cryptic speciation in the white shouldered antshrike thamnophilus aethiops aves thamnophilidae the...
Post on 06-Jul-2018
219 Views
Preview:
TRANSCRIPT
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
1/16
Cryptic speciation in the white-shouldered antshrike (Thamnophilusaethiops, Aves – Thamnophilidae): The tale of a transcontinentalradiation across rivers in lowland Amazonia and the northeasternAtlantic Forest
Gregory Thom a, Alexandre Aleixo b,⇑
a Curso de Pós-graduação em Zoologia, Universidade Federal do Pará/Museu Paraense Emílio Goeldi, Caixa Postal 399, CEP 66040-170 Belém, PA, Brazilb Coordenação de Zoologia, Museu Paraense Emílio Goeldi, Caixa Postal 399, CEP 66040-170 Belém, PA, Brazil
a r t i c l e i n f o
Article history:
Received 23 June 2014
Revised 20 September 2014
Accepted 26 September 2014
Available online 5 October 2014
Keywords:
Diversification hypotheses
Historical biogeography
Phylogeography
Population genetics
Refuges
Taxonomy
a b s t r a c t
The growing knowledge on paleogeography and the recent applications of molecular biology and phylo-
geography to the study of the Amazonian biota have provideda framework for testing competinghypoth-
eses of biotic diversification in this region. Here, we reconstruct the spatio-temporal context of
diversification of a widespread understory polytypic Amazonian bird species (Thamnophilus aethiops)
and contrast it with different hypotheses of diversification and the taxonomy currently practiced in the
group. Sequences of mtDNA (cytochrome b and ND2) and nuclear (b-fibrinogen introns 5 and 7 and the
Z-liked Musk4) genes, addingup to 4093 bp of 89 individuals covering the Amazonian, Andean, andAtlan-
tic Forest populations of T. aethiops were analyzed. Phylogenetic and population genetics analyses
revealed ten reciprocally monophyletic and genetically isolated or nearly-isolated lineages in T. aethiops,
highlighting several inconsistencies between taxonomy and evolutionary history in this group. Our data
suggest that the diversification of T. aethiops started in the Andean highlands, and then proceeded into
the Amazonian lowlands probably after the consolidation of the modern Amazonian drainage. The main
cladogenetic events in T. aethiops may be related to the formation and structuring of large Amazonian riv-
ers during the Late Miocene–Early Pleistocene, coinciding with the dates proposed for other lineages of
Amazonian organisms. Population genetics data do not support climatic fluctuations as a major source
of diversification in T. aethiops. Even though not entirely concordant with paleobiogeographic models
derived from phylogenies of other vertebrate lineages, our results support a prominent role for rivers as
major drivers of diversification in Amazonia, while underscoring that different diversification scenarios
are probably related to the distinct evolutionary origins of groups being compared.
2014 Elsevier Inc. All rights reserved.
1. Introduction
Since the 19th century, the high species diversity of the Amazon
allied to multifaceted patterns of geographical distributions insti-gated naturalists and researchers to explain such complexity
(Wallace, 1852; Haffer, 1969; Bates, 2001).
Despite the large number of distinct hypotheses to explain
Amazonian biodiversity (e.g., refuge hypothesis, Haffer, 1969; riv-
erine hypothesis, Wallace, 1852; Ayres and Clutton-Brock, 1992;
riverine-refuge hypothesis, Ayres and Clutton-Brock, 1992;
Haffer, 1993, 2001; ecological gradients hypothesis, Endler, 1977;
‘‘museum’’ hypothesis, Roy et al., 1997; and marine incursions,
Bates, 2001), and the common sense that many causations have
operated for the formation of such diversity (Bush, 1994; Haffer,
2001; Miller et al., 2008), recent phylogeographic and paleobioge-
ographic reconstructions (Aleixo and Rossetti 2007; Patel et al.,2011; Weir and Price, 2011; Ribas et al., 2012) have postulated
the formation of the current Amazonian physical landscape as
the main source of cladogenetic events among the studied lineages.
The formation of the Amazon basin was ultimately driven by
the Andean uplift and related arches, which resulted in the forma-
tion of a large fluvio-lacustrine system in western Amazonia, dur-
ing the early Miocene (Espurt et al., 2010; Mora et al., 2010). With
the continuous rise of the Andes in the middle Miocene, this sys-
tem probably expanded to the Purus Arch, a tectonic structure
located 300 km west of Manaus, and which separates the Solimões
and Amazonas sedimentary basins (Figueiredo et al., 2009; Hoorn
http://dx.doi.org/10.1016/j.ympev.2014.09.023
1055-7903/ 2014 Elsevier Inc. All rights reserved.
⇑ Corresponding author.
E-mail address: aleixo@museu-goeldi.br (A. Aleixo).
Molecular Phylogenetics and Evolution 82 (2015) 95–110
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / y m p e v
http://dx.doi.org/10.1016/j.ympev.2014.09.023mailto:aleixo@museu-goeldi.brhttp://dx.doi.org/10.1016/j.ympev.2014.09.023http://www.sciencedirect.com/science/journal/10557903http://www.elsevier.com/locate/ympevhttp://www.elsevier.com/locate/ympevhttp://www.sciencedirect.com/science/journal/10557903http://dx.doi.org/10.1016/j.ympev.2014.09.023mailto:aleixo@museu-goeldi.brhttp://dx.doi.org/10.1016/j.ympev.2014.09.023http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://crossmark.crossref.org/dialog/?doi=10.1016/j.ympev.2014.09.023&domain=pdfhttp://-/?-
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
2/16
et al., 2010). The period when the Purus Arch was breached prob-
ably marked the onset of the development of the transcontinental
Amazon River, draining eastward the western fluvio-lacustrine
system, and enabling the formation of upland terra-firme forests
in the western Amazonia; however, the timing of this event is still
a matter of controversy, with two main proposed periods based on
different sources of evidence: late Miocene, between 6.5 and 10 Ma
(Hoorn et al., 2010; Latrubesse et al., 2010) and Pliocene (approx-imately 2.5 Ma; Campbell et al., 2006). Despite the fact that major
interfluves of the Amazonian region delineate the geographical
distribution of most endemic vertebrate taxa and that this has pro-
vided the basis for the recognition of the so called areas of ende-
mism (Cracraft, 1985; Silva et al., 2005), the process of river
dynamics driving population divergence is still poorly understood,
with multiple area-relationships patterns documented so far
(Aleixo, 2004; Fernandes et al., 2012; Ribas et al., 2012; d’Horta
et al., 2013). This suggests that although rivers have been barriers
to gene flow, other historical events probably contributed to the
overall diversification pattern. However, this knowledge is still
meager when compared with the rich and complex biodiversity
of Amazonia, preventing the recognition of a general model or sets
of heuristic models of diversification, corroborated by several
lineages.
The polytypic species Thamnophilus aethiops (Aves: Thamno-philidae) is a good model to study the paleobiogeography of the
Amazon basin due the following reasons: (1) it is widely distrib-
uted in Amazonia and neighboring areas such as the Andes and
the Atlantic Forest in eastern Brazil, two areas known to be histor-
ically connected to the development of modern Amazonia; (2) it is
restricted to the understory of upland terra-firme forest, rapidlyresponding to environmental change (Stotz et al., 1996); and (3)
subspecies distributions are mainly bounded by the major tributar-
ies of the Amazon River, with some important exceptions that can
provide insights into the circumstances whereby a single lineage
does and does not respond to rivers as barriers. Thus, we estimated
the spatio-temporal scenario of diversification of the polytypic T.
aethiops to address the following questions: (1) what are the evo-lutionary relationships among the populations/subspecies of T.aethiops? (2) what are the relationships between the events that
led to diversification in T. aethiops and the paleogeographic modelsproposed for the formation of Amazonia? (3) do the demographic
history of the studied populations support any particular diversifi-
cation hypothesis?
2. Material and methods
2.1. Samples, laboratory procedures, and data analyses
A total of 89 individuals from 55 localities were sampled
throughout the distribution of T. aethiops in Amazonia, northeast-ern Atlantic Forest and the Andean foothills, covering nine of ten
described subspecies (Zimmer and Isler, 2003; Fig. 1b, Table 1).
Only T. a. wetmorei, purportedly endemic to the Andean foothills
of Colombia, was not sampled. Nonetheless, we assume here that
that this taxon is closely related to the polionotus subspecies fromnorthwestern Amazonia, from which it is hardly differentiated
based on plumage characters (Zimmer and Isler, 2003). Subspecific
identification of our samples were made through the inspection of
voucher specimens and followed the most recent taxonomy pro-
posed for T. aethiops (Zimmer and Isler 2003). We used Thamnophi-lus aroyae, T. unicolor , and T. caerulescens as outgroups due theirclose relationship to T. aethiops (Brumfield and Edwards, 2007).
Total DNA was extracted from approximately 20 mg of muscle
tissue following a standard phenol/chloroform protocol(Sambrook et al., 1989) or with the aid of a DNeasy Quiagen
(Hilden, Germany) extraction kit. We amplified the mitochondrial
genes cytochrome b (cyt b, 992 bp, n = 88) and NADH dehydroge-nase subunit 2 (ND2, 1041 bp, n = 79), as well as the nuclear genesb-fibrinogen intron 7 (Bf7, 963 bp, n = 51), b-fibrinogen intron 5
(Bf5, 532 bp, n = 63), and the intron 4 of the skeletal muscle recep-tor of tyrosine kinase (Musk4, 565 bp, n = 64) linked to the Z chro-mosome (see Table 2 for the primers used). Polymerase chain
reaction (PCR) was performed with 25ll of final volume, andapproximately 50 ng of genomic DNA, 1.5–2.5 mM of MgCl2,200 mM of dNTPs and 0.1 U of Taq DNA polymerase Promega
(Madison, WI, USA). Reactions started with a denaturation step at
94 C for 5 min, followed by 35 cycles of three steps: (1) 94 C for
1 min; (2) annealing temperatures ranging from 50 C (cyt b andBf5) and 52 C (Musk4) to 59 C (ND2, Bf7) for 1 min; and (3)
72 C for 1 min. The last step, for the extension, was at 72 C for
5 min. PCR products were purified with the Polyethylene glycol
protocol (PEG). Sequencing was carried out on an ABI 3130 auto-
mated capillary sequencer (Applied Biosystems, Foster City, Cali-
fornia, USA) with the ABI Prism Big Dye terminator Kit. To
confirm observed mutations, both strands of each sample were
sequenced. The DNA strands were edited and aligned manually
in BIOEDIT 7.0.5 (Hall, 1999). Saturation of the nucleotide substitu-
tions in the mitochondrial DNA were evaluated using the software
DAMBE (Xia and Xie, 2001). For nuclear loci, heterozygous nucleo-
tide positions were inferred by the presence of double peaks of the
same size in the electropherogram. To obtain the gametic phase of
haplotypes of the heterozygous individuals, we used a Bayesian
approach as implemented in PHASE 2.1 1 (Stephens et al., 2001;
Stephens and Donnelly, 2003; Stephens and Scheet, 2005). The
threshold of 70% of posterior probability was assumed as a confi-
dence value for the analyzed haplotypes (see Harrigan et al.,
2008). Lower values were regarded as ambiguous. To obtain the
gametic phase for individuals heterozygous in size (presence of
indels in one of the strands), we used the program CHAMPURU
v1.0 (Flot et al., 2006; Flot, 2007; available online at http://
www.mnhn.fr/jfflot/champuru/). Females did not have the gametic
phase estimated for Musk4, since this gene is linked to de Z chro-mosome. To test the hypothesis of neutral evolution among inde-
pendent loci we performed the Tajima’s D test (Tajima, 1989)
using DNASP v.4.10.9 (Rozas et al., 2003). The significance for these
tests was assessed through 10.000 coalescence simulations. To
check for possible recombination among the nuclear loci we used
the phi test as implemented in the SPLITSTREE 4.10 software
(Huson and Bryant, 2006).
2.2. Phylogenetic analyses
2.2.1. Concatenated genes and gene treesThe phylogenetic analyses were performed using Bayesian
inference (BI) in MrBAYES 3.1.2 (Ronquist and Huelsenbeck,
2003) and Maximum likelihood (ML) in RaxML 7.0.3 (Stamatakis,2006). The evolutionary models which best explain the evolution
of each dataset were selected in JMODELTEST 0.1.1 (Posada,
2008), using the Bayesian information criterion (BIC) for BI and
the Akaike information criterion (AIC) for ML. For the BI analyses
with the concatenated dataset, a Bayes factor analysis (Brandley
et al., 2005) selected four partitions (mtDNA + one separate parti-
tion for each nuclear gene) as the best partitioning scheme. The
evolutionary models for each partition were: (1) mtDNA (GTR + G);
(2) Bf5 (GTR + I + G); (3) Bf7 (GTR + I); and (4) Musk4 (HKY + G).
The BI estimated based on mtDNA only used one model for the
two genes (GTR + G). BI analyses were generated through two
independent runs of 1 107 generations, each with four Markov
chains. The parameters of the chains were sampled every 1000
generations and the first 1000 trees were discarded as burn-in.The posterior probabilities for each estimated node were obtained
96 G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110
http://www.mnhn.fr/jfflot/champuru/http://www.mnhn.fr/jfflot/champuru/http://www.mnhn.fr/jfflot/champuru/http://www.mnhn.fr/jfflot/champuru/
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
3/16
Fig. 1. (a) Phylogenetic relationships among major clades of the polytypic Thamnophilus aethiops and outgroups derived from Bayesian and Maximum likelihood inferences
based on sequences of the mtDNA genes (cyt b and ND2; 2033 bp) and all loci combined (cyt b, ND2, Bf5, Bf7 and Musk4; 4093 bp). Nodal support values correspond to
posterior probabilities (above) and bootstrap pseudo-replicates (below) obtained, respectively, in the mtDNA and concatenated dataset analyses. (b) Map showing the current
distribution and sampled localities of major clades of the polytypic T. aethiops. Sample codes are the same used in Fig. 1a and Table 1. (c) Haplotype network of the five
sequenced genes estimated through HaploViewer (Salzburger et al., 2011). Clade colors are the same as in Fig. 1a and 1b. Numbers inside circles represent actual number of
individuals having a particular haplotype, with circle sizes being proportional to it, while numbers on connecting branches are nucleotide substitutions higher than one
separating haplotypes. Asterisks beside light blue circles represent the number of individuals from the Pernambuco area of endemism. (d) Bayesian Phylogenetics and
Phylogeography (BP&P) results. Numbers on braches represent the number of times a given node was recovered with a speciation probability P0.95 based on six analyses
performed using two algorithms (0 and 1) and three combinations of priors on ancestral population sizes and divergence times (see methods). (e) Overlapped Bayesian
estimatedchronogramsderived fromalternativedating analyses based on theconcatenated mtDNA (cyt b andND2; 2033 bp;branches and95% of confidence interval in dark
gray) and a multi-locus coalescent species tree (mtDNA, Bf5/Bf7 andMusk4; 4093 bp; branches and 95%confidence intervals in Black). Asterisks andcrosses represent values
of posterior probability P95% for the species tree and concatenated mtDNA analyses, respectively. (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of this article.)
G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110 97
http://-/?-
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
4/16
Table 1
Code (asin Fig. 1a andb), taxon(speciesor subspecies followingthe taxonomy in Zimmer and Isler, 2003), lineage (namedaccordingto recognizedNeotropicalareas of endemism as
in Silvaet al., 2005, withsome modifications), N – vouchernumber, Inst.– institution(MPEG: MuseuParaense Emílio Goeldi; LSUMZ: Louisiana State UniversityMuseum of Natural
Science), and locality information (presented coordinates are plotted in Fig. 1b) associated with each sample of Thamnophilus aethiops and outgroups sequenced in this study.
Code Taxon Lineage N Inst. Locality Coordinates
T1 T. a. atriceps Tapajós 63,888 MPEG Brazil, Pará, Altamira, Floresta Nacional de Altamira 06S0401200
55W1901200
T2 T. a. atriceps Tapajós 70,861 MPEG Brazil, Pará, Itaituba, Miritituba 04S2602400
55W380
2400
T2 T. a. atriceps Tapajós 70,862 MPEG Brazil, Pará, Itaituba, Miritituba
T3 T. a. atriceps Tapajós 59,159 MPEG Brazil, Pará, Novo Progresso, 20 km SW 07S1102400
55W3000000
T3 T. a. atriceps Tapajós 59,160 MPEG Brazil, Pará, Novo Progresso, 20 km SW
T3 T. a. atriceps Tapajós 59,161 MPEG Brazil, Pará, Novo Progresso, 20 km SW
X1 T. a. atriceps Xingu 57,707 MPEG Brazil, Pará, Senador José Porfírio, Rio Xingu 02S3202400
51W3300000
X1 T. a. atriceps Xingu 57,708 MPEG Brazil, Pará, Senador José Porfírio, Rio Xingu
X1 T. a. atriceps Xingu 57,709 MPEG Brazil, Pará, Senador José Porfírio, Rio Xingu
X2 T. a. atriceps Xingu 70,635 MPEG Brazil, Pará, Carajás, Serra dos Carajás 06S0000000
51W1904800
X3 T. a. atriceps Xingu 70,658 MPEG Brazil, Pará, Carajás, Serra dos Carajás, Serra Norte 06S0900000
50W2400000
P1 T. a. distans Pernambuco 70,454 MPEG Brazil, Alagoas, Ibateguara, Engenho Coimbra 09S1001200
35W3202400
P1 T. a. distans Pernambuco 70,455 MPEG Brazil, Alagoas, Ibateguara, Engenho Coimbra
P1 T. a. distans Pernambuco 70,457 MPEG Brazil, Alagoas, Ibateguara, Engenho Coimbra
P2 T. a. distans Pernambuco 70,459 MPEG Brazil, Pernambuco, Barreiros, Cachoeira Linda 08S4800000
35W1901200
P2 T. a. distans Pernambuco 70,460 MPEG Brazil, Pernambuco, Barreiros, Cachoeira Linda
P2 T. a. distans Pernambuco 70,458 MPEG Brazil, Pernambuco, Barreiros, Cachoeira Linda
B1 T. a. incertus Belém 58,647 MPEG Brazil, Pará, Santa Bárbara, Parque Ecológico GUNMA 01S3303600
47W3903600
B2 T. a. incertus Belém 61,190 MPEG Brazil, Pará, Barcarena 02S1800000
48W3903600
B2 T. a. incertus Belém 61,192 MPEG Brazil, Pará, Barcarena
B3 T. a. incertus Belém 58,632 MPEG Brazil, Pará, Tomé-Açú, Quatro Bocas 02S3202400
48W0104800
B4 T. a. incertus Belém 70,559 MPEG Brazil, Pará, Curuça 01S0202400
47W2703600
EI1 T. a. injunctus Eastern Inambari 68,883 MPEG Brazil, Amazonas, Careiro, Br 319 km 04S0404800
60W3903600
EI2 T. a. injunctus Eastern Inambari 71,054 MPEG Brazil, Amazonas, Humaitá, Rio Ipixuna 07S3101200
63W2002400
EI2 T. a. injunctus Eastern Inambari 71,055 MPEG Brazil, Amazonas, Humaitá, Rio Ipixuna
EI2 T. a. injunctus Eastern Inambari 71,056 MPEG Brazil, Amazonas, Humaitá, Rio Ipixuna
EI2 T. a. injunctus Eastern Inambari 71,057 MPEG Brazil, Amazonas, Humaitá, Rio Ipixuna
EI3 T. a. injunctus Eastern Inambari 60,637 MPEG Brazil, Acre, Senador Guiomard, Ramal Nabor Júnior 09S4604800
67W1904800
WI1 T. a. kapouni Western Inambari 58,016 MPEG Brazil, Acre, Parque Nacional Serra do Divisor 08S2100000
73W1803600
WI2 T. a. kapouni Western Inambari 59,837 MPEG Brazil, Acre, Assis Brasil, ESEC Rio Acre 11S0303600
70W1601200
WI3 T. a. kapouni Western Inambari 60,171 MPEG Brazil, Amazonas, RDS Cujubim, Rio Jutaí 04S3900000
68W1904800
WI4 T. a. kapouni Western Inambari 60,631 MPEG Brazil, Acre, Tarauacá, Br 364 km 40, Rio Liberdade 07S5302400
71W3903600
WI4 T. a. kapouni Western Inambari 60,632 MPEG Brazil, Acre, Tarauacá, Br 364 km 40, Rio Liberdade
WI5 T. a. kapouni Western Inambari 62,071 MPEG Brazil, Acre, Porto Walter, Igarapé Cruzeiro do Vale 08S3300000
72W5201200
WI6 T. a. kapouni Western Inambari 40,722 LSUMZ Peru, Loreto, 86 km SE Juanjui 07S3301900
75W5403200
WI6 T. a. kapouni Western Inambari 40,661 LSUMZ Peru, Loreto, 86 km SE Juanjui
WI7 T. a. kapouni Western Inambari 11,235 LSUMZ Peru, Ucayali, SE Cerro Tahuayo, ENE Pucallpa 08S2503300
74W2202600
WI8 T. a. juruanus Western Inambari 59,966 MPEG Brazil, Acre, Rio Branco, Fazenda Experimental Catuaba 02S1904800
67W3600000
WI9 T. a. juruanus Western Inambari 60,634 MPEG Brazil Acre, Bujari, Floresta Estadual do Antimary 09S2100000
68W0600000
WI9 T. a. juruanus Western Inambari 60,636 MPEG Brazil Acre, Bujari, Floresta Estadual do Antimary
WI10 T. a. juruanus Western Inambari 60,638 MPEG Brazil, Acre, Plácido de Castro, Ramal Novo Horizonte 10S0704800
67W1904800
WI11 T. a. juruanus Western Inambari 61,297 MPEG Brazil, Acre, Rio Branco, Ramal Jarinal 09S5403600
68W1901200
WI11 T. a. juruanus Western Inambari 61,298 MPEG Brazil, Acre, Rio Branco, Ramal Jarinal
WI11 T. a. juruanus Western Inambari 61,300 MPEG Brazil, Acre, Rio Branco, Ramal Jarinal
98 G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
5/16
Table 1 (continued)
Code Taxon Lineage N Inst. Locality Coordinates
WI12 T. a. juruanus Western Inambari 62,069 MPEG Brazil, Acre, Mâncio Lima, Estrada do Barão 07S3300000
72W3603600
WI12 T. a. juruanus Western Inambari 62,070 MPEG Brazil, Acre, Mâncio Lima, Estrada do Barão
WI13 T. a. juruanus Western Inambari 59,965 MPEG Brazil, Acre, Porto Acre, Reserva Humaitá 09S4503600
67W4001200
WI14 T. a. juruanus Western Inambari 63,336 MPEG Brazil, Acre, Santa Rosa, Rio Purus 09S0701200
69W4904800
WI15 T. a. juruanus Western Inambari 64,546 MPEG Brazil, Acre, Senador Guiomard, Ramal Oco do Mundo 09S5002400
67W4901200
WI16 T. a. juruanus Western Inambari 8984 LSUMZ Bolivia, Pando, Nicolás Suarez, 12km by road of Cobija 11S1000200
68W2601800
WI17 T. a. juruanus Western Inambari 1164 LSUMZ Bolivia, La Paz, 20 k m by Rio Beni N. Puerto Linares 15S1400600
67W3701100
EN1 T. a. polionotus Eastern Negro 59,521 MPEG Brazil, Amazonas, Barcelos, Rio Aracá 00S2501200
62W5602400
EN1 T. a. polionotus Eastern Negro 59, 522 MPEG Brazil, Amazonas, Barcelos, Rio Aracá
EN1 T. a. polionotus Eastern Negro 59, 523 MPEG Brazil, Amazonas, Barcelos, Rio Aracá
WN1 T. a. polionotus Western Negro 59,524 MPEG Brazil, Amazonas, Barcelos, Rio Cuiuni 00S4604800
63W1604800
WN2 T. a. polionotus Western Negro 59,525 MPEG Brazil, Amazonas, Novo Airão, Igarapé-Açu 02S5100000
60W5100000
WN3 T. a. polionotus Western Negro 62,770 MPEG Brazil, Amazonas, Maraã, Lago Cumapi 01S4304800
65W520
4800
WN3 T. a. polionotus Western Negro 62, 771 MPEG Brazil, Amazonas, Maraã, Lago Cumapi
NR1 T. a. punctuliger Northern Rondônia 62,215 MPEG Brazil, Amazonas, Juruti, Base Capiranga 02S2801200
56W0000000
NR1 T. a. punctuliger Northern Rondônia 62,216 MPEG Brazil, Amazonas, Juruti, Base Capiranga
NR1 T. a. punctuliger Northern Rondônia 58,100 MPEG Brazil, Amazonas, Juruti, Base Capiranga
NR2 T. a. punctuliger Northern Rondônia 68,944 MPEG Brazil, Pará, Jacareacanga, Terra do Burandir 06S1500000
57W5201200
NR2 T. a. punctuliger Northern Rondônia 68,965 MPEG Brazil, Pará, Jacareacanga, Terra do Burandir
NR3 T. a. punctuliger Northern Rondônia 66,127 MPEG Brazil, Pará, Santarém, Retiro 02S2400000
55W4702400
NR4 T. a. punctuliger Northern Rondônia 67,048 MPEG Brazil, Amazonas, Maués, Flona do Pau Rosa 03S5403600
58W2400000
SR1 T. a. punctuliger Southern Rondônia 54,953 MPEG Brazil, Rondônia, Guajará-Mirim, REBIO Ouro Preto 10S4904800
64W4500000
SR1 T. a. punctuliger Southern Rondônia 54,955 MPEG Brazil, Rondônia, Guajará-Mirim, REBIO Ouro Preto
SR2 T. a. punctuliger Southern Rondônia 61, 575 MPEG Brazil, Mato Grosso, Querência, Fazenda Tanguro 12S5302400
52W2201200
SR2 T. a. punctuliger Southern Rondônia 61,576 MPEG Brazil, Mato Grosso, Querência, Fazenda Tanguro
SR2 T. a. punctuliger Southern Rondônia 70,226 MPEG Brazil, Mato Grosso, Querência, Fazenda Tanguro
SR3 T. a. punctuliger Southern Rondônia 67,397 MPEG Brazil, Mato Grosso, Paranaíta, Rio Teles Pires 09S3300000
56W3401200
SR3 T. a. punctuliger Southern Rondônia 67,396 MPEG Brazil, Mato Grosso, Paranaíta, Rio Teles Pires
SR3 T. a. punctuliger Southern Rondônia 67,398 MPEG Brazil, Mato Grosso, Paranaíta, Rio Teles Pires
SR4 T. a. punctuliger Southern Rondônia 67, 442 MPEG Brazil, Mato Grosso, Paranaíta, Fazenda Aliança 09S4004800
56W5103600
SR4 T. a. punctuliger Southern Rondônia 67,443 MPEG Brazil, Mato Grosso, Paranaíta, Fazenda Aliança
SR5 T. a. punctuliger Southern Rondônia 69, 215 MPEG Brazil, Mato Grosso, Paranaíta, Fazenda Paranaíta 09S3404800
56W4301200
SR6 T. a. punctuliger Southern Rondônia 58,704 MPEG Brazil, Amazonas, Humaitá, T. Indígena Parintintin 07S5700000
62W2201200
SR6 T. a. punctuliger Southern Rondônia 58,705 MPEG Brazil, Amazonas, Humaitá, T. Indígena Parintintin
SR6 T. a. punctuliger Southern Rondônia 58,707 MPEG Brazil, Amazonas, Humaitá, T. Indígena Parintintin
SR7 T. a. punctuliger Southern Rondônia 14,649 LSUMZ Bolivia, Santa Cruz, Serrania de Huanchaca 14S3104800
60W410
2400
A1 T. a. aethiops 5500 LSUMZ Peru, San Martín, 28 k m by road NE Tarapoto 06S2600600
76W1900400
T aroyae 38,993 LSUMZ Bolivia, Cochabamba, Chapare
T aroyae 38,985 LSUMZ Bolivia, Cochabamba, Chapare
T aroyae 22,836 LSUMZ Bolivia, La Paz
T. unicolor 12,144 LSUMZ Ecuador, Pichincha, Mindo
T. unicolor 6196 LSUMZ Morona-Santiago Province
T. unicolor 7741 LSUMZ Ecuador, Caóar
T. unicolor 32,602 L SUMZ P eru, Cajamarca
T. unicolor 43,515 LSUMZ Peru, San Martín
G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110 99
http://-/?-
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
6/16
through a majority rule consensus of the remaining MCMC sam-
ples. The ML analyses were not partitioned and the evolutionary
models selected were GTR + I + G for the concatenated (all loci)
and GTR + G for the mtDNA datasets. Nodal support was estimated
with 1000 bootstrap pseudo-replicates. Both BI and ML analyses
with the concatenated dataset (all loci) were performed using
the nuclear genes with both gametic phases and the mitochondrial
genes duplicated. To visualize genealogical relationships among
individuals of each sequenced gene, haplotype networks were con-
structed in HaploViewer (Salzburger et al., 2011) based on the
topologies recovered in the species tree analysis. Mean pairwise
p-distances (Nei, 1987) within and among populations were calcu-lated using the mtDNA dataset only in MEGA 4.0 ( Tamura et al.,
2007).
2.2.2. Species treeRecent approaches have shown that multi-locus analyses with
concatenated datasets can result in well-supported topologies thatare incongruent with the true species tree, particularly in recent
scenarios of diversification (Degnan and Rosenberg, 2009;
Kubatko and Degnan, 2007). Thus, we used a Bayesian hierarchical
model implemented in *BEAST 1.6.1 (Drummond and Rambaut,
2007; Heled and Drummond, 2010) to obtain an estimate of the
species tree for the different lineages of T. aethiops. For thisapproach, we assumed three independent loci: (1) mtDNA (cyt band ND2); (2) Bf5 and Bf7; and (3) Musk4. The evolutionary models
were the same used in the BI for the concatenated dataset, with the
addition of the locus joining the Bf5 and Bf7 genes, for which the
GTR + I + G model was selected. We performed an initial run of
5 107 generations to optimize the analysis operators. Afterwards,
five independent runs of 5 107 generations were performed,
sampling the parameters of the Markov chain every 1000 genera-
tions, until the effective sample sizes (ESS) of all parameters were
equal or higher than 200 (Kuhner 2008). Four independent runs
were performed and combined in a majority rule consensus tree
with posterior probability support. TRACER 1.5 (Rambaut and
Drummond, 2007) was used to access ESS values and verify when
the MCMC reached stable and convergent values, allowing for a
definition of burn-in values. Based on the obtained results and
under a conservative approach, the first 5000 samples of each
run were discarded as burn-in. The purported species in this anal-
ysis were the reciprocally monophyletic populations of T. aethiopsrevealed by the BI and ML analyses (Fig. 1a).
2.2.3. Species delimitation
We implemented a coalescent-based bayesian modelingapproach to generate speciation probabilities of closely related
taxa from multi locus sequence data using the program Bayesian
Phylogenetics and Phylogeography (BP&P v.2.0b; Yang and
Rannala 2010), considered the most accurate coalescent-based
method for species delimitation evaluated by Camargo et al.
(2012). The model implemented in BP&P assumes no gene flow
among species, no recombination, and takes into account gene tree
uncertainty and lineage sorting. BP&P incorporates a model that
include the species divergence times (s), and the population sizeparameters h = 4N l, where N is the effective population size andl is the substitution rate per site per generation. However, reason-able prior distributions of population parameters can be difficult to
determine, potentially affecting the posterior probability of species
delimitations (Yang and Rannala 2010). Thus, we implemented the
approach of Leaché and Fujita (2010), performing analyses using
three combination of priors representing different population sizes
and ages for the root of the species tree as follows: (1) large ances-
tral population size and deep divergences (h and s gamma priorsG(1, 10) and G(1, 10)); (2) small ancestral population size and shal-
low divergences among species (h and s gamma priors G(2, 2000)and G(2, 2000)); and 3) large ancestral population size and shallow
divergences among species (h and s gamma priors G(1, 10) andG(2, 2000)). We ran the analyses for 1 106 generations, sampling
every five and discarding the first 5 104 generations as burn-in,
using the algorithms 0 and 1 with different fine tuning parameters
(e = 5 for algorithm 0 and a = 2 and m = 1 for algorithm 1). We usedthe populations and the topology obtained through the species tree
analyses as the guide tree (Fig. 1e). The population occurring dis-
junctly in the Pernambuco region (Atlantic Forest) was considered
a distinct lineage, sister to that of the Belém area of endemism
population.
2.3. Molecular dating
To estimate the divergence times among T. aethiops populationsrevealed by the BI and ML phylogeny estimates, a second BI was
carried out using only the mtDNA dataset (cyt b and ND2). Afterthe selection of the model of molecular evolution for this dataset
with JMODELTEST 0.1.1 (Posada, 2008), a preliminary run of
1 107 generations was performed in BEAST 1.6.1 (Drummond
and Rambaut, 2007) fixing the rate of nucleotide mutations at
1.0 per millions years for the cyt b (for which a robust calibrationis available; Weir and Schluter, 2008) and estimating that for the
ND2 under the options relaxed clock and uncorrelated lognormal.
This analysis was performed to evaluate whether both mitochon-
drial genes were evolving at similar rates and the cyt b calibration
could be applied to ND2. After the confirmation that these twogenes were evolving at similar rates, the overall molecular clock
Table 2
List of primers used in PCR amplifications and in DNA cycles sequencing reactions of samples of Thamnophilus aethiops and outgroups sequenced in this study.
Gene Primer Sequence 50–30 Source
Cyt b L14990 CCA TCC AAC ATC TCA GCA TGA TGA AA Brumfield et al. (2007)
H16065 AAC TGC AGT CAT CTC CGG TTT ACA AGA C Brumfield et al. (2007)
ND2 L5215 TAT CGG GCC CAT ACC CCG AAA AT Brumfield et al. (2007)
H5677 DGA DGA RAA DGC YAR RAY YTT DCG Brumfield et al. (2007)
L5758 GGN GGN TGR RBH GGN YTD AAY CAR AC Brumfield et al. (2007)
H6313 CTC TTA TTT AAG GCT TTG AAG GC Brumfield et al. (2007)
bf7 Fib-B17L TCC CCA GTA GTA TCT GCC ATT AGG GTT Prychitko and Moore (1997)
Fib-B17U GGA GAA AAC AGG ACA ATG ACA ATT CAC Prychitko and Moore (1997)
bf5 Fib5L CGC CAT ACA GAG TAT ACT GTG ACA T Brumfield et al. (2007)
Fib5H GCC ATC CTG GCG ATC TGA A Brumfield et al. (2007)
Musk4 Musk13R CTCTGAACATTGTGGATCCTCAA Clark and Witt (2)006
Musk13F CTTCCATGCACTACAATGGGAAA Clark and Witt (2006)
100 G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
7/16
calibration used was 2.1% of nucleotide substitutions per million
years (Weir and Schluter, 2008), under the relaxed clock and
uncorrelated lognormal options. We performed an initial run of
1 107 generations to optimize the analysis operators. Afterwards,
two independent runs of 1 107 generations were performed,
sampling the parameters of the Markov chain every 1000 genera-
tions, until the ESS of all parameters were equal or higher than
200. Based on the obtained results and under a conservativeapproach, the first 800 samples of each run were discarded as
burn-in. Values of posterior probability and divergence times were
estimated through a majority rule consensus of the remaining
samples. For this analysis we used only one individual from each
populations using the Yule process as a speciation prior.
Analyses based on a multi-locus coalescent approach enable a
more accurate estimate of divergence processes, since gene diver-
gence times normally occur before true speciation events
(Maddison and Knowles, 2006; Carstens and Knowles, 2007;
Edwards et al., 2007; Heled and Drummond, 2010; McCormack
et al., 2010). Thus, during the species tree analysis, we set for the
mtDNA dataset (cyt b and ND2 genes) the mutation rate of 2.1%substitutions per million years (Weir and Schluter, 2008), whereas
those of the nuclear loci (Bf5/Bf7 and Musk4) were estimated in
comparison to that of the mtDNA under a Yule process speciation
prior.
2.4. Population genetics, historical demography, and gene flow
The recognized groups for the population genetics analyses
were the reciprocally monophyletic populations revealed by the
BI, ML, and species tree analyses (Fig. 1a and e). Even though pop-
ulations of the Belém and Pernambuco areas of endemism did not
show significant genetic differentiation and have not acquired reci-
procal monophyly, they were recognized as independent popula-
tions in the population genetics and network analyses, since they
are currently separated by a long stretch of non-forest environ-
ments (Cerrado and Caatinga, Ab’Saber, 1977), without possibility
of current gene flow.We analyzed sequences of the three sampled loci (mtDNA, Bf5/
Bf7 and Musk4) and populations with a minimum sampling of at
least five individuals. The nuclear loci were used with both gametic
phases, except females for Musk4. To estimate changes in historical
demography through non-neutral models of evolution, we per-
formed the Tajima’s D (Tajima, 1989), Fu’s Fs (Fu, 1997), and R2
Ramos-Onsins and Rozas (2002) tests. Significance was evaluated
through 10,000 coalescent simulations. We also calculated nucleo-
tide diversity (p) and haplotype diversity (h) for all populations. Allanalyses were performed in DNASP v.4.10.9 (Rozas et al., 2003).
The dynamics of effective population sizes through time of the
recognized populations of T. aethiops was estimated throughExtended Bayesian Skyline Plots (EBSP; Heled and Drummond,
2008), using a linear model in BEAST 1.6.1 (Drummond andRambaut, 2007). EBSP estimate changes in effective population
sizes over time under a multi-locus approach by using the times
of coalescent events among gene trees. We used the rate of 2.1%
of nucleotide substitutions per million years (Weir and Schluter,
2008) for the mtDNA with the relaxed clock and uncorrelated log-
normal priors. The evolutionary rates of the nuclear loci (Bf5/Bf7
and Musk4) were estimated in comparison to that the mtDNA.
The MCMC parameters were the same used in the species tree
analysis. The evolutionary models for each locus of each popula-
tion were estimated in JMODELTEST 0.1.1 (Posada, 2008).
To corroborate the obtained results in the phylogenetic analyses
and test for population structuring across recognized geographical
barriers (rivers and non-forest environments) we performed an
analysis of molecular variance (AMOVA) using the mtDNA datasetin ARLEQUIN 3.1 (Excoffier et al., 2006).
We applied the isolation with migration model (Hey and
Nielsen, 2004) implemented in the IMa program (Hey and
Nielsen, 2007) to estimate whether gene flow has occurred among
those parapatric populations potentially in contact (Fig. 1b). For
each pair of populations being compared, IMa estimates values of
H = 4N l (where l is the mutation rate per year per marker) forpopulations 1 and 2, and their ancestor, as well as the t time
(where t = t l, the time of population splitting at t generations inthe past) in which they diverged in the presence of gene flow(where m = m/l, given in the coalescent). We structured the anal-yses assuming as populations the reciprocal monophyletic lineages
reveled in the phylogenetic and species tree analyses. IMa esti-
mates compared populations potentially in contact, without an
apparent physical barrier separating them and parapatric popula-
tions occurring on opposite banks of major Amazonian tributaries
(see Fig. 1b). Our main objective with IMa analyzes was to test if
the observed absence of phylogenetic signal in the nuclear markers
(see Fig. 1c) is better explained by incomplete lineage sorting as a
result of recent population splitting (m = 0) or by the presence of
gene flow (m > 0). We assumed the Hasegawa–Kishino–Yano(HKY) model of evolution for all analyses and markers. Initial runs
in MCMC mode were performed to establish the best priors for
effective population sizes, divergence times, and migration param-
eters for each pair of populations being compared. After prior
selection, three independent final runs in MCMC mode were per-
formed changing the seed number to observe the convergence of
parameter values. Every run was performed using 1,000,000 gener-
ations of burn-in, sampling 100,000 trees in 5,000,000 generations
with 20 chains with a geometric heating. We performed a likeli-
hood ratio test (LRT, Nielsen and Wakeley, 2001), using the Load-
trees mode of IMa, sampling 100,000 generations and the results
of the final MCMC runs, to reject or accept scenarios with migra-
tion different from 0. If the LRT rejected a scenario of m > 0, weassumed that the absence of phylogenetic signal in the nuclear
markers was due to incomplete lineage sorting. On the other hand,
if the LRT rejected a scenario with m = 0, we performed another
MCMC run fixing m = 0 to evaluate whether a model withoutmigration adjusted better to the observed data than the full model
with migration. For these comparison we applied the Akaike infor-
mation Criterion (AIC), where the model that minimized
AIC = 2[log (L) d] was chosen as the best, where d is the numberof parameters (Nielsen and Wakeley, 2001). If the model with
migration had a better fit to the data, we assumed that the phylog-
eographic pattern may have been affected by gene flow. To convert
the model parameter estimations of m in demographic parameterswe applied the rate of 2.1% of nucleotide substitutions per million
years based on the mtDNA calibration adopted (Weir and Schluter,
2008), and a generation time of 1 year.
3. Results
3.1. Description of DNA sequences
Results of Tajima’s D was not significant for the mtDNA and
Musk4 (P > 0.05), but did reject neutrality significantly for Bf5/Bf7(P < 0.05; Table 3), suggesting that this locus does not evolve in aclock-like fashion. Wedid notdetect signsof saturation forthe faster
evolving mitochondrial genes (cyt b and ND2). The phi’stest did notrejectthe null hypothesis of a dataset without recombination forthe
nuclear genes (Bf5, Bf7 and Musk4; P > 0.1). Were identified 57 dis-tinct haplotypes for cyt b (992pb, n = 82), 38 for the ND2 (1041pb,
n = 72), 42 for Bf5 (532pb, n = 118), 50 for Bf7 (963pb, n = 98), and30 for Musk4(565pb, n = 97; Table 3). All sequences weredeposited
in Gen Bank under the accession numbers KF685940-KF686022
(cyt b), KF664029-KF664102 (ND2), KF686023-KF686081 (Bf5),KF686141-KF686186 (Bf7) and KF686081-KF686140 (Musk4).
G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110 101
http://-/?-
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
8/16
3.2. Area and phylogenetic relationships
BI and ML analyses based on the mtDNA and the concatenated
dataset (total of four analyses; Fig. 1a) recovered identical topolo-
gies showing with high statistical support the reciprocal mono-
phyly of 10 populations of T. aethiops, with T. aroyae grouping asthe sister species. Two main clades were recovered in T. aethiops,splitting apparently parapatric and attitudinally segregated
Andean foothill from lowland Amazonian populations, which
diverge by about 5% (uncorrected p genetic distance-value;Table 4). A subsequent major split involved lowland populations
separated by the Tapajós River in south-central Amazonia, which
diverge by roughly 4% and are hereafter referred to as the eastern
and western clades (populations found to the east and west of the
Tapajós River), respectively. The eastern clade grouped reciprocally
monophyletic populations endemic to the Tapajós, Xingu, and
Belém Amazonian areas of endemism (Silva et al., 2005), as well
as the isolated Pernambuco population in the northern sector of
the Atlantic Forest biome in northeastern Brazil (Fig. 1a and b).
The latter population was nested within the Belém population
despite these two being located in different biomes separated by
more than 1000 km of inhospitable habitat to T. aethiops (extensivenon-forest vegetation). The western clade grouped populations
from the Madeira, Inambari, Napo, Imeri, and Guiana areas of ende-
mism (Silva et al., 2005), but only the Napo/Imeri (west of the
Negro River) and Guiana (east of the Negro River to west Branco
River) areas were occupied by reciprocally monophyletic popula-
tions (Fig. 1a and b). Although we did not sample populations from
the Napo area of endemism (Silva et al., 2005), we tentatively
include them in the Imeri population based on their morphological
similarity and placement in the same subspecies polionotus(Zimmer and Isler, 2003). In contrast, the Inambari and Rondônia
Table 3
Diversity and demographic parameters of lineages of the polytypic T. aethiops for which at least five individuals were sequenced for mitochondrial (cyt b and ND2) and nuclear
(Bf5/Bf7, and musk4) genes. Lin. = lineages/clades; N = number of phased alleles; n H = number of haplotypes; H = haplotype diversity; p = nucleotide diversity; D = Tajima’s Dtest (Tajima,1989); F s = Fu’s Fs (Fu, 1997); R2 = Ramos-Onsins, Rozas test (2002). Significance levels for Tajima’s D an d R2 = *P < 0.05; **P < 0.01. Significance levels for Fu’s
F s = *P < 0.02.
Lin. Gene N n H H p D F s R2
T. a. aethiops mtDNA 72 64 0.996 0.0261 0.3502
Bf5/Bf7 118 42 0.935 0.0054 1.68371*
musk4 97 30 0.921 0.0051 1.37883
Tapajós mtDNA 6 6 1.000 0.0018 0.4155 1.013 0.1446
Bf5/Bf7 6 5 0.933 0.0061 0.7612 1.009 0.211
musk4 5 3 0.700 0.0023 0.1747 0.0607 0.2848
Xingu mtDNA 5 4 0.900 0.0014 0.1909 0.4448 0.2186
Bf5/Bf7 6 4 0.867 0.0083 0.1057 1.0749 0.2073
musk4 5 3 0.700 0.0033 0.2735 0.6436 0.1936
Pernambuco mtDNA 6 4 0.800 0.0006 0.4474 1.4544 0.1805
Bf5/Bf7 8 3 0.714 0.0037 0.5044 1.7263 0.2143
musk4 6 3 0.600 0.0032 0.5617 0.957 0.2206
Belém mtDNA 5 5 1.000 0.0042 0.4208 0.5418 0.1597
Bf5/Bf7 12 6 0.864 0.0028 0.7877 1.8982 0.2027
musk4 8 3 0.714 0.0024 0.9657 0.8748 0.2381
Eastern IInambari mtDNA 6 6 1.000 0.0021 0.6915 2.4843 0.1446
Bf5/Bf7 6 6 1.000 0.0077 0.9902 2.4199 0.1023**
musk4 6 5 0.933 0.0044 1.0484 1.5652 0.2386
Western Inambari mtDNA 15 13 0.981 0.0021 1.5705* 7.6834* 0.0700*
Bf5/Bf7 32 14 0.897 0.0034 1.6007* 8.3201* 0.0582**
musk4 25 11 0.847 0.0031 0.6854 5.3341* 0.0958
Northern Rondônia mtDNA 7 7 1.000 0.0021 0.3606 3.4573* 0.1267*
Bf5/Bf7 14 8 0.901 0.0040 0.768 2.8844 0.1174
musk4 11 9 0.945 0.0045 0.9471 5.1712* 0.1247
Southern Rondônia mtDNA 15 12 0.971 0.0047 0.4438 2.11639 0.1208
Bf5/Bf7 24 6 0.757 0.0023 1.2115 1.1177 0.1042
musk4 20 7 0.800 0.0036 0.5208 0.9804 0.1166
Table 4
Average pairwise uncorrected p-distances (mtDNA) between and within major clades of the polytypic Thamnophilus aethiops and outgroups recovered by Bayesian and Maximum
Likelihood phylogenies.
Clade (average pairwise p-distances within clades) 1 2 3 4 5 6 7 8 9 10 11
1 – Western Negro (0.1)
2 – Eastern Negro (0) 0.9
3 – Western Inambari (0.2) 1.6 1.4
4 – Southern Rondônia (0.6) 2.2 2.1 2.7
5 – Eastern Inambari (0.2) 2.2 2.3 2.9 1.7
6 – Northern Rondônia (0.2) 2.7 2.8 3.1 3.0 3.4
7 – Tapajós (0.1) 3.6 3.7 4.0 3.8 3.9 3.9
8 – Xingu (0.2) 3.4 3.4 3.6 3.6 3.7 3.8 1.9
9 – Belém (0.4) 3.1 3.1 3.5 3.2 3.2 3.4 1.9 0.7
10 – Pernambuco (0.1) 3.1 3.2 3.5 3.3 3.4 3.3 1.8 0.6 0.3
11 – T. a. aethiops 5.0 5.1 5.7 5.2 5.3 6.0 4.3 4.8 4.5 4.7
12 – T. aroyae 5.2 5.5 6.2 5.2 5.5 5.5 5.2 5.8 5.5 5.6 6.0
102 G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
9/16
areas of endemism were inhabited by four distinct non-sister pop-
ulations with the following distributions: (1) northern portion of
the Rondônia area of endemism in the Tapajós–Madeira interfluve,
probably limited to the south by the Aripuanã River; (2) southern
part of the Rondônia area of endemism, probably limited to the
north by the Aripuanã River, crossing the Tapajós–Madeira inter-
fluve eastwards into the headwaters of the Tapajós and Xingu Riv-
ers, and hence reaching the southernmost parts of the Tapajós andXingu areas of endemism; (3) eastern Inambari area of endemism
in the lower–central portion of the Purus–Madeira interfluve; and
(4) western Inambari area of endemism west of the Purus River
and south of the Marañon/Huallaga/Ucayali/Solimões River in
Peru, eastward reaching the headwaters of the Purus–Madeira
interfluve into northeastern Bolivia (Pando and La Paz Depart-
ments). Uncorrected genetic p-distances among populations of T.aethiops ranged from 0.6% (between Belém/Pernambuco and Xingupopulations) to 6.0% between Andean foothill and northern Rondô-
nia area of endemism populations, with the average p-distancesbetween reciprocally monophyletic sisters populations around
1.6%.
The coallescent species tree recovered an identical topology to
those of BI and ML analyses based on the concatenated dataset
(Fig. 1e). The species tree also recovered with high statistical sup-
port the monophyly of the polytypic T. aethiops, as well as that of the Amazonian populations, the eastern and western clades, and
the internal relationships within them. Only the sister relationship
between the Western Inambari and the Northern Solimões River
populations was not statistically supported (posterior probability
less than 0.95; Fig. 1e).
The individual topologies of each nuclear gene (Bf5, Bf7 and
Musk4, results not shown) do not support any particular well-
resolved relationship among individuals of T. aethiops, except forMusk4, which supported the monophyly of lowland Amazonian
and Atlantic Forest populations.
3.3. Species delimitation
We obtained equal results among all six BP&P analyses, using
both algorithms and the three different combinations of s and hvalues, assuming a cutoff of 95% of posterior probability. Species
delimitations results were robust to the choice of prior distribu-
tions, supporting most of the reciprocally monophyletic popula-
tions recovered by the BI, ML, and species tree estimates as
distinct species, except for the Belém/Pernambuco and Eastern/
Western Negro sister population pairs (Fig. 1d). The purported spe-
ciation event between Belém and Pernambuco populations had
higher speciation probabilities when we used priors representing
large ancestral populations and deep divergences (PP = 0.90) or
shallow divergences (PP = 0.89), but very low values with priors
representing small ancestral populations and shallow divergences
(PP = 0.10), using algorithm 0 with the fine-tuning parameter setto 5. The split between Eastern and Western Negro populations
had very low speciation probabilities in all analyses (PP 6 0.20).
3.4. Molecular dating
According to the molecular dating based on the concatenated
mtDNA dataset (Fig. 1e), the split between T. aethiops and T. aroyaetook place during the Pliocene between 4.07 and 2.85 Mya (mean
3.45 Mya). The divergence between the Andean (T. a. aethiops) andthe ancestor of the Amazonian and Atlantic Forest populations took
place between 3.54 and 2.44 Mya (mean 2.97 Mya).
The earliest split within Amazonian populations occurred in the
Late Pliocene–Early Pleistocene (2.70–1.86 Mya, mean 2.27 Mya),
with separation of the eastern and western clades across theTapajós River. The first split in the western clade separated
populations from the northern part of the Rondônia area of ende-
mism (east of Aripuanã River) from the remaining ones found to
the west of this river and across the Madeira, Solimões, and Negro
rivers, during the Early–Middle Pleistocene (1.84–1.19 Mya, mean
1.50 Mya). Other cladogenetic events in the western clade
stretched from the Middle to Late Pleistocene between 1.4–0.29
Mya (mean 0.84 Mya), with one of them (involving southern
Rondônia + eastern Inambari versus western Inambari + northernSolimões populations) coinciding to some extent with the modern
course of the Purus River (Fig. 1b and e). The splits in the eastern
clade occurred between the Middle (1.27–0.66 Mya, mean 0.95
Mya) and Late Pleistocene (0.49–0.15 Mya, mean 0.31 Mya) and
separated populations of the Tapajós, Xingu, and Belém/Pernam-
buco areas of endemism across the Xingu and Tocantins rivers.
The splitting dates estimated by the multi-locus coalescent
approach (species tree) were in general more recent than those
obtained by the single locus mtDNA dataset, particularly for those
younger than 1.0 Mya. However, both coalescent and concatenated
mtDNA timing estimates overlapped to various degrees in their
respective 95% confidence intervals, and thus cannot be considered
statistically different.
3.5. Population genetics and historical demography
Haplotype networks recovered for cyt b and ND2 mirrored thephylogenetic analyses based on BI and ML (Fig. 1a and c). For cyt
b, populations with the highest number of sequenced individuals
differed dramatically in structure: the western Inambari popula-
tion presented a dominant haplotype shared by six individuals
and 12 other haplotypes represented by one or two individuals,
generally differing from the commonest haplotype by a single
mutation. On the other hand, in the southern Rondônia population,
10 different haplotypes distributed in three groups separated by
two to eight mutations were recovered, with only three haplotypes
present in more than one individual (Fig. 1c). Networks of the
nuclear makers recovered the absence of phylogeographic struc-
ture and haplotype sharing among the recognized populations(Fig. 1c).
Haplotype diversity was generally high and similar among the
sampled Amazonian populations (Table 3). Estimated nucleotide
diversity varied widely among populations depending on the locus
considered, while within a single locus values obtained for the dif-
ferent populations were similar (Table 3), suggesting an overall
demographic stability. The Tajima’s D test (1989) showed negative
and significant values for the mtDNA and Bf5/Bf7 loci in the wes-
tern Inambari population, consistent with demographic fluctua-
tions (Table 3). The Fu’s Fs (1997) showed significant and
negative values for the mtDNA and musk4 loci in the northern
Rondônia population and in all three sampled loci in the western
Inambari, also supporting demographic instability. The R2 (2002)
test results showed low and significant values for the same popu-lations as the Fu’s Fs (1997), suggesting a similar demographic sce-
nario regardless of the test considered.
The EBSP’s (Fig. 2) were in part congruent with the neutrality
tests, inferring tendencies of recent demographic expansions in
both populations of the Inambari and the northern Rondônia areas
of endemism during the Late Pleistocene and Holocene. In contrast,
EBSP’s favored scenarios of demographic stability in the Belém,
Pernambuco, Xingu, Tapajós, and southern Rondônia populations
(Fig. 2).
An analysis of molecular variation (AMOVA; Table 5) confirmed
that most of the genetic variation in the Amazonian and Atlantic
Forest populations of T. aethiops is partitioned among the geo-
graphically structured clades recovered by the phylogenetic analy-
ses, and not within these groups. Similarly, these resultscorroborate that the large tributaries of the Amazon River are at
G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110 103
http://-/?-http://-/?-
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
10/16
least contemporary barriers to gene flow between populations
from opposite banks.
3.6. Gene flow among populations
IMa analyses favored scenarios of very low levels or absence of
gene flow among all populations of T. aethiops potentially in con-
tact (Table 6). Migration events were not rejected by LRT tests
among most pairwise comparisons, with models predicting migra-tion having better AIC scores than models predicting no gene flow
between the following clades: Xingu/Tapajós, Northern Rondônia/
Southern Rondônia, Northern Rondônia/Eastern Inambari, South-
ern Rondônia/Western Inambari, and Eastern Inambari/Western
Inambari. In all these instances, the estimated migration rate was
very low in both directions (with confidence intervals’ lower bonds
reaching zero except in one comparison), and involved non-sister
populations (Fig. 1, Table 6). The highest migration rate detected
and the only one not including a lower bond likelihood of zero,
involved the Eastern Inambari and Western Inambari populations(Maximum likelihood = 0.0015; 90% HPD interval = 0.001–0.004).
Fig. 2. Demographic histories of major clades of Thamnophilus aethiops for which at least five individuals were sampled, inferred through Extended Bayesian Skyline Plots
based on mtDNA (cyt b and ND2), Bf5/Bf7, and Musk4 sequences. Black solid lines represent median values, while the dashed lines corresponds to 95% confidence intervals.
The X axis corresponds to time in million years before present. The Y axis represents N es in a logarithmic scale.
104 G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
11/16
4. Discussion
4.1. Species limits and taxonomy
Although our analyses support the monophyly of the polytypic
T. aethiops, of the 10 reciprocally monophyletic populations recov-ered only two are entirely consistent with subspecies limits cur-
rently recognized in this group: nominate aethiops from thefoothills of the Andes and T. a. injunctus, which corresponds tothe eastern Inambari population (Zimmer and Isler, 2003; Fig. 1a,
d and e). In fact, high statistical support for key nodes in the
multi-locus coalescent species tree and high speciation probabili-
ties recovered by the species delimitation analysis (BP&P), support
the recognition of nine reciprocally monophyletic lineages fitting
the definition of evolutionary species (see Fujita et al., 2012;Fig. 1d) in T. aethiops.
These lineages are as follows (taxon names are assigned torecovered populations based on type locality and nomenclatural
priority following Peters 1951 and Zimmer and Isler 2003): (1)
Thamnophilus aethiops Sclater, 1858 (foothills of the Andes); (2)Thamnophilus atriceps Todd, 1927 (Tapajós population, distributedthroughout most of the Tapajós area of endemism); (3) Thamnophi-lus incertus Pelzeln, 1869 (Belém and Pernambuco populations;
given their lack of reciprocal monophyly and low speciation prob-
abilities, the former Thamnophilus aethiops incertus from the Belémarea of endemism and Thamnophilus aethiops distans Pinto 1954from the Atlantic Forest should be regarded as subspecies of a sin-
gle species, T. incertus, the name with nomenclatural precedence);(4) Thamnophilus punctuliger Pelzeln 1869 (northern Rondôniapopulation distributed east of the Aripuanã River in the Madeira–
Tapajós interfluve); (5) Thamnophilus injunctus Zimmer 1933(eastern Inambari population, distributed through most of the
Table 5
Results of an Analysis of Molecular Variation (AMOVA) based exclusively on the mtDNA among major clades of the polytypic Thamnophilus aethiops for which at least five
individuals were sampled, separated by potential modern barriers (rivers and non-forest habitats). Results regarded as significant if P < 0.001.
Populations Potential barrier Among p opulations o n opposite s ides o f
the barrier
Within the population in the same side
of the barrier
Ust p-
Value
Pernambuco/Belém Caatinga/Cerrado (non-forest
landscapes)
18.77 81.23 0.18 0.026
Belém/Xingu Tocantins R. 60.42 39.58 0.60 0.004
Xingu/Tapajós Xingu R. 91.08 8.92 0.91 0.002Xingu/Southern Rondônia Unknown 84.78 15.22 0.84 0.000
Tapajós/Northern Rondônia Lower Tapajós R. 71.25 28.75 0.71 0.000
Tapajós/Southern Rondônia Teles Pires R. (part) 46.49 53.51 0.46 0.000
Northern/Southern Rondônia Aripuanã R. (part) 86.05 13.95 0.86 0.000
Northern Rondônia/Eastern
Inambari
Lower Madeira R. 93.39 6.61 0.93 0.000
Southern Rondônia/Eastern
Inambari
Middle Madeira R. 73.82 26.18 0.73 0.000
Southern Rondônia/Western
Inambari
Upper Madeira R. 84.84 15.16 0.84 0.000
Eastern/Western Inambari Purus R. (part) 92.26 7.74 0.92 0.000
Table 6
Summary of IMa results of migration estimates between parapatric population pairs of T. aethiops potentially in contact (see Fig. 1b). Posterior distribution values of migration
were converted to demographic units, where the values of m1 and m2 represent the average number of migrations per 1000 generations per gene copy on the coalescent
(m1 = rate of migration from population 2 to population 1; m2 = rate of migration from population 1 to population 2). Confidence intervals represent HPD90. All maximum values
for migration reached likelihood zero, indicating the posterior distribution ends.
Pairwise analyses m1 m2 AIC
Belém (5)/Xingu (5) 0 (0–0.0011) 0.0027 (0–0.0063) 9569.71
Forced to be zero Forced to be zero 9548.03
Xingu (5)/Tapajós (6) 0 (0–0.0033) 0 (0–0.003) 9586.18
Forced to be zero Forced to be zero 9613.29
Xingu (5)/Southern Rondônia (15)* 0 0 –
Tapajós (6)/Northern Rondônia (7)* 0 0 –
Tapajós (6)/Southern Rondônia (15)* 0 0 –
Northern Rondônia (7)/Southern Rondônia (15) 0 (0–0.0012) 0 (0–0.0013) 10366.19
Forced to be zero Forced to be zero 10378.84
Northern Rondônia (7)/Eastern Inambari (6) 0 (0–0.0013) 0 (0–0.002) 9996.38Forced to be zero Forced to be zero 10012.88
Southern Rondônia (15)/Eastern Inambari (6) 0 (0–0.0016) 0.0013 (0–0.0032) 9920,21
Forced to be zero Forced to be zero 9898.74
Southern Rondônia (15)/Western Inambari (9) 0 (0–0.0019) 0 (0–0.0012) 10963.26
Forced to be zero Forced to be zero 10997.83
Eastern Inambari (6)/Western Inambari (9) 0 (0–0.0032) 0.0015 (0.001–0.004) 10369.91
Forced to be zero Forced to be zero 10395.45
Western Inambari (9)/Northern Solimões (7)* 0 0 –
Asterisks indicate pairwise analyses where the likelihood ratio test rejects a scenario with m > 0. For pairwise comparisons where the likelihood ratio test supports a scenario
with m > 0, models with and without migration were contrasted with the Akaike information criterion (AIC). The model that minimized AIC was chosen as the best scenario
(in bold). Numbers in parenthesis next to population names denote the number of individuals of the respective population used in the comparison. See Table 1 for detailed
specimen and locality information.
G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110 105
http://-/?-http://-/?-http://-/?-http://-/?-
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
12/16
Madeira–Purus interfluve); (6) Thamnophilus juruanus Iheringi1904 (western Inambari population, distributed through most of
the Inambari area of endemism west of the Purus River; the taxon
name Thamnophilus aethiops kapouni Seilern 1913 also applies to
this population, but it has no nomenclatural priority, and therefore
should be synonymized with juruanus); (7) Thamnophilus poliono-
tus Pelzeln 1869 (western and eastern Negro populations distrib-
uted north of the Amazon in the Branco–Solimões interfluve; asexplained above the taxon Thamnophilus aethiops wetmorei deSchauensee, 1945 is tentatively included in this lineage); and,
finally, two additional unnamed lineages (no known taxon
described previously from their ranges) corresponding respectively
to most of the Xingu area of endemism (assigned currently to T.atriceps, whose type locality is in the Tapajós area of endemism)and the southern part of the Rondônia, Tapajós, and Xingu areas
of endemism (assigned currently to T. punctuliger , whose typelocality lies in the northern part of the Rondônia area of
endemism).
By occupying mostly shaded environments in the understory of
tropical forests, the evolution of plumage color states traditionally
used in subspecies delimitations in T. aethiops probably proceededat a slower pace than at least one of the sequenced loci (mtDNA).
This process can generate the formation of morphologically cryptic
and sometimes polymorphic lineages, resulting in the taxonomic
inconsistencies cited above (Baker et al., 1995; Irwin et al., 2001;
Fernandes et al., 2012). In contrast, vocal characters are thought
to be directly involved in the reproductive isolation of forest inte-
rior suboscine lineages (Carneiro et al., 2012). We do not report on
the vocal variation within the polytypic T. aethiops in this paper,but will present in a separate publication a detailed taxonomic
overhaul of the T. aethiops complex based on a multi character
approach, where the unnamed evolutionary lineages mentioned
above will be described.
The only sister populations of T. aethiops for which low specia-tion probabilities were recovered are the parapatric eastern/wes-
tern Negro populations (T. polionotus) and the allopatric Belém/
Pernambuco populations (T. i. incertus and T. i. distans). Eventhough the species tree recovered the former pair as distinct spe-
cies, the species delimitation analyses favored a scenario of very
shallow divergence between them, not supporting their status as
distinct evolutionary species (Fig. 1d and e). Indeed, the lack of
reciprocal monophyly in the mtDNA between the Belém (T. i. incer-tus) and Pernambuco (T. i. distans) populations supports a very
recent divergence between them, despite their current separation
by over 1000 km.
The overall lack or very low rate of gene flow estimated among
most parapatric populations of T. aethiops are also indicative of
their status as independent species (Table 6). Interestingly, when-
ever lack of gene flow (i.e., zero migration rates) could be statisti-
cally rejected between any population pair potentially in contact, it
always involved non-sister lineages, implying in secondary contactrather than primary intergradation (Table 6). Hence, it is possible
that these very low rates of gene flow are explained by a significant
degree of reproductive isolation already acquired by these popula-
tions that have diverged in allopatry for a relatively long time
before coming in contact. Estimates of gene flow between non-sis-
ter populations or populations that exchange migrants with a third
unsampled population go against a main assumption of the IMa
model and can generate several biases in the estimation of the
main parameters, although they have little effect when low levels
of gene flow are detected (see Strasburg and Rieseberg 2010), as
documented herein. IMa analyses supported absolute no gene flow
among all populations of the two main Amazonian clades of T.aethiops separated by the Tapajós River (eastern clade: Xingu and
Tapajós populations; and western clade: northern Rondônia andsouthern Rondônia populations), which likely come in contact
across a wide area in the headwaters of the Tapajós, Xingu, and
Tocantins rivers (Fig. 1b, Table 6). Despite sampling limitations,
this study provides the best evidence available so far that interflu-
vial populations of terra-firme avian lineages in contact across the
headwaters of southern Amazonian tributaries can retain their
genetic diagnosabilities, probably as a result of an advanced degree
of reproductive isolation acquired in allopatry before coming in
contact in more recent times, as suggested by several other studiesbased solely on mtDNA datasets (Carneiro et al., 2012; Batista
et al., 2013; Rodrigues et al., 2013). In contrast, gene flow was pres-
ent, yet at a very small rate, between the non-sister Tapajós and
Xingu populations belonging to the same eastern clade, as well
as between the southern Rondônia and western Inambari popula-
tions of the western clade across the upper Madeira River ( Fig. 1,
Table 6). Therefore, comparative levels of gene flow across the
headwaters of major Amazonian tributaries are likely to be more
correlated with the phylogenetic distance of the lineages/popula-
tions in contact, rather than the smaller barrier effect of rivers in
these areas (Haffer 1992), which result in a more random pattern
of gene flow.
4.2. The diversification of the Thamnophilus aethiops complex in Cis- Andean South America
Populations of T. aethiops distributed in the Amazon and Atlan-tic Forests are in a clade with several basal Andean taxa typically
occurring above 1000 m (T. unicolor, T. aroyae, and T. a. aethiops),
supporting an ancestor of Andean origin for these lowland forest
populations (see also Brumfield and Edwards, 2007). Diversifica-
tion events along Andean altitudinal gradients have been proposed
for some avian lineages (Bates and Zink, 1994; Weir, 2006; Isler
et al., 2012; d’Horta et al., 2013), and are probably related to allo-
patric speciation during altitudinal shifts in habitats due to cli-
matic oscillations (Graham et al., 2004). Under this diversification
model, the dispersal of an Andean ancestor into the Amazonian
lowlands would only be possible after the draining of the lacus-
trine system of the Solimões Basin in western Amazonia (the socalled Pebas and Amazonas lakes), which led to the formation of
the modern Amazon drainage (Hoorn et al., 2010) and the estab-
lishment of upland terra-firme forests in this region. Paleogeo-graphic hypotheses differ in the time frame when these events
occurred (Campbell et al., 2006; Figueiredo et al., 2009;
Latrubesse et al., 2010), even though they coincide in postulating
a favorable environment for the establishment of upland terra- firme forests in western Amazonia between the late Pliocene andearly Pleistocene, when the diversification of the T. aethiops com-plex in Amazonia began (Fig. 1e).
The genetically poorly-differentiated yet isolated Atlantic Forest
population (T. i. distans) may have originated from a recent dis-persal event of the Belém population (T. i. incertus) or through iso-
lation caused by climatic fluctuations leading to the disruption of the forest corridor linking eastern Amazonia with the northeastern
Atlantic Forest during the Late Quaternary (Batalha-Filho et al.,
2013). In contrast, other Amazonian and Atlantic Forest avian sister
lineages exhibited reciprocal monophyly and high levels of genetic
differentiation estimated to date back to a time frame stretching
from the Late Pliocene to the Early Pleistocene (Aleixo, 2002;
Cabanne et al., 2008; Weir and Price, 2011). These different phylog-
eographic patterns are consistent with multiple and cyclical con-
nection and isolation episodes between eastern Amazonia and
the northern sector of the Atlantic Forest until at least the Late
Quaternary (Batalha-Filho et al., 2013).
The data presented herein support that distinct events of vicar-
iance related to river formation and reorganization mostly during
the Pleistocene have influenced the diversification of the T. aethiopscomplex, providing another body of evidence that different
106 G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
13/16
modern interfluves in Amazonia harbor distinct evolutionary lin-
eages, with little or no gene flow among them (Table 6). In the T.
aethiops complex, all splits involving the recognized lineages coin-cide with at least part of the course of a major Amazonian river,
indicating that at some point in time these rivers might have acted
as primary diversification barriers. Interestingly, the absence of a
physical barrier separating the eastern and western Inambari
clades where they meet in the middle Purus–Madeira interfluveis associated with the highest gene flow rate recovered herein
among lineages of the T. aethiops complex, yet still very low(0.0015; Table 6).
The phylogeographic data presented herein is consistent with at
least two independent splits across different portions of the mod-
ern course of the Madeira River as also suggested for several other
avian lineages (Aleixo 2004; Patané et al., 2009; Fernandes et al.,
2013; Sousa-Neves et al., 2013). Latrubesse (2002) postulated that
the Madeira paleodrainage was broader and more complex than
today until the late Pleistocene, reporting the presence of two
mega-fans related to the Aripuanã and Jiparaná rivers, both of
which currently flow into the Madeira River. Thus, it is possible
that the initial isolation of the northern Rondônia lineage in the
western clade is related to a former larger barrier (Aripuanã
mega-fan), which decreased in size due to a drainage-capture
event (Wilkinson et al., 2010), promoting the secondary contact
between different non-sister lineages that diverged in allopatry,
as postulated for other terra-firme avian lineages (Fernandes2013). The absence or very low levels of gene flow detected among
populations of the T. aethiops complex suggest a fickle scenario of migration across Amazonian rivers, which is probably best
explained by an overall inability to cross open water, as demon-
strated for other understory Neotropical avian lineages (Moore
et al., 2008). Thus, multiple and independent splitting events along
a single modern river course are more likely explained by the dis-
ruption of river drainages, whereby ‘‘barrier effects’’ move across
neighbouring interfluvia.
Likewise, the estimated dates for the splits across the Solimões
and Negro rivers long after the formation of these barriers, suggesta similar scenario of river lateral change or course capture. The for-
mation of the Solimões River is closely related to the formation of
the transcontinental Amazonian drainage during the Late Plio-
cene–Early Pleistocene (Campbell et al., 2006; Hoorn et al., 2010;
Latrubesse et al., 2010). Thus, if these time estimates for the estab-
lishment of the Solimões River are correct, the relatively recent
split of T. aethiops populations across this river (0.68–0.26 Mya)is explained by vicariance following dispersal after the formation
of the current Solimões River. As observed for clades separated
by the Solimões, the formation of the Negro River (see Almeida-
Filho and Miranda 2007) probably predates the cladogenetic event
separating the Imeri/Napo and western Guianan clades of T. polion-otus (0.23–0.02 Mya). Unlike widely reported local instances of
river-channel migration due to sedimentation involving ‘‘white-water’’ rivers in western Amazonia (Salo et al., 1986; Patton and
Silva, 1998), some shifts in Amazonian rivers courses take place
over long periods of time and are probably related to drainage cap-
ture events mediated by tectonics (Almeida-Filho and Miranda
2007; Rossetti and Valeriano, 2007; Shephard et al., 2010). The
growing body of phylogeographic evidence available now for Ama-
zonian lineages suggest that river courses, particularly those of the
Negro, Madeira, Tapajós and Tocantins, have been stable for long
periods of time until changing part of their courses, and then
remaining stable for an additional time (Ribas et al., 2012;
d’Horta et al., 2013; Fernandes et al., 2012, 2013; Maldonado-
Coelho et al., 2013; Sousa-Neves et al., 2013). Hence, a dynamic
drainage landscape, over long periods of time, can act like a speci-
ation pump rather than prevent diversification, as suggested previ-ously (Haffer 1993; Colwell 2000; Gascon et al., 2000).
When compared to other upland terra-firme avian lineageswhich were also shown to have their diversification mediated by
Amazonian rivers (Fernandes et al., 2012, 2013; Ribas et al.,
2012; d’Horta et al., 2013; Sousa-Neves et al., 2013), the order
and timing in which different rivers accounted for splits of lineages
of the T. aethiops complex differ significantly from most of them,indicating that distinct lineages responded differently to the pro-
cess of drainage evolution in Amazonia. Perhaps the most similarcases to that of the T. aethiops complex are those reported for the Xiphorhynchus spixii/elegans (Dendrocolaptidae; Aleixo 2004) and
Phlegopsis nigromaculata (Thamnophilidae; Aleixo et al., 2009),whereby the Tapajós River also accounted for the first split in time.
One hypothesis is that these differences in the relative order and
timing in which different rivers account for splits throughout the
Amazon are related to the geografic origins of the ancestral popu-
lations of these widespread lineages (Aleixo and Rossetti 2007). In
contrast to the T. aethiops complex, X. spixii/elegans and Sclerurus
mexicanus (d’Horta et al., 2013), whose sister groups in Amazoniainclude widespread Andes lineages, a different but pervasive phy-
logeographic pattern in the Amazon is that where earliest splits
usually involve lineages endemic to the Guianan shield and coin-
cide either with the present course of the lower Amazon or Negro
rivers (Carneiro et al., 2012; Batista et al., 2013; d’Horta et al.,
2013; Rodrigues et al., 2013; Sousa-Neves et al., 2013). This alter-
native pattern imply a Guianan shield origin for these lineages,
whereas those reported for T. aethiops, P. nigromaculata, and X. spi- xii/elegans (which are absent or nearly absent from the Guianan
shield) support a Brazilian shield origin (see also Aleixo and
Rossetti 2007). Therefore, we hypothesize that the structuring of
the modern Amazon drainage and the drying out of the western
Amazonian sedimentary basins from the late Pliocene to the late
Pleistocene were keystone events to promote concomitantly: (1)
an increase in the dispersal rates of both Brazilian and Guianan
shield lineages across the more recent upland terra-firme forestsof the upper Amazonia (Solimões sedimentary basin); and (2) an
increase in cladogenetic events involving upland terra-firme forest
lineages due to the latest cycle of drainage evolution throughoutAmazonia, which shaped the modern transcontinental river sys-
tem. Under this scenario, depending on the geographical origins
of any given lineage before this latest cycle of widespread drainage
structuring (late Pliocene–Early Pleistocene), their response to riv-
erine barriers can differ widely, as verified by the phylogeographic
studies conducted so far.
When climate change is evaluated as a possible driver of diver-
sificationin the T. aethiops complex, neutrality tests and EBSP’s sup-port demographic expansions in lineages distributed in the
Inambari and northern Rondônia areas of endemism since the last
interglacial cycle (approximately 0.13 Mya) to the present (Fig. 2).
Recent demographic expansions have been postulated for other lin-
eages of birds in western Amazonia (Aleixo, 2004; Fernandes et al.,
2012; Ribas et al., 2012), but in all cases there was no evidence thatpurported refuges were correlated with cladogenetic events in
these lineages. The dates estimated for the origin of the main recip-
rocally monophyletic lineages of the T. aethiops complex based on
the multi-locus species tree precede the coalescent time of the
locus used in EBSP’s analyzes as well as the estimated time of the
demographic expansions. Thus, if climatic oscillations during the
last 0.2 Mya affected populations of the T. aethiops complex, theyapparently were not strong enough to generate the formation of
new clades, hence not supporting the refuge hypothesis as an
important cause of diversification in the T. aethiops complex(Haffer, 2001). Furthermore, differences in the historical population
demography among T. aethiops complex lineages (Fig. 1c and 2),
with some lineages exhibiting relatively stable demographic histo-
ries, suggest that climate oscillations during the Late Pleistocenedid not impact uniformly all sectors of Amazonia. Even though
G. Thom, A. Aleixo / Molecular Phylogenetics and Evolution 82 (2015) 95–110 107
-
8/16/2019 Cryptic Speciation in the White Shouldered Antshrike Thamnophilus Aethiops Aves Thamnophilidae the Tale of a Tr…
14/16
the sparse sampling of some T. aethiops complex lineages may yieldunreliable results that underestimate the effect of climatic oscilla-
tions on ancestral population sizes during the last glacial cycles,
our data is in agreement with that recovered for several other
linages of Amazonian organisms where no significant changes in
historical population structures were found since the Last Glacial
Maximum (Lessa et al., 2003; Fernandes et al., 2012; Ribas et al.,
2012; Maldonado-Coelho et al., 2013). These results have ignitedan intense debate on the applicability of the refuge hypothesis in
explaining patterns of diversification in Amazonia (Bush and de
Oliveira, 2006), along with paleo-environmental uncertainties con-
cerning the existence and location of refuges (Bush, 1994; van der
Hammen and Hooghiemstra, 2000; Haffer, 2001).
Acknowledgments
We thank the curator and curatorial assistants of the Museum
of Natural Science, Louisiana State University (LSUMZ), for allow-
ing us to sequence tissues and study specimens under their care.
We also grateful to the tenacious effort of many specimen collec-
tors working for or together with the Museu Paraense Emílio Goe-
ldi (MPEG), who along years of intense field work in the Amazon,
amassed the tissues necessary for the analyzes contained in this
paper, with permits provided by ICMBIO (Instituto Chico Mendes
de Conservação da Biodiversidade). Field and laboratory work
related to this paper were generously funded by the Brazilian
Research Council (CNPq; grants # 310593/2009-3; ‘‘INCT em Bio-
diversidade e Uso da Terra da Amazônia’’ # 574008/2008-0; #
563236/2010-8; and # 471342/ 2011-4) and the Pará State Funding
Agency (ICAAF 023/2011). Support to GT’s graduate research was
provided by a CNPq Master’s fellowship (# 131000/2010-1). AA
is supported by a CNPq research productivity fellowship (#
310880/2012-2). We thank an anonymous referee as well as Mar-
cos Maldonado-Coelho, Renato Caparroz, Luciano N. Naka, Camila
Ribas, and Péricles S. Rego for reviewing earlier versions of this
manuscript.
References
Ab’Saber, A.N., 1977. Os domínios morfoclimáticos da América do Sul. Primeiraaproximação. Geomorfologia 53, 1–23.
Aleixo, A., 2002. Molecular systematics and the role of the ‘‘várzea’�
top related