-01CD58 all R-CHOP PFS 12 104 2.36 [1.07-5.20] 3.27E-02 5.67E-01CD58 GC R-ACVBP OS 4 33 NA 4.96E-01 7.72E-01CD58 GC R-ACVBP PFS 4 33 NA 3.82E-01 8.30E-01CD58 GC R-CHOP OS 4 36 3.26 [0.67-15.76] 1.19E-01 7.72E-01CD58 GC R-CHOP PFS 4 36 2.44 [0.52-11.30] 2.40E-01 8.30E-01CD58 Other R-ACVBP OS 0 14 0.89 [0.06-14.36] NA NACD58 Other R-ACVBP PFS 0 14 0.89 [0.06-14.36] NA NACD58 Other R-CHOP OS 2 15 2.27 [0.68-7.61] NA NA
CD58 Other R-CHOP PFS 2 15 2.12 [0.63-7.09] NA NACD58 PMBL R-ACVBP OS 5 5 0.89 [0.06-14.36] 9.37E-01 9.59E-01CD58 PMBL R-ACVBP PFS 5 5 0.89 [0.06-14.36] 9.37E-01 9.89E-01CD58 PMBL R-CHOP OS 2 3 2.27 [0.68-7.61] NA NACD58 PMBL R-CHOP PFS 2 3 2.12 [0.63-7.09] NA NACD79A ABC R-ACVBP OS 0 22 NA NA NACD79A ABC R-ACVBP PFS 0 22 NA NA NACD79A ABC R-CHOP OS 0 54 NA NA NACD79A ABC R-CHOP PFS 0 54 NA NA NACD79A all R-ACVBP OS 0 83 NA NA NACD79A all R-ACVBP PFS 0 83 NA NA NACD79A all R-CHOP OS 2 114 NA NA NACD79A all R-CHOP PFS 2 114 NA NA NACD79A GC R-ACVBP OS 0 37 NA NA NACD79A GC R-ACVBP PFS 0 37 NA NA NACD79A GC R-CHOP OS 2 38 NA NA NACD79A GC R-CHOP PFS 2 38 NA NA NACD79A Other R-ACVBP OS 0 14 NA NA NACD79A Other R-ACVBP PFS 0 14 NA NA NACD79A Other R-CHOP OS 0 17 NA NA NACD79A Other R-CHOP PFS 0 17 NA NA NACD79A PMBL R-ACVBP OS 0 10 NA NA NACD79A PMBL R-ACVBP PFS 0 10 NA NA NACD79A PMBL R-CHOP OS 0 5 NA NA NACD79A PMBL R-CHOP PFS 0 5 NA NA NACD79B ABC R-ACVBP OS 4 18 NA 4.99E-01 7.72E-01CD79B ABC R-ACVBP PFS 4 18 2.02 [0.37-11.08] 4.06E-01 8.30E-01CD79B ABC R-CHOP OS 16 38 0.35 [0.12-1.02] 4.44E-02 7.72E-01CD79B ABC R-CHOP PFS 16 38 0.33 [0.11-0.95] 3.07E-02 8.30E-01CD79B all R-ACVBP OS 4 79 NA NA NACD79B all R-ACVBP PFS 4 79 NA NA NACD79B all R-CHOP OS 19 97 0.31 [0.11-0.90] 3.13E-02 5.43E-01CD79B all R-CHOP PFS 19 97 0.29 [0.10-0.83] 2.15E-02 5.58E-01CD79B GC R-ACVBP OS 0 37 NA NA NACD79B GC R-ACVBP PFS 0 37 NA NA NACD79B GC R-CHOP OS 2 38 0.31 [0.11-0.90] NA NACD79B GC R-CHOP PFS 2 38 0.29 [0.10-0.83] NA NACD79B Other R-ACVBP OS 0 14 NA NA NACD79B Other R-ACVBP PFS 0 14 2.02 [0.37-11.08] NA NACD79B Other R-CHOP OS 1 16 0.35 [0.12-1.02] NA NACD79B Other R-CHOP PFS 1 16 0.33 [0.11-0.95] NA NACD79B PMBL R-ACVBP OS 0 10 NA NA NACD79B PMBL R-ACVBP PFS 0 10 2.02 [0.37-11.08] NA NACD79B PMBL R-CHOP OS 0 5 0.35 [0.12-1.02] NA NACD79B PMBL R-CHOP PFS 0 5 0.33 [0.11-0.95] NA NACDKN2A ABC R-ACVBP OS 0 22 NA NA NACDKN2A ABC R-ACVBP PFS 0 22 NA NA NACDKN2A ABC R-CHOP OS 2 52 NA NA NA
CDKN2A ABC R-CHOP PFS 2 52 NA NA NACDKN2A all R-ACVBP OS 0 83 NA NA NACDKN2A all R-ACVBP PFS 0 83 NA NA NACDKN2A all R-CHOP OS 3 113 NA NA NACDKN2A all R-CHOP PFS 3 113 NA NA NACDKN2A GC R-ACVBP OS 0 37 NA NA NACDKN2A GC R-ACVBP PFS 0 37 NA NA NACDKN2A GC R-CHOP OS 1 39 NA NA NACDKN2A GC R-CHOP PFS 1 39 NA NA NACDKN2A Other R-ACVBP OS 0 14 NA NA NACDKN2A Other R-ACVBP PFS 0 14 NA NA NACDKN2A Other R-CHOP OS 0 17 NA NA NACDKN2A Other R-CHOP PFS 0 17 NA NA NACDKN2A PMBL R-ACVBP OS 0 10 NA NA NACDKN2A PMBL R-ACVBP PFS 0 10 NA NA NACDKN2A PMBL R-CHOP OS 0 5 NA NA NACDKN2A PMBL R-CHOP PFS 0 5 NA NA NACDKN2B ABC R-ACVBP OS 0 22 NA NA NACDKN2B ABC R-ACVBP PFS 0 22 NA NA NACDKN2B ABC R-CHOP OS 0 54 NA NA NACDKN2B ABC R-CHOP PFS 0 54 NA NA NACDKN2B all R-ACVBP OS 0 83 NA NA NACDKN2B all R-ACVBP PFS 0 83 NA NA NACDKN2B all R-CHOP OS 1 115 NA NA NACDKN2B all R-CHOP PFS 1 115 NA NA NACDKN2B GC R-ACVBP OS 0 37 NA NA NACDKN2B GC R-ACVBP PFS 0 37 NA NA NACDKN2B GC R-CHOP OS 0 40 NA NA NACDKN2B GC R-CHOP PFS 0 40 NA NA NACDKN2B Other R-ACVBP OS 0 14 NA NA NACDKN2B Other R-ACVBP PFS 0 14 NA NA NACDKN2B Other R-CHOP OS 1 16 NA NA NACDKN2B Other R-CHOP PFS 1 16 NA NA NACDKN2B PMBL R-ACVBP OS 0 10 NA NA NACDKN2B PMBL R-ACVBP PFS 0 10 NA NA NACDKN2B PMBL R-CHOP OS 0 5 NA NA NACDKN2B PMBL R-CHOP PFS 0 5 NA NA NACIITA ABC R-ACVBP OS 3 19 NA 5.69E-01 7.72E-01CIITA ABC R-ACVBP PFS 3 19 NA 2.73E-01 8.30E-01CIITA ABC R-CHOP OS 7 47 1.37 [0.47-4.00] 5.59E-01 7.72E-01CIITA ABC R-CHOP PFS 7 47 1.29 [0.45-3.74] 6.38E-01 9.07E-01CIITA all R-ACVBP OS 11 72 0.72 [0.08-6.55] 7.67E-01 9.99E-01CIITA all R-ACVBP PFS 11 72 0.33 [0.04-2.64] 2.99E-01 7.56E-01CIITA all R-CHOP OS 16 100 1.38 [0.57-3.33] 4.71E-01 9.99E-01CIITA all R-CHOP PFS 16 100 1.02 [0.41-2.54] 9.72E-01 9.98E-01CIITA GC R-ACVBP OS 2 35 0.72 [0.08-6.55] NA NACIITA GC R-ACVBP PFS 2 35 0.33 [0.04-2.64] NA NACIITA GC R-CHOP OS 5 35 0.81 [0.10-6.39] 8.39E-01 9.45E-01
CIITA GC R-CHOP PFS 5 35 0.64 [0.08-4.98] 6.68E-01 9.07E-01CIITA Other R-ACVBP OS 2 12 1.73 [0.11-27.89] NA NACIITA Other R-ACVBP PFS 2 12 1.73 [0.11-27.89] NA NACIITA Other R-CHOP OS 0 17 1.37 [0.47-4.00] NA NACIITA Other R-CHOP PFS 0 17 1.29 [0.45-3.74] NA NACIITA PMBL R-ACVBP OS 4 6 1.73 [0.11-27.89] 6.95E-01 8.64E-01CIITA PMBL R-ACVBP PFS 4 6 1.73 [0.11-27.89] 6.95E-01 9.07E-01CIITA PMBL R-CHOP OS 4 1 1.37 [0.47-4.00] NA NACIITA PMBL R-CHOP PFS 4 1 1.29 [0.45-3.74] NA NACREBBP ABC R-ACVBP OS 1 21 1.04 [0.11-10.03] NA NACREBBP ABC R-ACVBP PFS 1 21 1.58 [0.29-8.66] NA NACREBBP ABC R-CHOP OS 4 50 0.84 [0.20-3.55] 8.09E-01 9.45E-01CREBBP ABC R-CHOP PFS 4 50 1.02 [0.24-4.31] 9.79E-01 9.89E-01CREBBP all R-ACVBP OS 11 72 0.92 [0.10-8.37] 9.40E-01 9.99E-01CREBBP all R-ACVBP PFS 11 72 1.14 [0.24-5.43] 8.73E-01 9.98E-01CREBBP all R-CHOP OS 28 88 1.42 [0.66-3.07] 3.69E-01 9.74E-01CREBBP all R-CHOP PFS 28 88 1.51 [0.74-3.05] 2.55E-01 7.56E-01CREBBP GC R-ACVBP OS 8 29 1.04 [0.11-10.03] 9.74E-01 9.75E-01CREBBP GC R-ACVBP PFS 8 29 1.58 [0.29-8.66] 5.92E-01 8.97E-01CREBBP GC R-CHOP OS 16 24 1.96 [0.55-6.96] 2.87E-01 7.72E-01CREBBP GC R-CHOP PFS 16 24 1.99 [0.63-6.28] 2.31E-01 8.30E-01CREBBP Other R-ACVBP OS 2 12 1.04 [0.11-10.03] NA NACREBBP Other R-ACVBP PFS 2 12 1.58 [0.29-8.66] NA NACREBBP Other R-CHOP OS 6 11 NA 6.15E-02 7.72E-01CREBBP Other R-CHOP PFS 6 11 5.87 [0.61-56.46] 8.22E-02 8.30E-01CREBBP PMBL R-ACVBP OS 0 10 1.04 [0.11-10.03] NA NACREBBP PMBL R-ACVBP PFS 0 10 1.58 [0.29-8.66] NA NACREBBP PMBL R-CHOP OS 2 3 0.84 [0.20-3.55] NA NACREBBP PMBL R-CHOP PFS 2 3 1.02 [0.24-4.31] NA NAEP300 ABC R-ACVBP OS 1 21 NA NA NAEP300 ABC R-ACVBP PFS 1 21 NA NA NAEP300 ABC R-CHOP OS 10 44 1.69 [0.68-4.22] 2.57E-01 7.72E-01EP300 ABC R-CHOP PFS 10 44 1.57 [0.63-3.92] 3.31E-01 8.30E-01EP300 all R-ACVBP OS 12 71 0.00 [0.00-Inf] 9.99E-01 9.99E-01EP300 all R-ACVBP PFS 12 71 0.80 [0.17-3.85] 7.83E-01 9.98E-01EP300 all R-CHOP OS 19 97 0.89 [0.37-2.12] 7.92E-01 9.99E-01EP300 all R-CHOP PFS 19 97 1.09 [0.51-2.33] 8.24E-01 9.98E-01EP300 GC R-ACVBP OS 6 31 NA 3.60E-01 7.72E-01EP300 GC R-ACVBP PFS 6 31 NA 2.45E-01 8.30E-01EP300 GC R-CHOP OS 5 35 NA 1.62E-01 7.72E-01EP300 GC R-CHOP PFS 5 35 NA 1.21E-01 8.30E-01EP300 Other R-ACVBP OS 3 11 NA NA NAEP300 Other R-ACVBP PFS 3 11 NA 5.13E-01 8.84E-01EP300 Other R-CHOP OS 3 14 NA 5.50E-01 7.72E-01EP300 Other R-CHOP PFS 3 14 1.65 [0.17-15.89] 6.62E-01 9.07E-01EP300 PMBL R-ACVBP OS 2 8 NA NA NAEP300 PMBL R-ACVBP PFS 2 8 NA NA NAEP300 PMBL R-CHOP OS 1 4 1.69 [0.68-4.22] NA NA
EP300 PMBL R-CHOP PFS 1 4 1.57 [0.63-3.92] NA NAEZH2 ABC R-ACVBP OS 0 22 NA NA NAEZH2 ABC R-ACVBP PFS 0 22 0.76 [0.09-6.52] NA NAEZH2 ABC R-CHOP OS 0 54 0.48 [0.06-3.78] NA NAEZH2 ABC R-CHOP PFS 0 54 0.37 [0.05-2.83] NA NAEZH2 all R-ACVBP OS 10 73 0.00 [0.00-Inf] 9.99E-01 9.99E-01EZH2 all R-ACVBP PFS 10 73 0.61 [0.07-4.89] 6.38E-01 9.37E-01EZH2 all R-CHOP OS 9 107 0.39 [0.05-2.99] 3.62E-01 9.74E-01EZH2 all R-CHOP PFS 9 107 1.08 [0.31-3.81] 9.07E-01 9.98E-01EZH2 GC R-ACVBP OS 8 29 NA 3.12E-01 7.72E-01EZH2 GC R-ACVBP PFS 8 29 0.76 [0.09-6.52] 8.03E-01 9.43E-01EZH2 GC R-CHOP OS 7 33 0.48 [0.06-3.78] 4.75E-01 7.72E-01EZH2 GC R-CHOP PFS 7 33 0.37 [0.05-2.83] 3.15E-01 8.30E-01EZH2 Other R-ACVBP OS 1 13 NA NA NAEZH2 Other R-ACVBP PFS 1 13 0.76 [0.09-6.52] NA NAEZH2 Other R-CHOP OS 2 15 0.48 [0.06-3.78] NA NAEZH2 Other R-CHOP PFS 2 15 0.37 [0.05-2.83] NA NAEZH2 PMBL R-ACVBP OS 1 9 NA NA NAEZH2 PMBL R-ACVBP PFS 1 9 0.76 [0.09-6.52] NA NAEZH2 PMBL R-CHOP OS 0 5 0.48 [0.06-3.78] NA NAEZH2 PMBL R-CHOP PFS 0 5 0.37 [0.05-2.83] NA NAFOXO1 ABC R-ACVBP OS 1 21 NA NA NAFOXO1 ABC R-ACVBP PFS 1 21 NA NA NAFOXO1 ABC R-CHOP OS 2 52 3.87 [1.00-15.07] NA NAFOXO1 ABC R-CHOP PFS 2 52 2.92 [0.79-10.87] NA NAFOXO1 all R-ACVBP OS 6 77 0.00 [0.00-Inf] 9.99E-01 9.99E-01FOXO1 all R-ACVBP PFS 6 77 0.00 [0.00-Inf] 9.98E-01 9.98E-01FOXO1 all R-CHOP OS 8 108 1.34 [0.41-4.39] 6.31E-01 9.99E-01FOXO1 all R-CHOP PFS 8 108 1.11 [0.34-3.63] 8.58E-01 9.98E-01FOXO1 GC R-ACVBP OS 4 33 NA 4.96E-01 7.72E-01FOXO1 GC R-ACVBP PFS 4 33 NA 3.82E-01 8.30E-01FOXO1 GC R-CHOP OS 5 35 3.87 [1.00-15.07] 3.53E-02 7.72E-01FOXO1 GC R-CHOP PFS 5 35 2.92 [0.79-10.87] 9.31E-02 8.30E-01FOXO1 Other R-ACVBP OS 0 14 NA NA NAFOXO1 Other R-ACVBP PFS 0 14 NA NA NAFOXO1 Other R-CHOP OS 1 16 3.87 [1.00-15.07] NA NAFOXO1 Other R-CHOP PFS 1 16 2.92 [0.79-10.87] NA NAFOXO1 PMBL R-ACVBP OS 1 9 NA NA NAFOXO1 PMBL R-ACVBP PFS 1 9 NA NA NAFOXO1 PMBL R-CHOP OS 0 5 3.87 [1.00-15.07] NA NAFOXO1 PMBL R-CHOP PFS 0 5 2.92 [0.79-10.87] NA NAGNA13 ABC R-ACVBP OS 2 20 NA NA NAGNA13 ABC R-ACVBP PFS 2 20 NA NA NAGNA13 ABC R-CHOP OS 5 49 3.68 [1.21-11.15] 1.36E-02 5.94E-01GNA13 ABC R-CHOP PFS 5 49 5.89 [1.86-18.64] 6.47E-04 3.04E-02GNA13 all R-ACVBP OS 13 70 0.42 [0.04-4.35] 4.64E-01 9.99E-01GNA13 all R-ACVBP PFS 13 70 0.24 [0.03-2.10] 1.97E-01 7.31E-01GNA13 all R-CHOP OS 15 101 1.82 [0.70-4.69] 2.17E-01 9.74E-01
GNA13 all R-CHOP PFS 15 101 1.62 [0.65-4.04] 2.98E-01 7.56E-01GNA13 GC R-ACVBP OS 3 34 NA 5.49E-01 7.72E-01GNA13 GC R-ACVBP PFS 3 34 NA 4.46E-01 8.30E-01GNA13 GC R-CHOP OS 6 34 0.84 [0.10-6.96] 8.69E-01 9.45E-01GNA13 GC R-CHOP PFS 6 34 0.70 [0.09-5.64] 7.40E-01 9.33E-01GNA13 Other R-ACVBP OS 2 12 0.73 [0.05-11.71] NA NAGNA13 Other R-ACVBP PFS 2 12 0.73 [0.05-11.71] NA NAGNA13 Other R-CHOP OS 2 15 3.68 [1.21-11.15] NA NAGNA13 Other R-CHOP PFS 2 15 5.89 [1.86-18.64] NA NAGNA13 PMBL R-ACVBP OS 6 4 0.73 [0.05-11.71] 8.24E-01 9.45E-01GNA13 PMBL R-ACVBP PFS 6 4 0.73 [0.05-11.71] 8.24E-01 9.56E-01GNA13 PMBL R-CHOP OS 2 3 3.68 [1.21-11.15] NA NAGNA13 PMBL R-CHOP PFS 2 3 5.89 [1.86-18.64] NA NAID3 ABC R-ACVBP OS 2 20 0.00 [0.00-Inf] NA NAID3 ABC R-ACVBP PFS 2 20 2.03 [0.43-9.60] NA NAID3 ABC R-CHOP OS 2 52 0.66 [0.09-4.87] NA NAID3 ABC R-CHOP PFS 2 52 0.99 [0.24-4.09] NA NAID3 all R-ACVBP OS 5 78 0.00 [0.00-Inf] 9.99E-01 9.99E-01ID3 all R-ACVBP PFS 5 78 2.03 [0.43-9.60] 3.72E-01 8.40E-01ID3 all R-CHOP OS 5 111 0.66 [0.09-4.87] 6.87E-01 9.99E-01ID3 all R-CHOP PFS 5 111 0.99 [0.24-4.09] 9.83E-01 9.98E-01ID3 GC R-ACVBP OS 1 36 0.00 [0.00-Inf] NA NAID3 GC R-ACVBP PFS 1 36 2.03 [0.43-9.60] NA NAID3 GC R-CHOP OS 1 39 0.66 [0.09-4.87] NA NAID3 GC R-CHOP PFS 1 39 0.99 [0.24-4.09] NA NAID3 Other R-ACVBP OS 2 12 0.00 [0.00-Inf] NA NAID3 Other R-ACVBP PFS 2 12 2.03 [0.43-9.60] NA NAID3 Other R-CHOP OS 1 16 0.66 [0.09-4.87] NA NAID3 Other R-CHOP PFS 1 16 0.99 [0.24-4.09] NA NAID3 PMBL R-ACVBP OS 0 10 0.00 [0.00-Inf] NA NAID3 PMBL R-ACVBP PFS 0 10 2.03 [0.43-9.60] NA NAID3 PMBL R-CHOP OS 1 4 0.66 [0.09-4.87] NA NAID3 PMBL R-CHOP PFS 1 4 0.99 [0.24-4.09] NA NAIRF4 ABC R-ACVBP OS 4 18 4.37 [0.27-69.94] 2.54E-01 7.72E-01IRF4 ABC R-ACVBP PFS 4 18 0.85 [0.10-7.34] 8.86E-01 9.89E-01IRF4 ABC R-CHOP OS 7 47 2.12 [0.80-5.67] 1.24E-01 7.72E-01IRF4 ABC R-CHOP PFS 7 47 1.98 [0.74-5.27] 1.64E-01 8.30E-01IRF4 all R-ACVBP OS 7 76 1.26 [0.15-10.58] 8.31E-01 9.99E-01IRF4 all R-ACVBP PFS 7 76 0.59 [0.08-4.60] 6.14E-01 9.37E-01IRF4 all R-CHOP OS 10 106 2.53 [1.10-5.87] 2.98E-02 5.43E-01IRF4 all R-CHOP PFS 10 106 2.01 [0.87-4.63] 1.02E-01 7.20E-01IRF4 GC R-ACVBP OS 2 35 1.26 [0.15-10.58] NA NAIRF4 GC R-ACVBP PFS 2 35 0.59 [0.08-4.60] NA NAIRF4 GC R-CHOP OS 2 38 2.53 [1.10-5.87] NA NAIRF4 GC R-CHOP PFS 2 38 2.01 [0.87-4.63] NA NAIRF4 Other R-ACVBP OS 0 14 4.37 [0.27-69.94] NA NAIRF4 Other R-ACVBP PFS 0 14 0.85 [0.10-7.34] NA NAIRF4 Other R-CHOP OS 0 17 2.12 [0.80-5.67] NA NA
IRF4 Other R-CHOP PFS 0 17 1.98 [0.74-5.27] NA NAIRF4 PMBL R-ACVBP OS 1 9 4.37 [0.27-69.94] NA NAIRF4 PMBL R-ACVBP PFS 1 9 0.85 [0.10-7.34] NA NAIRF4 PMBL R-CHOP OS 1 4 2.12 [0.80-5.67] NA NAIRF4 PMBL R-CHOP PFS 1 4 1.98 [0.74-5.27] NA NAITPKB ABC R-ACVBP OS 5 17 NA 4.36E-01 7.72E-01ITPKB ABC R-ACVBP PFS 5 17 NA 1.68E-01 8.30E-01ITPKB ABC R-CHOP OS 2 52 1.92 [0.41-9.07] NA NAITPKB ABC R-CHOP PFS 2 52 1.73 [0.38-7.94] NA NAITPKB all R-ACVBP OS 16 67 2.22 [0.53-9.32] 2.76E-01 9.74E-01ITPKB all R-ACVBP PFS 16 67 1.48 [0.47-4.68] 5.08E-01 8.66E-01ITPKB all R-CHOP OS 13 103 1.11 [0.34-3.67] 8.60E-01 9.99E-01ITPKB all R-CHOP PFS 13 103 0.92 [0.30-2.84] 8.91E-01 9.98E-01ITPKB GC R-ACVBP OS 8 29 3.89 [0.54-28.04] 1.47E-01 7.72E-01ITPKB GC R-ACVBP PFS 8 29 4.28 [0.84-21.88] 5.78E-02 8.30E-01ITPKB GC R-CHOP OS 5 35 1.92 [0.41-9.07] 4.00E-01 7.72E-01ITPKB GC R-CHOP PFS 5 35 1.73 [0.38-7.94] 4.73E-01 8.56E-01ITPKB Other R-ACVBP OS 1 13 NA NA NAITPKB Other R-ACVBP PFS 1 13 NA NA NAITPKB Other R-CHOP OS 2 15 1.92 [0.41-9.07] NA NAITPKB Other R-CHOP PFS 2 15 1.73 [0.38-7.94] NA NAITPKB PMBL R-ACVBP OS 2 8 NA NA NAITPKB PMBL R-ACVBP PFS 2 8 NA NA NAITPKB PMBL R-CHOP OS 4 1 1.92 [0.41-9.07] NA NAITPKB PMBL R-CHOP PFS 4 1 1.73 [0.38-7.94] NA NAKMT2D ABC R-ACVBP OS 8 14 1.69 [0.11-26.97] 7.09E-01 8.68E-01KMT2D ABC R-ACVBP PFS 8 14 0.79 [0.14-4.32] 7.83E-01 9.33E-01KMT2D ABC R-CHOP OS 23 31 1.33 [0.62-2.84] 4.67E-01 7.72E-01KMT2D ABC R-CHOP PFS 23 31 1.27 [0.59-2.72] 5.36E-01 8.84E-01KMT2D all R-ACVBP OS 28 55 1.07 [0.25-4.47] 9.31E-01 9.99E-01KMT2D all R-ACVBP PFS 28 55 0.80 [0.28-2.32] 6.85E-01 9.37E-01KMT2D all R-CHOP OS 56 60 1.28 [0.68-2.41] 4.40E-01 9.99E-01KMT2D all R-CHOP PFS 56 60 1.22 [0.67-2.23] 5.12E-01 8.66E-01KMT2D GC R-ACVBP OS 13 24 1.65 [0.23-11.72] 6.16E-01 8.12E-01KMT2D GC R-ACVBP PFS 13 24 1.66 [0.33-8.24] 5.32E-01 8.84E-01KMT2D GC R-CHOP OS 24 16 1.12 [0.31-4.01] 8.65E-01 9.45E-01KMT2D GC R-CHOP PFS 24 16 1.06 [0.33-3.36] 9.22E-01 9.89E-01KMT2D Other R-ACVBP OS 4 10 NA NA NAKMT2D Other R-ACVBP PFS 4 10 NA 3.88E-01 8.30E-01KMT2D Other R-CHOP OS 9 8 1.22 [0.07-20.14] 8.91E-01 9.57E-01KMT2D Other R-CHOP PFS 9 8 0.89 [0.13-6.37] 9.10E-01 9.89E-01KMT2D PMBL R-ACVBP OS 3 7 NA 3.35E-01 7.72E-01KMT2D PMBL R-ACVBP PFS 3 7 NA 3.35E-01 8.30E-01KMT2D PMBL R-CHOP OS 0 5 1.33 [0.62-2.84] NA NAKMT2D PMBL R-CHOP PFS 0 5 1.27 [0.59-2.72] NA NAMEF2B ABC R-ACVBP OS 4 18 4.37 [0.27-69.94] 2.54E-01 7.72E-01MEF2B ABC R-ACVBP PFS 4 18 2.87 [0.52-15.84] 2.06E-01 8.30E-01MEF2B ABC R-CHOP OS 6 48 0.53 [0.13-2.24] 3.80E-01 7.72E-01
MEF2B ABC R-CHOP PFS 6 48 0.46 [0.11-1.95] 2.81E-01 8.30E-01MEF2B all R-ACVBP OS 12 71 0.90 [0.11-7.74] 9.27E-01 9.99E-01MEF2B all R-ACVBP PFS 12 71 1.57 [0.43-5.69] 4.91E-01 8.66E-01MEF2B all R-CHOP OS 19 97 0.74 [0.29-1.91] 5.37E-01 9.99E-01MEF2B all R-CHOP PFS 19 97 0.73 [0.31-1.74] 4.81E-01 8.66E-01MEF2B GC R-ACVBP OS 7 30 NA 3.45E-01 7.72E-01MEF2B GC R-ACVBP PFS 7 30 0.97 [0.11-8.30] 9.77E-01 9.89E-01MEF2B GC R-CHOP OS 11 29 1.69 [0.41-6.88] 4.61E-01 7.72E-01MEF2B GC R-CHOP PFS 11 29 1.24 [0.33-4.73] 7.52E-01 9.33E-01MEF2B Other R-ACVBP OS 1 13 4.37 [0.27-69.94] NA NAMEF2B Other R-ACVBP PFS 1 13 2.87 [0.52-15.84] NA NAMEF2B Other R-CHOP OS 1 16 0.53 [0.13-2.24] NA NAMEF2B Other R-CHOP PFS 1 16 0.46 [0.11-1.95] NA NAMEF2B PMBL R-ACVBP OS 0 10 4.37 [0.27-69.94] NA NAMEF2B PMBL R-ACVBP PFS 0 10 2.87 [0.52-15.84] NA NAMEF2B PMBL R-CHOP OS 1 4 0.53 [0.13-2.24] NA NAMEF2B PMBL R-CHOP PFS 1 4 0.46 [0.11-1.95] NA NAMFHAS1 ABC R-ACVBP OS 0 22 NA NA NAMFHAS1 ABC R-ACVBP PFS 0 22 NA NA NAMFHAS1 ABC R-CHOP OS 1 53 2.94 [0.62-13.87] NA NAMFHAS1 ABC R-CHOP PFS 1 53 2.78 [0.61-12.70] NA NAMFHAS1 all R-ACVBP OS 10 73 0.00 [0.00-Inf] 9.99E-01 9.99E-01MFHAS1 all R-ACVBP PFS 10 73 0.00 [0.00-Inf] 9.98E-01 9.98E-01MFHAS1 all R-CHOP OS 7 109 1.64 [0.55-4.85] 3.75E-01 9.74E-01MFHAS1 all R-CHOP PFS 7 109 2.15 [0.80-5.73] 1.28E-01 7.20E-01MFHAS1 GC R-ACVBP OS 5 32 NA 3.97E-01 7.72E-01MFHAS1 GC R-ACVBP PFS 5 32 NA 3.00E-01 8.30E-01MFHAS1 GC R-CHOP OS 3 37 2.94 [0.62-13.87] 1.53E-01 7.72E-01MFHAS1 GC R-CHOP PFS 3 37 2.78 [0.61-12.70] 1.70E-01 8.30E-01MFHAS1 Other R-ACVBP OS 2 12 NA NA NAMFHAS1 Other R-ACVBP PFS 2 12 NA NA NAMFHAS1 Other R-CHOP OS 1 16 2.94 [0.62-13.87] NA NAMFHAS1 Other R-CHOP PFS 1 16 2.78 [0.61-12.70] NA NAMFHAS1 PMBL R-ACVBP OS 3 7 NA 3.35E-01 7.72E-01MFHAS1 PMBL R-ACVBP PFS 3 7 NA 3.35E-01 8.30E-01MFHAS1 PMBL R-CHOP OS 2 3 2.94 [0.62-13.87] NA NAMFHAS1 PMBL R-CHOP PFS 2 3 2.78 [0.61-12.70] NA NAMYC ABC R-ACVBP OS 0 22 3.73 [0.39-35.89] NA NAMYC ABC R-ACVBP PFS 0 22 2.28 [0.26-19.71] NA NAMYC ABC R-CHOP OS 4 50 NA 1.01E-01 7.72E-01MYC ABC R-CHOP PFS 4 50 NA 9.11E-02 8.30E-01MYC all R-ACVBP OS 4 79 NA NA NAMYC all R-ACVBP PFS 4 79 NA NA NAMYC all R-CHOP OS 8 108 0.90 [0.28-2.94] 8.66E-01 9.99E-01MYC all R-CHOP PFS 8 108 0.77 [0.24-2.50] 6.69E-01 9.37E-01MYC GC R-ACVBP OS 4 33 3.73 [0.39-35.89] 2.22E-01 7.72E-01MYC GC R-ACVBP PFS 4 33 2.28 [0.26-19.71] 4.40E-01 8.30E-01MYC GC R-CHOP OS 2 38 0.90 [0.28-2.94] NA NA
MYC GC R-CHOP PFS 2 38 0.77 [0.24-2.50] NA NAMYC Other R-ACVBP OS 0 14 3.73 [0.39-35.89] NA NAMYC Other R-ACVBP PFS 0 14 2.28 [0.26-19.71] NA NAMYC Other R-CHOP OS 1 16 NA NA NAMYC Other R-CHOP PFS 1 16 NA NA NAMYC PMBL R-ACVBP OS 0 10 3.73 [0.39-35.89] NA NAMYC PMBL R-ACVBP PFS 0 10 2.28 [0.26-19.71] NA NAMYC PMBL R-CHOP OS 1 4 NA NA NAMYC PMBL R-CHOP PFS 1 4 NA NA NAMYD88 ABC R-ACVBP OS 6 16 2.92 [0.18-46.84] 4.27E-01 7.72E-01MYD88 ABC R-ACVBP PFS 6 16 0.50 [0.06-4.33] 5.22E-01 8.84E-01MYD88 ABC R-CHOP OS 17 37 0.65 [0.27-1.56] 3.33E-01 7.72E-01MYD88 ABC R-CHOP PFS 17 37 0.67 [0.28-1.59] 3.59E-01 8.30E-01MYD88 all R-ACVBP OS 13 70 1.00 [0.11-8.84] 9.99E-01 9.99E-01MYD88 all R-ACVBP PFS 13 70 0.26 [0.03-2.01] 1.96E-01 7.31E-01MYD88 all R-CHOP OS 22 94 0.53 [0.23-1.25] 1.49E-01 9.31E-01MYD88 all R-CHOP PFS 22 94 0.63 [0.28-1.39] 2.50E-01 7.56E-01MYD88 GC R-ACVBP OS 4 33 NA 4.57E-01 7.72E-01MYD88 GC R-ACVBP PFS 4 33 NA 3.49E-01 8.30E-01MYD88 GC R-CHOP OS 4 36 NA 2.66E-01 7.72E-01MYD88 GC R-CHOP PFS 4 36 0.81 [0.10-6.30] 8.36E-01 9.58E-01MYD88 Other R-ACVBP OS 3 11 NA NA NAMYD88 Other R-ACVBP PFS 3 11 NA 3.88E-01 8.30E-01MYD88 Other R-CHOP OS 1 16 0.65 [0.27-1.56] NA NAMYD88 Other R-CHOP PFS 1 16 0.67 [0.28-1.59] NA NAMYD88 PMBL R-ACVBP OS 0 10 2.92 [0.18-46.84] NA NAMYD88 PMBL R-ACVBP PFS 0 10 0.50 [0.06-4.33] NA NAMYD88 PMBL R-CHOP OS 0 5 0.65 [0.27-1.56] NA NAMYD88 PMBL R-CHOP PFS 0 5 0.67 [0.28-1.59] NA NANOTCH1 ABC R-ACVBP OS 0 22 NA NA NANOTCH1 ABC R-ACVBP PFS 0 22 NA NA NANOTCH1 ABC R-CHOP OS 5 49 0.61 [0.08-4.57] 6.30E-01 8.18E-01NOTCH1 ABC R-CHOP PFS 5 49 0.47 [0.06-3.47] 4.47E-01 8.30E-01NOTCH1 all R-ACVBP OS 1 82 NA NA NANOTCH1 all R-ACVBP PFS 1 82 NA NA NANOTCH1 all R-CHOP OS 8 108 0.38 [0.05-2.81] 3.43E-01 9.74E-01NOTCH1 all R-CHOP PFS 8 108 0.20 [0.03-1.54] 1.23E-01 7.20E-01NOTCH1 GC R-ACVBP OS 0 37 NA NA NANOTCH1 GC R-ACVBP PFS 0 37 NA NA NANOTCH1 GC R-CHOP OS 1 39 0.38 [0.05-2.81] NA NANOTCH1 GC R-CHOP PFS 1 39 0.20 [0.03-1.54] NA NANOTCH1 Other R-ACVBP OS 1 13 NA NA NANOTCH1 Other R-ACVBP PFS 1 13 NA NA NANOTCH1 Other R-CHOP OS 1 16 0.61 [0.08-4.57] NA NANOTCH1 Other R-CHOP PFS 1 16 0.47 [0.06-3.47] NA NANOTCH1 PMBL R-ACVBP OS 0 10 NA NA NANOTCH1 PMBL R-ACVBP PFS 0 10 NA NA NANOTCH1 PMBL R-CHOP OS 1 4 0.61 [0.08-4.57] NA NA
NOTCH1 PMBL R-CHOP PFS 1 4 0.47 [0.06-3.47] NA NANOTCH2 ABC R-ACVBP OS 1 21 NA NA NANOTCH2 ABC R-ACVBP PFS 1 21 NA NA NANOTCH2 ABC R-CHOP OS 1 53 0.83 [0.10-6.65] NA NANOTCH2 ABC R-CHOP PFS 1 53 0.73 [0.09-5.71] NA NANOTCH2 all R-ACVBP OS 4 79 NA NA NANOTCH2 all R-ACVBP PFS 4 79 NA NA NANOTCH2 all R-CHOP OS 10 106 1.78 [0.58-5.46] 3.10E-01 9.74E-01NOTCH2 all R-CHOP PFS 10 106 1.26 [0.43-3.73] 6.74E-01 9.37E-01NOTCH2 GC R-ACVBP OS 2 35 NA NA NANOTCH2 GC R-ACVBP PFS 2 35 NA NA NANOTCH2 GC R-CHOP OS 5 35 0.83 [0.10-6.65] 8.64E-01 9.45E-01NOTCH2 GC R-CHOP PFS 5 35 0.73 [0.09-5.71] 7.67E-01 9.33E-01NOTCH2 Other R-ACVBP OS 1 13 NA NA NANOTCH2 Other R-ACVBP PFS 1 13 NA NA NANOTCH2 Other R-CHOP OS 4 13 4.51 [0.38-53.06] 1.97E-01 7.72E-01NOTCH2 Other R-CHOP PFS 4 13 1.85 [0.29-11.85] 5.10E-01 8.84E-01NOTCH2 PMBL R-ACVBP OS 0 10 NA NA NANOTCH2 PMBL R-ACVBP PFS 0 10 NA NA NANOTCH2 PMBL R-CHOP OS 0 5 0.83 [0.10-6.65] NA NANOTCH2 PMBL R-CHOP PFS 0 5 0.73 [0.09-5.71] NA NAPIM1 ABC R-ACVBP OS 6 16 2.92 [0.18-46.84] 4.27E-01 7.72E-01PIM1 ABC R-ACVBP PFS 6 16 3.03 [0.61-15.04] 1.53E-01 8.30E-01PIM1 ABC R-CHOP OS 19 35 0.52 [0.22-1.23] 1.27E-01 7.72E-01PIM1 ABC R-CHOP PFS 19 35 0.52 [0.22-1.23] 1.31E-01 8.30E-01PIM1 all R-ACVBP OS 9 74 1.20 [0.13-10.85] 8.73E-01 9.99E-01PIM1 all R-ACVBP PFS 9 74 1.59 [0.42-6.02] 4.93E-01 8.66E-01PIM1 all R-CHOP OS 25 91 0.54 [0.24-1.22] 1.40E-01 9.31E-01PIM1 all R-CHOP PFS 25 91 0.51 [0.23-1.14] 9.97E-02 7.20E-01PIM1 GC R-ACVBP OS 3 34 NA 5.26E-01 7.72E-01PIM1 GC R-ACVBP PFS 3 34 NA 4.26E-01 8.30E-01PIM1 GC R-CHOP OS 4 36 1.13 [0.14-9.10] 9.08E-01 9.59E-01PIM1 GC R-CHOP PFS 4 36 1.03 [0.13-8.07] 9.77E-01 9.89E-01PIM1 Other R-ACVBP OS 0 14 2.92 [0.18-46.84] NA NAPIM1 Other R-ACVBP PFS 0 14 3.03 [0.61-15.04] NA NAPIM1 Other R-CHOP OS 2 15 0.52 [0.22-1.23] NA NAPIM1 Other R-CHOP PFS 2 15 0.52 [0.22-1.23] NA NAPIM1 PMBL R-ACVBP OS 0 10 2.92 [0.18-46.84] NA NAPIM1 PMBL R-ACVBP PFS 0 10 3.03 [0.61-15.04] NA NAPIM1 PMBL R-CHOP OS 0 5 0.52 [0.22-1.23] NA NAPIM1 PMBL R-CHOP PFS 0 5 0.52 [0.22-1.23] NA NAPRDM1 ABC R-ACVBP OS 1 21 NA NA NAPRDM1 ABC R-ACVBP PFS 1 21 NA NA NAPRDM1 ABC R-CHOP OS 12 42 0.45 [0.15-1.36] 1.49E-01 7.72E-01PRDM1 ABC R-CHOP PFS 12 42 0.51 [0.18-1.48] 2.05E-01 8.30E-01PRDM1 all R-ACVBP OS 4 79 NA NA NAPRDM1 all R-ACVBP PFS 4 79 NA NA NAPRDM1 all R-CHOP OS 15 101 0.48 [0.18-1.29] 1.46E-01 9.31E-01
PRDM1 all R-CHOP PFS 15 101 0.51 [0.19-1.33] 1.66E-01 7.20E-01PRDM1 GC R-ACVBP OS 2 35 NA NA NAPRDM1 GC R-ACVBP PFS 2 35 NA NA NAPRDM1 GC R-CHOP OS 3 37 1.11 [0.14-8.82] 9.18E-01 9.59E-01PRDM1 GC R-CHOP PFS 3 37 0.89 [0.11-6.88] 9.08E-01 9.89E-01PRDM1 Other R-ACVBP OS 1 13 NA NA NAPRDM1 Other R-ACVBP PFS 1 13 NA NA NAPRDM1 Other R-CHOP OS 0 17 0.45 [0.15-1.36] NA NAPRDM1 Other R-CHOP PFS 0 17 0.51 [0.18-1.48] NA NAPRDM1 PMBL R-ACVBP OS 0 10 NA NA NAPRDM1 PMBL R-ACVBP PFS 0 10 NA NA NAPRDM1 PMBL R-CHOP OS 0 5 0.45 [0.15-1.36] NA NAPRDM1 PMBL R-CHOP PFS 0 5 0.51 [0.18-1.48] NA NASOCS1 ABC R-ACVBP OS 2 20 NA NA NASOCS1 ABC R-ACVBP PFS 2 20 NA NA NASOCS1 ABC R-CHOP OS 2 52 1.28 [0.27-6.04] NA NASOCS1 ABC R-CHOP PFS 2 52 0.96 [0.21-4.38] NA NASOCS1 all R-ACVBP OS 18 65 0.78 [0.12-5.07] 7.96E-01 9.99E-01SOCS1 all R-ACVBP PFS 18 65 0.43 [0.09-2.16] 3.05E-01 7.56E-01SOCS1 all R-CHOP OS 11 105 0.97 [0.33-2.81] 9.52E-01 9.99E-01SOCS1 all R-CHOP PFS 11 105 1.03 [0.40-2.68] 9.54E-01 9.98E-01SOCS1 GC R-ACVBP OS 6 31 NA 3.60E-01 7.72E-01SOCS1 GC R-ACVBP PFS 6 31 NA 2.45E-01 8.30E-01SOCS1 GC R-CHOP OS 6 34 1.28 [0.27-6.04] 7.54E-01 8.98E-01SOCS1 GC R-CHOP PFS 6 34 0.96 [0.21-4.38] 9.56E-01 9.89E-01SOCS1 Other R-ACVBP OS 3 11 NA NA NASOCS1 Other R-ACVBP PFS 3 11 NA 6.17E-01 9.06E-01SOCS1 Other R-CHOP OS 1 16 1.28 [0.27-6.04] NA NASOCS1 Other R-CHOP PFS 1 16 0.96 [0.21-4.38] NA NASOCS1 PMBL R-ACVBP OS 7 3 NA 3.35E-01 7.72E-01SOCS1 PMBL R-ACVBP PFS 7 3 NA 3.35E-01 8.30E-01SOCS1 PMBL R-CHOP OS 2 3 1.28 [0.27-6.04] NA NASOCS1 PMBL R-CHOP PFS 2 3 0.96 [0.21-4.38] NA NASTAT6 ABC R-ACVBP OS 0 22 NA NA NASTAT6 ABC R-ACVBP PFS 0 22 0.73 [0.08-6.25] NA NASTAT6 ABC R-CHOP OS 0 54 NA NA NASTAT6 ABC R-CHOP PFS 0 54 0.62 [0.08-4.84] NA NASTAT6 all R-ACVBP OS 16 67 0.18 [0.02-2.03] 1.65E-01 9.31E-01STAT6 all R-ACVBP PFS 16 67 0.41 [0.06-2.72] 3.58E-01 8.40E-01STAT6 all R-CHOP OS 8 108 0.22 [0.03-1.99] 1.79E-01 9.31E-01STAT6 all R-CHOP PFS 8 108 0.41 [0.09-1.78] 2.35E-01 7.56E-01STAT6 GC R-ACVBP OS 7 30 NA 3.12E-01 7.72E-01STAT6 GC R-ACVBP PFS 7 30 0.73 [0.08-6.25] 7.71E-01 9.33E-01STAT6 GC R-CHOP OS 4 36 NA 2.00E-01 7.72E-01STAT6 GC R-CHOP PFS 4 36 0.62 [0.08-4.84] 6.48E-01 9.07E-01STAT6 Other R-ACVBP OS 1 13 NA NA NASTAT6 Other R-ACVBP PFS 1 13 0.73 [0.08-6.25] NA NASTAT6 Other R-CHOP OS 1 16 NA NA NA
STAT6 Other R-CHOP PFS 1 16 0.62 [0.08-4.84] NA NASTAT6 PMBL R-ACVBP OS 8 2 NA NA NASTAT6 PMBL R-ACVBP PFS 8 2 0.73 [0.08-6.25] NA NASTAT6 PMBL R-CHOP OS 3 2 NA NA NASTAT6 PMBL R-CHOP PFS 3 2 0.62 [0.08-4.84] NA NATCF3 ABC R-ACVBP OS 1 21 NA NA NATCF3 ABC R-ACVBP PFS 1 21 NA NA NATCF3 ABC R-CHOP OS 0 54 NA NA NATCF3 ABC R-CHOP PFS 0 54 NA NA NATCF3 all R-ACVBP OS 2 81 NA NA NATCF3 all R-ACVBP PFS 2 81 NA NA NATCF3 all R-CHOP OS 1 115 NA NA NATCF3 all R-CHOP PFS 1 115 NA NA NATCF3 GC R-ACVBP OS 1 36 NA NA NATCF3 GC R-ACVBP PFS 1 36 NA NA NATCF3 GC R-CHOP OS 1 39 NA NA NATCF3 GC R-CHOP PFS 1 39 NA NA NATCF3 Other R-ACVBP OS 0 14 NA NA NATCF3 Other R-ACVBP PFS 0 14 NA NA NATCF3 Other R-CHOP OS 0 17 NA NA NATCF3 Other R-CHOP PFS 0 17 NA NA NATCF3 PMBL R-ACVBP OS 0 10 NA NA NATCF3 PMBL R-ACVBP PFS 0 10 NA NA NATCF3 PMBL R-CHOP OS 0 5 NA NA NATCF3 PMBL R-CHOP PFS 0 5 NA NA NATNFAIP3 ABC R-ACVBP OS 5 17 NA 4.36E-01 7.72E-01TNFAIP3 ABC R-ACVBP PFS 5 17 NA 1.42E-01 8.30E-01TNFAIP3 ABC R-CHOP OS 6 48 9.04 [2.82-28.98] 9.03E-06 7.86E-04TNFAIP3 ABC R-CHOP PFS 6 48 5.59 [1.91-16.39] 4.29E-04 3.04E-02TNFAIP3 all R-ACVBP OS 18 65 0.31 [0.03-3.01] 3.14E-01 9.74E-01TNFAIP3 all R-ACVBP PFS 18 65 0.42 [0.09-1.98] 2.71E-01 7.56E-01TNFAIP3 all R-CHOP OS 17 99 2.52 [0.96-6.63] 6.02E-02 7.83E-01TNFAIP3 all R-CHOP PFS 17 99 1.95 [0.81-4.73] 1.38E-01 7.20E-01TNFAIP3 GC R-ACVBP OS 4 33 NA 4.96E-01 7.72E-01TNFAIP3 GC R-ACVBP PFS 4 33 NA 3.82E-01 8.30E-01TNFAIP3 GC R-CHOP OS 5 35 0.97 [0.12-7.68] 9.75E-01 9.75E-01TNFAIP3 GC R-CHOP PFS 5 35 0.75 [0.10-5.84] 7.84E-01 9.33E-01TNFAIP3 Other R-ACVBP OS 3 11 NA NA NATNFAIP3 Other R-ACVBP PFS 3 11 2.83 [0.17-47.15] 4.50E-01 8.30E-01TNFAIP3 Other R-CHOP OS 2 15 9.04 [2.82-28.98] NA NATNFAIP3 Other R-CHOP PFS 2 15 5.59 [1.91-16.39] NA NATNFAIP3 PMBL R-ACVBP OS 6 4 0.58 [0.04-9.30] 6.95E-01 8.64E-01TNFAIP3 PMBL R-ACVBP PFS 6 4 0.58 [0.04-9.30] 6.95E-01 9.07E-01TNFAIP3 PMBL R-CHOP OS 4 1 9.04 [2.82-28.98] NA NATNFAIP3 PMBL R-CHOP PFS 4 1 5.59 [1.91-16.39] NA NATNFRSF14 ABC R-ACVBP OS 0 22 NA NA NATNFRSF14 ABC R-ACVBP PFS 0 22 0.54 [0.06-4.59] NA NATNFRSF14 ABC R-CHOP OS 2 52 NA NA NA
TNFRSF14 ABC R-CHOP PFS 2 52 NA NA NATNFRSF14 all R-ACVBP OS 13 70 0.00 [0.00-Inf] 9.99E-01 9.99E-01TNFRSF14 all R-ACVBP PFS 13 70 0.50 [0.06-4.13] 5.17E-01 8.66E-01TNFRSF14 all R-CHOP OS 11 105 0.31 [0.04-2.32] 2.51E-01 9.74E-01TNFRSF14 all R-CHOP PFS 11 105 0.23 [0.03-1.78] 1.61E-01 7.20E-01TNFRSF14 GC R-ACVBP OS 10 27 NA 2.30E-01 7.72E-01TNFRSF14 GC R-ACVBP PFS 10 27 0.54 [0.06-4.59] 5.63E-01 8.97E-01TNFRSF14 GC R-CHOP OS 4 36 NA 3.17E-01 7.72E-01TNFRSF14 GC R-CHOP PFS 4 36 NA 2.55E-01 8.30E-01TNFRSF14 Other R-ACVBP OS 3 11 NA NA NATNFRSF14 Other R-ACVBP PFS 3 11 NA 7.39E-01 9.33E-01TNFRSF14 Other R-CHOP OS 5 12 NA 1.60E-01 7.72E-01TNFRSF14 Other R-CHOP PFS 5 12 NA 9.97E-02 8.30E-01TNFRSF14 PMBL R-ACVBP OS 0 10 NA NA NATNFRSF14 PMBL R-ACVBP PFS 0 10 0.54 [0.06-4.59] NA NATNFRSF14 PMBL R-CHOP OS 0 5 NA NA NATNFRSF14 PMBL R-CHOP PFS 0 5 NA NA NATP53 ABC R-ACVBP OS 4 18 NA 4.99E-01 7.72E-01TP53 ABC R-ACVBP PFS 4 18 2.44 [0.44-13.60] 2.95E-01 8.30E-01TP53 ABC R-CHOP OS 10 44 1.23 [0.49-3.05] 6.61E-01 8.45E-01TP53 ABC R-CHOP PFS 10 44 1.29 [0.52-3.20] 5.86E-01 8.97E-01TP53 all R-ACVBP OS 8 75 1.68 [0.19-14.88] 6.43E-01 9.99E-01TP53 all R-ACVBP PFS 8 75 3.23 [0.98-10.67] 5.42E-02 7.04E-01TP53 all R-CHOP OS 23 93 1.06 [0.50-2.24] 8.89E-01 9.99E-01TP53 all R-CHOP PFS 23 93 1.07 [0.53-2.18] 8.48E-01 9.98E-01TP53 GC R-ACVBP OS 2 35 1.68 [0.19-14.88] NA NATP53 GC R-ACVBP PFS 2 35 3.23 [0.98-10.67] NA NATP53 GC R-CHOP OS 11 29 0.51 [0.11-2.44] 3.93E-01 7.72E-01TP53 GC R-CHOP PFS 11 29 0.71 [0.19-2.66] 6.08E-01 9.06E-01TP53 Other R-ACVBP OS 1 13 NA NA NATP53 Other R-ACVBP PFS 1 13 2.44 [0.44-13.60] NA NATP53 Other R-CHOP OS 1 16 1.23 [0.49-3.05] NA NATP53 Other R-CHOP PFS 1 16 1.29 [0.52-3.20] NA NATP53 PMBL R-ACVBP OS 1 9 NA NA NATP53 PMBL R-ACVBP PFS 1 9 2.44 [0.44-13.60] NA NATP53 PMBL R-CHOP OS 1 4 1.23 [0.49-3.05] NA NATP53 PMBL R-CHOP PFS 1 4 1.29 [0.52-3.20] NA NAXPO1 ABC R-ACVBP OS 0 22 1.60 [0.14-18.48] NA NAXPO1 ABC R-ACVBP PFS 0 22 1.16 [0.12-10.96] NA NAXPO1 ABC R-CHOP OS 0 54 NA NA NAXPO1 ABC R-CHOP PFS 0 54 NA NA NAXPO1 all R-ACVBP OS 5 78 1.60 [0.14-18.48] 7.07E-01 9.99E-01XPO1 all R-ACVBP PFS 5 78 1.16 [0.12-10.96] 8.99E-01 9.98E-01XPO1 all R-CHOP OS 4 112 NA NA NAXPO1 all R-CHOP PFS 4 112 NA NA NAXPO1 GC R-ACVBP OS 1 36 1.60 [0.14-18.48] NA NAXPO1 GC R-ACVBP PFS 1 36 1.16 [0.12-10.96] NA NAXPO1 GC R-CHOP OS 0 40 NA NA NA
XPO1 GC R-CHOP PFS 0 40 NA NA NAXPO1 Other R-ACVBP OS 1 13 2.16 [0.13-34.61] NA NAXPO1 Other R-ACVBP PFS 1 13 2.16 [0.13-34.61] NA NAXPO1 Other R-CHOP OS 0 17 NA NA NAXPO1 Other R-CHOP PFS 0 17 NA NA NAXPO1 PMBL R-ACVBP OS 3 7 2.16 [0.13-34.61] 5.77E-01 7.72E-01XPO1 PMBL R-ACVBP PFS 3 7 2.16 [0.13-34.61] 5.77E-01 8.97E-01XPO1 PMBL R-CHOP OS 4 1 NA NA NAXPO1 PMBL R-CHOP PFS 4 1 NA NA NA
Table S7: Prognostic impact of mutations in Lymphopanel genes.All genes were tested for prognostic impact, either over all subtypes or by subtype. Only patients with Rituximab (R)-based treatment were included in survival analysis, and were separated into two cohorts: patients treated with R-CHOP and patients treated with R-ACVBP. NA is given as a result for p-value or FDR when there are fewer than five patients in either the WT or the mutated group.
top related