downloaded from on april 25, 2020 by guest...2019/07/29 · 100 g lobal changes in the proteome of...
Post on 10-Sep-2020
0 Views
Preview:
TRANSCRIPT
1
Global proteomic and mutagenic analyses reveal ethanol adaptation strategies in 1
Salmonella enterica serovar Enteritidis 2
Running title: Proteome of S. Enteritidis during ethanol adaptation 3
Shoukui He a,b
, Xiaojie Qin a, Catherine W. Y. Wong
b, Chunlei Shi
a, Siyun Wang
b, *, 4
Xianming Shi a,
* 5
6
a MOST-USDA Joint Research Center for Food Safety, School of Agriculture and 7
Biology, State Key Lab of Microbial Metabolism, Shanghai Jiao Tong University, 8
Shanghai 200240, China 9
b Food, Nutrition and Health, Faculty of Land and Food Systems, The University of 10
British Columbia, Vancouver, BC V6T 1Z4, Canada 11
12
* Corresponding authors: 13
Dr. Xianming Shi 14
Phone & Fax: 86-21-3420-6616 15
Email: xmshi@sjtu.edu.cn 16
17
Dr. Siyun Wang 18
Phone: +1(604)827-1734 19
Email: siyun.wang@ubc.ca 20
21
AEM Accepted Manuscript Posted Online 2 August 2019Appl. Environ. Microbiol. doi:10.1128/AEM.01107-19Copyright © 2019 American Society for Microbiology. All Rights Reserved.
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
ABSTRACT 22
Salmonella enterica serovar Enteritidis (S. Enteritidis) is able to adapt to 23
sublethal concentrations of ethanol, which subsequently induce the tolerance of this 24
pathogen to normally lethal ethanol challenges. This work aimed to elucidate the 25
underlying ethanol adaptation mechanisms of S. Enteritidis by proteomic and 26
mutagenic analyses. The global proteomic response of S. Enteritidis to ethanol 27
adaptation (5% ethanol for 1 h) was determined by iTRAQ and it was found that a 28
total of 138 proteins were differentially expressed in ethanol-adapted cells compared 29
to those in non-adapted cells. Fifty-six upregulated proteins were principally 30
associated with purine metabolism and transporters for glycine betaine, phosphate, 31
D-alanine, thiamine and heme; whereas 82 downregulated proteins were mainly 32
involved in enterobactin biosynthesis and uptake, ribosome, flagellar assembly as well 33
as virulence. Moreover, mutagenic analysis further revealed the functions of two 34
highly upregulated proteins belonging to purine metabolism (HiuH, 35
5-hydroxyisourate hydrolase) and glycine betaine transport (ProX, glycine 36
betaine-binding periplasmic protein) pathways. Deletion of either hiuH or proX 37
resulted in the development of stronger ethanol tolerance response, suggesting their 38
negative regulatory roles in ethanol adaptation. Collectively, this work suggested that 39
S. Enteritidis employs multiple strategies to coordinate ethanol adaptation. 40
41
42
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
43
44
IMPORTANCE 45
Stress adaptation in foodborne pathogens has been recognized as a food safety 46
concern since it may compromise currently-employed microbial intervention 47
strategies. While adaptation to sublethal levels of ethanol is able to induce ethanol 48
tolerance in foodborne pathogens, the molecular mechanism underlying this 49
phenomenon is poorly characterized. Hence, global proteomic analysis and mutagenic 50
analysis were conducted in the current work to understand the strategies employed by 51
Salmonella enterica serovar Enteritidis to respond to ethanol adaptation. It was 52
revealed that coordinated regulation of multiple pathways involving metabolism, 53
ABC transporter, regulator, enterobactin biosynthesis and uptake, ribosome, flagella 54
and virulence was responsible for the development of ethanol adaptation response in 55
this pathogen. Such knowledge will undoubtedly contribute to the development and 56
implementation of more effective food safety interventions. 57
58
KEYWORDS: iTRAQ; Salmonella; Stress adaptation; Ethanol; Survival mechanism 59
60
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
INTRODUCTION 61
Ethanol adaptation in foodborne pathogens has been a subject of great interest in 62
food safety in the last two decades. A number of pathogenic bacteria (e.g., Listeria 63
monocytogenes, Bacillus cereus, Vibrio parahaemolyticus and Cronobacter sakazakii) 64
are able to adapt to sublethal concentrations of ethanol (1–4). Ethanol adaptation can 65
enhance the tolerance of these pathogens to homologous and heterologous stressing 66
agents commonly applied during food processing and storage, thus increasing 67
microbial food safety risks (5–7). In fact, there is an increasing number of 68
stress-adapted pathogenic bacteria involved in foodborne outbreaks (8). In this 69
context, it is of paramount importance to uncover ethanol adaptation mechanisms in 70
understudied foodborne pathogens such as Salmonella enterica. 71
To date, the strategies employed by pathogenic bacteria to respond to ethanol 72
adaptation are poorly characterized, especially at the molecular level. Chiang et al. 73
(2008) found that ethanol adaptation increased the ratio of unsaturated to saturated 74
fatty acids, indicating an enhancement in cell membrane fluidity (6). Moreover, 75
two-dimensional gel electrophoresis (2-DE) analysis revealed that the expression of 76
eight proteins were enhanced 1.11- to 1.94-fold while the expression of seven proteins 77
was reduced 0.22- to 0.64-fold by ethanol adaptation (9). Unfortunately, further 78
identification and functional analysis of these differentially-expressed proteins have 79
not yet been reported. Furthermore, traditional gel-based methods such as 2-DE suffer 80
from their lack of proteome coverage, sensitivity and reproducibility (10). A novel 81
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
approach, isobaric tags for relative and absolute quantification (iTRAQ), can 82
overcome these shortcomings. The iTRAQ has been extensively utilized to 83
characterize bacterial stress response mechanisms at the proteomics level in recent 84
years (11–14). Maserati et al. (2018) reported that global proteomic analysis by 85
iTRAQ contributed to a better understanding of the regulatory systems involved in the 86
response of Salmonella enterica serovar Typhimurium to low aw, desiccation and heat 87
(15). Additionally, quantitative proteomics revealed the important role of YbgC in the 88
survival of Salmonella enterica serovar Enteritidis (S. Enteritidis) in egg white (16). It 89
is therefore expected that this technology will be helpful to provide an insight into the 90
molecular and cellular bases of ethanol adaptation in foodborne pathogens. 91
Ethanol adaptation in S. Enteritidis was evaluated in our previous study and it 92
was demonstrated that this bacterium acquired tolerance to normally lethal ethanol 93
challenges upon adaptation to sublethal concentrations (2.5-10%) of ethanol, which 94
was defined as the ethanol tolerance response (17). The current work was carried out 95
to unravel ethanol adaptation mechanisms in S. Enteritidis by iTRAQ and mutagenic 96
analyses. 97
98
RESULTS AND DISCUSSION 99
Global changes in the proteome of S. Enteritidis during ethanol adaptation 100
Exposure to 5% ethanol for 1 h has been identified as an optimal adaptation 101
condition that induced the highest magnitude of ethanol tolerance response in S. 102
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
Enteritidis (17). This adaptive response was reconfirmed in the current work as 103
ethanol-adapted cells exhibited a significantly (p < 0.05) higher survival rate than 104
non-adapted cells under normally lethal ethanol challenge conditions (15% ethanol for 105
1 h) (Fig. 1). Proteomic response of S. Enteritidis to the aforementioned sublethal 106
treatment (5% ethanol for 1 h) was thus determined by iTRAQ analysis to provide an 107
insight into ethanol adaptation mechanisms. A total of 2,174 proteins were detected 108
and quantified in two independent trials. A significant correlation (p < 0.0001, 109
correlation coefficient > 0.67) between protein expression levels in the two biological 110
replicates for non-adapted and ethanol-adapted groups was observed (supplemental 111
Fig. S1), confirming the repeatability of the iTRAQ experiment. 112
A considerable cut-off criterion (p < 0.05 and iTRAQ ratios > 1.3 or < 0.77) was 113
then employed for protein quantification in the current work. The same iTRAQ ratio 114
cut-off was used by Allan et al. (2016) to determine whether a protein was 115
differentially expressed in Streptococcus pneumoniae in response to nitric oxide (18). 116
It should be noted that differential proteins with moderate iTRAQ ratios may also be 117
important to bacterial stress response. For example, YbgC was upregulated by 1.20- 118
and 1.46-fold after the exposure of S. Enteritidis to 50% and 80% egg white as 119
identified by the iTRAQ experiments; mutagenic analysis further revealed that YbgC 120
was indeed a key protein contributing to S. Enteritidis survival in egg white (16). 121
Therefore, all significantly differentially expressed proteins, including those with 122
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
moderate iTRAQ ratios, will be utilized to uncover ethanol adaptation mechanisms in 123
S. Enteritidis in the current study. 124
Based on the aforementioned criterion, a total of 138 differentially expressed 125
proteins (56 upregulated and 82 downregulated) were screened (supplementary Data 126
S1). These proteins were assigned to functional groups by KEGG pathway analysis 127
for a better understanding of their cellular functions. The major clustered functional 128
categories belonged to metabolism, ABC transporter, regulator, enterobactin 129
biosynthesis and uptake, ribosome, flagellar assembly and virulence (Table 1). 130
Moreover, approximately 20% proteins were poorly characterized with an unknown 131
function or with a general function based on predictions only (supplemental Table S1). 132
A proposed model highlighting the major proteomic changes was presented in Fig. 2, 133
which indicated complex regulatory networks governing ethanol adaptation of S. 134
Enteritidis. 135
Metabolism 136
S. Enteritidis altered the expression of a considerable proportion of 137
metabolism-related proteins in the current study (Table 1), reflecting a coordinated 138
regulation of metabolic processes in response to ethanol adaptation. These 139
differentially-expressed proteins belonged to metabolic pathways for carbohydrate, 140
terpenoid and polyketide, energy, amino acid, glycan, cofactor and vitamin, lipid and 141
nucleotide. Some proteins involved in CoA biosynthesis (CoaD), pentose phosphate 142
pathway (STM2340), oxidative phosphorylation (NuoM and NuoN) as well as purine 143
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
(HiuH and YaiE), galactose (GatY), glyoxylate (Gcl), histidine (HisIE) and arginine 144
(AstA) metabolism were enhanced 1.34- to 1.98-fold. These diverse metabolic 145
upregulations suggested the nutritional requirements of S. Enteritidis for ethanol 146
adaptation. 147
The relationship between amino acid biosynthesis and microbial ethanol 148
tolerance has been reported before. Transcriptome analysis revealed that biosynthetic 149
pathways for amino acids (e.g., histidine, tryptophan and branched-chain amino acids) 150
were commonly upregulated in ethanol-tolerant strains of Escherichia coli obtained 151
by parallel evolution (19). Furthermore, Hirasawa et al. (2007) found that 152
overexpression of tryptophan biosynthesis genes or supplementation of tryptophan to 153
the culture medium conferred ethanol tolerance to Saccharomyces cerevisiae (20). In 154
the current study, it was noted that several proteins (e.g., HisIE, CysM and STM1557) 155
related to amino acid metabolism were differentially expressed. In particular, histidine 156
biosynthesis bifunctional protein HisIE was elevated by 1.34-fold in ethanol-adapted 157
S. Enteritidis (Table 1). Therefore, amino acid biosynthesis seems to be involved in 158
ethanol adaptation of S. Enteritidis. 159
ABC transporters 160
A large number of differentially expressed proteins were related to ABC 161
transporters in the current study (Table 1). Briefly, proteins responsible for transport 162
of glycine betaine (ProX and ProV), phosphate (PstC and PstS), D-alanine (DalS), 163
thiamine (TbpA) and heme (CcmC) were upregulated; while those for manganese 164
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
(SitB), cationic peptide (SapF) and siderophore (FepB and FepC) were downregulated. 165
The differential expression of such a sizable fraction of ABC transporters certainly 166
highlights their importance in ethanol adaptation of S. Enteritidis. There were only 167
two transporters, ProVWX and PstSCAB, with more than one upregulated protein. 168
ProVWX, one of the three osmoprotectant systems in S. enterica, utilizes ATP 169
hydrolysis to drive transport of compatible solutes (21). The pore, ATPase and 170
substrate binding proteins in this system are called ProW, ProV and ProX, 171
respectively. The contribution of compatible solutes (e.g., glycine betaine) transported 172
by ProVWX to bacterial survival under NaCl stress has been outlined (22, 23). In the 173
current study, the expression of ProX and ProV was enhanced 1.65- and 1.42-fold, 174
respectively (Table 1). Nevertheless, ethanol-adapted S. Enteritidis did not mount 175
cross protection against NaCl (17), reflecting that regulatory pathways mediating 176
osmotic stress tolerance may be different to those involved in ethanol stress response. 177
Bacteria have developed intricate strategies to sense and respond to changes in 178
environmental phosphate, thus maintaining intracellular phosphate pools which are 179
essential for their survival (24). The Pho regulon mediates the response of S. enterica 180
and E. coli to phosphate starvation conditions. In this regulon, the PstSCAB 181
transporter senses phosphate concentrations and communicates with the 182
two-component system PhoRB via PhoU (25). The genes belonging to this signal 183
transduction pathway in E. coli are only expressed when external phosphate is limited 184
(24). In the current study, PstS (a phosphate-binding protein), PstC (a phosphate 185
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
transport system permease protein) and PhoU (a phosphate-specific transport system 186
accessory protein) were upregulated following ethanol adaptation (Table 1; 187
supplementary Data S1). It was therefore indicative that a phosphate limitation 188
response was triggered by the sublethal ethanol treatment. Similarly, the expression of 189
genes encoding the PstSCAB transporter was enhanced in response to acid and 190
oxidative stresses in S. enterica (25, 26). Overall, maintaining cellular phosphate 191
homeostasis may be essential for S. Enteritidis to mount an adaptive response. 192
Regulators 193
Regulators are indispensable for S. enterica to mount appropriate responses to 194
food processing and storage-related stresses (26–28). Altogether, six regulators (Crl, 195
Fis, RssB, PurR, MetR and CspA) in S. Enteritidis showed differential expression in 196
the current study. Crl and RssB were upregulated by 1.40- and 1.33-fold, respectively, 197
while Fis was downregulated by 1.92-fold (Table 1). Interestingly, all these three 198
proteins are involved in the regulation of the sigma factor RpoS in S. enterica. Crl is 199
an unconventional transcription factor known to enhance RpoS activity by a direct 200
interaction, thus controlling the expression of RpoS-regulated genes (29, 30). The 201
RssB response regulator plays a central role in RpoS degradation by delivering it to 202
the ClpXP protease (31, 32); mutation in rssB (mviA) led to a higher level of RpoS 203
and stronger acid tolerance in S. Typhimurium (33). Fis acts as a regulator which 204
mediates the transcriptional induction of RpoS (34). In fact, RpoS abundance is 205
regulated at many levels, including protein activity, protein turnover, transcription and 206
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
translation (35). Although RpoS was not detected by iTRAQ in the current study, a 207
significant increase in rpoS mRNA level was observed upon ethanol adaptation (36). 208
The importance of RpoS to the survival of S. enterica under food processing and 209
storage-related stresses has been well documented (27, 28, 37). Therefore, it is 210
reasonable to speculate that Fis, RssB and Crl play a role in ethanol adaptation of S. 211
Enteritidis considering their regulatory effect on RpoS. 212
PurR is a transcriptional repressor of purine nucleotide biosynthesis in S. 213
enterica (38). In the current study, ethanol adaptation led to a repression of PurR, 214
along with the induction of HiuH and YaiE involved in purine metabolism (Table 1). 215
Cho et al. (2011) provided an evidence for the involvement of PurR in bacterial stress 216
response; deletion of purR decreased the expression of acid tolerance genes (e.g., 217
hdeA, hdeB and hdeD) in E. coli K-12 MG1655 (39). In this sense, downregulation of 218
PurR in the current work correlated well with our previous finding that ethanol 219
adaptation failed to induce cross protection against hydrochloric, citric, lactic, 220
ascorbic and acetic acids in S. Enteritidis (36). 221
MetR is a transcription factor of the LysR family, which regulates the expression 222
of methionine biosynthesis genes (e.g., metE, metF and metH) in S. enterica (40). 223
MetR and two other proteins (STM1557 and CysM) involved in methionine and 224
cysteine metabolism showed downregulation in the current study (Table 1). 225
Furthermore, the above-mentioned six proteins displayed a close interaction by 226
STRING analysis (supplemental Fig. S2). These results indicate the repression of 227
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
methionine biosynthesis pathway by ethanol adaptation. In fact, methionine 228
biosynthesis is generally sensitive to environmental signals such as heat shock and 229
oxidative stress (41). 230
CspA, the major and best characterized cold shock protein, acts as a global 231
regulator by binding to mRNA or single-stranded DNA. It can influence the 232
transcriptional and translational properties of bacterial cells (42). For instance, 233
Rennella et al. (2017) highlighted the RNA binding and chaperone activity of CspA in 234
E. coli (43). In S. Typhimurium, CspA targeted about 25% of the RNA encoded by 235
the genome. These targets were responsible for stress response, motility, virulence, 236
metabolic process, cellular transport, transcription regulation and metal binding (44). 237
Further mutational analysis provided evidences that cold shock proteins were 238
involved in ethanol, pH and NaCl stress response of Clostridium botulinum (45). In 239
the current study, ethanol adaptation reduced the expression of CspA by 2.13-fold 240
(Table 1). Meanwhile, our previous study showed that cross protection against -20 °C 241
occurred in S. Enteritidis following ethanol adaptation (17). Hence, the role of CspA 242
in ethanol adaptation and its induced cross protection effect against freezing 243
temperature in S. Enteritidis can be anticipated. 244
Ribosome 245
The expression of ribosome-related proteins was decreased in ethanol-adapted 246
cells of S. Enteritidis in the current study. As shown in Table 1, GTPases (Der and 247
Obg) and ATP-dependent RNA helicases (DeaD, RhlE and DbpA), which are 248
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
involved in ribosome maturation at least in E. coli (46), were repressed. The 249
ribosome-binding factor (RbfA) and tRNA methyltransferase (TrmD) were also 250
downregulated. In a similar vein, lower expression levels were observed for 30S 251
(RpsN and RpsI) and 50S (RpmH and RpmD) ribosomal proteins. The number of 252
ribosomal units determines the rate of protein synthesis, which is strictly related to the 253
rate of cellular growth (47). This means that the amount of ribosome-related proteins 254
plays an important role in bacterial growth rate. In our previous study, sublethal 255
concentrations of ethanol (2.5-10%) used for ethanol adaptation inhibited the growth 256
of S. Enteritidis (17). This inhibitory effect can be explained by the repression of 257
ribosome-related proteins under ethanol adaptation conditions. 258
Enterobactin biosynthesis and uptake 259
Enterobactin is a major siderophore produced by S. enterica under iron 260
restriction conditions to solubilize exogenous iron, thereby making this metal 261
available for bacterial cells (48). In the current study, ethanol adaptation led to a 262
repression of proteins responsible for enterobactin biosynthesis (EntA, EntB, EntC, 263
EntF and EntH; 1.38- to 1.69-fold) and uptake (CirA, FepA, FepB and FepC; 1.32- to 264
1.78-fold) (Table 1). In fact, there is increasing evidence implicating the role of 265
enterobactin in bacterial stress response. For example, enterobactin biosynthesis and 266
uptake were induced following exposure of S. Enteritidis to egg white to facilitate iron 267
acquisition, thus providing a survival advantage to this bacterium (16, 49). Peralta et 268
al. (2016) found that enterobactin protected E. coli against oxidative stress and this 269
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
effect was independent of its capacity to scavenge iron (50). Moreover, the growth of 270
E. coli ⊿tolC mutant was impaired by the accumulation of periplasmic enterobactin 271
(51). Therefore, blocking enterobactin synthesis and uptake pathways could be an 272
adaptation strategy of S. Enteritidis under sublethal ethanol stress in the current study. 273
Flagella 274
As shown in Table 1, two proteins (FliH, a flagellar assembly protein; FlgF, a 275
flagellar basal body rod protein) related to flagellar assembly were repressed during 276
the course of ethanol adaptation. Similarly, flgF in S. Typhimurium was 277
downregulated in response to oxidative stress, which might serve as an energy 278
conservation strategy (25). Moreover, the expression of both fliH and flgF was 279
reduced when an acid tolerance response was stimulated in S. Typhimurium; further 280
functional analysis revealed that mutation of flgD encoding a scaffolding protein 281
required for flagellar hook formation led to the absence of an acid adaptation 282
phenotype (26). Hence, the results above enforce the knowledge of flagella-related 283
proteins playing a crucial role in the stress response of S. enterica. 284
Salmonella pathogenicity island (SPI) 285
During food processing and storage, foodborne pathogens encounter many of the 286
same stresses as they experience during host infection. Therefore, many stress 287
tolerance-related genes are also likely involved in bacterial survival within the host 288
and stress adaptation can thus alter the virulence potential of foodborne pathogens 289
(52). In the current study, four SPI-related proteins (PrgI, PrgK, MisL and InvC) were 290
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
downregulated by 1.39- to 1.85-fold after ethanol adaptation (Table 1). SPIs are 291
highly conserved across the genus and essential for virulence (26). The prgI and prgK 292
genes encode secretion apparatus proteins of SPI-1 (53). The misL gene encodes an 293
outer membrane autotransporter in SPI-3 (54). The invasion gene invC is a key 294
component of type III secretion system (55). Ryan et al. (2015) found that several 295
virulence factors in S. Typhimurium were differentially regulated during acid 296
adaptation, including invACE in SPI-1 and ssaCGJNQRV in SPI-2 (26). Furthermore, 297
heat shock led to a repression of SPI-1 genes (e.g., prgK and prgH) and an induction 298
of SPI-2 and SPI-5 genes in S. Typhimurium, accompanied with a greater adhesion to 299
Caco-2 cells (56). There is still a lack of knowledge on the virulence of 300
ethanol-adapted S. Enteritidis that can be further addressed in future studies. 301
Validation of iTRAQ results at the mRNA level 302
The iTRAQ data were verified by reverse transcription quantitative real-time 303
PCR (RT-qPCR) to determine the transcriptional profile of ten differentially regulated 304
proteins. Six proteins (ProV, SecE, STM2506, YlaC, HiuH and ProX) were 305
upregulated and four (EntA, FepA, SitB and CspA) were downregulated. As shown in 306
Fig. 3, nine of the ten proteins and their corresponding mRNAs displayed a similar 307
expression pattern, and the only exception was ProV. This finding provided evidence 308
for the reliability of data derived from the aforementioned proteomic analysis. 309
Functional analysis of HiuH and ProX in ethanol adaptation of S. Enteritidis 310
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
In the current study, we hypothesized that highly-upregulated proteins revealed 311
by iTRAQ are important to ethanol adaptation of S. Enteritidis. Therefore, two 312
proteins (HiuH involved in nucleotide metabolism and ProX associated with ABC 313
transporter) that showed enhanced expression in both iTRAQ and RT-qPCR tests 314
were selected for mutagenic analysis. We constructed S. Enteritidis mutants in which 315
hiuH or proX was deleted and compared their ability to develop ethanol tolerance 316
response with that of the wild type strain. No significant (p > 0.05) difference was 317
found in the growth curve of wild type, ⊿hiuH and ⊿proX strains in Luria-Bertani 318
(LB) broth (supplemental Fig. S3). Nevertheless, ⊿hiuH and ⊿proX mutants mounted 319
a significantly (p < 0.05) higher ethanol tolerance response compared with that of the 320
wild type strain (Fig. 4). Furthermore, ethanol tolerance response was restored in 321
complementing strains (Fig. 4), thereby confirming the negative regulatory role of 322
these two proteins in ethanol adaptation of S. Enteritidis. 323
The 5-hydroxyisourate (5-HIU) hydrolase HiuH is involved in bacterial purine 324
metabolism (57). This pathway requires four enzymatic steps that convert xanthine to 325
uric acid, uric acid to 5-HIU, 5-HIU to OHCU 326
(2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline) and OHCU to allantoin, 327
respectively (58). HiuH catalyzes the third step of this reaction to metabolize 5-HIU 328
to OHCU (59). Hennebry et al. (2012) found that mutation in hiuH (yedX) did not 329
affect the response of S. Typhimurium to oxidative stress, reduced nutrient provision 330
and temperature alteration (58). In the current study, it was demonstrated that the 331
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
deficiency of hiuH contributed to the development of ethanol tolerance response in S. 332
Enteritidis. Although the mechanism for this negative regulation is unclear, these 333
findings suggest that the purine metabolism pathway is involved in ethanol adaptation 334
of S. Enteritidis. 335
Deletion of proX also led to a significantly (p < 0.05) higher magnitude of 336
ethanol tolerance response in the current study. Similarly, the tolerance of E. coli to 337
n-hexane and cyclohexane was improved by the disruption of proX (60). These 338
observations provided evidence for the involvement of the ProVWX uptake system in 339
bacterial organic solvent tolerance. In ProVWX system, ProX recognizes a 340
compatible solute and delivers it to a protein complex consisting of ProV and ProW. 341
The ProVWX transporter permits the uptake of various compatible solutes (e.g., 342
glycine betaine, ectoine, taurine, proline and structural analogues glycine betaine) 343
involved in bacterial stress response (61). It was therefore speculated that the 344
disruption of the proX gene improved ethanol tolerance response of S. Enteritidis by 345
acting on the intracellular concentration of these solutes. Taken together, mutational 346
analysis supports our hypothesis that highly upregulated proteins, such as HiuH and 347
ProX, play a role in ethanol adaptation of S. Enteritidis. 348
349
CONCLUSIONS 350
Proteomic characterization revealed that complex regulatory pathways associated 351
with metabolism, ABC transporter, regulator, enterobactin biosynthesis and uptake, 352
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
ribosome, flagellar assembly and virulence were at play during ethanol adaptation of 353
S. Enteritidis. Moreover, mutagenic and complementation analyses demonstrated a 354
negative regulatory role of ProX and HiuH in ethanol adaptation. Collectively, our 355
work provides important insights into ethanol adaptation mechanisms of S. Enteritidis 356
as well as a framework for further investigation on this subject. For example, 357
functional analysis of more proteins belonging to different pathways will deepen our 358
understanding of ethanol adaptation in S. Enteritidis. It would also be interesting to 359
address the effect of ethanol adaptation on virulence properties of S. Enteritidis in 360
future studies. 361
362
MATERIALS AND METHODS 363
Bacterial strains and storage conditions 364
The S. Enteritidis strain ATCC 13076, obtained from the American Type Culture 365
Collection, was used in the current study. The bacterial strain was maintained in LB 366
broth supplemented with 25% glycerol at -80 °C, and streaked onto LB agar, followed 367
by incubation at 37 °C for 24 h prior to use. For each experiment, a single colony was 368
inoculated in 5 ml LB broth and incubated overnight at 37 °C. A 500-μl aliquot of the 369
active culture was inoculated into 50 ml LB broth and incubated at 37 °C/200 rpm for 370
5 h to reach the late exponential phase (17). 371
Ethanol adaptation assays 372
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
The ethanol adaptation assay was carried out as previously described (17). 373
Briefly, the late exponential-phase cultures (5 ml) of S. Enteritidis were centrifuged, 374
washed with PBS (phosphate buffered saline, pH 7.4) and resuspended in 50 ml fresh 375
LB broth (control) or in LB broth containing 5% (v/v) ethanol. These samples were 376
incubated at 25 °C with shaking (170 rpm) for 1 h to prepare non-adapted and 377
ethanol-adapted cultures for iTRAQ test, respectively. Moreover, these two cultures 378
were subjected to ethanol tolerance assessment according to our previous method 379
(17). 380
Protein extraction, quantification and digestion 381
Non-adapted and ethanol-adapted cells of S. Enteritidis were washed twice with 382
PBS, resuspended in SDT buffer (1 mM DTT, 4% SDS, 150 mM Tris-HCl, pH 8.0), 383
boiled for 5 min and ultrasonicated for another 5 min. The lysates were centrifuged at 384
14,000 g for 10 min to remove cellular debris (16). The resulting supernatants were 385
transferred to new tubes and stored at -80 °C for subsequent use. Bicinchoninic acid 386
(BCA) Protein Assay Reagent (Promega, Madison, WI) was then utilized to 387
determine the protein concentration. 388
Protein digestion was performed according to FASP (filter-aided sample 389
preparation) protocol (62). Briefly, 200 μg protein from each sample was mixed with 390
30 μl SDT buffer and was washed three times by ultrafiltration (Pall units, 10 kDa) 391
with 200 μl UA buffer (8 M urea, 150 mM Tris-HCl pH 8.0). Proteins were then 392
alkylated with 50 mM iodoacetamide in the dark for 30 min, washed three times with 393
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
100 μl UA buffer and then twice with 100 μl DS buffer (50 mM triethylammonium 394
bicarbonate, pH 8.5). Finally, proteins were digested overnight with 2 μg trypsin 395
(Promega, Madison, WI) in 40 μl DS buffer at 37 °C. The resulting peptides were 396
collected as a filtrate in clean tubes by centrifugation at 14,000 g for 10 min. The 397
peptide content was estimated by UV light spectral density at 280 nm using an 398
extinction coefficient of 1.1 of 0.1% solution that was calculated on the basis of the 399
frequency of tryptophan and tyrosine in vertebrate proteins. 400
iTRAQ labeling and SCX fractionation 401
The 8 multiplex iTRAQ labelings were carried out according to the 402
manufacturer’s instructions (Applied Biosystems, Foster City, CA). iTRAQ reagents 403
113 and 114 were employed to label the peptides from non-adapted S. Enteritidis, 404
whereas the reagents 117 and 118 were utilized to label the peptides from 405
ethanol-adapted S. Enteritidis. Other four labels (115, 116, 119, 121) were used in 406
other experiments. Samples were combined and vacuum dried after labeling. The 407
iTRAQ-labeled peptides were dissolved in 2 ml buffer A (10 mM KH2PO4 in 25% 408
acetonitrile, pH 3.0) and fractionated using an AKTA Purifier system (GE Healthcare, 409
Sweden) and a PolySulfoethyl column (4.6 100 mm, 5 µm, PolyLC Columbia, 410
MD). The gradient elution was conducted with 0% to 10% buffer B (500 mM KCl, 10 411
mM KH2PO4 in 25% acetonitrile, pH 3.0) for 32 min, 10% to 20% buffer B for 10 412
min, 20% to 45% buffer B for 5 min and 45% to 100% buffer B for 13 min. The 413
tryptic peptides were separated at a flow rate of 1,000 μl/min and monitored by 414
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
absorbance at 214 nm. The fractions were collected every minute, combined into 15 415
pools, desalted using C18 Cartridges (Empore SPE Sigma, St. Louis, MO) and 416
concentrated by vacuum centrifugation. 417
LC-ESI-MS/MS analysis 418
The labeled peptides were analyzed on a Q Exactive mass spectrometer coupled 419
to an Easy-nLC liquid chromatography system (Proxeon Biosystems, Thermo Fisher, 420
Fairlawn, NJ) and equipped with a C18 trap column (5 μm, 100 μm × 20 mm) and a 421
C18 analytical column (3 μm, 75 μm × 100 mm). An aliquot of 10 μl sample was 422
loaded along with RP-C18 5 μm resin in buffer A (0.1% formic acid). Separation was 423
achieved using a linear gradient of buffer B (84% acetonitrile in 0.1% formic acid) 424
controlled by IntelliFlow technology at a flow rate of 250 nl/min. A data-dependent 425
top 10 method was utilized to acquire MS data, dynamically selecting the most 426
abundant precursor ions from the survey scan (300-1800 m/z) for HCD 427
(higher-energy collisional dissociation) fragmentation. The predictive Automatic Gain 428
Control (pAGC) system was employed with the instrument using dynamic exclusion 429
duration of 60 s to determine the target value. Survey scans were obtained at m/z 200 430
at a resolution of 70,000 and resolution for HCD spectra was set to 17,500 at m/z 200. 431
Normalized collision energy was 30 eV and the underfill ratio was defined as 0.1%. 432
The instrument was run along with the peptide recognition mode enabled. 433
Data analysis 434
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
MS/MS spectra were searched against the S. Enteritidis uniprot database (37,314 435
sequences downloaded on June 22, 2016) and the decoy database using Mascot 2.2 436
(Matrix Science, London, UK) embedded in Proteome Discoverer 1.4 (Thermo 437
Electron, San Jose, CA). The following parameters were used for protein 438
identification: enzyme, trypsin; MS/MS tolerance, 0.1 Da; missed cleavage, 2; 439
variable modification, Oxidation (M); fixed modification, Carbamidomethyl (C); 440
iTRAQ8plex(K), iTRAQ8plex(N-term); false discovery rate (FDR), ≤ 0.01. 441
Proteins with iTRAQ ratios > 1.3 (increased) or < 0.77 (decreased) and p < 0.05 442
were considered to be differentially expressed. The KEGG (Kyoto Encyclopedia of 443
Genes and Genomes) pathway enrichment analysis 444
(http://www.genome.jp/kegg/pathway.html) was employed to determine the metabolic 445
pathway for all differentially expressed proteins. 446
Gene expression analysis 447
Differentially expressed proteins in iTRAQ test were validated at the mRNA 448
level by RT-qPCR. A total of ten differentially regulated proteins were selected to 449
determine their corresponding transcription levels. RNA extraction and RT-qPCR 450
analysis were carried out on non-adapted and ethanol-adapted S. Enteritidis cells as 451
previously described using primers listed in Table 2 (36). Alterations of gene 452
expression in ethanol-adapted cells compared to non-adapted counterparts were 453
calculated by the 2−ΔΔCt
method. The 16S rRNA gene was employed as a nonregulated 454
control for data normalization. 455
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
Generation of hiuH and proX deletion mutants and complementing strains 456
In-frame deletions of hiuH and proX were performed according to 457
previously-described homologous recombination knockout procedures using primers 458
in Table 3 (63). Plasmids and strains used were listed in Table 4. The fragments of 459
homologous arms were obtained from S. Enteritidis genomic DNA by overlap 460
extension PCR. This product was cloned into the pMD19-T vector (TaKaRa, Dalian, 461
China) to generate pMD19⊿hiuH and pMD19⊿proX, respectively. The correct 462
construction was confirmed by DNA sequencing. Both pMD19⊿hiuH and 463
pMD19⊿proX were digested with Sac I and Xba I, and then ligated into pRE112 (a 464
suicide vector carrying a sucrose-sensitive gene and a chloramphenicol-resistance 465
gene). The resulting pRE⊿hiuH and pRE⊿proX were introduced into E. coli 466
SM10λpir by CaCl2 transformation. These two plasmids were then extracted from E. 467
coli cells and transformed into the wild type S. Enteritidis ATCC 13076 by 468
electroporation (2400 V, 4.2 ms) to accomplish a single crossover. The single 469
crossover strains were grown in LB broth supplemented with 8% sucrose to 470
accomplish a second crossover. Colonies that were resistant to sucrose and sensitive 471
to chloramphenicol were selected. The resulting mutants, S. Enteritidis ⊿hiuH and S. 472
Enteritidis ⊿proX, were confirmed by PCR analysis and DNA sequencing. 473
To generate complemented strains, the constructed plasmids pRE⊿hiuH-C and 474
pRE⊿proX-C were transferred into the corresponding mutant strains by 475
electroporation at 2400 V for 4.2 ms. A double selection was then carried out as 476
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
described above. The complementation of these two genes was confirmed by PCR 477
and DNA sequencing. 478
Determination of the role of hiuH and proX in ethanol adaptation 479
The role of hiuH and proX in ethanol adaptation of S. Enteritidis was assessed by 480
comparing the capacity of their deletion mutants (⊿hiuH and ⊿proX) and 481
complemented strains (⊿hiuH-C and ⊿proX-C) to develop ethanol tolerance response 482
with that of the wild type (WT). Ethanol tolerance response, defined as the induced 483
tolerance to normally lethal ethanol challenge conditions following adaptation to mild 484
ethanol stress, was determined as previously detailed (17). The wild type, deletion 485
mutants and complemented strains of S. Enteritidis were adapted in 5% ethanol for 1 486
h as described above. Ethanol-adapted cells (100 μl) were then inoculated into 10 ml 487
LB broth containing 15% ethanol. The viable bacterial population was determined 488
after incubation at 25 °C/170 rpm for 4 h by plating the appropriate dilutions onto LB 489
agar. The survival rate was then calculated by dividing the initial population 490
(corresponding to 100%) with the surviving population. 491
Statistical analysis 492
Gene expression levels and survival rates were subjected to a one-way ANOVA 493
analysis by SAS version 8.0 (SAS Institute Inc., Cary, NC). Duncan’s test was then 494
employed to detect the statistical significance at the level of p < 0.05. 495
ACKNOWLEDGEMENTS 496
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
This work was supported by the grant from National Key R&D program of 497
China (2016YFE0106100). The first author Mr. Shoukui He received a scholarship 498
(File No. 201706230177) from China Scholarship Council for his study at The 499
University of British Columbia. Authors would like to thank Dr. Gahee Ban for her 500
critical reading of this manuscript, and Dr. Daniel Ryan for his helpful suggestions on 501
proteomic data analysis. 502
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
REFERENCES 503
1. Lou Y, Yousef AE. 1997. Adaptation to sublethal environmental stresses protects 504
Listeria monocytogenes against lethal preservation factors. Appl Environ 505
Microbiol 63:1252-1255. 506
2. Browne N, Dowds BCA. 2001. Heat and salt stress in the food pathogen Bacillus 507
cereus. J Appl Microbiol 91:1085-1094. 508
3. Chiang ML, Ho WL, Chou CC. 2006. Response of Vibrio parahaemolyticus to 509
ethanol shock. Food Microbiol 23:461-467. 510
4. Huang YT, Cheng KC, Yu RC, Chou CC. 2013. Effect of ethanol shock 511
pretreatment on the tolerance of Cronobacter sakazakii BCRC 13988 exposed to 512
subsequent lethal stresses. Foodborne Pathog Dis 10:165-170. 513
5. Browne N, Dowds BCA. 2002. Acid stress in the food pathogen Bacillus cereus. 514
J Appl Microbiol 92:404-414. 515
6. Chiang ML, Ho WL, Chou CC. 2008. Ethanol shock changes the fatty acid 516
profile and survival behavior of Vibrio parahaemolyticus in various stress 517
conditions. Food Microbiol 25:359-365. 518
7. Chiang ML, Chou CC. 2009. Survival of Vibrio parahaemolyticus under 519
environmental stresses as influenced by growth phase and pre-adaptation 520
treatment. Food Microbiol 26:391-395. 521
8. Chen Z. 2017. Stress responses of foodborne pathogens and implications in food 522
safety. J Food Microbiol Saf Hyg 2:E103. 523
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
9. Chiang ML, Ho WL, Yu RC, Chou CC. 2008. Protein expression in Vibrio 524
parahaemolyticus 690 subjected to sublethal heat and ethanol shock treatments. J 525
Food Protect 71:2289-2294. 526
10. Wu WW, Wang G, Baek SJ, Shen RF. 2006. Comparative study of three 527
proteomic quantitative methods, DIGE, cICAT, and iTRAQ, using 2D gel- or 528
LC-MALDI TOF/TOF. J Proteome Res 5:651-658. 529
11. Hu S, Yu Y, Wu X, Xia X, Xiao X, Wu H. 2017. Comparative proteomic analysis 530
of Cronobacter sakazakii by iTRAQ provides insights into response to 531
desiccation. Food Res Int 100:631-639. 532
12. Jain S, Graham C, Graham RL, McMullan G, Ternan NG. 2011. Quantitative 533
proteomic analysis of the heat stress response in Clostridium difficile strain 630. J 534
Proteome Res 10:3880-3890. 535
13. Pittman JR, Buntyn JO, Posadas G, Nanduri B, Pendarvis K, Donaldson JR. 2014. 536
Proteomic analysis of cross protection provided between cold and osmotic stress 537
in Listeria monocytogenes. J Proteome Res 13:1896-1904. 538
14. Sun L, Chen H, Lin W, Lin X. 2017. Quantitative proteomic analysis of 539
Edwardsiella tarda in response to oxytetracycline stress in biofilm. J Proteomics 540
150:141-148. 541
15. Maserati A, Lourenco A, Diez-Gonzalez F, Fink RC. 2018. iTRAQ-based global 542
proteomic analysis of Salmonella enterica serovar Typhimurium in response to 543
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
desiccation, low aw, and thermal treatment. Appl Environ Microbiol 544
84:e00393-18. 545
16. Qin X, He S, Zhou X, Cheng X, Huang X, Wang Y, Wang S, Cui Y, Shi C, Shi X. 546
2019. Quantitative proteomics reveals the crucial role of YbgC for Salmonella 547
enterica serovar Enteritidis survival in egg white. Int J Food Microbiol 548
289:115-126. 549
17. He S, Zhou X, Shi C, Shi X. 2016. Ethanol adaptation induces direct protection 550
and cross‐protection against freezing stress in Salmonella enterica serovar 551
Enteritidis. J Appl Microbiol 120:697-704. 552
18. Allan RN, Morgan S, Brito-Mutunayagam S, Skipp P, Feelisch M, Hayes SM, 553
Hellier W, Clarke SC, Stoodley P, Burgess A, Ismail-Koch H, Salib RJ, Webb JS, 554
Faust SN, Hall-Stoodley L. 2016. Low concentrations of nitric oxide modulate 555
Streptococcus pneumoniae biofilm metabolism and antibiotic tolerance. 556
Antimicrob Agents Chemother 60:2456-2466. 557
19. Horinouchi T, Tamaoka K, Furusawa C, Ono N, Suzuki S, Hirasawa T, Yomo T, 558
Shimizu H. 2010. Transcriptome analysis of parallel-evolved Escherichia coli 559
strains under ethanol stress. BMC Genomics 11:579. 560
20. Hirasawa T, Yoshikawa K, Nakakura Y, Nagahisa K, Furusawa C, Katakura Y, 561
Shimizu H, Shioya S. 2007. Identification of target genes conferring ethanol 562
stress tolerance to Saccharomyces cerevisiae based on DNA microarray data 563
analysis. J Biotechnol 131:34-44. 564
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
21. Frossard SM, Khan AA, Warrick EC, Gately JM, Hanson AD, Oldham ML, 565
Sanders DA, Csonka LN. 2012. Identification of a third osmoprotectant transport 566
system, the OsmU system, in Salmonella enterica. J Bacteriol 194:3861-3871. 567
22. Cairney J, Booth IR, Higgins CF. 1985. Osmoregulation of gene expression in 568
Salmonella typhimurium: proU encodes an osmotically induced betaine transport 569
system. J Bacteriol 164:1224-1232. 570
23. Finn S, Rogers L, Händler K, McClure P, Amézquita A, Hinton JC, Fanning S. 571
2015. Exposure of Salmonella enterica serovar Typhimurium to three humectants 572
used in the food industry induces different osmoadaptation systems. Appl 573
Environ Microbiol 81:6800-6811. 574
24. Vuppada RK, Hansen CR, Strickland KA, Kelly KM, McCleary WR. 2018. 575
Phosphate signaling through alternate conformations of the PstSCAB phosphate 576
transporter. BMC Microbiol 18:8. 577
25. Wang S, Phillippy AM, Deng K, Rui X, Li Z, Tortorello ML, Zhang W. 2010. 578
Transcriptomic responses of Salmonella enterica serovars Enteritidis and 579
Typhimurium to chlorine-based oxidative stress. Appl Environ Microbiol 580
76:5013-5024. 581
26. Ryan D, Pati NB, Ojha UK, Padhi C, Ray S, Jaiswal S, Singh GP, Mannala GK, 582
Schultze T, Chakraborty T, Suar M. 2015. Global transcriptome and mutagenic 583
analyses of the acid tolerance response of Salmonella enterica serovar 584
Typhimurium. Appl Environ Microbiol 81:8054-8065. 585
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
30
27. Álvarez-Ordóñez A, Prieto M, Bernardo A, Hill C, López M. 2012. The acid 586
tolerance response of Salmonella spp.: an adaptive strategy to survive in stressful 587
environments prevailing in foods and the host. Food Res Int 45:482-492. 588
28. Spector MP, Kenyon WJ. 2012. Resistance and survival strategies of Salmonella 589
enterica to environmental stresses. Food Res Int 45:455-481. 590
29. Cavaliere P, Sizun C, Levi-Acobas F, Nowakowski M, Monteil V, Bontems F, 591
Bellalou J, Mayer C, Norel F. 2015. Binding interface between the Salmonella 592
σS/RpoS subunit of RNA polymerase and Crl: hints from bacterial species lacking 593
crl. Scientific reports 5:13564. 594
30. Robbe-Saule V, Jaumouillé V, Prévost MC, Guadagnini S, Talhouarne C, 595
Mathout H, Kolb A, Norel F. 2006. Crl activates transcription initiation of 596
RpoS-regulated genes involved in the multicellular behavior of Salmonella 597
enterica serovar Typhimurium. J Bacteriol 188:3983-3994. 598
31. Moreno M, Audia JP, Bearson SM, Webb C, Foster JW. 2000. Regulation of 599
sigma S degradation in Salmonella enterica var Typhimurium: in vivo 600
interactions between sigma S, the response regulator MviA (RssB) and ClpX. J 601
Mol Microbiol Biotechnol 2:245-254. 602
32. Zhou Y, Gottesman S, Hoskins JR, Maurizi MR, Wickner S. 2001. The RssB 603
response regulator directly targets σS for degradation by ClpXP. Genes Dev 604
15:627-637. 605
33. Bearson SM, Benjamin WH, Swords WE, Foster JW. 1996. Acid shock induction 606
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
31
of RpoS is mediated by the mouse virulence gene mviA of Salmonella 607
typhimurium. J Bacteriol 178:2572-2579. 608
34. Hirsch M, Elliott T. 2005. Fis regulates transcriptional induction of RpoS in 609
Salmonella enterica. J Bacteriol 187:1568-1580. 610
35. Hengge-Aronis R. 2002. Signal transduction and regulatory mechanisms involved 611
in control of the σS (RpoS) subunit of RNA polymerase. Microbiol Mol Biol Rev 612
66:373-395. 613
36. He S, Cui Y, Qin X, Zhang F, Shi C, Paoli GC, Shi X. 2018. Influence of ethanol 614
adaptation on Salmonella enterica serovar Enteritidis survival in acidic 615
environments and expression of acid tolerance-related genes. Food Microbiol 616
72:193-198. 617
37. Esbelin J, Santos T, Hébraud M. 2018. Desiccation: An environmental and food 618
industry stress that bacteria commonly face. Food Microbiol 69:82-88. 619
38. Yang Z, Lu Z, Wang A. 2001. Study of adaptive mutations in Salmonella 620
typhimurium by using a super-repressing mutant of a trans regulatory gene purR. 621
Mutat Res 484:95-102. 622
39. Cho BK, Federowicz SA, Embree M, Park YS, Kim D, Palsson BØ. 2011. The 623
PurR regulon in Escherichia coli K-12 MG1655. Nucleic Acids Res 624
39:6456-6464. 625
40. Rubinelli P, Kim S, Park SH, Baker CA, Ricke SC. 2017. Growth 626
characterization of single and double Salmonella methionine auxotroph strains for 627
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
32
potential vaccine use in poultry. Front Vet Sci 4:103. 628
41. Jozefczuk S, Klie S, Catchpole G, Szymanski J, Cuadros‐Inostroza A, 629
Steinhauser D, Selbig J, Willmitzer L. 2010. Metabolomic and transcriptomic 630
stress response of Escherichia coli. Mol Syst Biol 6:364. 631
42. Ricke SC, Dawoud TM, Kim SA, Park SH, Kwon YM. 2018. Salmonella cold 632
stress response: mechanisms and occurrence in foods. Adv Appl Microbiol 633
104:1-38. 634
43. Rennella E, Sára T, Juen M, Wunderlich C, Imbert L, Solyom Z, Favier A, Ayala 635
I, Weinhäupl K, Schanda P, Konrat R, Kreutz C, Brutscher B. 2017. RNA 636
binding and chaperone activity of the E. coli cold-shock protein CspA. Nucleic 637
Acids Res 45:4255-4268. 638
44. McGibbon LC. 2013. RNA interactome of cold shock proteins, CspA and CspE, 639
in Salmonella Typhimurium. (Doctoral dissertation, The University of 640
Edinburgh). 641
45. Derman Y, Söderholm H, Lindström M, Korkeala H. 2015. Role of csp genes in 642
NaCl, pH, and ethanol stress response and motility in Clostridium botulinum 643
ATCC 3502. Food Microbiol 46:463-470. 644
46. Kaczanowska M, Rydén-Aulin M. 2007. Ribosome biogenesis and the translation 645
process in Escherichia coli. Microbiol Mol Biol Rev 71:477-494. 646
47. Maserati A. 2017. Salmonella's desiccation survival and thermal tolerance: 647
genetic, physiological, and metabolic factors (Doctoral dissertation, University of 648
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
33
Minnesota). 649
48. Ahmed E, Holmström SJ. 2014. Siderophores in environmental research: roles 650
and applications. Microb Biotechnol 7:196-208. 651
49. Baron F, Bonnassie S, Alabdeh M, Cochet MF, Nau F, Guérin-Dubiard C, 652
Gautier M, Andrews SC, Jan S. 2017. Global gene-expression analysis of the 653
response of Salmonella Enteritidis to egg white exposure reveals multiple egg 654
white-imposed stress responses. Front Microbiol 8:829. 655
50. Peralta DR, Adler C, Corbalán NS, García ECP, Pomares MF, Vincent PA. 2016. 656
Enterobactin as part of the oxidative stress response repertoire. PLoS One 657
11:e0157799. 658
51. Vega DE, Young KD. 2014. Accumulation of periplasmic enterobactin impairs 659
the growth and morphology of Escherichia coli tolC mutants. Mol Microbiol 660
91:508-521. 661
52. Begley M, Hill C. 2015. Stress adaptation in foodborne pathogens. Annu Rev 662
Food Sci Technol 6:191-210. 663
53. Klein JR, Fahlen TF, Jones BD. 2000. Transcriptional organization and function 664
of invasion genes within Salmonella enterica serovar Typhimurium pathogenicity 665
island 1, including the prgH, prgI, prgJ, prgK, orgA, orgB, and orgC genes. 666
Infect Immun 68:3368-3376. 667
54. Dorsey CW, Laarakker MC, Humphries AD, Weening EH, Bäumler AJ. 2005. 668
Salmonella enterica serotype Typhimurium MisL is an intestinal colonization 669
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
34
factor that binds fibronectin. Mol Microbiol 57:196-211. 670
55. Brumme S, Arnold T, Sigmarsson H, Lehmann J, Scholz HC, Hardt WD, Hensel 671
A, Truyen U, Roesler U. 2007. Impact of Salmonella Typhimurium DT104 672
virulence factors invC and sseD on the onset, clinical course, colonization 673
patterns and immune response of porcine salmonellosis. Vet Microbiol 674
124:274-285. 675
56. Sirsat SA, Burkholder KM, Muthaiyan A, Dowd SE, Bhunia AK, Ricke SC. 2011. 676
Effect of sublethal heat stress on Salmonella Typhimurium virulence. J Appl 677
Microbiol 110:813-822. 678
57. Hennebry SC, Law RH, Richardson SJ, Buckle AM, Whisstock JC. 2006. The 679
crystal structure of the transthyretin-like protein from Salmonella dublin, a 680
prokaryote 5-hydroxyisourate hydrolase. J Mol Biol 359:1389-1399. 681
58. Hennebry SC, Sait LC, Mantena R, Humphrey TJ, Yang J, Scott T, Strugnell RA. 682
2012. Salmonella typhimurium's transthyretin-like protein is a host-specific factor 683
important in fecal survival in chickens. PLoS One:e46675. 684
59. French JB, Ealick SE. 2011. Structural and kinetic insights into the mechanism of 685
5‐hydroxyisourate hydrolase from Klebsiella pneumoniae. Acta Crystallogr D 686
Biol Crystallogr 67:671-677. 687
60. Doukyu N, Ishikawa K, Watanabe R, Ogino H. 2012. Improvement in organic 688
solvent tolerance by double disruptions of proV and marR genes in Escherichia 689
coli. J Appl Microbiol 112:464-474. 690
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
35
61. Lucht JM, Bremer E. 1994. Adaptation of Escherichia coli to high osmolarity 691
environments: Osmoregulation of the high-affinity glycine betaine transport 692
system ProU. FEMS Microbiol Rev 14:3-20. 693
62. Wiśniewski JR, Zougman A, Nagaraj N, Mann M. 2009. Universal sample 694
preparation method for proteome analysis. Nat Methods 6:359. 695
63. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed 696
mutagenesis by overlap extension using the polymerase chain reaction. Gene 697
77:51-59. 698
699
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
36
Figure captions 700
Figure 1 Ethanol adaptation (5% ethanol for 1 h) induces tolerance to a normally 701
lethal ethanol treatment (15% ethanol for 1 h) in S. Enteritidis. The survival rate was 702
calculated by dividing the surviving population by the initial population 703
(corresponding to 100%). Data are presented as mean ± standard deviation. Different 704
lowercase letters indicate significant differences (p < 0.05). 705
Figure 2 A proposed model for major cellular changes occurring during ethanol 706
adaptation of S. Enteritidis. The star symbol (★) indicates that the function of a 707
protein belonging to this pathway has been validated by mutagenic analysis in the 708
current study. 709
Figure 3 Comparison between protein and mRNA levels of ten differentially 710
regulated proteins revealed by iTRAQ and RT-qPCR. Stars (*) signify that a gene in S. 711
Enteritidis was significantly (p < 0.05) differentially expressed in response to 712
sublethal ethanol adaptation (5% ethanol for 1 h). 713
Figure 4 Ethanol tolerance response in the wild type (WT), deletion mutants (⊿hiuH 714
and ⊿proX) and complemented strains (⊿hiuH-C and ⊿proX-C) of S. Enteritidis. 715
Ethanol-adapted cells (5% ethanol for 1 h) were further exposed to 15% ethanol for 4 716
h. The survival rate, calculated by dividing the initial population (corresponding to 717
100%) with the surviving population, was then employed to assess the development 718
of ethanol tolerance response. A survival rate of 50% indicates that the population of 719
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
37
S. Enteritidis cells was reduced by half. Data are presented as mean ± standard 720
deviation. Different lowercase letters indicate significant differences (p < 0.05). 721
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
38
Figure 1 722
723
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
39
Figure 2 724
725 on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
40
Figure 3 726
727
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
41
Figure 4 728
729
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
42
Table 1 Representative functional groups for differentially expressed proteins during ethanol adaptation of S. Enteritidis 730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
Accession Description Gene name Ratio
Metabolism
S4IEX7 5-hydroxyisourate hydrolase hiuH 1.98
B5QTE0 UPF0345 protein YaiE yaiE 1.36
S4K9X6 Histidine biosynthesis bifunctional protein HisIE hisI 1.34
B5QWI9 Arginine N-succinyltransferase astA 1.81
S4HY70 Cysteine synthase cysM 0.59
S4JEB3 Aminotransferase, class I/II STM1557 0.69
S4JAI7 Ketose-bisphosphate aldolase gatY 1.52
S4I2H1 Glyoxylate carboligase gcl 1.43
S4IDM5 Transketolase protein STM2340 1.40
S4HV82 PTS system fructose-specific EIIBBC component fruA 1.30
B5R1U0 Ribulokinase araB 0.72
S4I914 Succinate dehydrogenase hydrophobic membrane anchor subunit sdhD 0.73
S4I998 PTS system, glucitol/sorbitol-specific, IIBC component srlE 0.49
B5R5F8 Phosphopantetheine adenylyltransferase coaD 1.36
T2Q4S9 Thioesterase family protein yciA 0.61
S4IJ46 Penicillin-binding protein mrdA 0.73
S4JPU1 NDH-1 subunit M nuoM 1.37
B5R2Z7 NADH-quinone oxidoreductase subunit N nuoN 1.38
S4HPP4 Polyprenyl synthetase ispA 0.69
ABC transporter
S4I520 Glycine betaine-binding periplasmic protein proX 1.65
S4JBQ6 Glycine betaine/L-proline transport ATP-binding protein ProV proV 1.42
S4IF67 Phosphate transport system permease protein pstC 1.56
S4JMC0 Phosphate-binding protein PstS pstS 1.76
S4IDQ2 Thiamine/thiamine pyrophosphate ABC transporter tbpA 1.35
S4I2Z4 Heme exporter protein ccmC 1.36
S4IRJ2 ABC transporter, substrate-binding protein, family 3 dalS 1.31
S4IFD6 Peptide transport system ATP-binding protein SapF sapF 0.68
S4HWX8 Manganese transport system ATP-binding protein MntA sitB 0.71
Regulator
B5R4S3 Sigma factor-binding protein Crl crl 1.40
B5R1C8 DNA-binding protein Fis fis 0.52
S4HTK4 Regulator of RpoS rssB 1.33
B5QV29 HTH-type transcriptional repressor PurR purR 0.75
S4IGU5 HTH-type transcriptional regulator MetR metR 0.68
P0A9Y5 Cold shock protein CspA cspA 0.47
Ribosome
B5QUQ1 50S ribosomal protein L34 rpmH 0.70
B5R1F9 50S ribosomal protein L30 rpmD 0.72
S4KBH8 30S ribosomal protein S14 rpsN 0.74
B5R0L7 30S ribosomal protein S9 rpsI 0.75
S4IBG4 ATP-dependent RNA helicase RhlE rhlE 0.66
S4I8H3 ATP-dependent RNA helicase DeaD deaD 0.70
S4KIE0 ATP-dependent RNA helicase DbpA dbpA 0.74
B5R578 GTPase Der der 0.73
B5R0H4 GTPase Obg obg 0.74
B5QZV7 Ribosome-binding factor A rbfA 0.71
B5QUG2 tRNA (guanine-N(1)-)-methyltransferase trmD 0.72
Enterobactin biosynthesis and uptake
S4J0D7 2,3-dihydroxybenzoate-2,3-dehydrogenase entA 0.59
S4ITD9 Isochorismatase entB 0.71
S4K7S9 Isochorismate synthase entC 0.67
S4J0C5 Enterobactin synthetase component F entF 0.73
B5QVK0 Proofreading thioesterase EntH entH 0.72
S4HRN3 Colicin I receptor cirA 0.56
S4IJA9 Ferrienterobactin receptor fepA 0.60
S4IJB9 Ferrienterobactin-binding periplasmic protein fepB 0.76
S4K7S4 Achromobactin ABC transporter, ATP-binding protein fepC 0.70
Flagella
S4JS57 Flagellar basal body protein flgF 0.63
S4IZ57 Flagellar assembly protein FliH fliH 0.75
Salmonella pathogenicity island
T2Q228 Outer membrane autotransporter barrel domain protein misL 0.54
S4IDP5 Type III secretion apparatus lipoprotein, YscJ/HrcJ family prgK 0.68
S4I9H1 Invasion protein InvC invC 0.69
S4JKT7 Type III secretion apparatus needle protein prgI 0.72
Note: Some proteins were classified in multiple functional groups, but information for such proteins was only given in one major category in Table 1. Namely,
EntABCFH and FepBC in enterobactin biosynthesis and uptake pathways also belong to the metabolism and ABC-transporter categories, respectively.
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
43
Table 2 Primers used for RT-qPCR analysis 763
Gene Forward primer sequence (5′ to 3′) Reverse primer sequence (5′ to 3′)
proV CTCGGGTAAATCCACAA TTATCCAGCACGGTCAT
secE CAATCGTCGGCAACTAC TACCAGGCGAACCAGA
STM2506 CGCATGACCCGTATCGT CGGCGTGGTGACAGAAA
ylaC AGCGAAACTATTGATGAC CCGTTGTAACAGACCC
hiuH CAGCAAACAGGCAAAC TAATAACAGCGGCACA
proX GGCATTACCGTCCAAC CGACTTCACTCGGCTTA
entA TTTGCGGTCAATGTGGG GCTGTTCGGCATCTTCG
fepA CGTATCCACCATCACCG ACTCGCTACCGCCTTTT
sitB TGGTAGGCGTAAATGGT CCCTGGCAAGAAACAC
cspA TTCGGCTTTATTACTCCTG CTTTCTGACCTTCGTCCA
16S rRNA CAGAAGAAGCACCGGCTAAC GACTCAAGCCTGCCAGTTTC
764
765
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
44
Table 3 Primers used for the construction and complementation of S. Enteritidis 766
deletion mutants 767
Primer Sequence (5′ to 3′)
hiuH-F1 CTCTAGAGCCGTCAGGCAAATAA (Xba I)
hiuH-R1 AGGCTCTAAAGCTTCACTCCTTTACGGTAT
hiuH-F2 GGAGTGAAGCTTTAGAGCCTATCCCATTAG
hiuH-R2 GCGAGCTCAAGCGGGATAACCACC (Sac I)
proX-F1 CTCTAGAAGGTGCCTGCCGACTT (Xba I)
proX-R1 AAAAACGATCCGTTGTTCCTTTAATTATGG
proX-F2 AGGAACAACGGATCGTTTTTTATGCCGGAT
proX-R2 GCGAGCTCTGCTAAGCGACTGACTGC (Sac I)
768
769
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
45
Table 4 Strains and plasmids used for the construction and complementation of S. 770
Enteritidis deletion mutants 771
Strain or plasmid Description Source/reference
S. Enteritidis ATCC 13076 Wild type strain American Type Culture
Collection
⊿hiuH hiuH deletion mutant of S. Enteritidis ATCC 13076 This study
⊿hiuH-C Complementary strain for hiuH deletion mutant This study
⊿proX proX deletion mutant of S. Enteritidis ATCC 13076 This study
⊿proX-C Complementary strain for proX deletion mutant This study
E. coli DH5α Host for cloning Laboratory stock
E. coli SM10 (λpir) thi thr-1 leu6 proA2 his-4 arg E2 lacY1 galK2,
ara14xyl5 supE44, λpir Laboratory stock
pMD19-T Cloning vector, Ampr TaKaRa, Japan
pRE112 pGP704 suicide plasmid, pir dependent, oriT, oriV,
sacB, Cmr
Laboratory stock
pRE112-⊿hiuH pRE112 containing a 686 bp hiuH-deletion PCR
product
This study
pRE112-⊿hiuH-C pRE112 containing a wild-type copy hiuH and its two
flanks sequence; used to complement strain ⊿hiuH This study
pRE112-⊿proX pRE112 containing a 905 bp proX-deletion PCR
product This study
pRE112-⊿proX-C pRE112 containing a wild-type copy proX and its two
flanks sequence; used to complement strain ⊿proX This study
772
on Decem
ber 30, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
top related