evaluation of hepatoprotective effect of hesperidin … · antitubercular drug induced hepatotoxic...
Post on 11-Jun-2020
1 Views
Preview:
TRANSCRIPT
EVALUATION OF HEPATOPROTECTIVE EFFECT OF HESPERIDIN
AND ASCORBIC ACID ON ETHANOL AND ANTITUBERCULAR
DRUGS INDUCED HEPATOTOXICITY IN WISTAR RATS.
Thesis submitted in partial fulfillment for the award of degree of
Doctor of Philosophy in Pharmacology
By
NATHIYA. S.
Reg No. PRMOC 12 B 02
Under the guidance of
Prof. Dr. S. RAJARAM. M.D
VINAYAKA MISSIONS UNIVERSITY, SALEM
(VINAYAKA MISSIONS RESEARCH FOUNDATION-DEEMED UNIVERSITY)
MARCH 2017
DECLARATION BY THE CANDIDATE
I, NATHIYA. S. declare that the thesis entitled “EVALUATION OF
HEPATOPROTECTIVE EFFECT OF HESPERIDIN AND ASCORBIC
ACID ON ETHANOL AND ANTITUBERCULAR DRUGS INDUCED
HEPATOTOXICITY IN WISTAR RATS” submitted by me for the award
of Degree of Doctor of Philosophy (Ph.D) in Pharmacology is the
record of research work carried out by me during the period from
July 2012 to June 2016 under the guidance of DR. S. RAJARAM. M.D,
Prof and HOD, Department of Pharmacology, VMKV Medical College,
Salem. This thesis has not formed the basis for the award of any
other degree, diploma, associate-ship, fellowship or any other similar
titles in this or any other university or other similar institutions of
higher learning.
Place: Salem
Date : 20.03.17 (Mrs. NATHIYA. S.)
CERTIFICATE BY THE RESEARCH SUPERVISOR
DR. RAJARAM. S Salem,
Professor and Head 20.03.17.
Dept. of Pharmacology
VMKV Medical College
Salem.
I, Dr. S. RAJARAM. M.D certify that the thesis entitled
“EVALUATION OF HEPATOPROTECTIVE EFFECT OF HESPERIDIN
AND ASCORBIC ACID ON ETHANOL AND ANTITUBERCULAR
DRUGS INDUCED HEPATOTOXICITY IN WISTAR RATS” submitted
by NATHIYA. S for the award of degree of Doctor of Philosophy in
the department of Pharmacology is the record of research work
carried out by her during the period from July 2012 to June 2016
under my guidance and supervision and this has not formed the
basis for the award of any other degree, diploma, associate-ship,
fellowship or any other similar titles in this or any other university or
other similar institutions of higher learning.
(Dr. S. RAJARAM)
ACKNOWLEDGEMENT
Every arduous job becomes easy if it is fueled by good guidance. This
is a small but generous attempt to acknowledge the tremendous
support my near and dear ones have given to me throughout my study.
I wish to express my sincere and hearty gratitude, to my respected
guide Prof. Dr.S.RAJARAM, M.D, Professor & HOD, Department of
Pharmacology, VMKV Medical College, Salem. For his immense
guidance, help, intellectual supervision, and dedicated support for the
timely completion of my work. I would be much thankful to his endless
help and criticisms to embellish my study, which influenced me to
accomplish this work successfully. Last but not least, it’s my fortune and
so I am proud to have him as my guide.
My special thanks to the Honourable Dr. A.S. GANESAN, Chancellor,
Vinayaka Missions University, Salem, for providing infrastructure and
facilities required for this research work.
I gratefully acknowledge my deep sense of gratitude to Prof. V. R.
Rajendran, Vice- Chancellor, Vinayaka Missions University, Salem
Dr. CL. Prabhavathi , Dean (Research) and Dr. R. Rajendran, former
Dean (Research), Vinayaka Missions University, Salem, for their
blessings and opportunity offered to precede this piece of research
leading to the award of Doctor of Pharmacology.
I gratefully acknowledge my deep sense of gratitude to Dean Dr.P.S.
Manoharan, VMKV Medical College for their blessings and opportunity
offered to fulfill my assignment in this prestigious institution.
My heartfelt gratitude to Dr.Nirmala Sethuraman, M.D., for her
guidance, suggestions and support.
I express my sincere thanks to Dr. E. Manivannan MD, Professor&
DR.V.Sivasankari, Associate Professor, Department of Pharmacology,
VMKV Medical College, Salem, for their valuable suggestions and
support throughout the work.
My sincere thanks to Dr. Vijayababu, MD, Professor, Annapoorna
Medical College, Salem and Dr. Arul Mohan M.D. Assistant professor
VMKVMC, Salem for their support.
My heartfelt gratitude to Dr.Philips Abraham, Professor, Department of
Biochemistry, VMKVMC, Salem and Dr. Sachu Philips, Professor and
HOD, Vivekananda Dental College, Mrs. G. Vennila, Lecturer, KSR
Dental College, Tiruchengode for their valuable guidance,
encouragement and support throughout the work.
My heartfelt thanks to Dr. Karthi, Dr. Dinesh for their timely help,
support, suggestion and guidance throughout the research.
I express my profound thanks to my colleagues Dr.Saravanan, Tutor,
Annapoorna Medical College, Salem, for his for his constant support
and encouragement.
My sincere thanks to my colleagues Dr. Arul Raja, Tutor,
Dr. Karthikeyan, Tutor , Dr. Ramya M.D. Assistant professor, VMKV
Medical College, Salem, for their valuable support.
My sincere thanks to Dr. Sivakami MD, Assistant professor, PMCH
Medical College salem for her support in Histopathological results.
My heartfelt thanks to Dr. Paramasivan, Dr. Geetha V Shasthri for
their dedicated support for the timely completion of my work.
My sincere thanks to Dr. Gandhimathi, Dr. Sumathi, Mr. Ramesh,
Mrs. Jeevitha for their support in completing my thesis.
My heartfelt gratitude to Dr. Reka, Dr. Rajitha, Dr. Perumal,
Miss. Reena, Dr. Hema Nandhini and Dr. Indra VMKV Medical
College, Salem for their timely help, support and suggestion throught
out the research.
My heartfelt thanks to Mr. Senthil, Mr. Selva kumar, Mrs. Amudha,
Mrs. Papa, Mrs Rajammal, mrs. Jeya for their support during my
research.
I would like to express my gratitude to all the HODs, Faculties, non
teaching staffs of VMKV Medical College for their encouragement and
support.
My sincere thanks to Miss. Udhaya, Miss. Nandhini, Miss Pavithra,
Miss. Tamilarasi, for their support during my work.
Words are not sufficient to express my love and appreciation to my
affectionate, lovable Father Mr. P.Shanmugam, My Mother
S.Soundaram, My Lovable sister S. Hemalatha and my inlaws
whose full-hearted co-operation, love and moral support made me to
complete this task successfully.
Above all, I would like to thank my beloved husband
Mr. P.Senthil Kumar B.Tech, for his personal support and great
patience at all times even during the inevitable ups and downs, without
which the thesis would not have been possible.
I thank the Almighty, who has given me this opportunity to extend
my gratitude to all those people who have helped me and
guided me throughout my work and life.
S.NATHIYA
CONTENTS
CHAPTER TITLE PAGE NO.
1. INTRODUCTION 1-9
2. REVIEW OF LITERATURE 10-57
3. NEED FOR THE STUDY 58
4. AIM AND OBJECTIVES OF THE STUDY 59
5. MATERIALS AND METHODS 60-92
6. RESULTS 93-129
7. DISCUSSION 130-163
8. CONCLUSION 164-165
9. LIMITATIONS AND FUTURE PROSPECTS 166
10. BIBLIOGRAPHY 167-212
11. LIST OF PUBLICATIONS 213
LIST OF TABLES
Table
No. TITLE
Page
No.
1. Drug and toxin induced hepatotoxicity 14
2. Primers used for RT-PCR analysis 91
3.
Effect of Hesperidin and Ascorbic acid on serum Total
protein, Albumin and Bilirubin in Ethanol induced
hepatotoxic rats
94
4. Effect of Hesperidin and Ascorbic acid on liver marker
enzymes in serum of ethanol induced hepatotoxic rats 96
5. Effect of Hesperidin and Ascorbic acid on antioxidant
enzymes in liver of ethanol induced hepatotoxic rats 101
6.
Effect of Hesperidin and Ascorbic acid on serum Total
protein, Albumin, Bilirubin, Urea and Creatinine in
antitubercular drug induced hepatotoxic rats
106
7.
Effect of Hesperidin and Ascorbic acid on liver marker
enzymes in serum of antitubercular drugs (HRZ)
intoxicated rats
108
8.
The effect of hesperidin and ascorbic acid on
enzymatic and non enzymatic antioxidant in
antitubercular drug induced hepatotoxic rats
112
9.
The antilipidemic effect of Hesperidin and Ascorbic
acid on serum lipid profile in antitubercular drug
induced hepatotoxic rats
116
LIST OF FIGURES
FIGURE
NO. TITLE
PAGE
NO.
1. The redox homeostasis of the liver 12
2. Structure of Ethanol 17
3. Metabolic pathway of Ethanol 18
4. Oxidative pathways of Ethanol metabolism 22
5. Chemical structure of Isoniazid 26
6. Chemical structure of Rifampicin 29
7. Chemical structure of Pyrazinamide 31
8. Metabolic pathway of Isoniazid 35
9. Chemical structure of Hesperidin 41
10. Chemical structure of Ascorbic acid 49
11. Effect of Hesperidin and Ascorbic acid on serum
lipid profile in ethanol induced hepatotoxic rats. 98
12.
Effect of Hesperidin and Ascorbic acid on Lipid
peroxidation in liver of ethanol induced hepatotoxic
rats
98
13.
Effect of Hesperidin and Ascorbic acid on
histopathological changes induced by ethanol in
rat liver (H & E stain, 400x).
103
14.
Effect of Hesperidin and Ascorbic acid on oxidative
stress markers (TBARS) in liver of antitubercular
drug induced hepatotoxic rats.
110
15.
Effect of Hesperidin and Ascorbic acid on liver
oxidative stress markers (LHP and CD) in
antitubercular drug induced hepatotoxic rats.
110
16.
Effect of Hesperidin and Ascorbic Acid on
antioxidant Vitamin C and Vitamin E in liver of
antitubercular drug induced hepatotoxic rats.
113
17.
Effect of Hesperidin and Ascorbic acid on serum
Total cholesterol and triglycerides in antitubercular
drug induced hepatotoxic rats.
113
18.
Effect of Hesperidin and Ascorbic acid on
membrane bound Na+K+ ATP ase enzymes in liver
of Antitubercular drug induced hepatotoxic rats
118
19.
Effect of Hesperidin and Ascorbic acid on membrane bound Ca 2+ and Mg 2+ ATP ase enzymes in liver of Antitubercular drug induced hepatotoxic rats.
118
20.
Effect of Hesperidin and Ascorbic acid on
histopathological changes induced by
antitubercular drug in rat liver (H & E stain, 400x).
120
21. Western blotting study on the protein expression of
Bax and Bcl-2. 122
22. Western blotting study on the protein expression of
caspase 3 and caspase 9. 122
23. RT-PCR Analysis on the mRNA expression of Bcl-2
and Bax. 124
24. RT-PCR Analysis on the mRNA expression of
caspase 3 and caspase 9. 124
25. Effect of Hesperidin and Ascorbic acid on DNA
Fragmentation. 126
26. Western blotting analysis on the Protein expression
of TNF-α, NF-κB and IL-10. 126
27. RT-PCR Analysis on the mRNA expression of
TNF-α, NF- κB and IL-10. 129
ABSTRACT
Aim
The present study was designed to evaluate the protective effect
of Hesperidin and Ascorbic acid against ethanol and antitubercular drug
induced hepatotoxicity in wistar albino rats.
Methods
Hepatoprotective activity of Hesperidin (200mg/kg) and Ascorbic
acid (100mg/kg) was studied against ethanol (40%) induced
hepatotoxicity. Biochemical parameters (total protein, bilirubin), serum
marker enzymes (AST, ALT, ALP etc.,), lipid peroxidation, antioxidant
enzymes (SOD, CAT, GSH, VIT C etc.,), lipid profile, histological
changes of liver were assessed in control, toxicant and treatment
animals exposed to ethanol.
Hepatoprotective activity of Hesperidin (200mg/kg) and Ascorbic
acid (100mg/kg) was studies against antitubercular drug Isoniazid +
Rifampicin + pyrazinamide (27,54,135 mg/kg.b.wt.) induced
hepatotoxicity. Biochemical parameters (total protein, bilirubin), serum
marker enzymes, lipid peroxidation, antioxidant enzymes (SOD, CAT,
GSH, VIT C etc.,), lipid profile, histological changes of liver , membrane
bound ATP ase enzyme, apoptotic (Bax, Bcl2, caspase 3, 9) and the
inflammatory markers (TNFα, IL-10 and NF kB) were assessed in
control, toxicant and treatment animals exposed to antitubercular drugs.
Results
Ethanol induced hepatotoxicity was evident by increased level of
serum liver marker enzymes (AST, ALT, ALP, & LDH) and also a
significant rise in the level of LPO along with decline in the level of both
enzymatic and non enzymatic antioxidant enzymes (SOD, CAT, GSH,
VIT C and VIT E). Ethanol administration showed alteration in the lipid
profile and serum biochemical markers (bilirubin, albumin, total protein).
Our results are further confirmed by Histopathological examination
which showed changes in the normal liver architecture. All these
biochemical and Histopathological changes induced by ethanol were
ameliorated by the co-administration of Hesperidin and Ascorbic acid.
Antitubercular drug induces hepatotoxicity was evident by
increased level of liver marker enzymes (AST, ALT, ALP, ACP, γ-GT &
LDH) and also a significant rise in the level of LPO along with decline in
the level of both enzymatic and non enzymatic antioxidant enzymes
(SOD, CAT, GSH, VIT C and VIT E) . Antitubercular drug also alter the
biochemical marker enzymes, lipid profile and membrane bound ATP
ase enzymes. Moreover, antitubercular drug causes hepatic damage by
inducing apoptotic death and inflammation in hepatic cells, manifested
by an increase in the expression of Bax, caspase-3, caspase-9, NF-κB,
IL- 10, TNF- α and decrease in Bcl-2 expression. These results were
further supported by the histopathological examination of liver. All these
features of antitubercular drugs induced toxicity were reversed by the
co-administration of Hesperidin and Ascorbic acid.
Conclusion
Therefore, our study favors the view that Hesperidin and Ascorbic
acid combination may be a useful modulator in alleviating ethanol and
antitubercular drug induced hepatotoxicity. However further research is
need to validate Hesperidin and ascorbic acid combination as a new
therapeutic agent supplemented with antitubercular drugs in the
treatment of TB and also in alcoholic liver disease .
ABBREVIATIONS
AA Ascorbic acid
ACP Acid phosphatise
ADH Alcohol Dehydrogenase
ALDH Aldehyde Dehydrogenase
ADH Alcohol Dehydrogenase
ALP Alkaline phosphatise
ALT Alanine aminotransferase
ANSA 1-amino 2-napthol 4-sulphonic acid
AST Aspartate aminotransferase
ATDH Anti TB drug induced hepatotoxicity
ATP Adenosine triphosphate
ATP ase Adenosinetriphosphatase
ATT Antitubercular treatment
Bcl 2 B-cell lymphoma 2
BHT Butylated Hydroxy Toluene
BSA Bovine serum albumin
cAMP Cyclic adenosine monophosphate
CAT Catalase
CDNB 1-Chloro-2, 4-dinitrobenzene
CDs Conjugated Dienes
CHF Congestive Heart Failure
CPCSEA Committee for the purpose of control and supervision
of experiments on animals
CYP cytochrome P 450
DTNB dithio-nitrobenzoic acid
DILI Drug induced liver injury
DNA Deoxyribonucleic Acid
E Ethambutol
EDTA Ethylenediaminetetraacetic acid
EtOH Ethanol
FAD Flavin Adenine Dinucleotide
FFA Free Fatty Acids
GABA Gamma-Aminobutyric Acid
GPx Glutathione peroxidase
GR Glutathione Reductase
GSH Reduced glutathione
GSSG Glutathione disulfide
GST Glutathione-S-transferase
H & E Hematoxylin and Eosin
H Isoniazid
H2O2 Hydrogen peroxide
H2SO4 Sulphuric acid
HBV Hepatitis B virus
HCL Hydrochloric acid
HCD High Cholesterol Diet
HDL High density lipoprotein
HDN Hesperidin
HIV Human Immunodeficiency Virus
HRP Horseradish Peroxidase
i.p Intra peritoneal
IAEC Institutional Animal Ethics Committee
IFN Interferon
IL Interleukin
INH Isonicotinylhydrazine
IU International unit
KCL Potassium chloride
LDH Lactate dehydrogenase
LDL low density lipoprotein
LHP lipid hydroperoxide
LPO Lipid peroxides
MDA Malondialdehyde
MEOS Microsomal Ethanol Oxidizing System
MgSO4 Magnesium sulphate
mg milli gram
MIC Minimum Inhibitory Concentration
Nacl Sodium chloride
NAD+ Nicotinamide adenine dinucleotide
NADH Nicotinamide adenine dinucleotide
NADH Reduced nicotinamide adenine dinucleotide
NADP Nicotinamide adenine dinucleotide phosphate
NaOH Sodium hydroxide
NAT N-acetyl transferase 2
NBT Nitro blue tetrazolium
NF-κ Nuclear Factor Kappa-Light-Chain-Enhancer Of
Activated B Cells
NMDA N -methyl-D-aspartate
OD Optical Denisity
PA Pyrazinoic Acid
PMS Phenazine methosulphate
PVDF polyvinylidene difluoride,
PUFA Poly unsaturated fatty acids
RBC Red Blood Cells
RNA Ribonucleic acid
RNS Reactive Species Of Nitrogen
RNTCP Revised National Tuberculosis Control Programme.
RTPCR Reverse Transcriptase Polymerase chain reaction
ROS Reactive oxygen species
Rpm Revolution per minute
R Rifampicin
S Streptomycin
SD Standard deviation
SDS-PAGE Sodium dodecil sulphate-polyacrylamide gel
Electrophoresis
SLY Silymarin
SOD Superoxide dismutase
TBA Thiobarbituric acid
TBARS Thiobarbituric acid reactive substances
TC Total Cholesterol
TCA Trichloroacetic acid
TB Tuberculosis
TNF-α Tumor necrosis factor alpha
TCA cycle Tri carboxylic acid cycle
TG Triglyceride
VLDL Very low-density lipoprotein
v/v volume per volume
WHO World Health Organisation
Z Pyrazinamide
γGT Gamma glutamyltransferase.
Introduction
1
1. INTRODUCTION
Drug induced liver injury (DILI) represent a major challenge for
drug regulatory authorities and industry and it is the leading causes for
termination of further substance development in preclinical and clinical
phases and it is also the most common single adverse drug reaction
leading to refusal of market approval. However in many instances a
drugs hepatotoxic potential can only be recognized post marketing. DILI
is the most frequent reason for withdrawing drugs from the market and
requires modification of labeling (Temple et al., 2002; kaplowitz, 2001).
Approximately around 900 drugs have been identified as
hepatotoxins and it is the most common reason for a drug to be
withdrawn from the market. Drugs like Isoniazid, Rifampicin,
paracetomol, Halothane and alcohol induce subclinical injury to liver
which manifests as abnormal liver enzyme activities (Ostapowicz et al.,
2002).
In the present study ethanol and antitubercular drugs like
Isoniazid, Rifampicin and pyrazinamide were used to induce
hepatotoxicity to investigate the protective effect of Hesperidin and
Ascorbic acid.
Tuberculosis (TB) is the one of the deadliest infectious disease
which affects one third of the world population. In 2015, 10.4 million
people are infected with TB in the world and 1.8 million deaths were
Introduction
2
reported to WHO (2015). TB can be cured by multiple drug regimens for
around 6-9 months. The first line anti tubercular regimen that form main
core in the TB treatment regimen includes Isoniazid (H), Rifampicin(R),
Pyrazinamide(z), Ethambutol(E) and streptomycin(S). However
hepatotoxicity is the main drawback of multiple treatment regimens
containing HRZ which is evidenced by increased level of liver marker
enzyme in systemic circulation. Adverse effects of antitubercular
therapy are sometimes potentiated by multiple drug regimens, though
these drugs each in it are hepatotoxic, given in combination their toxic
effect is enhanced synergistically.
During metabolism Isoniazid is converted into a reactive
metabolite, which get activated by cytochrome P450 system, results in
the generation of toxic intermediates and reactive oxygen species. This
will leads to oxidative stress which will induce liver injury (Tayal et al.,
2007). On the other hand Rifampicin is the enzyme inducers which
enhances the production of toxic metabolites from INH and exacerbate
liver injury (Asduq et al., 2007). However Pyrazinamide in combination
with isoniazid and Rifampicin will increase incidence of hepatotoxicity
(Asduq et al., 2007).
Research evidence stated that the antitubercular drug induced
liver injury is mainly due to the oxidative stress which leads to cell injury
and apoptosis in humans (Tasduq et al., 2005; British Medical Research
Council 1991; Steele, 1991).
Introduction
3
Mechanism of anti TB drugs metabolism and related liver injury is
not completely understood, but alterations in the various cellular
defense mechanism have reported to be involved in this (Tasduq et al.,
2005). Recent studies suggested that antitubercular drug induced
hepatotoxicity is mainly due to the oxidative stress which enhances the
production of reactive oxygen species (ROS) and induced peroxidative
damage (LPO) to lipids. This will lead to the dysfunction of hepatic
antioxidant defense system, causing destruction and damage to the
cellular membrane (Tasduq et al., 2005; Singh et al., 2011; Basini Jyothi
et al., 2013; Attri et al., 2000). This paves the way for apoptosis
(Chowdhury et al., 2006).
Since oxidative stress mediated hepatotoxicity is the major events
in TB treatment, there is no effectual treatment to overcome such liver
injury. This results in interruption of the most efficacious first line
antitubercular drugs or change in the treatment regimen.
On the other side Alcohol abuse is one of the major healths,
social and economic problems facing the world. At least 80% of heavy
drinkers have been reported to develop steatosis, 10–35% alcoholic
hepatitis, and approximately 10% liver cirrhosis. Alcoholic liver disease
(ALD) is a main cause of chronic liver disease globally which lead to
fibrosis, cirrhosis and hepatocellular carcinoma (Partha Pal et al., 2016).
It was recognized as the second most widely used psychoactive
substances in the world, after caffeine. Possible factors that affect the
Introduction
4
development of liver injury include the dose, duration, type of alcohol
and related risk factors including obesity, iron overload, concomitant
infection with viral hepatitis, and genetic factors (O'Shea et al., 2010).
During metabolism Alcohol is oxidized to acetaldehyde in the
liver. The metabolic process is catalyzed by different enzymes like
alcohol dehydrogenase (ADH), microsomal ethanol metabolizing
system (MEOS) and acetaldehyde dehydrogenase (ALDH). The
acetaldehyde is more toxic metabolite which leads to a larger number of
the metabolic disorders including hepatic and extra hepatic diseases
(Tarasankar Maity et al., 2012). Alcohol ingestions have been found to
cause accumulation of reactive oxygen species and deplete the
antioxidants which lead to oxidative stress and liver injury (Tostmann et
al., 2008).
The important factor that plays a central role in the
aetiopathology of alcohol-induced liver disease and which has been the
focus of much research is the excessive generation of ROS. Thus,
numerous interventions have been put forward to counteract the
vulnerability of the liver to oxidative challenges during alcohol
consumption by reinforcing the endogenous antioxidant defense system
(Wu et al., 2003; Koch et al., 2004).
Research evidence suggested that Ethanol and antitubercular
drugs induced hepatotoxicity was mainly due to the accumulation of free
Introduction
5
radical in hepatocytes that oxidized the reduced glutathione, which in
turn lead to lipid per oxidation of cellular membranes, oxidation of
protein and DNA resulting in hepatic injury (Vidhya and Indira, 2009;
Sana Tufail et al., 2010). On the otherhand the toxic metabolite formed
during metabolism of ethanol and antitubercular drug will increased the
generation of free radical so that the antioxidant in our body are not able
to neutralise the excess free radical which result in the failure of
antioxidant dense system which damage the hepatocytes. Therefore,
agents that have antioxidant properties, represent promising therapeutic
interventions for liver damage.
In the modern medicine corticosteroids, pentoxyphylline and
immunosuppressant were used in the treatment of liver disorder but
their side effects will be more. Although substantial advance have been
made against drug induced hepatotoxicity but the efficacy is often
limited by its side effects. According new approaches needed to further
the development of an effective therapy against DILI. So focus has
shifted to materials from natural sources that aid in liver damage.
Traditional medicines have been the starting point for the
discovery of many important modern drugs which led to
pharmacological investigations and biological screening programs for
natural products all over the world. Now a day’s dietary supplement
containing natural products, fruits, vegetables and medicinal plants
have many biological properties and have potential to fight against
Introduction
6
human pathogens. Consumption of a flavonoid rich diet might decrease
the risk of degenerative changes in certain diseases.
Flavonoids are low molecular weight polyphenolic compounds,
widely distributed in the plant kingdom as a secondary metabolite based
on parent compound flavones. Flavonoid occur in all plants including
fruits, vegetables, nuts, seeds, leaves, flowers and barks (Garg et al.,
2001).
Hesperidin is the flavanon glycosides which belong to the
polyphenolic compounds. It’s mainly found in citrus fruits, especially in
the peel of orange and grape fruit (Crozier et al., 2009). It named after
the term hesperidium referring to citrus fruits. Citrus fruits and their
products are important sources of health promoting constituents and are
widely consumed around the world. It is used as a supplement drug in
the treatment regimen. Hesperidin deficiency has been associated to
the abnormal capillary leakage as well as pain in the extremities
causing aches, weakness and night leg cramps. Supplement with
Hesperidin helps in reducing edema/ excess swelling in the leg due to
fluid accumulation (Naveen Tirkey et al., 2005).
Furthermore Hesperidin shows various pharmacological actions
such as antihypertensive (Chanet et al., 2012), anti-inflammatory (Garg
et al., 2001), sedative and antinociceptive properties (Loscalzo et al.,
2008). In addition an anti-tumor property of hesperidin was reported by
Introduction
7
Kamaraj et al., (2010). Numerous studies reported that Hesperidin has
antioxidant property and possess satisfactory effect in neutralize free
radicals formed during oxidative stress (Cho 2006; Ahmad et al., 2012).
The antioxidant property of Hesperidin may be the reason behind
various pharmacological actions and hence it can be used to treat
number of diseases. Hesperidin is present in a combination with
ascorbic acid; flavonoid in combination with vitamins act in synergistic
manner (Seiichiro et al., 2006; Joe et al., 2001).
Ascorbic acid (AA) is commonly known as vitamin C. Vitamin C is
a water soluble micronutrient in human and required for variety of
biological functions. Humans and a small selection of animal species
are not able to synthesis vitamin C due to mutations in the gene
encoding L-gulono-γ-lactone oxidase, the terminal enzyme involve in
the vitamin C biosynthetic pathway (Nishikimi et al., 1994). Hence they
depend on diet as a source of Vitamin C. It is found in citrus, soft fruits
and green leafy vegetables, while kidney and liver are good animal-
derived sources of this compound (Stangeland et al., 2008).
Several studies have demonstrated that, Ascorbic acid decreased
risk of a wide range of pathologies, such as cardiovascular disease like
atherosclerosis (Seung-Woo Hong et al., 2007; Salonen et al. 2003),
human breast cancer (Shailja chambial et al., 2013), diabetes (Hoffman
et al., 2012), schizophrenia (Dakhale et al., 2005), Alzheimer’s disease
Introduction
8
(Harrison FE,2012), anxiety, depression (Gautam et al., 2012),
nephrotoxicity (Shang et al., 2014) and so on.
Ascorbic acid is essential for detoxification process in liver and
used for various liver diseases like hepatitis C, non alcoholic fatty liver
and other liver diseases. It is a well known antioxidant, which can
protect the body from damage caused by free radicals that can be
generated during normal metabolism as well as through exposure to
toxins and carcinogens (Banerjee et al., 2009). Ascorbic acid is
hydrophilic and exerts its antioxidant action by inhibiting lipid
peroxidation and oxidative cell damage (Xavier et al., 2007). In another
study by Uwe Wenze et al. (2004) reported that ascorbic acid
drastically reduces the ROS in mitochondria by its antioxidative capacity
that is required for the execution of drug-induced apoptosis.
Ascorbic acid also contributes to the regeneration of the vitamin E
and constitutes a strong line of defence in retarding free radical induced
cellular damage and apoptosis (Uwe Wenzel et al., 2004; Chan, 1993).
Hence, Ascorbic acid scavenges reactive oxygen species there by
reduces oxidative damage, apoptosis and related complications
(Naseer et al., 2011).
In this context, Ascorbic acid supplementation has been reported
to ameliorate symptoms and to enhance the expression of specific
Introduction
9
immune response markers in clinical conditions (Wintergerst et al.,
2006).
There are strong indications of Vitamin C involvement, along with
bioflavonoid like Quercetin, in maintaining the tissue levels of the
glutathione. Vitamin C, as glutathione's right hand man, can produce
indirectly an antioxidant benefit similar to that of giving glutathione itself.
Besides its ability to scavenge the free radicals, Vitamin C shows
synergistic antioxidant effect with other phenolic antioxidant (Liao and
Yin, 2000). Hence combination of Vitamin C with the phenolic
antioxidant Hesperidin may provide protective effects against free
radical induced oxidation which will be helpful for the prevention of
oxidation related disorder.
Review Of Literature
10
2. RIVIEW OF LITERATURE
2.1. Liver
Liver is the major organ which performs most vital function and
maintains the homeostasis of the body. One of the primary functions of
the liver is involve in the Biotransformation and detoxification of
ingested substances including xenobiotics, alcohol, environmental
pollutant etc., Hence, it is the most susceptible organ for drug induced
adverse effects, because all ingested substances that are absorbed are
first presented to the liver and it is responsible for the metabolism and
elimination (Klaassen, 2008).
The main functions of liver involves
Synthesis of glucose, plasma proteins, clotting factor, hormones
(Thrombopoietin, Angiotensinogen) etc.,
Secretion of bile.
Storage of vitamins, sugars, fats and other nutrients from the
food.
Aids in metabolism of carbohydrate, protein and fat.
Remove waste products from the blood.
Decomposition of RBC.
Detoxification/ biotransformation: One of the major functions of
liver is to remove the toxic substance from the blood stream.
Smooth endoplasmic reticulum in the liver is the principal clearing
Review Of Literature
11
houses that detoxify both endogenous (metabolic byproducts)
and exogenous substance (drugs, alcohol) (Singh et al., 2011).
Because of the role of clearance of blood and excretion of drugs and
exogenous compounds, liver profusely exposed to the adverse effects
of these compounds and is hence it is prone to injury.
2.2. Hepatotoxicity
Hepatotoxicity implies chemical induced liver injury. The Incidence of
liver toxicity has been reported to be much higher in developing
countries like India (8-30%) to that of advanced countries (2-3%) (Jyothi
Basini et al., 2012).
Several reasons are known to cause moderate to severe hepatic
complication, few liver complications emerge out as result of socially
unaccepted life style and also due to unavoidable circumstances.
Certain drugs like Halothane, acetaminophen, antiepileptic (valporic
acid), paracetomol, antitubercular drugs and chemicals used as food
preservatives are of great threat to the integrity of the liver. In addition
cigarette smoking and tobacco chewing are found to aggravate the
above said problems.
Chronic alcoholism is one of the major reasons for hepatic
damage which result in fatty liver, cirrhosis and hepatomegaly. On the
another side natural products, environmental pollutants, heavy metals,
Review Of Literature
12
dietary constituents and exposure of the individual to various
hepatotoxic substances due to occupational responsibilities also
produce hepatotoxicity (Singh et al., 2011). Hence the liver is not only
expected to perform functions, but also play a role in protecting itself
against the deleterious effects of medicines and harmful chemicals.
2.3. Drugs and toxin induced hepatotoxicity
Hepatotoxicity caused by deleterious effect of drugs and toxic
chemicals has been linked to the occurrence of oxidative stress which
alters the redox homeostasis of the liver (Fig 1). This will result in the
generation of ROS and depletion of antioxidant enzymes SOD, CAT
GSH,VIT C&E etc.,
Fig 1: The redox homeostasis of the liver
Review Of Literature
13
Oxidative stress has also been implicated in the pathogenesis of cellular
damage caused by a number of drugs/toxic agents including arsenic,
diclofenac, carbon tetrachloride, alcohol etc., (Deavall et al., 2012).
Drugs and toxin can affect the liver in any one of the following ways.
1. Predictable and dose related or intrinsic hepatotoxicity
Two types of intrinsic Hepatotoxicity.
a. Direct hepatotoxins: a direct cytotoxic effect refers to the direct
development of liver cell injury at the sub cellular level, affecting various
organelles, like endoplasmic reticulum, with subsequent steatosis,
necrosis or both.
b. Indirect hepatotoxins: the cell injury is caused by alterations of
specific metabolic pathways or selective effects on cell membrane
receptors, DNA and RNA molecules either within the nuclei or in the
cytosol.
2. Unpredictable and idiosyncratic
Idiosyncratic hepatotoxins: An idiosyncratic reaction is due to either
hypersensitivity or genetically determined differences in drug
metabolism. Other clinical classifications include hepatocellular,
cholestatic or mixed liver enzyme patterns, histological criteria, acute
vs. chronic, onset or severity (Tsui, 2003; Zimmerman, 2004; Tierney et
al., 2006).
Review Of Literature
14
Table 1: Drug and toxin induced hepatotoxicity:
Category of
agent
Mechanism Histological
lesion
Examples
1.Intrinsic toxicity
a) Direct
Membrane injury,
destruction of
structural basis of
cell metabolism.
Necrosis/
steatosis
CCl 4,
CHCl3
phosphorus
b) Indirect
I. cytotoxic
Interference with
specific metabolic
pathways leads to
structural injury
Steatosis/
necrosis
Ethanol,
tetracycline,
thioacetamide,
paracetomol.
II. cholestatic Interference with
hepatic excretory
pathways leads to
cholestasis.
Bile cysts,
bile duct
injury.
Rifampicin,
steroids.
II idiosyncrasy
a)hypersensitivity
b) metabolic
abnormality
Drug allergy
Production of
hepatotoxic
metabolites
Necrosis/
cholestasis
Necrosis/
cholestasis
Halothane,
sulphonamides
Isoniazid,
Rifampicin,
pyrazinamide.
Review Of Literature
15
2.4. Drug induced liver injury (DILI)
DILI may result not only from the direct toxicity of the parent drug
compound but also from the reactive / toxic metabolite or from an
immunologically mediated response affecting the hepatocytes
(Saukkonen, et al., 2006; Deng et al., 2009).
DILI is responsible for 5% of all hospital admissions and 50% of
all acute liver failure cases. More than 75% are due to idiosyncratic drug
reactions result in liver transplantation or death (Ostapowicz et al.,
2002).
The human body identifies almost all drugs (xenobiotics) as
foreign substances and subjects them to various chemical processes to
make them suitable for elimination. Mostly all drugs are liphophilic which
rendered hydrophilic in the hepatocytes to yield water soluble products
by biochemical process (biotransformation) which can be excreted in
urine/ bile (Tostmann et al., 2008). Biotransformation involves phase I &
II reaction which is mediated by cyt p 450 systems located in the
endoplasmic reticulum of the liver. The Phase I reactions includes
oxidation, reduction hydroxylation etc., produces toxic intermediates
which are rendered non toxic by phase II conjugation reactions which
lead to the formation of water soluble metabolite which, can be excreted
easily.
Review Of Literature
16
Another metabolic pathway for detoxifying many compounds in
phase II involves glutathione which covalently bind to toxic
intermediates by glutathione S transferase. However this phase can
lead to the formation of reactive metabolite (Singh et al., 2011). In the
liver these chemically reactive metabolites have the ability to
interconnect with cellular macromolecules such as proteins, lipids and
nucleic acids, leading to protein dysfunction, lipid peroxidation, DNA
damage and oxidative liver damage.
These damaging hepatocytes activate innate immune system like
kupffer cells and produce proinflammatory mediators like tumor necrosis
factor –α (TNF α); interferon (IFN) and interleukin (IL) produced liver
injury. However, innate immune cells are also the main source of IL-10,
IL-6 and certain prostaglandins, all of which have been shown to play a
hepatoprotective role. Thus, it is the delicate balance of inflammatory
and hepatoprotective mediators produced after activation of the innate
immune system (Michael et al., 2006). Many agents directly act on
mitochondria and inhibit electron transport and fatty acid oxidation
which leads to apoptosis (programmed cell death) or necrosis (Singh
Robin et al., 2012; Patel et al., 1998).
In our study ethanol and antitubercular drug induced
hepatotoxicity mainly due to oxidative stress caused by the reactive
metabolite and ROS.
Review Of Literature
17
2.5. Ethanol
Alcohol (ethanol), has occupied an important place in the history
of humankind for around 8000 years. Like other sedative-hypnotic
drugs, alcohol in low to moderate amounts will relieve anxiety and
induces sleep. It also fosters a feeling of well-being or even euphoria.
The majority of this drinking population is able to enjoy the pleasurable
effects of alcohol without allowing their alcohol consumption to become
a health risk. People who continue to drink alcohol in spite of adverse
medical or social consequences suffer from alcoholism, which is a
complex disorder that appears to have genetic as well as environmental
determinants.
2.5.1. Structure
Fig 2: Structure of ethanol
Review Of Literature
18
2.5.2. Pharmacokinetics
Ethanol is a small water-soluble molecule absorbed rapidly from
the GIT. The presence of food specially milk delays absorption of
ethanol. The volume of distribution for ethanol approximates total body
water (0.5-0.7 L/kg). It crosses the BBB and placental barrier. About
95% of alcohol consumed is oxidized in the liver; much of the remainder
is excreted through the lungs, sweat and in the urine. The ethanol is
metabolised first to acetaldehyde and then to acetic acid. In the liver two
major pathways involves in alcohol metabolism.
Fig 3: Metabolic pathway of Ethanol
2.5.2.1. Alcohol Dehydrogenase Pathway
It is the primary pathway of alcohol metabolism which involves
the cytosolic enzyme- alcohol dehydrogenase (ADH), which catalyzes
the conversion of alcohol to acetaldehyde (Figure 3). ADH is mainly
Review Of Literature
19
located in the liver, but trace amounts are also found in major organ like
brain. The genetic polymorphisms of ADH in Asian populations
increased the risk of alcoholism.
During metabolism the ethanol is oxidised into acetaldehyde by
ADH. In this oxidative pathway hydrogen ion is transferred from alcohol
to the cofactor nicotinamide adenine dinucleotide (NAD+) to form
NADH. As a net result, alcohol oxidation generates the highly reduced
cytosolic environment in the liver, chiefly as NADH. Hence it leaves the
hepatocytes from the deleterious effects of intermediate products like
acetaldehyde and ROS, which are formed during ethanol metabolism.
The excess NADH production appears to induce metabolic disorders
that accompany chronic alcoholism.
2.5.2.2. Microsomal Ethanol Oxidizing System (MEOS):
This enzyme system, also known as the mixed function oxidase
system, uses NADPH as a cofactor for ethanol metabolism which
consists of cytochrome P450 1A2, 2E1, and 3A4. These enzymes
contributed in the oxidation of ethanol which is present mainly in the
microsomes, endoplasmic reticulum and vesicles of the cell.
As the concentration of ethanol increases above 100 mg/dL the
ADH system get saturated owing to depletion of NAD+. In such situation
there is increased contribution from the MEOS system, which does not
rely on NAD+ as a cofactor. As a result of chronic alcohol consumption
Review Of Literature
20
there is an induction of MEOS system which increases not only the
ethanol metabolism but also increases the clearance of other drugs
(steroids, paracetomol etc.,) eliminated by the cytochrome P450s. This
will result in the generation of the toxic byproducts of cytochrome P450
reactions (toxins, free radicals, H2O2).
2.5.2.3. Metabolism of Acetaldehyde to Acetate
Around 75-80% of the acetaldehyde formed from alcohol is
oxidised to acetate in the liver in a reaction catalyzed by aldehyde
dehydrogenase (ALDH). The product of this reaction is acetate (Figure
3), which can be further metabolized to CO2 and water, or used to form
acetyl-CoA. Chronic alcoholism results in the increased risk of severe
liver disease, mainly due to the deleterious effects of acetaldehyde
(Deck DH et al., 2012; Sharma and Sharma, 2009).
2.5.3. Mechanism of Action of Ethanol
Ethanol affects a membrane proteins that participate in signalling
pathways, including neurotransmitter receptors for amines, amino acids;
enzymes such as Na+ K+ ATPase, adenylyl cyclase etc., Ethanol
enhances the action of GABA (the main inhibitory neurotransmitters in
the CNS) at GABAA receptor (GABA mimetic action). Ethanol inhibits
the ability of glutamate to open the cation channel associated with the N
-methyl-D-aspartate (NMDA) receptors and inhibit the opening of ca 2+
channel linked to NMDA receptor. The NMDA receptor is implicated in
Review Of Literature
21
many aspects of cognitive function, including learning and memory.
High level of alcohol inhibits the NMDA receptor activation will leads to
Blackouts periods of memory loss.
2.5.4. Uses of Ethanol
As an antiseptic
As an astringent used to harden the skin to prevent bed sores.
To treat methanol poisoning.
2.5.5. Adverse effects of Ethanol
The acute effects of ethanol on CNS comprise sedation, loss of
inhibition, impaired judgements and motor functions. Higher levels of
alcohol 500mg/dL are usually lethal. Chronic ethanol consumption will
develop tolerance, physical and psychological dependence.
Neurological deficits occur in chronic drinkers which lead to ataxia,
dementia and peripheral neuropathies. Consumption of alcohol during
pregnancy cause foetal alcohol syndrome. Long term excessive
consumption of alcohol causes fatty liver which progress to hepatitis,
necrosis, fibrosis and liver failure (Sharma and Sharma, 2009; Deck DH
et al., 2012).
2.5.6. Mechanism of ethanol induced hepatotoxicity
Ethanol induced hepatotoxicity is mainly due to oxidative stress
mediated by the proximal metabolite acetaldehyde. Ethanol or its
Review Of Literature
22
metabolite alter the peroxidative balance of the liver cell by acting as
pro- oxidant and decreased the antioxidant level. This will result in the
excess generation of free radicals (ROS) that causes damage to the
cellular proteins, lipids and DNA (Wu et al., 2006).
During ethanol metabolism the cyt p 450 catalytic cycle use
NADPH to reduce O 2 leading to the production of hydrogen peroxide
and superoxide anion radical. Cellular system is protected from ROS
induced cell injuries by various antioxidant defense systems in our
body.
Fig 4: Oxidative pathways of Ethanol metabolism
Chronic exposure to ethanol involves CYP 450 2E1 which will
induce the generation of ROS in the cellular system. This ROS
Review Of Literature
23
overwhelm the antioxidant defense mechanism which results in
hepatocyte injury. Alcohol has been shown to deplete GSH levels in
mitochondria, which are normally characterized by high levels of GSH
needed to eliminate ROS generated during activity of the respiratory
chain. The selective depletion of the mitochondrial GSH pool is the
consequence of a defect in GSH transport from the cytosol to the
mitochondrial matrix. In mitochondrial GSH occur predominantly in the
centrilobular hepatocytes, where most of the liver injury originates and
precede the development of mitochondrial dysfunction and lipid
peroxidation (Sid et al., 2013).
2.6. Tuberculosis
Tuberculosis (TB) is chronic granulomatous diseases caused by
the mycobacterium tuberculi and remains one of the major global health
problems in developing countries (Glickman et al., 2006).
The incidence of TB was estimated that, around 10.4 million
people were fallen ill with TB in the world. In India the incidence of TB
was around 23% of world TB cases (WHO 2015). TB along with HIV
infection increases the risk of TB to 5-50 folds (Corbett EL et al., 2003).
2.6.1. Treatment regimen for TB
Single drug therapy may not be useful in the TB treatment due to
the occurrence of resistance which results in the treatment failure.
Hence combination therapy will be used in the treatment of TB (Forget
Review Of Literature
24
et al., 2006). The combination therapy consists of Isoniazid and
Rifampicin for 9 months cures about 95-98% of TB cases. Including
pyrazinamide to the above combination for the first 2 months will
reduced the total duration of treatment to 6 months without affecting the
efficacy.
2.6.2. DOTS- Treatment regimen (Directly Observed Treatment-
Short Course)
The new TB cases should be treated for the 6 months of therapy
consists of 2 months of intensive phase with Isoniazid, Rifampicin,
Pyrazinamide and Ethambutol and followed by 4 moths of continuation
phase with Isoniazid and Rifampicin. Control and treatment of TB in
India is covered under the Revised National Tuberculosis Control
Programme (RNTCP).
2.6.3. Antitubercular drug induced hepatotoxicity
Even though drugs are available for curing TB, many adverse
effects attributable to anti TB drug therapy. Although a vast majority of
patients tolerate the drugs, some develop adverse effects; among this
hepatotoxicity is the major one. This hepatotoxicity leads to treatment
interruption or modifies the treatment regimen during the course of
therapy. This challenges not only the physician, but also a challenge for
drug regulatory agencies (Sudhir Kumar et al., 2014). Further it
decreases the success rate of the treatment and brings the negative
Review Of Literature
25
impact on TB control. Therefore anti TB (ATT) drug induced liver
damage is an increasing concern in the treatment of TB.
2.6.4. Incidence of AntiTB drug induced Hepatotoxicity
Overall Hepatotoxicity attributed to AntiTB drugs has been
reported in 5-28% of patients. Huang et al. (2002) reported that the
incidence was 24.7 % in Taiwanese population. In Nepalese population,
the incidence of Hepatotoxicity was 8%. In Turkey it was 8.1%, in
Germany it was 11%. In Indian population the incidence for AntiTB DILI
was 14.3%. The variation in anti TB DILI may be due to the difference in
the patient factors, regimen used and the diagnostic criteria (Sudhir
Kumar et al., 2014; Tostmann et al., 2008; Saukkonen et al., 2006).
2.6.5. Risk factors
It has been observed in several studies that patients with pre-
existing hepatic diseases due to chronic viral infection with Hepatitis B,
Hepatitis C, HIV, HBV infection, Alcoholics, the elderly, and the
malnourished are at a higher risk of developing ATT induced
hepatotoxicity (Anand et al., 2006). Recent studies show that
polymorphism of N-acetyl transferase 2 (NAT2) genes, glutathione-s-
transferase (GST) and Null mutation at GSTM1 gene are the major
susceptibility risk factors for ATT induced hepatitis (Hussain et al., 2003;
Roy et al., 2001). The time required for the metabolites to reach
hepatotoxic levels is much earlier with Isoniazid plus Rifampicin
Review Of Literature
26
treatment than Isoniazid alone and this has shown to be synergistic
rather than additive. Slow acetylators of NAT2 develop more severe
hepatotoxicity than rapid acetylators making it a significant risk factor
(Hussain et al., 2003).
2.6.6. Antitubercular drugs
2.6.6.1. Isoniazid
Isoniazid also known as isonicotinylhydrazine (INH) is an
excellent first line bactericidal antitubercular drug. It is used for actively
growing tubercle bacilli. For active tuberculosis it is often used together
with rifampicin and pyrazinamide.
2.6.6.2. Structure
Chemically isoniazid is Isonicotinic acid hydrazide. Its molecular
formula is C6H7N30. The structure of isoniazid comprises a pyridine ring
and a hydrazine group. The MIC of isoniazid in the treatment of TB is
0.02-0.20 µg/ml. structurally similar to pyridoxine.
Fig 5: Chemical structure of Isoniazid
Review Of Literature
27
2.6.6.3. Properties
The molecular weight of INH is 137.14gm, and the melting point
is 170-173°C. It is a colourless, odourless, white crystalline powder and
freely soluble in water.
2.6.6.4. Mechanism of action
INH is a prodrug and converted into an active metabolite by the
M.tuberculosis catalase – peroxidise enzyme KatG. The activated drug
generates the organic and oxygen derived free radicals (superoxide,
hydrogen peroxide and peroxynitrite) that will inhibit the synthesis of
mycolic acid which are unique fatty acid component of mycobacterium
cell wall. The sensitive bacteria convert INH into an active metabolite
that interacts with InhA and KasA gene products involved in mycolic
acid synthesis (Deck et al., 2012).
2.6.6.5. Pharmacokinetics:
INH completely absorbed from the gastro intestinal tract and
penetrates all body tissues, tubercular cavities, placenta and meninges.
Metabolism takes place in liver by N acetylation by NAT2 enzyme. The
acetylated metabolites are excreted via urine. The genetic variation
influence the rate of INH acetylation: they are slow and fast acetylators.
Review Of Literature
28
2.6.6.6. Uses
The typical dosage of 5mg/kg/day, adult dose 300mg/day can be
given in Tuberculosis. A regimen with Isoniazid 15 mg/kg dose or
900mg twice weekly can be used along with Rifampicin for 9 months.
For latent TB Isoniazid alone can also be given at the dosage of
300mg/day (5mg/kg/day) or 900mg twice weekly for 9 months.
2.6.6.7. Adverse effects
Hepatitis is the most common adverse effect of Isoniazid and can
be fatal if the drug is not stopped promptly. The occurrence of hepatitis
depends on age. The age between 21-35 years the incidence was
around 0.3%, between 36-50 was around 1.2%, 50 and above it was
2.3%. The risk of hepatitis will be more during pregnancy and
postpartum period and also in alcohol dependent individual. Histological
reports shows that isoniazid cause hepatocellular damage and necrosis.
Peripheral neuritis and neurological manifestations like paresthesias,
mental disturbances and rarely convulsion are the most important dose
dependent adverse effects. Other miscellaneous side effects include
pyridoxine deficiency anaemia, tinnitus and gastrointestinal discomfort.
2.6.7. Rifampin (Rifampicin -R)
It is a semi synthetic derivative of Rifamycin B. It is bactericidal
drug obtained from Streptomyces mediterranei. It act against M.
Review Of Literature
29
tuberculosis and other gram positive and negative bacteria like Staph.
Aureus, N. meningitides, H. Influenza, E. Coli etc., Against M.
tuberculosis it is as efficacious as INH and better than all other drugs. It
acts best on slowly and intermittently dividing organism. MIC of
Rifampin for M. tuberculosis is 0.05-0.50 μg/mL.
2.6.7.1. Structure
Chemically Rifampicin is 3-[((4-methyl-1-piperazinyl) imino] methyl)]
rifamycin. Its chemical structure is depicted in fig (6).
Fig 6: Chemical structure of Rifampicin
2.6.7.2. Properties
Molecular formula is C43H58N4012 and its Molecular weight is
822.96g. It is powder in nature, red to orange in colour and odourless.
Melting point is 138 to 188º C. Suspension in water has pH 4.5 to 6.5.
Rifampicin is Soluble in water and chloroform.
Review Of Literature
30
2.6.7.3. Mechanism of action
Rifampin inhibits the RNA synthesis by binding to the subunit of
DNA dependent RNA polymerase. This will prevents the bacillus from
synthesizing messenger RNA and protein, causing cell death.
2.6.7.4. Pharmacokinetics
Well absorbed orally when taken on empty stomach, widely
distributed in the body. Highly plasma protein bound, penetrate cavities
caseous masses, Placenta and meninges. It is metabolized in liver to an
active deacetylated metabolite which is excreted mainly in bile and
some in urine also. Rifampicin is a potent enzyme inducer. The t1/2 is
2-5 hours.
2.6.7.5. Uses
For active tuberculosis patients, Rifampicin 600mg/day orally
(10mg/kg/day) can be given in combination with Isoniazid and other
antitubercular drugs. Rifampicin at a dose of 600mg daily or twice
weekly for 6 months effective in combination with other drugs used in
mycobacterial infections and in leprosy. Rifampicin 600mg daily for 4
months used as an alternative to INH for latent TB who are unable to
take isoniazid, leprosy, prophylaxis of Meningococcal and H influenza
meningitis and carrier state. Combination of doxycyline and Rifampin is
the first line therapy of brucellosis.
Review Of Literature
31
2.6.7.6. Adverse effects:
ADR is similar to that of INH. Hepatitis is a major adverse effect
generally occurs in patients with pre existing liver disease and is dose
related. Minor reactions are cutaneous syndrome, flu syndrome, and
abdominal syndrome. Urine and secretions may become orange red but
this is harmless.
2.6.8. Pyrazinamide (Z)
Pyrazinamide is a bactericidal drug and relative of nicotinamide. The
chemical structure of pyrazinamide is depicted in fig 7.
2.6.8.1. Properties
It is stable compound soluble in water. It inhibits the tubercle
bacilli at the concentration of 20 mcg/ mL.
Fig 7: Chemical structure of Pyrazinamide
Review Of Literature
32
2.6.8.2. Mechanism of action
During metabolism Pyrazinamide is converted into pyrazinoic acid
by the mycobacterial pyrazinamidase. Pyrazinoic acid accumulated in
the acidic medium and inhibits the mycolic acid synthesis and disrupts
mycobacterial cell membrane metabolism and transport functions.
2.6.8.3. Pharmacokinetics
The absorption takes place in the gastrointestinal tract and
distributed widely in the body including inflamed meninges. Parent drug
is metabolised in liver but the active metabolite excreted in urine. A
dose of 40–50 mg/kg can be given in twice or thrice weekly treatment
regimens. Half life is about 8-11hours.
2.6.8.4. Uses
In short course TB (6 month) regimens it is usually given in
conjugation with Isoniazid and Rifampicin as a sterilizing agent active
against residual intracellular organism which may cause relapse.
2.6.8.5. Adverse effects
Hepatotoxicity (1-5%) is the major adverse effect of
pyrazinamide. Other side effect includes nausea, vomiting, drug fever
and hyperuricemia. Hyperuricaemia may result in acute gouty arthritis
Review Of Literature
33
2.6.9. Mechanism of AntiTB drug induced hepatotoxicity
Hepatotoxicity is a serious complication of anti TB therapy and it
is mainly due to the combination of multiple drug regimens. It
encompasses a wide spectrum of liver injury ranging from
asymptomatic elevation of liver enzymes to acute liver failure, which
often leading to death or liver transplantation (Kumar et al., 2010). Most
cases of DILI associated with ATT are idiosyncratic in nature, it is
mainly due to the nature of the host and not about the drug which
responsible for liver injury. On the otherhand ATT induced liver injury is
through metabolic idiosyncrasy due to the metabolites released during
the metabolic pathway. This may be facilitated by genetic factors or
polymorphism in drug metabolizing enzymes (genetic polymorphism)
(Lammert et al., 2010). Research evidence suggested that it is
mediated through toxic metabolite which induces oxidative stress
damage to the hepatocytes (Ali, 2012).
2.6.9.1. Hepatotoxicity induced by Isoniazid
Among the first line antitubercular drugs, Isoniazid is mainly
attributed to most cases of drug induced liver damage. In the metabolic
pathway (fig 8) Isoniazid is acetylated to acetylisoniazid via hepatic
enzyme NAT2 and it is further hydrolysis to acetylhydrazine and
isonicotinic acid. The acetylhydrazine is either acetylated to
diacetylhydrazine or hydrolysed to hydrazine or oxidized by CYP2E1 to
Review Of Literature
34
form hepatotoxic intermediates, which destroy hepatocytes resulting in
injury (Huang et al., (2003). The other metabolic route of INH leads to
the production of toxic metabolite hydrazine by the process of direct
hydrolysis. NAT2 is also responsible for converting hydrazine to
acetylhydrazine and further diacetylhydrazine, a nontoxic component
(Sudhir kumar et al., 2014). Also, INH is a potent enzyme inhibitor of
many forms of cytochrome P450 enzymes including CYP1A2, 2A6,
2C19 and 3A4. Among these cytochromes, CYP1A2 play a key role in
the detoxification of hydrazine. Therefore, INH is the most likely to
cause its own toxicity, possibly by the inhibition of these enzymes (Wen
et al., 2002; Desta et al., 2001; Jyothi bhasini et al., 2012).
GST is an important phase II detoxification enzyme, plays a
defensive role against hepatotoxic products that are generated from
CYP2E1, by conjugating glutathione with toxic metabolites. This
conjugation reduces the toxic effect and is eliminated from the body
(Hayes et al., 2005). The diminish level of plasma glutathione due to
toxic metabolite in AntiTB therapy will leads to oxidative stress which
leads to hepatotoxicity.
Isoniazid induced hepatotoxicity is mainly due to the induction of
oxidative stress by the toxic metabolite hydrazine. Research evidence
stated that Isoniazid induce peroxidative damage which leads to protein
damage, inflammation and apoptosis. This is evidence by significant
elevation of serum liver marker enzymes (AST, ALT, AST), Lipid
Review Of Literature
35
peroxidation, proinflammatory cytokines (NF-κB, TNF-α) and
subsequent decrease in the level of serum albumin, protein, liver
glutathione and antioxidant enzymes (Ayman et al., 2014).
Fig 8: Metabolic pathway of Isoniazid
2.6.9.2. Hepatotoxicity induced by Rifampicin
Rifampicin is associated with hepatocellular pattern of DILI and
more often it potentiates the hepatotoxicity of other anti-TB drugs
(Ramappa and Aithal, 2013). Rifampicin is an effective inducer of
CYP2E1 enzymes and increase INH induced toxicity by increasing the
formation of its toxic metabolite hydrazine, resulting in elevated liver
Review Of Literature
36
marker enzymes and altered the structural integrity of liver (Ramappa
and Aithal, 2013). Rifampicin also increases the metabolism of INH to
isonicotinic acid, which is also a hepatotoxic product. The plasma half
life of acetyl hydrazine (INH metabolite) is shortened by RIF and acetyl
hydrazine is quickly converted to its active metabolites by increasing the
oxidative elimination rate of acetyl hydrazine, which is related to the
higher occurrence of liver necrosis (Tostmann et al., 2008). Therefore,
the activity of Rifampicin has been attributed to the enzyme inducing
property thereby it increase the incidence of anti-TB-DIH.
2.6.9.3. Hepatotoxicity induced by Pyrazinamide
Pyrazinamide is usually given in combination with Isoniazid and
Rifampicin in the treatment of TB. Pyrazinamide is metabolized to
pyrazinoic acid (PA) by hepatic Microsomal amidase and further
oxidized to 5- hydroxyl pyrazinoic acid (5-OH-PA) by xanthine oxidase.
These two reactive metabolites of Pyrazinamide are considered to have
hepatotoxic potential. However, 5- OH-PA is the more toxic metabolite
as compared to PA, responsible for Pyrazinamide-induced
hepatotoxicity (Shih et al., 2013). The combination of Pyrazinamide with
the other antitubercular drug like Isoniazid and rifampicin will increase
incidence of hepatotoxicity (Jyothi bhasini et al., 2012).
Numerous studies stated that Isoniazid, Rifampicin and
Pyrazinamide have been reported to induce significant hepatotoxicity by
Review Of Literature
37
inducing oxidative stress mediated cell injury which will leads to
inflammation and apoptosis in the hepatocytes (Tasduq et al., 2005;
Steele et al., 1991). Ayman et al.(2014) and Sankar et al.(2015) in their
studies shown that anti TB drug induced liver damage is mainly due to
oxidative stress caused by the parent drug and active metabolites. In
the liver, the hepatotoxic metabolite of AntiTB drugs enhances the level
of liver marker enzymes (AST, ALT, ALP and LDH).
The oxidative stress induces Lipid peroxidation of membrane and
subsequently depletes the glutathione and other antioxidants (SOD,
CAT, and GST). These altered levels of antioxidant enzymes influence
the liver tissue to oxidative damage which paves the way for apoptosis
and inflammation which is indicated by the upregulated Bax, NF-κB,
TNF-α , caspase 3 and caspase 9 and down regulated the Bcl2 gene
expression (Ayman et al., 2014; Sankar et al., 2015). Wang et al. (2011)
and Saraswathy et al. (1998) demonstrated that the Antitubercular drug
altered the lipid profile which is evidenced by increased level of LDL,
VLDL, and FFA and decreased level of HDL. Saraswathy et al. (1998)
in their study stated that HRZ decreased the level of membrane bound
ATPase enzymes like Na+ K+, Ca+ and Mg+ ATPase.
2.7. Hepatoprotective compounds
The use of medicinal plants in treating hepatic illnesses has been
reported since ancestral times. In the case of hepatic diseases, several
Review Of Literature
38
species such as Silybum marianum, Curcuma longa, Phyllanthus niruri,
Allium sativum, Hibiscus vitifolius, Phyllanthus polyphyllus, Ocimum
sanctum and Panus giganteus (Bark) have been shown to ameliorate
hepatic lesions.
2.7.1. Current antioxidant therapy for liver disease in clinical trials
In addition to the natural plants, many single compounds are
investigated for their antioxidant role in eliminating oxidative stress. The
compounds include l-theanine, Vitamin E, N-acetyl cysteine, Raxofelast
and betaine. L-theanine, an amino acid in green tea, has been proven
the ability to prevent alcoholic hepatic damage. The compounds like
silymarin, N-acetyl cysteine are used as a drug or supplement for non
alcoholic fatty liver disease or non alcoholic steatohepatitis or alcoholic
liver disease in phase IV clinical trial. In phase III trial Quercetin and
reservatrol have been studied as an antioxidant in food for liver disease.
Vitamins especially Vit E used as a dietary antioxidant supplement for
liver disease in phase II and phase III clinical trial.
Hence natural sources and bioactive compounds isolated from
plants and endogenous antioxidant have shown strong antioxidant
effect and hepatoprotective effect should be studied in trials (Li et al.,
2015).
Review Of Literature
39
2.7.2 .Flavonoids
Flavonoids are a dietary component, consist of a large number of
polyphenolic compounds have health-promoting properties due to their
high antioxidant capacity. Several flavonoids such as Catechin,
Silymarin, Apigenin, Quercetin, Naringenin, Rutin etc, are reported to
have hepatoprotective activities.
2.7.3. Silymarin
Silymarin is derived from Silybum marianum, which is commonly
known as Milk thistle. The plant contains at least seven flavolignans and
the flavonoid taxifolin. The most important flavolignans present in it
include silybin, silydianin, and silychristine. Silymarin has been used for
many years as a complementary alternative medicine used in treatment
of hepatic diseases.
In Clinical trials silymarin exerts hepatoprotective effects in acute
viral hepatitis, poisonous A phalloides and toxic effects produced by
alcohol-related liver disease, including cirrhosis, at daily doses ranging
from 280 to 800mg. Hepatoprotection has been documented by
improvement in liver function tests; moreover, treatment with silymarin
was associated with an increase in survival in a placebo-controlled
clinical trial in alcoholic liver disease (Fraschini et al., 2002).
Review Of Literature
40
In previous studies, Silymarin shows an imminent
hepatoprotective and antioxidant activity against free radicals produced
during the metabolism of ethanol (Et-OH), acetaminophen
(Paracetamol), or carbon tetrachloride (Vargas-Mendoza et al., 2014).
Silymarin inhibit the depletion of two main detoxicification
enzymes like GSH and superoxide dismutase (SOD), by enhancing
GSH, SOD level thereby it reduces the free radical burden.
Subsequently prevent the cell contents, including DNA, RNA and other
cellular components from oxidative damage. It has a regulatory
mechanism on cellular and mitochondrial membrane permeability in
association with enhanced membrane stability against xenobiotics
injury. It can prevent the absorption of toxins into the hepatocytes by
occupying the binding sites as well as inhibiting many transport proteins
at the membrane. It donate electrons to stabilize the free radicals and
ROS and also enhance glutathione thereby it prevent lipid peroxidation.
It prevent the ROS induced IL-10, TNF α, NFκB and reduces apoptosis
and inflammation (Vargas-Mendoza et al., 2014).
These actions, together with the antiperoxidative property, make
silymarin a suitable candidate for the treatment of iatrogenic and toxic
liver diseases (Fraschini et al., 2002).
Review Of Literature
41
2.8. Hesperidin
Hesperidin’s is a bioflavonoid which was derived from the word
“hesperidium” which refers to fruit produced by citrus trees. Hesperidin
exerts wide range of benefits in a variety of neuronal conditions from
anxiety and depression to Alzheimer's and Parkinson's diseases.
Additional benefits that come from hesperidin consumption include radio
and UV-protection, anti-diabetic, anti-allergic, anti-osteoporotic, and
anti-cancerous effects.
2.8.1 Sources
Lemons, limes, oranges and tangerines the main source of
hesperidin. Citrus fruit peels contain highest concentration of
hesperidin.
2.8.2. Structure
Chemical structure of Hesperidin depicted in fig: 9
Fig 9: Chemical structure of Hesperidin
Review Of Literature
42
2.8.3. Pharmacokinetics
Hesperidin is a hesperitin-7-rutinoside which is bound to Rutin.
Absorption not takes place in intestine. Hesperidin is metabolised by
fermentation in colon to produce Hesperitin, get absorbed in the colon
then it reaches the circulation. Plasma peak concentration of the
Hesperetin was up to 7-7.4 hours. The metabolism takes place in the
liver mainly through glucuronidation and sulfation. The circulating form
of Hesperetin metabolites were found in plasma was glucuronides
(87%) and sulfoglucuronides (13%) and the metabolites are excreted in
urine.
2.8.3.1. Acute toxicity study
The lethal dose of Hesperidin was more than 2000mg/kg (Papiya
Bigoniya and Kailash singh, 2014).
2.8.4. Pharmacological Effects
Hesperidin plays a protective role against fungal and other
microbial infections in plants. Apart from its physiological antimicrobial
activity, decades of research revealed its many therapeutic applications
in prevention as well as in the treatment of many human disorders. Most
of these benefits are attributed to its antioxidant properties. Hesperidin
is effectively used as a supplemental agent in treatment programs and
protocols of complementary settings.
Review Of Literature
43
2.8.4.1. Hesperidin in prevention of cardiovascular diseases
Hesperidin supplementation has been recommended for vascular
disorders like fragility and permeability. Studies show that Hesperidin
inhibits inflammatory processes in the ischaemia-induced
hyperpermeability, characteristic for venous stasis. HDN at 200mg/kg
oral administration in rat shows antihypertensive and diuretic effect
(Vesna Kunti et al., 2014). In randomized crossover study in healthy
volunteers’ shows that it decreases the systolic blood pressure and
postprandially increases endothelium-dependent microvascular
reactivity by promote NO production resulting in vasodilatation
(Christine Morand et al., 2011). Research evidence shows that
consumption of citrus fruits reduced the risk of coronary heart disease
and stroke. In case of myocardial infarction after cardiac
ischemia/reperfusion injury HDN treatment significantly reduced the
percentage of infarction, partially by antioxidant and anti-inflammatory
activity and also by blocking apoptosis (cell death) (Agrawal et al.,
2014). Hesperidin notably augmented anti-apoptotic (Bcl-2) and
decreased pro-apoptotic (Bax) protein expression thereby preventing
loss of contractile cells (Agrawal et al., 2009). Hesperidin 200mg/kg
shows a protective effect against doxorubicin induced cardiotoxicity
(Ihab T. Abdel-Raheem et al., 2009).
Review Of Literature
44
2.8.4.2. Antilipidemic effect of hesperidin
It also acts as an inhibitor of two main enzymes in cholesterol
metabolism includes HMGCoA reductase and acetyl CoA
acetyltransferase (ACAT) that regulate LDL and HDL levels. Thus, by
inhibiting the activity of these two enzymes hesperidin decreases the
LDL and increases the HDL. A study on rats fed a high cholesterol diet
supplemented with flavonoids (hesperidin and naringin) demonstrated
inhibition of liver cholesterol biosynthesis (28.3 %) and the esterification
of hepatic cholesterol (23.7 %) by hesperidin. A human study
demonstrated that there was a marked reduction in the triglyceride level
after 4 weeks of hesperidin (G-Hesperidin, 500 mg/day)
supplementation (Kim et al., 2003; Miwa et al., 2005).
2.8.4.3. Effect on Central Nervous system
Hesperidin has the ability to cross blood brain barrier and hence
used in number of neurological disorder like Parkinson’s disease,
Alzheimer’s disease, Anxiety, Epilepsy and Multiple sclerosis. The
neuroprotective effect of hesperidin has mainly attributed to its anti-
inflammatory and antioxidant properties as seen by an increased level
of antioxidant enzymes, decreased level of oxidative stress,
inflammatory markers, and pro-apoptotic proteins in neurons (Vesna
Kunti et al., 2014). It also shows anxiolytic and antidepressant effect
(Filho CB et al., 2013). Hesperidin reduces pain sensitivity which is
Review Of Literature
45
mediated through µ-opioid receptor like morphine (Loscalzo et
al., 2011).
2.8.4.4. Hesperidin as a radioprotector
Hesperidin shows a protective and antioxidant effect against
-irradiation and X ray radiation induced cellular damage in the liver by
diminished the level of liver marker enzymes and lipid peroxidation by
simultaneously enhances the level of antioxidant enzymes (Pradeep et
al., 2008; Kalpana et al., 2011).
2.8.4.5. Effect on Respiratory System
A study in mouse model shows that hesperidin has a protective
effect against allergic asthma (Kim et al., 2011). Hesperidin inhibits the
synthesis and release of histamine from mast cells and also increases
the vascular endothelial growth factor (VEGF & Ig E). It also shows
protective effective against allergic rhinitis and allergic asthma by
suppressing the inflammation in airway (Kobayashi, 2006).
2.8.4.6. Effect on cancer
Hesperidin induces cell growth arrest apoptosis in a large variety
of cells including colon, pancreatic and lung cancer (Park et al., 2008;
Patil et al., 2009; Al-Jasabi and Abdullah, 2013; Kamaraj et al., 2010).
Some studies have reported that hesperidin significantly induced
apoptosis by modulating BAX/Bcl-2 ratio together with enhanced
Review Of Literature
46
cytochrome c release and caspase activations in colon cancer cells
(Saiprasad et al., 2014) and mediates apoptosis through extrinsic
pathway in cervical cancer cells (Bartoszewski et al., 2014).
2.8.4.7. Effect on Oxidative stress
Free radicals are generated in the body by various
physiochemical reactions. The excess formation of free radicals leads to
oxidative stress which produces damage to the cell structure and
function. Oxidative stress triggers inflammation which further triggers
the various life threatening disease ranging from cardiovascular and
neurodegenerative disorders to diabetes and cancer.
Hesperidin scavenges the reactive oxygen species and also has
the ability to stimulate the endogenous antioxidant defense mechanism.
In recent years, studies have focused mainly on the protective
properties of HDN against various oxidants, chemicals and toxins that
cause damage to tissues via oxidative stress or other mechanisms
(Kalpana et al., 2009; Ahmad et al., 2012; Kamaraj et al., 2010;
Kawaguchi et al., 2004; Kim et al., 2011).
Kalpana et al. (2009) studied the antioxidant effects of HDN
against H2O2 induced membrane damage in red blood cells (RBCs).
They found that HDN showed significant radical scavenging activity and
prevented H2O2 induced oxidative damage on the cellular membranes of
RBCs. HDN exert their antioxidant properties via two ways: direct
Review Of Literature
47
radical scavenging and augmenting cellular antioxidant defense.
Numerous studies showed that HDN neutralized ROS, including
superoxide anions, hydroxyl radicals, nitric oxide radicals etc., (Garg et
al., 2001; Hamideh Parhiz et al., 2015). This direct radical scavenging
activity of HDN plays an important role in their protection of DNA,
proteins, and tissues against oxidative damage induced by intrinsic
(such as oncogenes) and extrinsic (such as radiation, inflammation, and
toxins) factors. Studies were shown that HDN had the capability to
attenuate oxidative damage in tissues induced by various compounds,
like hydrogen peroxide, CCl4, acetaminophen, gamma radiation
(Kalpana et al., 2009; Naveen Tirkey et al., 2005; Ahmad et al., 2012;
Pradeep et al., 2008). The above mentioned compounds increased the
lipid peroxidation and decrease the antioxidant enzymes including SOD,
GST, CAT, GSH-Px, GR etc. Reversibly these compounds enhance the
liver marker enzymes including ALT, AST, ALP, LDH, GGT, and
bilirubin in the serum.
HDN treatment resulted in a decreased level of all of the
biomarkers, and the antioxidant status was brought back to nearly
normal. Therefore, HDN offers protection against oxidative tissue
damage that is caused by various intrinsic and extrinsic factors by
enhanced the production of enzymatic and non enzymatic antioxidant
(Kalpana et al., 2009; Naveen Tirkey et al., 2005; Ahmad et al., 2012;
Pradeep et al.,2008).
Review Of Literature
48
2.8.4.8. Effect of hesperidin on apoptosis and inflammation
Hesperidin showed anti-apoptotic effects by augmented anti-
apoptotic (Bcl-2) and decreased pro-apoptotic (Bax) protein expression
thereby protect the cells from apoptosis (Agrawal et al., 2009). Recent
study showed that Hesperidin Attenuates Ultraviolet B-Induced
Apoptosis by Mitigating Oxidative Stress and attenuated the oxidation of
cellular macromolecules, prevented the release of cytochrome c into the
cytoplasm, down regulated the expression of Bcl-2-associated X protein
and caspase in Human Keratinocytes (Susara et al., 2016). In another
study Hesperidin attenuates oxidative stress, inflammation and
apoptosis by down regulated the expression of caspase-3, caspase-9,
NFκB, iNOS, Kim-1 and upregulated the expression of Bcl-2 (Ahmad et
al. 2012). Furthermore, HDN apparently suppressed NF-κB, IL-1β and
TNF-α and enhanced IL-10 production at the transcription level (Li et al.,
2010).
2.8.5. Adverse effects of Hesperidin
It is safe for majority of the people when taken orally for up to 6
months. The Safety of using it for a longer duration is unknown. The
common side effects include headache, nausea, stomach upset, and
diarrhoea. It is possibly safe during pregnancy and breast feeding
mothers. Hesperidin slow down blood clotting and increase the risk of
Review Of Literature
49
bleeding during and after surgery. It also decreases the blood pressure
(WebMD 2017).
2.9. Ascorbic acid
Ascorbic acid (Vitamin C) is a water soluble vitamin. It is
generally known as ascorbic acid. Man and few small animals require
Vitamin C from their diet. It is completely absorbed from gastrointestinal
tract and distributed widely distributed both extra and intracellularly.
Usual 60 mg/day intake results in about 0.8 mg/dl in plasma and 1.5 gm
in body as a whole. Chemical Formula - C6H8O6.
2.9.1. Structure
Chemical Structure of Ascorbic Acid is debited in the fig 10.
Fig 10: Chemical structure of Ascorbic acid
Review Of Literature
50
2.9.2. Sources
Citrus fruits (lemon, orange), Guavas, Amla and Indian
gooseberry, vegetables including tomatoes, cabbage, leafy greens
and germinating pulses, are the rich sources of Vitamin C.
2.9.3. Physiological role of Ascorbic acid
It acts as a cofactor in the numerous oxidation and hydroxylation
reactions.
It is essential for the synthesis of collagen, norepinephrine,
oxytocin and adrenal steroidogenesis
It enhances iron and calcium absorption and also assists in the
prevention of blood clotting and also strengthening the walls of
the capillaries.
It promotes cell development, wound healing and protect against
infection
It enhances the immune system and helps reduce cholesterol
levels, high blood pressure and preventing arteriosclerosis (Ozer
et al., 2017; Monfort et al., 2013).
2.9.4. RDA (Recommended daily allowance
Infants- 30 mg/day, premature babies - 40 mg/day, adult male -60
mg/day, Pregnant & lactating women - 75-90 mg/day.
Review Of Literature
51
2.9.5. Deficiency symptoms and treatment
Scurvy (defect in collagen synthesis) characterized by gingival
bleeding, gingivitis, loosening of tooth and defects in tooth formation,
failure of wound healing, capillaries rupture, haematomas and anaemia.
Treatment: Ascorbic acid 1-1.5gm daily for scurvy, at a dose of 100-
300 mg/day provides quick relief, for Prophylaxis- 50-500mg /day, as an
antioxidant 100mg /day, in haematinic formulations 150mg /day with
iron and folic acid.In mega doses it given for common cold, viral
infections and cancer prophylaxis.
2.9.6. Pharmacokinetics
They are ingested in the diet, since ascorbate can be oxidized in
the gastrointestinal tract (GIT) by the presence of other substances that
act as oxidizing agents [e.g., Iron (F3+) and some flavonoids] (Wilson,
2002). Sodium-Dependent Vitamin C Transporters (SVCTs) & GLUT
transporters transport ascorbate into the cell. Ascorbate is better
absorbed in the most distal segments (ileum) of the small intestine and,
in smaller quantities, in the most proximal segments (duodenum).
2.9.7. Pharmacological effects:
2.9.7. 1. Ascorbic acid role in CNS
Ascorbate functions in the nervous system can be divided as
follows: firstly, the interaction of ascorbate with blood- brains barrier as
Review Of Literature
52
well as its medical implications; secondly, it is essential for neuronal
differentiation, maturation and survival; thirdly, its effect on modulating
neurotransmission and its participation in catecholamine synthesis.
Finally, it has an antioxidant effect and plays a role in the structure and
support of the nervous system. The studies showed that ascorbate
interaction with other antioxidant such as α- tocopherol and glutathione
therapeutically used in the prevention of Alzheimer’s disease (Figueroa-
Méndez R and Rivas-Arancibia, 2015). Another study showed that the
intravenous injection of large dose of vitamin C produced improvement
in mental condition in 75 % of schizophrenic’s patients. Oral
supplementation of Vitamin C with antipsychotic reverses ascorbate
levels by reducing oxidative stress and improves BPRS score (Dakhale
et al., 2005). Gautam et al. (2012) in their study shows the effect of
ascorbic in stress induced psychiatric disorders.
2.9.7. 2. Role in Diabetes
Vitamin C has been associated with decreased risk of developing
diabetes mellitus (DM). Hyperglycaemia is responsible for micro
vascular ROS generation which causes endothelial dysfunction.
Treatment with ascorbic acid prevented the acute hyperglycaemic
impairment of endothelial function in diabetic subjects (Shailja Chambial
et al., 2013).
Review Of Literature
53
2.9.7.3. Cardiovascular disease:
2.9.7.3.1. Vitamin C role in Hypertension
Vitamin C has been shown to lower blood pressure. After an
initial vitamin C dose of 2 g and subsequent daily doses of 500 mg for
one month, the participants’ mean blood pressure dropped 9.1%,
providing evidence that long-term vitamin C treatment can reduce blood
pressure in patients with hypertension.
2.9.7.3.2. Vitamin C role in hyperlipidemia and atherosclerosis
Amir Khan and Deepti Malhotra, (2011) investigation showed that
daily intake of Vitamin-C by smokers may be useful in the prevention as
well as in the treatment of tobacco induced hyperlipidemia and
atherosclerosis by decreased the level of plasma lipid parameters like
VLDL, LDL, TC,TG,MDA and enhanced the level of HDL in smokers.
Vitamin C reduces plasma lipid level on hypercholesterolemia -induced
hepatic damage by high cholesterol diet (HCD) in female Wistar rats
(Osama A Alkhamees 2013). Few researchers observed that vitamin C
administration causes significant reduction in LDL and increase in HDL
thereby reduces the risk of cardiovascular disease (Lothar Rossig et al.,
2001; Marc P and McRae, 2008).
Review Of Literature
54
2.9.7.4. Role in cancer
Evidence supports that a high intake of vitamin C decreased risk for
cancer. Ascorbic acid shows the potential effect in the cancer of
oesophagus, oral cavity, stomach, pancreas, cervix, rectum and breast
(Shailja Chambial et al., 2013) and also non-hormonal cancers (Head
1998). Vitamin C also decreases the tumor cell growth and tumor
weight (Chen et al., 2008).
Vitamin C once weekly dose of 7.5 g IV decreased overall side-
effects like nausea, loss of appetite, and fatigue on breast cancer
patients undergoing chemotherapy/radiotherapy (Vollbracht et al.,
2011). In an 11 year cohort study on the association of vitamin
supplementation and upper gastrointestinal cancers, it was shown that
multivitamin use did not help to lower risk, but specific vitamin C
supplementation revealed a 21% lower risk of gastric noncardia
adenocarcinoma (Dawsey et al., 2014).
2.9.7.5. Vitamin C as an antioxidant and interaction with ROS
Vitamin C is an effective antioxidant protects the body from the
deleterious effect of free radicals during oxidative stress. Banerjee et al.
(2009), Naseer et al. (2011), Sminorff and Wheeler, (2000) reported that
Vitamin C has the ability to trap free radicals and protect the
biomembranes from peroxide damage by effectively scavenge the ROS.
The antioxidant property of Vit C can ameliorate the oxidative damage
Review Of Literature
55
by decreasing lipid peroxidation by donating electrons to free radicals
and quench their deleterious activity on cellular macromolecules, thus
playing a role in antioxidant mechanism (El-Gendy et al., 2010). In
addition, ascorbate prevents hepatic antioxidant depletion in chemical-
induced toxicity in which antioxidant acted as intracellular free radical
scavengers and protected cells from free radical induced peroxidative
damage (Cuddihy et al., 2008). Accordingly, Santos et al. (2009)
reported that tissue dysfunction owing to cell death via apoptosis is one
of the major outcomes of oxidative stress that could be ameliorated by
Vitamin C.
2.9.7. 6.Coantioxidant to regenerate the vitamin E
Vitamin C act as cofactor used to regenerate the α-tocopherol
(Vitamin E) from the α-tocopheroxil radical produced when this is
debugged from the lipid-soluble radicals. This is a potentially important
function, because in the in vitro experiments have shown that α-
tocopherol can act as a pro-oxidant in absence of co-oxidants just as
vitamin C. It also helps in the regeneration of glutathione and β-
carotene from their own oxidation products with one unpaired electron
(urate radicals, glutathionil radicals and cations of β-carotene radicals)
(Gueguen et al., 2003). In the absence of ascorbic acid Vit E can act as
a prooxidant hence ascorbic acid act as a cofactor in the generation of
Vit E.
Review Of Literature
56
2.9.7.7. Vitamin C role in Apoptosis and inflammation
Heikal et al. (2014) reported that Vitamin C supplement down
regulated the level of the expression of apoptosis-related genes and
protect against oxidative damage and apoptosis. Vitamin C could
reduce cytotoxicity via the ROS-mediated mitochondrial pathway and
NF-kB/FasL pathway (Jin et al., 2014). Its shows antiapoptotic activity
by inhibiting the mitochondrial cytochrome C release and suppression of
subsequent activation of pro-inflammatory cytokines(IL-2, IL-8,TNF-)
and caspase (Rossig et al., 2001; Perez-Cruz et al., 2007;Siow et al.,
1999; Isabel Perez-Cruz et al., 2003; Mikirova et al.,(2012)
2.9.8. Adverse effects
The common side effects of vitamin C include redness of the skin,
flushing, headache, Nausea, vomiting, diarrhoea. Renal side effects
include oxalate and urate kidney stones.
From the above part it is clear that human beings can’t avoid taking
drugs and some of these unavoidable drugs posses significant toxicity
on liver. Ethanol and antitubercular drugs induced hepatotoxicity is
mainly due to the cellular oxidative stress and failure of antioxidant
defense mechanism. Hence there is the need for hepatoprotective
agent with antioxidant property in the treatment regimen while
administering antitubercular drugs to minimize the hepatic damage and
also to treat alcoholic liver disease.
Review Of Literature
57
Hesperidin and ascorbic acid are potential antioxidant used in the
treatment of various ailments. From the scientific data Hesperidin
reported to posses’ hepatoprotective and antioxidant effect against
acetaminophen (Ahmad et al., 2012), γ radiation (Pradeep et al., 2012),
iron (Pari et al., 2015) and cyclophosphamide (Ayman, 2014) induced
hepatotoxicity. On the other hand Ascorbic acid posses’ protective
effect against formaldehyde (Shang et al., 2014), acetaminophen (Sabiu
et al., 2015) and monosodium glutamate (Ibrahim et al., 2011) induced
hepatotoxicity.
The above scientific reviews suggested that the hepatoprotective effect
of Hesperidin and ascorbic acid is mainly due to its antioxidant and free
radical scavenging property. Considering the high patronage of this
antioxidant property Hesperidin and ascorbic acid can be used to
alleviate ethanol and antitubercular drugs induced hepatotoxicity. Even
though previous studies reported the protective effect of Hesperidin and
Ascorbic acid against various toxic models none of the earlier studies
have reported the protective effect against ethanol and antitubercular
drugs induced hepatotoxicity.
Hence the present study was designed evaluate the hepatoprotective
effect of Hesperidin and Ascorbic acid on ethanol and antitubercular
drugs induced hepatotoxicity in rats.
58
3. NEED FOR THE STUDY
Due to rapid industrialization and change in life style, human
subjects are exposed to a variety of xenobiotics inevitably. However, the
ultimate burden due to such exposure will be on the vital organ of the
body, especially the liver.
In spite of tremendous strides in the modern medicine, there is no
satisfactory measure for the treatment of liver disorders. Hence, it is an
urgent need to explore the natural made remedies to serve as the
alternative therapeutic agents so as to counter the side effects of
various drugs and toxins because they are believed to be safer and
economical. Thus, additional natural products need to be evaluated for
their antioxidant potential.
Hence the present study was designed to evaluate the protective effect
of Hesperidin and Ascorbic acid against ethanol and antitubercular drug
induced hepatotoxicity.
59
4. AIM AND OBJECTIVES OF THE STUDY
The main aim of the study was to evaluate the hepatoprotective effect of
Hesperidin and Ascorbic acid on Ethanol and Antitubercular drugs
induced hepatotoxicity in Wistar albino rats.
The Primary objective of the research was
to evaluate the hepatoprotective effect of Hesperidin and ascorbic
acid on ethanol and antitubercular drug induced hepatotoxicity.
The secondary objectives of the research was
to analyse the effect of Hesperidin and ascorbic acid on lipid
peroxidation and antioxidant status on ethanol and antitubercular
drug induced hepatotoxicity.
to investigate the effect of Hesperidin and ascorbic acid on lipid
profile and membrane stabilizing action on antitubercular drug
induced hepatotoxicity.
to explore the effect of Hesperidin and ascorbic acid on the
expression of apoptotic and inflammatory markers on
antitubercular drug induced hepatotoxicity.
to evaluate the synergistic effect of Hesperidin and ascorbic acid
on ethanol and antitubercular drug induced hepatotoxicity.
Materials and Methods
60
5. MATERIALS AND METHODS
5.1. Experimental animals:
Healthy adult wistar male rats weighing about 150-200g were
obtained from the VMKV Medical College, Salem. The experimental
animals were housed in polypropylene cages in a well ventilated room
under laboratory condition (24± 2 ºC) and relative humidity with a 12 h
light/dark cycle. The animals were acclimatize for around one week
before the experimental procedure and fed with standard laboratory diet
and water ad libitum. The Experimental design was approved by the
institutional Animal ethical committee VMKV Medical college (Approved
No: IAEC/VMKVMC/04/2013). CPCSEA and WHO guidelines were
followed for animal handling and treatment.
5.2. Tools
Chemicals, pH meter, vertex, centrifuge, spectrophotometer,
Tissue homogenizer, agarose gel electrophoresis and RTPCR.
5.3 Chemicals:
Isoniazid, Hesperidin, Ascorbic acid and Silymarin were
purchased from Sigma Aldrich, USA. Pyrazinamide obtained from the
Sterling healthcare Ltd and Rifampicin obtained from Lupin limited. The
Antibody for Bcl-2, Bax, caspase 3, and caspase 9 were purchased
from cell signalling technology (Beverly, MA) and the antibody for TNF-
Materials and Methods
61
α, NF-kB, IL-10 were purchased from Abcam Ltd (Cambridge, U.K). All
other chemicals and solvents used in the study are of analytical grade.
Standard orogastric cannula was used for oral drug administration.
5.4. Treatment regimens:
The selection of the dose for Ethanol (Tarasankar Maity et al.,
2012) and Anti–tubercular drugs (Chandane et al., 2013), Hesperidin
(Ahmad et al., 2012), Ascorbic acid (Ibrahim et al., 2011), Silymarin
(Basini Jyothi et al., 2013) based on the previous literature. The fasted
rats were randomly divided into 6 groups consists of 6 rats each such
that the weight difference within and between group does not exceed
±20% of the average weight of the total rats.
5.5. Experimental design -1: Ethanol-induced hepatotoxicity
Group 1 :Control rats were administered with distilled water
p.o for 21 days.
Group 2 :test control were administered with Ethanol (40%)-
2ml/100gm p.o for 21 days.
Group 3 :rats administered with Hesperidin ( 200 mg/kg b.wt.)
p.o 1 h before oral administration of Ethanol (40%-
2ml/100gm) for 21 days.
Materials and Methods
62
Group 4 :rats administered with Ascorbic acid (100 mg/kg
b.wt.) p.o 1 h before oral administration of Ethanol
(40%-2ml/100gm) for 21 days.
Group 5 :rats administered with both Hesperidin 200 mg/kg
b.wt. and Ascorbic acid (100 mg/kg b.wt.) p.o 1 h
before oral administration of Ethanol(40%-
2ml/100gm) for 21 days.
Group 6 :rats administered with Silymarin (100mg/kg b.wt.)
p.o 1 h before oral administration of Ethanol (40%-
2ml/100gm) for 21 days.
At the end of the experimental period (21 days) all the
animals were faster overnight and they were anesthetized with inhaled
diethyl ether anesthesia for about 30–40s. The 2ml of the blood was
collected through retro orbital vein and the serum was separated for
biochemical analysis. After that the animals were sacrificed by cervical
dislocation. For biochemical analysis, liver tissues were quickly
removed and homogenized with appropriate buffer and centrifuged at
4°C and the supernatant was used in the assay of antioxidants and lipid
peroxidation. The small sections of the liver lobe were collected in 10%
formalin and stored for Histopathological examination.
Materials and Methods
63
5.5.1. Investigations:
5.5.1.1. Estimation of serum Biochemical markers.
Serum Total Protein, Albumin, Bilirubin.
5.5.1.2. Estimation of liver marker enzymes in serum.
Aspartate aminotransferase (AST), Alanine
aminotransferase (ALT), Alkaline phosphatase (ALP) and Lactate
dehydrogenase (LDH) was estimated by using commercially available
KIT purchased from Transasia Bio Medicals, Bengaluru.
5.5.1.3. Estimation of serum lipid profile.
Total cholesterol and triglycerides was estimated by KIT obtained
from Nicholas India Pvt Ltd.
5.5.1.4. Estimation of Oxidative stress markers in the liver.
The level of TBARS was measured using the method of Ohkawa et al.
5.5.1.5. Estimation of antioxidant enzymes in the liver.
Superoxide dismutase (SOD) was estimated by the method of
Kakkar et al. Catalase (CAT) was determined by the method of Sinha.
Reduced glutathione (GSH) activity was estimated by the method of
Rotruck et al. Vitamin C & E content were estimated by the methods of
Materials and Methods
64
Omaye et al & Desai ID. Total protein content was determined by the
method of Lowry et al.
5.5.1.6. Histopathological Examination
The liver was quickly removed after sacrificing the rats and fixed with
10% formalin solution. Histological sections were prepared, stained with
hematoxylin and eosin and then examined under microscope.
5.6. Experimental design 2: Antitubercular drug induced
hepatotoxicity.
Group 1 :Control rats administered distilled water p.o for 50
days.
Group 2 :test control were administered with Isoniazid (27
mg/kg. b.wt.) + Rifampicin (54 mg/kg b.wt.)+
Pyrazinamide (135 mg/kg b.wt.) p.o for 50 days.
Group 3 :rats administered with Hesperidin (200 mg/kg b.wt.)
p.o 1h before oral administration of Isoniazid (27
mg/kg b.wt.) + Rifampicin (54 mg/kg b.wt).+
Pyrazinamide (135 mg/kg b.wt.) for 50 days.
Group 4 :rats administered with Ascorbic acid (100 mg/kg b.wt.)
p.o 1 h before oral administration of Isoniazid (27
mg/kg b.wt.) + Rifampicin (54 mg/kg b.wt.) +
Pyrazinamide (135 mg /kg b.wt.) for 50 days.
Materials and Methods
65
Group 5 :rats administered with both Hesperidin (200 mg/kg
b.wt.) and Ascorbic acid (100 mg/kg b.wt.) p.o 1 h
before oral administration of Isoniazid (27 mg/kg
b.wt.) + Rifampicin (54 mg/kg b.wt.) + Pyrazinamide
(135 mg/kg b.wt.) for 50 days.
Group 6 :rats administered with Silymarin (100 mg/kg b.wt.)
p.o 1 h before oral administration of Isoniazid (27 mg/
kg b.wt.)+ Rifampicin (54mg/kg b.wt.) + Pyrazinamide
(135 mg/kg b.wt.) for 50 days.
At the end of the experimental period (50 days) all the animals
were fasted overnight and sequentially anesthetized with inhaled diethyl
ether anesthesia for about 30–40s. The 2ml of the blood was collected
through retro orbital vein and serum was separated for biochemical
analysis. After that the animals were sacrificed by cervical dislocation.
For biochemical analysis, liver tissues were quickly removed and
homogenized with appropriate buffer and centrifuged at 4°C and the
supernatant was used in the assay of antioxidants, ATP ase and lipid
peroxidation. For western blot studies and RT PCR studies liver was
dissected, immediately stored on RNA later (sigma), and stored at
−80ºC. A small section of the liver lobe were collected in 10% formalin
and stored for histopathology.
Materials and Methods
66
5.6.1. Biochemical Investigations
5.6.1.1. Estimation of Serum Biochemical markers
The serum level Total protein, Albumin, Bilirubin, Urea and
Creatine were estimated by using kit obtained from Transasia Bio
Medicals, Bengaluru).
5.6.1.2. Estimation of Liver marker enzymes in serum
The serum level of Aspartate aminotransferase (AST), Alanine
aminotransferase (ALT), Lactate dehydrogenase (LDH), Acid
phosphatase (ACP), Alkaline phosphatise (ALP), Gamma
glutamyltransferase (γGT) were estimated by using KIT from- Transasia
Bio Medicals, Bengaluru).
5.6.1.3. Estimation of lipid profile
The serum level of high density lipoprotein (HDL), Low density
lipoprotein (LDL), Very low density lipoprotein (VLDL), Free Fatty Acids
(FFA),Phospholipids, Total cholesterol (TC), Triglycerides (TG) were
estimated by KIT- from Nicholas India Pvt. Ltd.
5.6.2. Estimation of protein
Protein content was determined by the method of Lowry, et al.,
(1951).
Materials and Methods
67
Principle
Proteins react with folin-ciocalteau reagent to give a coloured
complex. The colour so formed was due to the reaction of alkaline
copper with protein and the reduction of phosphomolybdate by tyrosine
and tryptophan present in the protein. The intensity of the colour
depends on the amount of these aromatic amino acids present.
Reagents
1. Alkaline copper reagent
i. Solution A : 2% sodium carbonate in 0.1N NaOH
ii. Solution B: 0.5% copper sulphate
iii.SolutionC: 1% sodium potassium tartarate 50mL solution A was
mixed with 0.5mL solution B and 1.0mL solution C just before use.
2. Folin's phenol reagent: This commercial Folin's phenol reagent was
diluted with double distilled water (1:2) just before use.
3. Standard bovine serum albumin (BSA): In a standard flask a stock
solution was prepared by dissolving 100mg of BSA in 100mL water.
10mL of the stock was diluted to 100mL, to obtain a working standard
concentration 100μg/mL.
Materials and Methods
68
Procedure
0.1mL of tissue homogenate was made up to 1.0 mL with saline,
then 1.0mL of 10% TCA was added. The mixture was centrifuged, the
supernatant was discarded and the precipitate was dissolved in 1.0mL
of 0.1 N NaOH. From this aliquots were taken for the estimation. 4.5mL
of alkaline copper reagent was added to all the tubes and the contents
were allowed to stand at 37°C for 10 minutes. Then 0.5mL diluted folin's
phenol reagent was added and mixed well. The colour intensity was
measured in a spectrophotometer at 660nm. A series of standards with
a concentration range of 20-100μg and a blank were processed in a
similar manner. The values are expressed as mg/g tissue in the liver.
5.6.3. Estimation of oxidative stress markers
5.6.3.1. Estimation of tissue thiobarbituric acid reactive
substances (TBARS)
The extent of lipid peroxidation (LPO) in tissues was estimated by
measuring TBARS by the method of Ohkawa, et al., (1979).
Principle
Thiobarbituric acid reactive substances (TBARS) were measured
by their reactivity with thiobarbituric acid (TBA) in acidic conditions to
generate a pink coloured chromophore, the absorbance of which was
read in a spectronic 20 colorimeter at 535nm.
Materials and Methods
69
Reagents
1. 5% TCA
2. 0.25N HCl
3. TBA: 0.375% in hot distilled water
4. TCA-TBA-HCl reagent: Solutions 1, 2 and 3 were mixed
freshly in the ratio of 1: 1:1.
5. Stock standard: 0.16mL of 3.0 M solution of 1, 1', 3, 3'
tetraethoxy propane was made up to 100mL with double
distilled water.
6. Working standard: 50 nmol/m in distilled water
Procedure
The tissue homogenate was prepared using the Tris- HCL buffer
0.025M, at pH 7.8. The 1.0mL of the tissue homogenate was mixed with
2.0mL of TCA-TBA-HCl reagent. This mixture was kept in the boiling
water bath for about 15 minutes and then cooled. After that the tubes
were centrifuged at 1000 x g for 10 minutes. The colour developed in
the supernatant was measured in a spectronic 20 colorimeter at 535nm
against a blank. A series of standard solutions in the concentration
range of 2.5 – 10 nmoles were treated in a similar manner. The values
are expressed as nmoles/mg protein.
Materials and Methods
70
5.6.3.2. Estimation of lipid hydroperoxides
Lipid hydroperoxides were determined by the method of Jiang et
al., (1992).
Principle
Oxidation of ferrous iron (Fe2+) under acidic medium in the presence of
xylenol orange which leads to the formation of a chromophore with an
absorbance maximum at 560nm.
Reagents
1. Fox reagent: 88mg butylated hydroxy toluene (BHT), 76mg
xylenol orange and 9.8mg ammonium iron (II) sulphate were
added to 90mL methanol and 10mL of 250mM H2SO4.
Procedure
0.9mL of Fox reagent was mixed with 0.1mL of the sample and
incubated for 30 minutes at room temperature. The absorbance was
read in a spectronic 20 colorimeter at 560 nm. The amount of
hydroperoxides produced was calculated by using the molar extinction
co-efficient of 4.6 x 104 M-1cm-1. The values are expressed as moles
/mg tissue.
5.6.3.3. Estimation of conjugated dienes (CD)
Conjugated dienes were assayed by the method of Recknagel,
(1984).
Materials and Methods
71
Principle
Lipid peroxidation is associated with rearrangement of the double
bonds in the poly unsaturated fatty acids this will results in the formation
of conjugated dienes, which absorb at 233nm. The conjugated dienes
will reflect the extent of lipid peroxidation taking place.
Reagents
1. Chloroform
2. Methanol
3. Cyclohexane
Procedure
To 1.0mL of tissue homogenate, 5.0mL chloroform-methanol
reagent (2:1v/v) was added, mixed thoroughly and centrifuged for 5
minutes. To this, 1.5mL of cyclohexane was added. The absorbance
was read at 233nm against a cyclohexane blank. The total amount of
conjugated dienes formed was calculated by using a molar extinction
coefficient (2.52 x 104cm-1). The conjugated dienes concentration was
expressed as moles/mg protein.
Materials and Methods
72
5.6.4. Estimation of enzymatic antioxidants
5.6.4. 1. Estimation of Superoxide dismutase (EC 1. 15. 1. 1)
Superoxide dismutase was estimated by the method of Kakkar et
al. (1984).
Principle
The assay was based on the inhibition of the formation of
NADH-phenazine methosulphate-nitroblue tetrazolium formazan. The
reaction was initiated by adding NADH and incubated for 90 seconds.
The glacial acetic acid was added to arrest the reaction. The colour
which was developed at the end of the reaction was extracted into the
n-butanol and the absorbance was measured in a colorimeter at 520nm.
Reagents
1. Sodium pyrophosphate buffer: 0.052M, pH 8.3.
2. Absolute ethanol
3. Chloroform
4. n-butanol
5. Phenazine methosulphate (PMS): 186M
6. Nitroblue tetrazolium (NBT): 300M
7. Reduced nicotinamide adenine dinucleotide (NADH): 780M
8. Glacial acetic acid
Materials and Methods
73
Procedure
Tissue was homogenised by using sodium pyrophosphate buffer
(0.025 M, pH). 0.5mL of the tissue homogenate was diluted to 10mL
with water, followed by the addition of 2.5mL of ethanol and 1.5mL
chloroform (chilled reagents were added). This mixture was shaken for
90 seconds at 4°C and then centrifuged. The enzyme activity in the
supernatant was determined as follows. The assay mixture contained
1.2mL of sodium pyrophosphate buffer, 0.1mL of PMS and 0.3mL of
NBT and appropriately diluted enzyme preparation in a total volume of
3.0mL. The reaction was started by adding 0.2mL NADH. After that it
was incubated under 30C for 90 seconds. Then the reaction was
stopped by the addition of 1.0mL glacial acetic acid. The reaction
mixture was stirred vigorously and shaken with 4.0mL n-butanol. The
contents were left aside for 10 minutes. The contents were centrifuged
and the n- butanol layer. The colour intensity of the chromogen in n-
butanol layer was measured in a spectronic 20 colorimeter at 560nm. A
system devoid of enzyme served as control. The enzyme concentration
required to inhibit the chromogen produced by 50% in one minute under
standard conditions was taken as one unit. The specific activity is
expressed as units/min/mg protein.
Materials and Methods
74
5.6.4. 2. Estimation of Catalase (EC 1. 11. 1. 6)
The activity of catalase was determined by the method of Sinha,
(1972).
Principle
Dichromate in acetic acid was heated in the presence of H2O2
was converted into perchromic acid and then to chromic acetate. The
chromic acetate formed was measured at 620 nm. The enzyme
catalase was allowed to split H2O2 for various periods of time. The
reaction was stopped at different time intervals by the addition of
dichromate-acetic acid mixture and the remaining H2O2 as chromic
acetate was measured using a spectrophotometer at 620nm.
Reagents
1. Phosphate buffer: 0.01M, pH 7.0
2. Hydrogen peroxide: 0.2M
3. Potassium dichromate: 5%
4. Dichromate-acetic acid reagent: 1:3 ratios of potassium
dichromate and glacial acetic acid.
5. Standard hydrogen peroxide: 0.1mL/100mL in distilled water.
Materials and Methods
75
Procedure
Tissue homogenate was prepared by using phosphate buffer
(0.01 M, pH 7.0). 0.9mL phosphate buffer was mixed with 0.1mL of
tissue homogenate and 0.4 mL H2O2. The reaction was arrested after
15, 30, 45 and 60 seconds by adding 2.0mL of dichromate-acetic acid
reagent. The tubes were kept in the boiling water bath for 10 minutes
and cooled. The absorbance of the colour developed was read in a
spectronic colorimeter at 620nm. Standards in the concentration range
of 20-100 moles were processed as for the test. The specific activity of
catalase is expressed as moles of H2O2 utilized/min/mg protein.
5.6.4.3. Estimation of glutathione peroxidase (EC. 1. 11. 1. 9)
Glutathione peroxidase (GPx) was determined by the method of
Rotruck et al., (1973).
Principle
A known amount of enzyme preparation was allowed to react with
H2O2 in the presence of GSH for a specified time period. The amount of
GSH was utilized measured calorimetrically.
2 GSH + H2O2 GPx GSSG + 2 H2O
Reagents
1. Tris-HCl buffer: 0.4 M, pH 7.0
Materials and Methods
76
2. Sodium azide solution: 10mM
3. TCA: 10%
4. EDTA: 0.4mM
5. 0.4mM H2O2 solution
6. Glutathione (GSH): 2.0mM
Procedure
0.2mL Tris buffer (0.4M pH 7), 0.2mL EDTA, 0.1mL sodium azide
and 0.5mL haemolysate and the tissue homogenate were mixed
together. To this mixture, 0.2 ml of GSH followed by 0.1 ml H2O2 was
added. These contents were mixed will and incubated at 37C for 10
minutes along with a control containing all reagents except the
homogenate. After 10 minutes the reactions was arrested by the
addition of 0.5 ml of 10% of TCA. The contents were centrifuged and
the supernatant was assayed for GSH by the method of Ellman. The
activities are expressed as moles of GSH utilized/min/mg protein.
5.6.4.4. Estimation of glutathione reductase (EC. 1. 6. 4. 2)
Glutathione reductase activity was assayed measured by the
method of Carlberg and Mannervik, (1985).
Materials and Methods
77
Principle
The enzyme activity was determined by measuring the GSH
formed when the oxidised glutathione (GSSG) is reduced by reduced
nicotinamide adenine dinucleotide phosphate (NADPH).
Reagents
1. Phosphate buffer: 0.1M pH 7.4
2. Sodium bicarbonate solution: 0.1M
3. GSSG: 250M
4. FAD: 250 mM
5. NADPH: 4mM
6. EDTA: 80mM
Procedure
2.0mL phosphate buffer, 0.1mL enzyme sample (plasma or tissue
homogenate), 0.1mL FAD and 0.5mL EDTA solution were taken in a
test tube. A blank was set up using all the reagents except FAD+. The
tubers were incubated for 15 minutes at 37°C, followed by the addition
of 0.1mL of NADPH solution to each tube. The reaction was
continuously monitored for 5 minutes at 340 nm and the change in the
Materials and Methods
78
linear absorbance was measured. The values are expressed in moles
of NADPH oxidised/min/mg Hb or protein.
5.6.4.5. Estimation of glutathione-S-transferase (EC. 2. 5. 1. 18)
The activity of (GST) glutathione-S-transferase was assayed by
the method of Habig et al., (1974).
Principle
GST activity was assayed by following the increase in
absorbance at 340nm using 1 - chloro, 2, 4 dinitrobenzene (CDNB) as
the substrate.
2GSH H2O2 Non-Se-GPx GSSG 2H2O
Reagents
1. Phosphate buffer: 0.3M, pH 6.5
2. GSH: 30mM
3. 30mM CDNB in 95% ethanol
Procedure
1.0mL phosphate buffer, 0.1mL CDNB and 0.1mL of tissue
homogenate were added in a test tube. The volumes were adjusted to
2.9mL by adding water. The reaction mixture was preincubated for 5
minutes at 37°C for 5 minutes and the reaction started by adding 0.1mL
Materials and Methods
79
of 30mM glutathione. The absorbance was followed for 5 minutes at
540 nm. A system without the enzyme served as the blank. The specific
activity of GST is expressed as moles of CDNB-GSH conjugate
formed/min/mg protein that was calculated using the formula
mginproteinx5x9.6
1000x3xO.D
9.6 is the difference in the molar extinction co-efficient between CDNB-
GSH conjugate and CDNB.
5.6.5. Estimation of non enzymatic antioxidants
5.6.5.1. Estimation of reduced glutathione (GSH)
Reduced glutathione was assayed by the method of Ellman, (1959).
Principle
This method was based on the development of yellow colour
when dithio-nitrobenzoic acid (DTNB) is added to compounds
containing sulphydryl groups.
Reagents
1. Phosphate buffer: 0.1M, pH 8.0
2. TCA: 5%
Materials and Methods
80
3. Ellman’s reagent: 34mg of DTNB was dissolved in 10mL of
0.1% sodium citrate.
4. 0.3M Disodium hydrogen phosphate
5. Stock standard glutathione: 1000g/mL in distilled water
6. Working standard: 100g/mL in distilled water.
Procedure
0.5 mL of tissue homogenized in phosphate buffer (0.1M, pH 7.0),
2.0mL of 5 % TCA was added to precipitate the proteins. After
centrifugation, to 1.0ml of supernatant, 3.0mL of 0.2 M phosphate buffer
and 0.5mL of Ellman’s reagents were added. The yellow colour
developed was read in a colorimeter at 412nm. A serious of standards
(20-100g) were treated in a same manner along with a blank
containing 1.0mL buffer. The amount of glutathione was expressed as
mg/g tissue.
5.6.5.2. Estimation of Vitamin-C
Vitamin C was estimated by the method of Omaye et al.,
(1979).
Reagents
1. Trichloroacetic acid (TCA): 5%
Materials and Methods
81
2. Sulphuric acid (H2SO4): 65%
3. DNPH- Thiourea-CuSO4 (DTC) reagent: 3 gm of DNPH,
0.4 gm of thiourea and 0.05 gm of CuSO4 were dissolved
in 9N H2SO4 and made up to 100 ml with the same.
4. Standard: Standards of ascorbic acid were made in 5%
TCA in the range of 1 to 20 μg/ml
Procedure
Aliquots of the sample was precipitated with 5% ice cold TCA
and centrifuged for 20 min at 3500 rpm. The 1 ml of the supernatant
was mixed with 0.2 ml of DTC was added and incubated at was added
and incubated at 37ºC for 3 h. Then to 1.5 ml of ice cold 65% of H2SO4
was added and mixed well. The solutions were allowed to stand at room
temperature for an additional 30 min. Absorbance was determined at
520 nm. The amount of Vitamin-C was expressed as mg/gm of wet
tissue.
5.6.5.3. Estimation of Vitamin-E
Vitamin-E was determined by the method of Desai (1984).
Reagents
1. Absolute ethanol
2. Hexane
Materials and Methods
82
3. Bathophenthroline reagent: 0.2% solution of 4,7-diphenyl-
1-10-pheneanthroline in purified absolute ethanol.
4. Ferric chloride reagent: 0.001 M ferric chloride solution in
purified absolute ethanol. This reagent was prepared
fresh and was kept in amber colored bottle.
5. Orthophosphoric acid reagent: 0.001 M orthophosphoric
acid solution in purified absolute ethanol.
6. Vitamin E standard: -tocopherol standards in the range
1-10μg/ml of purified absolute ethanol were prepared and
treated in the same manner as test samples.
Procedure
To 1 ml of sample, l ml of ethanol was added and thoroughly
mixed. Then 3m1 of hexane was added, shaken rapidly and
centrifuged. 2m1 of supernatant was taken and evaporated to dryness.
To this 0.2 ml of bathophenanthroline was added. The assay mixture
was protected from light and 0.2ml of ferric chloride was added followed
by 0.2m1 of 0-phosphoric acid. To the total volume was made up to
3m1 with ethanol. Standard α-tocopherol acetate was also treated
similarly. The absorbance was read at 530 nm. The amount of Vitamin
E was expressed as mg/dL for serum and mg/gm of wet tissue.
Materials and Methods
83
5.6.6. Estimation of membrane bound ATP ase enzyme
5.6.6.1. Estimation of Na+ K+ ATPase (E.C 3.6.1.3)
Na+ K+ ATPase was assayed according to the method of
Bonting, (1970).
Reagents
1. Tris-HCl buffer (184 mM, pH 7.5): Tris (2.23 gm) was
dissolved in 100 ml of deionised water and pH was
adjusted to 7.5 with 1N HCl.
2. Magnesium sulphate (50 mM): MgSO4 (369.9 mg) was
dissolved in 25 ml of deionised water.
3. Potassium chloride (50 mM): KCl (93.2 mg) was dissolved
in 25 ml of the deionised water.
4. Sodium chloride (600 mM): NaCl (876.6 mg) was
dissolved in the 25 ml of deionised water.
5. EDTA (1 mM): EDTA (3.72 mg) was dissolved in 10 ml of
deionised water.
6. ATP (40 mM): ATP (44.56mg) was dissolved in 2.0 ml of
deionised water.
Materials and Methods
84
7. Sodium bisulphate (15%): Anhydrous sodium bisulphate
(15gm) was dissolved and made upto 100m1 with
distilled water.
8. Sodium sulphite (20%): Sodium sulphite (20gm) was
dissolved and made upto 100m1 with distilled water.
9. 1-amino 2-napthol 4-sulphonic acid (ANSA): ANSA
(500mg) was dissolved in a solution containing 195 ml of
15% sodium bisulphate and 5 ml of 20% sodium sulphite
and stored in a brown bottle.
Procedure
The incubation mixture contained 1.0 ml of buffer, 0.2 ml each
of magnesium sulphate, EDTA, ATP, potassium chloride, sodium
chloride and the test samples. The mixture was incubated for 15 min at
37°C. The reaction was arrested by adding 1.0 ml of TCA and mixed
well. The mixture was then centrifuged and the supernatant was used
for the estimation of inorganic phosphate by the method of Fiske and
Subbarow, (1925). The control without the enzyme was also incubated
after arresting with TCA, after that the enzyme was added. The enzyme
activity was expressed as µ moles of inorganic phosphate liberated/mg
protein/min.
Materials and Methods
85
5.6.6.2. Estimation of Ca2+ ATPase (E.C 3.6.1.3)
Ca2+- ATPase was estimated as described by the method of
Hjerten and Pan (1983).
Reagents
1. Tris-HCl buffer (125 mM, pH 8.0): Tris (1.514 gm) was
dissolved in 100 ml of deionised water and the pH 8.0
was adjusted with 1N HCl.
2. Calcium chloride (50 mM): calcium chloride (273.6 mg)
was dissolved in 25 ml of deionised water.
3. ATP (10 mM): ATP (33 mg) was dissolved in 6.0 ml of
deionised water.
4. Sodium bisulphate (15%): Anhydrous sodium bisulphate
(15gm) was dissolved in distilled water and made upto
100ml.
5. Sodium sulphite (20%): sodium sulphite (20gm) was
dissolved in distilled water and made up to 100ml.
6. 1-amino 2-napthol 4-sulphonic acid (ANSA): ANSA
(500mg) was dissolved in a solution containing 5 ml of
20% sodium sulphite and 195 ml of 15% sodium
bisulphate and stored in brown bottle.
Materials and Methods
86
Procedure
The mixture contained 0.1 ml of each buffer, calcium chloride,
ATP and test samples were incubated at 37°C for 15 min. The reaction
was arrested by adding 1.0 ml 10% TCA. The color developed was
read at 620nm after 20 min against the blank using a
spectrophotometer. The amount of inorganic phosphate liberated was
estimated by the method of Fiske and Subbarow, (1925). The enzyme
activity was expressed as µ moles of inorganic phosphate liberated/mg
protein/min.
5.6.6.3. Estimation of Mg2+- ATPase (E.C 3.6.1.3)
Mg2+- ATPase was estimated by the method of Ohnishi et al..
(1962).
Reagents
1. Tris-HCl buffer (374 mM, pH 7.6): Tris (4.536 gm) was
dissolved in the 100 ml of deionised water and the pH 7.6
was adjusted with 1N HCl.
2. Magnesium chloride (50 mM): MgCl2 (50.8 mg) was
dissolved in 5.0 ml of deionised water.
3. ATP (10 mM): ATP (33mg) was dissolved in 6.0 ml of
deionised water.
Materials and Methods
87
4. Sodium bisulphate (15%): 15gm of anhydrous sodium
bisulphate was dissolved in distilled water and made upto
100ml.
5. Sodium sulphite (20%): sodium sulphite (20gm) was
dissolved with distilled water and made up to 100ml.
6. 1-amino 2-napthol 4-sulphonic acid (ANSA): ANSA
(500mg) was dissolved in a solution containing 5 ml of
20% sodium sulphite and 195 ml of 15% sodium
bisulphate and stored in brown bottle.
Procedure
The mixture containing 0.1 ml of each buffer, magnesium
chloride, ATP and test samples were incubated for 15 min at 37°C. The
reaction was arrested by the addition of 1.0 ml 10% TCA and it was
centrifuged. The color developed was read at 620nm after 20 min
against the blank using a spectrophotometer. The liberated inorganic
phosphate was estimated by the method of Fiske and Subbarow,
(1925). The enzyme activity was expressed as µ moles of inorganic
phosphate liberated/mg protein/min.
5.6. 7. Histopathological Examination
The portion of the liver was cut into small slices and fixed in 10%
formalin until processing. Formalin fixed tissues were dehydrated
Materials and Methods
88
through 70%, 90%, and 100% alcohol and embedded in low-melting-
point paraffin. Sections of 5 μm thick were made using rotary microtome
Hematoxylin and Eosin Staining
After paraffin embedding and routine sectioning, sections were
loaded on slides. The slide were deparaffinize through three changes of
xylene, incubating slides for 10 min in each change.
Hydrate slides to water by dipping them 20-40 times in each of
three changes of 100% ethanol, two changes of 95% ethanol, one of
70% ethanol. Rinse with 2-3 changes of tap water, 30-50 dips each.
Stain with Hematoxylin for 5 minutes. Rinse with 3-4 changes of tap
water. Stain in Eosin for 10 minutes. Dehydrate through 2 changes of
95% ethanol (15 dips each) followed by 3 changes of 100% ethanol (30-
50 dips each). Clear through three changes of Xylene, 30-50 dips each.
Blotting was done after each steps Mount by cover slip with D.P.X.
slides examined under microscopes.
5.6.8. Western blotting analysis
Liver tissue sample were subjected to lyse in the sample buffer
and the protein concentration of lysates was determined. The Bradford
protein estimation kit was used to determine the concentrate of the
protein in the lysate. From the each sample equal amount (40 µg) of
liver tissue proteins are subjected to 12% SDS–PAGE gels. Then it is
Materials and Methods
89
transferred onto PVDF membranes. Then membranes were then
probed with the respective primary antibodies (rabbit polyclonal
antibody) against Bax, Bcl2, Caspase-3, Caspase 9, IL-10, TNF –α and
NF-κB) overnight at 4oC. After that wash the each membrane and then
incubated with horseradish peroxidase (HRP)-labeled anti-rabbit
secondary antibodies for 1 h at room temperature. The protein bands
were visualized by Enchanced chemiluminescent HRP substrate (ECL)
kit (Amersham Bioscience) according to the manufacturer’s
instructions.The expression levels were quantified using the image J
analysis (version 1.43, NIH, USA) for Windows. Blots were reported
with β- actin antibody as a loading control.
5.6.9. Reverse Transcription PCR
The total RNA was isolated from the liver tissue using Trizol
reagent, according to the manufacturer’s recommendations (Invitrogen
Life Technologies, Carlsbad, CA, USA). By using SuperScript First-
Strand Synthesis System for RT-PCR (Invitrogen), 0.1 µg of the total
RNA was reverse transcribed as per the manufacturer’s
recommendations. By using the first-strand cDNA as a template, the
PCR was carried out using the gene specific upstream & downstream
primers (Table 2) for Bcl-2, Bax, Caspase-3, Caspase-9, TNF-α, NFκB,
IL-10 and β-actin (reference gene), were subjected to 35 cycles of PCR
amplification with 30s denaturation at 94 ◦C, then followed by 30s
annealing temperature at 55◦C and 2 min extension at 72 ◦C. The PCR
Materials and Methods
90
products were resolved by agarose gel electrophoresis (Biorad) on
1.5% agarose and visualized by ethidium bromide. β- Actin was used as
an internal loading control. The intensity of the individual bands was
semi-quantitatively assessed using NIH Image.
5.6.10. DNA Fragmentation
DNA fragmentation is a distinctive feature of apoptosis at the
biochemical level. It is a semi quantitative method used for measuring
the apoptosis. The liver tissue was homogenised and centrifuged at
3000 × g for 5 min and the cell pellet was collected. The Pellets were
lysed with a hypotonic lysis buffer (10 mM of Tris-HCl at pH 8.0)
containing EDTA (10 mM) and Triton X-100 (0.5%) and then pooled
with pellets made of detached cells. RNA was digested using RNase
(0.1 mg/ml at 37 °C for 1 hour) followed by proteinase K treatment for 2
hour at 50 °C. After that DNA was extracted with a mixture of phenol,
chloroform, and isoamyl alcohol (25:24:1). Then the DNA was
precipitated by the addition of an equal volume of isopropyl alcohol and
stored overnight at 20 °C and centrifuged at 12,000 × g for 15 min at 4
°C. The pellet was air-dried, resuspended in 20 μl Tris acetate EDTA
buffer supplemented with 2 μl of sample buffer (0.25% bromphenol
blue, 30% glyceric acid). Then it was electrophoretically separated on a
2% agarose gel containing 1 μg/ml ethidium bromide and visualized
under ultraviolet transillumination.
Materials and Methods
91
Table 2: Primers used in RT-PCR analysis.
S.No Genes Forward primer Reverse primer
1 Caspase-3 TCCTAGCGGATGGGTGCTAT TCACGGCCTGGGATTTCAAG
2 Caspase-9 TGTTCAGGCCCCATATGATCG GGACTCACGGCAGAAGTTCA
3 Bcl-2 GAACTGGGGGAGGATTGTGG GGCAGGCATGTTGACTTCAC
4 Bax CCCTTTTGCTTCAGGGTTTCAT ACAGGGACATCAGTCGCTTC
5 NF-kB ACTTCTCCTGAAAGCCGGTG AGGAAGAGGTTTGGATGCCG
6 IL-10 TACGGCGCTGTCATCGATTT AAGGTTTCTCAAGGGGCTGG
7 TNF-α CTGGGCAGGTCTACTTTGGG CTGGAGGCCCCAGTTTGAAT
8 β- Actin GAGCACAGAGCCTCGCCTTT AGAGGCGTACAGGGATAGCA
Materials and Methods
92
5.7. Statistical analysis
Statistical analysis was done using SPSS v 16.0. All results were expressed
as mean± SD. The results were statistically analyzed using one way ANOVA
by Tukey HSD Post hoc multiple range test and differences below P<0.05 are
considered as significant.
Results
93
6. RESULTS
6.1. Effect of Hesperidin and Ascorbic acid against Ethanol
induced hepatotoxicity in rats.
6.1.1 Effect of Hesperidin and Ascorbic acid on serum biochemical
markers in Ethanol induced hepatotoxic rats.
Table 3 shows the effects of Hesperidin (HDN) and Ascorbic acid
(AA) on the activities of serum Albumin, Total protein (TP) and Bilirubin
in the control and experimental rats. In Ethanol intoxicated group the
level of Bilirubin was significantly increased (p<0.001), where as the
level of total protein and albumin were found to be significantly
(p<0.001) decreased when compared to the control group.
This elevated activities of the assayed bilirubin concentration
induced by Ethanol was significantly (p<0.001) diminished following
treatment with either HDN or AA or combination of both HDN and AA.
On the otherhand Ethanol induced reduction in the total protein
concentration was significantly enhanced after treatment with either
HDN (p< 0.001) or AA (p< 0.01) or combination of both HDN and AA
(p<0.001). Similarly the level of serum albumin was significantly
increased in the group supplemented with either HDN (p<0.05) or AA
(p>0.05) when compared to the ethanol treated group.
Results
94
Table 3: Effect of Hesperidin and Ascorbic acid on serum Total protein, Albumin and Bilirubin in
Ethanol induced hepatotoxic rats.
Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post
hoc multiple range test. The significant changes are calculated as * p<0.05, ** p<0.01,
*** p<0.001 compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to Ethanol group.
ns – non significant results.
SERUM CONTROL ETHANOL(EtOH) EtOH +HDN EtOH +AA EtOH +HDN+AA EtOH +SLY
TP(g/dl) 6.33±0.33 3.66±0.29*** 5.52 ±0.47 c 4.85±0.15 b 6.22±0.30 c 6.24 ±0.30 c
Albumin(g/dl) 37.95±2.36 19.30±0.77*** 26.59 ±2.27 a 24.96 ±3.06 ns 36.05 ±2.31 c 33.94 ±2.94 c
Bilirubin(mg/dl) 0.43±0.13 3.75±0.10*** 1.41 ±0.16 c 1.27 ±0.27 c 0.48 ±0.10 c 0.45 ±0.08 c
Results
95
However the effects were significantly (p< 0.001) more pronounced in
the rats those co treated with the combination of both Hesperidin and
Ascorbic acid when compared to the individual treatment. Standard
drug Silymarin (SLY) significantly (p<0.001) reversed all the biochemical
changes induced by Ethanol to the normal level. There was no
significant difference noted between Ethanol+HDN+AA treated group
and Silymarin treated group.
6.1.2: Effect of Hesperidin and Ascorbic acid on liver marker
enzymes in the serum of ethanol induced hepatotoxic rats.
The effects of HDN and AA on the serum level of AST, ALT, ALP
and LDH were shown in the Table 4. Ethanol induced liver injury is
evidenced by significant (p<0.001) elevation in the levels of liver marker
enzyme (AST, ALT, ALP and LDH) when compared to control group.
In contrast, co treatment with either HDN or AA significantly
(p<0.001) reduced the level of liver marker enzymes compared to the
ethanol group. Moreover, the elevated activities of the assayed serum
marker enzymes induced by Ethanol were significantly (p<0.001)
attenuated following treatment with the combination of both HDN and
AA. However, concurrent treatment with the combination of both HDN
+AA shows better results when compared to the individual treatment
with either HDN or AA. Standard drug silymarin significantly (p<0.001)
reversed the changes induced by ethanol.
Results
96
Table 4: Effect of Hesperidin and Ascorbic acid on liver marker enzymes in serum of
Ethanol induced hepatotoxic rats.
The results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post hoc
multiple range test. The Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared
to control group; a p<0.05, b p<0.01, c p<0.001 compared to Ethanol group. ns – non significant results.
SERUM CONTROL ETHANOL (EtOH) EtOH +HDN EtOH +AA EtOH +HDN+AA EtOH +SLY
AST (IU/L) 17.50±1.10 64.31±3.72*** 28.31 ±2.78 c 30.00 ±2.83 c 22.10 ±2.83 c 26.34 ±0.87 c
ALT(IU/L) 45.31±2.58 105.81±5.27*** 64.55 ±5.73 c 76.41±2.80 c 56.81 ±1.40 c 60.72 ±1.64 c
ALP(IU/L) 188.50±5.36 284.19±4.56*** 214.64 ±5.0 c 218.93±1.91 c 196.99 ±6.94 c 191.15 ±1.66 c
LDH (IU/L) 3.08±0.17 10.26±1.13*** 4.55 ±0.67 c 5.05 ±0.71 c 3.45 ±0.65 c 3.97 ±0.21 c
Results
97
6.1.3. Effect of Hesperidin and Ascorbic acid on serum lipid profile
in Ethanol induced hepatotoxic rats.
Fig 11 shows the effects of Hesperidin and Ascorbic acid on the
serum level of total cholesterol (TC) and triglycerides (TG) in the control
and experimental rats. Ethanol administration significantly enhanced the
level of serum total cholesterol (p<0.001) and triglycerides (p<0.001)
when compared to control group.
On the otherhand, concurrent treatment with either HDN or AA
significantly (p<0.001) reduced the serum level of total cholesterol &
triglycerides when compared to ethanol treated group.
Moreover the combination therapy with HDN and AA shows
better result (p<0.001) when compared to individual therapy with either
HDN or AA alone. The standard drug silymarin also significantly
(p<0.001) reversed the lipid changes induced by Ethanol.
Results
98
Fig 11: Effect of Hesperidin and Ascorbic acid on serum lipid profile in Ethanol
induced hepatotoxic rats.
Fig 12: Effect of Hesperidin and Ascorbic acid on Lipid peroxidation in liver of
ethanol induced hepatotoxic rats.
Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by
Tukey HSD Post hoc multiple range test. Significant changes are calculated as
* p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01,
c p<0.001 compared to Ethanol group. ns – non significant results.
Results
99
6.1.4. Effect of Hesperidin and Ascorbic acid against Ethanol
induced oxidative stress in rat liver.
The effects of Hesperidin and Ascorbic acid on the activities of
Lipid peroxidation (TBARS) in liver was depicted in fig 12. The lipid
peroxidation study revealed that the level of TBARS was significantly
increased (p<0.001) in ethanol intoxicated group, when compared to
that of control group.
Alternatively, co treatment with either HDN or AA significantly
(P<0.001) reduced the level of TBARS when compared to ethanol
group. Similarly, co treatment with the combination of both HDN and AA
effectively (P<0.001) ameliorate the lipid peroxidative damage induced
by ethanol by reducing level of TBARS in liver. Furthermore, treatment
with silymarin significantly (P<0.001) reduced the TBARS level when
compared to the ethanol intoxicated group.
6.1.5 Effect of Hesperidin and Ascorbic acid on antioxidant
enzymes in the liver of Ethanol intoxicated rats.
Table 5 shows the effects of Hesperidin and Ascorbic acid on the
enzymatic and non enzymatic antioxidant enzymes in the liver of
ethanol induced hepatotoxic rats. Administration of ethanol significantly
(p<0.001) reduced the level of enzymatic and non enzymatic
antioxidants such as SOD, CAT, GSH, VIT C and VIT E when
compared to control rats.
Results
100
Conversely, the animals supplemented with HDN markedly
increased the level of SOD (p<0.001), CAT (p<0.001), GSH (p<0.001),
VIT E (p<0.001) and VIT C (p<0.01) when compared to the ethanol
administered group. Similarly in the AA supplemented group the level of
antioxidant enzymes like SOD (p<0.01), CAT (p<0.001), GSH
(p<0.001), VIT E (p<0.001) and VIT C (p<0.001) were found to be
moderately enhanced when compared to the ethanol group.
However, the combination of HDN and AA effectively (p<0.001)
restored the antioxidant enzymes to their normal levels when compared
to the individual treatment with either HDN / AA and protect the liver
from the oxidative damage. Standard drug Silymarin (p<0.001)
significantly restored the antioxidant enzyme to their normal levels when
compared to ethanol administered group.
Results
101
Table 5: Effect of Hesperidin and Ascorbic acid on the antioxidant enzymes in the liver of
Ethanol induced hepatotoxic rats.
TISSUE CONTROL ETHANOL(EtOH) EtOH +HDN EtOH +AA EtOH +HDN+AA EtOH +SLY
SOD 18.59±0.77 8.99±0.62*** 14.17±0.21 c 13.38 ±1.02 b 17.68 ±0.67 c 16.97±1.52 c
CAT 55.20±4.16 20.39 ±1.08*** 45.95±1.74 c 43.95 ±1.48 c 50.15 ±0.84 c 51.81±1.47 c
GSH 83.52±2.52 37.91±1.56*** 69.47 ±0.84 c 64.79 ±1.81 c 77.74 ±0.87 c 80.36 ±0.66 c
VIT C 2.31±0.18 1.02 ±0.10*** 1.53b ±0.10 b 2.16 ±0.08 c 2.35 ±0.21 c 2.32 ±0.14 c
VIT E 8.18±0.17 3.24±0.04*** 4.48 ±0.41 c 6.04 ±0.15 c 8.04 ±0.28 c 7.82±0.53 c
SOD- (units/mg protein/min), CAT - (μm of H2O2 consumed /min/ mg protein), GSH (μg /mg protein), VIT
C (mg/g of wet tissue), VIT E (mg/g of wet tissue).
Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post hoc
multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared
to control group; a p<0.05, b p<0.01, c p<0.001 compared to Ethanol group. ns – non significant results.
Results
102
6.1.6. Histopathological analysis:
The Histopathological examinations of the rat liver are
represented in fig (13). The liver of the control rats showed normal
architecture with well-preserved hepatocytes, well demarcated
sinusoids without any signs of inflammatory changes (Fig. 13.1).
This is in contrast to the features observed in the liver of hepatotoxic
rats. There was a drastic alteration in liver architecture ranging from
extensive central vein congestion; distended hepatocytes, sinusoidal
congestion and disruption of lobular architecture were seen in the
Ethanol intoxicated rats (Fig. 13.2).
In contrast, rats treated with either HDN (Fig. 13.3) / AA (Fig.
13.4) showed mild sinusoidal congestion with almost near normal
architecture. In addition, rats supplemented with the combination of both
HDN and AA shows normal liver architecture by attenuating the above
mentioned changes induced by Ethanol and protect the liver from
ethanol induced injury (Fig 13.5). Standard drug silymarin treatment
shows the normal liver architecture (Fig 13.6).
Results
103
Fig 13: Effect of Hesperidin and Ascorbic acid on histopathological
changes induced by ethanol in rat liver (H and E stain, 400X).
Fig 13.1: CONTROL Fig 13.2: ETHANOL
Fig 13.3: ETHANOL +HDN Fig 13.4: ETHANOL+AA
Fig 13.5: ETHANOL+HDN+AA Fig 13.6: ETHANOL+SLY
Results
104
6.2. Effect of Hesperidin and Ascorbic Acid on Antitubercular Drug
Induced Hepatotoxicity
6.2.1: Effect of Hesperidin and Ascorbic acid on serum
biochemical markers in Antitubercular drug (HRZ) induced
hepatotoxic rats.
The level of Total protein (TP), Albumin, Bilirubin, urea and
creatinine were shown in the table 6. The serum level of total protein
(P<0.001) and albumin (P>0.05) were significantly diminished in HRZ
administered rats when compared to the normal control rats. On the
otherhand the serum level of urea, creatinine and bilirubin were
significantly (p<0.001) elevated in HRZ administered group when
compared to control group.
Conversely co treatment with HDN along with HRZ significantly
raised the serum level of TP (p<0.05) and Albumin (p>0.05) and
subsequently decreased the level of bilirubin (p>0.05), urea (p<0.01)
and creatinine (p<0.05) when compared to HRZ administered group.
Similarly, Ascorbic acid (AA) treatment with HRZ moderately enhanced
the level of Total protein (p<0.01) and Albumin (p>0.05) and
subsequently diminished the level of bilirubin (p<0.001), urea (p<0.001)
and creatinine (p<0.01) when compared to HRZ administered group.
However concurrent treatment with the combination of both HDN
and AA significantly (p<0.001) reversed all the above changes induced
Results
105
by HRZ and restored their level to normal. Moreover the effect will be
higher in combined therapy (HDN+AA+HRZ) when compared to the
individual therapy (HRZ+ HDN, HRZ+AA). Standard drug silymarin also
significantly (p<0.001) reversed all the changes induced by HRZ.
Results
106
Table 6: Effect of Hesperidin and Ascorbic acid on serum Total protein, Albumin, Bilirubin, Urea and
Creatinine in antitubercular drug induced hepatotoxic rats.
SERUM CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY
TP g/dl 11.60 ±0.63 5.54±0.37*** 7.27 ±0.58 a 7.82 ±0.66 b 11.25 ±0.44 c 11.49 ±0.82 c
Albumin g/dl 47.47 ±1.62 42.81 ±2.19 ns 43.82 ±0.92 ns 44.65±0.92 ns 47.93±1.57 a 45.86 ±0.64 ns
Bilirubin mg/dl 1.87 ±0.15 4.65±0.61*** 3.61 ±0.26 ns 2.46 ±0.56 c 2.09±0.15 c 2.45 ±0.49c
Urea mg/dl 26.16 ±0.86 53.49±2.16*** 46.81 ±1.40 b 40.46 ±1.68 c 31.23±1.40 c 27.35 ±1.41 c
Creatinine mg/dl 1.42 ±0.12 4.66 ±0.27*** 3.44 ±0.37 a 2.89±0.73 b 2.10 ±0.61 c 1.46 ±0.10 c
Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post
hoc multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001
compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non
significant results.
Results
107
6.2.2. Effect of Hesperidin and Ascorbic acid on liver marker
enzymes in serum of antitubercular drugs (HRZ) intoxicated rats.
Table 7 provides the serum level of liver marker enzymes in the
control and experimental rats. In the present study the serum levels of
liver specific marker enzymes namely ALT (p<0.001), AST (p<0.001),
ALP (p<0.001), ACP (p<0.01), LDH (p<0.001) and ϒ-GT (p<0.001)
were significantly enhanced in HRZ intoxicated rats in comparison with
that of control rats. Conversely, co treatment with HDN significantly
diminished the level of liver marker enzymes namely ALT (p>0.05), AST
(p<0.05), ALP (p>0.05), ACP (p>0.05), LDH (p<0.05) and ϒ-GT
(p<0.01) when compared to the HRZ group.
On the otherhand, co treatment with AA significantly decreased
the level of liver marker enzymes AST (p<0.01), ALT (p<0.01), ALP
(p>0.001), ACP (p>0.01), LDH (p<0.05) and ϒ-GT (p<0.01) when
compared to the HRZ group. Moreover, co treatment with the
combination of both HDN and AA more pronouncedly (p<0.001)
restored the liver marker enzymes almost to the normal range. However
the treatment effect found to be higher in the combined therapy
(HRZ+HDN+AA) when compared to the individual therapy (HRZ+HDN
and HRZ+AA). The combined treatment of HDN+AA+HRZ was shown
significant effect which is almost similar to the effect of standard drug
Silymarin.
Results
108
Table 7: Effect of Hesperidin and Ascorbic acid on liver marker enzymes in serum of the
antitubercular drugs (HRZ) intoxicated rats.
SERUM(IU/L) CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY
AST 7.55 ±0.38 11.62±0.18*** 9.39±0.13b 9.95 ±0.42a 8.26 ±0.76c 8.51±0.81 c
ALT 38.36 ±1.63 46.64±1.15*** 41.86±0.78b 42.58 ±0.49ns 39.40±1.09c 40.57±0.84 c
ALP 202.97 ±12.64 296.8 ±10.2*** 260.02±4.30ns 255.16 ±10.71b 219.09±14.21c 211.84±11.87 c
ACP 51.81 ±4.82 62.77±1.67** 56.21 ±1.40ns 58.02 ±2.36ns 53.00±1.98a 52.76 ±3.25 a
LDH 1.64 ±0.13 4.55±0.48 *** 3.25±0.27a 3.95 ±0.05ns 2.28±0.68 c 2.31±0.37c
γ -GT 3.1 ±0.78 8.79 ±0.89*** 5.89 ±0.53 b 6.21±0.45b 3.76±0.46 c 3.64 ±0.51 c
Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post hoc
multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared
to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.
Results
109
6.2.3. Effect of Hesperidin and Ascorbic acid against antitubercular
drug induced oxidative stress in rat liver.
Antitubercular drug induced peroxidative damage is determined
by measuring the level of oxidative stress markers like TBARS, CDs
and LHP. Our data revealed that administration of antitubercular drugs
(HRZ) drastically (p<0.001) enhanced the level of TBARS, CDs and
LHP in liver when compared to the control group (Fig 14, 15).
In contrast, concurrent treatment with HDN moderately reduced
the level of TBARS (p<0.001), LHP (p<0.01) and CDS (p<0.001) when
compared to the HRZ group. Similarly in AA cotreatment group the level
of TBARS (p<0.01), LHP (p<0.001), CDS (p<0.001) were found to be
significantly diminished when compared to the HRZ administered group.
However, cotreatment with the combination of both HDN and AA
more efficiently (p<0.001) reduced the level of lipid peroxidative markers
to near normalcy as compared with that of individual treatment
(HRZ+HDN, HRZ+AA). In addition, Silymarin co treatment significantly
(p<0.001) reversed the level of TBARS, CDs and LHP to normal
compared to the HRZ intoxicated group.
Results
110
Fig 14: Effect of Hesperidin and Ascorbic acid on oxidative stress
markers (TBARS) in liver of antitubercular drug induced hepatotoxic
rats.
Fig 15: Effect of Hesperidin and Ascorbic acid on liver oxidative stress
markers (LHP and CD) in antitubercular drug induced hepatotoxic rats.
Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by
Tukey HSD Post hoc multiple range test. Significant changes are calculated as
* p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01,
c p<0.001 compared to HRZ group. ns – non significant results.
Results
111
6.2.4. Effect of Hesperidin and Ascorbic acid on enzymatic and non
enzymatic antioxidant in antitubercular drug induced hepatotoxic
rats.
The effects of HDN and AA on the antioxidant status of rat liver
are represented in the table 8 and fig 16. The levels of enzymatic
(SOD, CAT, GST, GPx, GR) and nonenzymatic antioxidants (GSH, VIT
C and VIT E) were drastically reduced (p<0.001) in HRZ group in
comparison to the control groups. However, the HRZ-induced
impairment in these enzyme activities (SOD (p<0.001), CAT (p<0.001),
GST (p>0.05), GSH (p<0.001), GPx (p<0.01), GR (P<0.001), VIT C
(p<0.001) and VIT E (p>0.05)) were significantly enhanced by
concurrent treatment with HDN. Similarly co treatment with AA
significantly enhanced the level of antioxidant enzyme SOD (p<0.01),
CAT (p<0.01), GPx (p<0.01), GR (P<0.001), GST (p<0.001), GSH
(p<0.001), VIT C (p<0.001) and VIT E (p<0.05) when compared to the
HRZ administered group.
Moreover, the combined effect of HDN+AA was more efficiently
(p<0.001) attenuated all the changes induced by antitubercular drugs
and restore the antioxidant levels to their normal level compared to the
HDN or AA alone treatment. Standard drug silymarin also significantly
(P<0.001) increased the level of antioxidant to near normal level.
Results
112
Table 8: The effect of hesperidin and ascorbic acid on enzymatic and non enzymatic antioxidant in
antitubercular drug induced hepatotoxic rats.
TISSUE CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY
SOD 12.38±0.83 3.28±0.27*** 7.28 ±0.92 c 6.43 ±0.36 b 11.11 ±0.91 c 11.41±0.79 c
CAT 66.44±3.27 38.82±1.93*** 54.23 ±3.62 c 52.28 ±1.95 b 62.43 ±3.25 c 62.90 ±1.75 c
GR 7.58±0.46 3.77±0.04*** 6.64 ±0.08 c 5.96 ±0.07 c 7.02 ±0.22 c 7.80 ±0.27 c
GPx 82.97±5.25 46.14±2.24*** 56.94 ±1.10 b 60.43±1.50 b 78.07±2.56 c 80.04 ±2.08 c
GST 24.36±1.12 6.32±0.95*** 16.77±0.51 ns 15.77 ±3.37 c 18.44 ±1.08 c 20.44±0.60 c
GSH 73.78 ±4.35 23.69±0.52*** 41.59 ±1.74 c 44.39 ±0.91 c 54.58 ±2.01 c 65.43±1.68 c
SOD-(units/mg protein/min), CAT (μm of H2O2 consumed /min/ mg protein), GSH (μg /mg protein). GR (μg/mg
protein /min), GPx (μg of GSH utilized/ mg protein /min), GST (mmoles of CDNB conjugate formed /min/mg
protein), VIT C (mg/g of wet tissue), VIT E (mg/g of wet tissue).
Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post hoc
multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared to
control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.
Results
113
Fig 16: Effect of Hesperidin and Ascorbic Acid on antioxidant Vitamin C and
Vitamin E in the liver of antitubercular drug induced hepatotoxic rats.
Fig 17: Effect of Hesperidin and Ascorbic acid on serum Total cholesterol and
triglycerides in antitubercular drug induced hepatotoxic rats.
Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by
Tukey HSD Post hoc multiple range test. Significant changes are calculated as *
p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.
Results
114
6.2.5. Effect of Hesperidin and Ascorbic acid on serum lipid profile
in antitubercular drug induced hepatotoxic rats.
The level of serum lipid profile LDL (p<0.001), VLDL (p<0.001),
FFA (p<0.001) were significantly increased (table 9) where as the level
of HDL (p<0.001), phospholipids (p<0.01) levels were significantly
decreased in HRZ administered group when compared to the control
group. Furthermore, there was a significant rise in the level of Total
Cholesterol (p<0.01), Triglycerides (p<0.001) in HRZ intoxicated rats
compared to the control rats (fig 17).
In contrary, the group supplemented with HDN significantly
reduced the level of LDL (p<0.01), VLDL (p>0.05), TC (p>0.05), TG
(p>0.05), FFA (p<0.001) and subsequently enhanced the level of HDL
(p>0.05) and Phospholipids (p>0.05). Similarly, AA supplement with
HRZ intoxicated group the level of LDL (p<0.05), VLDL (p>0.05), TC
(p>0.05), TG (p>0.05), FFA (p<0.001) were significantly decreased
whereas the level of HDL (p<0.05) and Phospholipids were significantly
increased (p>0.05) when compared to HRZ group.
Furthermore the group supplemented with both HDN and AA
significantly reversed all the changes induced by antitubercular drug
(HRZ) by diminished level of LDL (p<0.001), VLDL (p<0.001), TC
(p>0.05), TG (p<0.001), FFA (p<0.001) and subsequently enhanced the
level of HDL (p<0.05) and Phospholipids (p>0.05).
Results
115
However combined therapy, showed more significant (P<0.001)
effect against hyperlipidemia-induced by HRZ when compared to the
individual therapy. Treatment with silymarin significantly (P<0.001)
ameliorates the hyperlipidaemia induced by HRZ.
Results
116
Table 9: Effect of Hesperidin and Ascorbic acid on serum lipid profile in
antitubercular drug induced hepatotoxic rats.
Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post
hoc multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001
compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non
significant results.
SERUM-mg/dl CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY
HDL 69.44 ±5.15 32.68 ±2.85*** 41.22 ±8.23 ns 45.38±2.25 a 63.68±2.06 c 66.37±1.05 c
LDL 6.93 ±0.51 37.45±2.32*** 27.53±1.24 b 22.86±2.01 a 9.39±0.25 c 8.02 ±0.99 c
VLDL 16.39 ±0.41 20.66±0.45*** 20.13 ±1.01 ns 19.43 ±0.69 ns 16.65±0.66 c 17.26 ±0.21 c
PHOSPHOLIPIDS 12.11 ±0.15 6.15±0.34* 8.73±0.41 ns 7.21 ±0.001 ns 9.33±0.10 ns 12.70 ±3.20 b
FFA 41.04 ±5.60 76.00±4.10*** 62.39 ±2.53 a 54.06 ±3.87 c 45.26±1.90 c 46.71 ±6.11 c
Results
117
6.2.6. Effect of Hesperidin and Ascorbic acid on membrane bound
ATPase enzymes in Antitubercular drug induced hepatotoxic rats.
Activities of membrane bound ATPase (Na+K+ ATPase,
Ca2+ATPase and Mg2+ ATPase) were represented in the fig (18,19).
There was a significant reduction in the activities of Na+K+ ATPase
(P<0.001), Mg2+ ATPase (P<0.001) and Ca2+ ATPase (P<0.001) in the
liver of HRZ administered rats as compared to the control rats.
On the otherhand, concurrent treatment with Hesperidin
significantly (P<0.001) increased the level of Na+K+ ATPase (P>0.05),
Ca2+ ATPase (P>0.05) and Mg2+ ATPase (P<0.001) compared to that of
HRZ group. Similarly co treatment with Ascorbic acid significantly
elevated the level of Na+K+ ATPase (P<0.01), Ca2+ ATPase P<0.01)
and Mg2+ ATPase (P<0.001) when compared to the HRZ group.
Moreover treatment with the combination of both Hesperidin and
Ascorbic acid significantly maintained the level of Na+K+ ATPase
(P<0.001), Ca2+ ATPase (P<0.001) and Mg2+ ATPase (P<0.001) near to
normal status when compared to the HRZ administered rats. The
concurrent treatment with Silymarin significantly (p<0.001) elevated the
level of membrane bound ATPase to near normal level.
Results
118
Fig 18: Effect of Hesperidin and Ascorbic acid on membrane bound Na+K
+ ATP ase
enzymes in liver of Antitubercular drug induced hepatotoxic rats.
Fig 19: Effect of Hesperidin and Ascorbic acid on membrane bound Ca 2+
and Mg 2+
ATP ase enzymes in liver of Antitubercular drug induced hepatotoxic rats.
Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey
HSD Post hoc multiple range test. Significant changes are calculated as * p<0.05,
** p<0.01, *** p<0.001 compared to control group; a
p<0.05, b
p<0.01, c
p<0.001
compared to HRZ group. ns – non significant results.
Results
119
6.2.7. Histopathological examination
Histopathological examination had been carried out in the liver
tissue of control and experimental groups of rats to confirm the
cytoprotective nature of HDN and AA against HRZ-induced liver
damage. In the present examination the control liver sections showed
normal hepatocytes architecture without any signs of hepatic damage
(Fig 20.1).
Conversely, antitubercular drugs induced changes in liver
architecture was indicated by dilatation & congestion in the central vein,
periportal tract inflammation, sinusoidal widening, apoptotic and necrotic
bodies around Central vein (Fig 20.2).
In contrast, HDN / AA (Fig 18.4) supplement with HRZ
(HRZ+HDN, HRZ+AA) showed mild congestion around the central vein
(Fig 20.3, 20.4). However treatment with the combination of both HDN
and AA (Fig 20.5) protect the hepatocyte from the HRZ induced
aberrations in the hepatic structure and showed normal hepatocytes.
Standard drug Silymarin also shows the normal liver architecture (Fig
20.6) without any changes in hepatocytes architecture.
Results
120
Fig 20: Effect of Hesperidin and Ascorbic acid on histopathological
changes induced by antitubercular drug in rat liver (H&E stain, 400X).
Fig 20.1: CONTROL Fig 20.2: HRZ
Fig 20.3: HRZ +HDN Fig 20.4: HRZ+AA
Fig 20.5: HRZ +HDN+AA Fig 20.6: HRZ +SLY
Results
121
6.2.8. Effect of Hesperidin and Ascorbic acid on HRZ induced
Apoptosis.
6.2.8.1. Western blotting analysis on the protein expression Bax,
Bcl-2, caspase 3 and caspase 9.
The protein expression of Bax and Bcl-2 were shown in Fig 21.
Administration of HRZ significantly increased the protein expression of
proapoptotic Bax and subsequently decreased the protein expression of
antiapoptotic Bcl-2. Conversely, concurrent treatment with either
Hesperidin or Ascorbic acid moderately decreases the expression of
Bax and subsequently increases the expression of Bcl-2 when
compared to the HRZ group. Moreover combined treatment with both
Hesperidin and Ascorbic acid more significantly ameliorate the HRZ
induced apoptosis by decreased the expression of Bax and increased
the expression of Bcl-2. Silymarin also restore the balance between
proapoptotic Bax and antiapoptotic Bcl-2 expression.
The protein expression of caspases was shown in the Fig 22. In
our western blotting analysis administration of HRZ significantly
increased the expression of caspase 3 and caspase 9. However co-
administration of either HDN/ AA significantly diminished the HRZ
induced expression of caspase 3 and caspase 9. Moreover the
combined treatment with both Hesperidin and Ascorbic acid shows
more pronounced effect by ameliorating HRZ induced expression of
Results
122
caspase 3 and caspase 9 compared to the individual treatment with
either HDN/ AA alone. Standard drug Silymarin also significantly
(p<0.001) reversed the HRZ induced caspase activation.
Fig 21: Western blotting analysis on the protein expression of
Bax and Bcl-2.
Fig 22: Western blotting analysis on the protein expression of
caspase 3 and caspase 9.
Results
123
6.2.8.2. RT-PCR Analysis on the mRNA expression of Bax, Bcl-2,
Caspase 3 and Caspase 9.
The mRNA expressions of Bcl-2 and Bax were represented in
the fig 23. Our results showed that HRZ administration upregulated the
expression of Bax and subsequently down regulated the expression of
Bcl-2 when compared to the control, which indicated that the liver was
acutely injured. However, concurrent treatment with either Hesperidin or
Ascorbic acid significantly reduced the expression of BAX and
enhanced the expression of Bcl-2 when compared to the HRZ group.
But combination of both Hesperidin and Ascorbic acid treatment
ameliorated the HRZ induced changes in mRNA expression which is
evidenced by down regulation of BAX and up regulation of Bcl-2. On the
otherhand silymarin attenuated the changes induced by HRZ by
maintaining the balance between pro and antiapoptotic factor.
The mRNA expression of caspase 3 and caspase 9 were
represented in the fig 24. Our RT PCR analysis shown that, the
mRNA expression in the level of caspase 3 and caspase 9 were
significantly increased in the liver of HRZ administered group when
compared to the control group. However concurrent treatment with
either Hesperidin or Ascorbic acid markedly down regulated the mRNA
expression of caspase 3 and 9 when compared to the HRZ intoxicated
rats.
Results
124
Fig 23: RT-PCR Analysis on the mRNA expression of Bcl-2 and Bax.
Fig 24: RT-PCR Analysis on the mRNA expression of
caspase 3 and caspase 9.
Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by
Tukey HSD Post hoc multiple range test. Significant changes are calculated as *
p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01,
c p<0.001 compared to HRZ group. ns – non significant results.
Results
125
Moreover co treatment with the combination of both HDN and AA more
effectively down regulated the expression of caspase 3 and caspase 9
and restore their level to normal when compared to the HRZ group.
However, the combined treatment with Hesperidin and Ascorbic
acid restored the apoptotic marker to near normal level when compared
to the individual treatment with either HDN or AA alone. Standard drug
Silymarin also restores the level of caspase 3 and 9 to near normal
level.
6.2.9. Effect of Hesperidin and Ascorbic acid on DNA
Fragmentation induced by HRZ induced hepatotoxic rats.
DNA fragmentation assay represented in the fig 25. Control group
shows an intact DNA without any laddering (G1) On the otherhand in
the HRZ administered group, there was substantial increase in the
internucleosomal DNA fragmentation evident from laddering pattern in
agarose gel (G2). However, co treatment with HDN was not able to
attenuate the HRZ induced DNA fragmentation (G3).
In contrast, cotreatment with AA (G4) attenuated the DNA
fragmentation induced by HRZ. Moreover in the group cotreated with
combination of both HDN+AA (G5) substantially prevented the DNA
fragmentation which is evident by the absence of DNA laddering
pattern. On the otherhand treatment with silymarin (G6) ameliorated
the DNA fragmentation induced by HRZ.
Results
126
Fig 25: Effect of Hesperidin and Ascorbic acid on DNA Fragmentation.
Fig 26: Western blotting analysis on the Protein expression of
TNF-α, NF-kB and IL-10.
Results
127
6.2.10. Effect of Hesperidin and Ascorbic acid on HRZ induced
inflammation.
6.2.10.1 Western blotting analysis on the Protein expression of
inflammatory markers.
Western blotting results shows the anti-inflammatory effect of
Hesperidin and Ascorbic acid on protein expression of HRZ induced
inflammation in liver (fig 26). The inflammatory markers like TNF-α, NF-
kB and IL-10 were significantly up regulated in HRZ administered group
when compared to the control group.
However co administration with either HDN or AA moderately
down regulated the expression of these inflammatory proteins when
compared to HRZ administered rats. Moreover the combination of both
HDN and AA effectively down regulated the HRZ induced inflammatory
markers compared to the individual treatment with either HDN or AA.
Standard drug Silymarin also significantly down regulated the
inflammatory proteins.
6.2.10.2: RT-PCR Analysis on the mRNA expression of
inflammatory markers.
Fig 27 shows the mRNA expression of the inflammatory markers.
The mRNA expressions of the inflammatory markers (TNF-α, NF-κB)
and anti-inflammatory marker (IL-10) were significantly upregulated in
Results
128
HRZ intoxicant group compared to the control group. In contrast,
treatment with either HDN or AA significantly attenuated the HRZ-
induced expression of mRNA levels of inflammatory markers. However,
HRZ+HDN+AA and HRZ+ Silymarin treatment more markedly
ameliorated the HRZ inflammation when compared to the other
treatment group.
Results
129
Fig: 27: RT-PCR Analysis on the mRNA expression of TNF-α, NF-kB and IL-10.
Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post hoc multiple range
test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05,
b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.
Disscussion
130
7. DISCUSSION
The present study was aimed to investigate the protective effect
of Hesperidin and Ascorbic acid against Ethanol and Antitubercular drug
(HRZ) induced hepatotoxicity in rats.
Drug-induced liver disorders occurred frequently and can be life
threatening. It is mediated mainly through the induction of Oxidative
stress which is occasioned by the formation of highly reactive/toxic
intermediates and reactive oxygen species (Balamurugan, 2007). The
catastrophic free radical events such as lipid peroxidation, protein
oxidation and DNA oxidation are the main causes for the cell death in
realistic in vivo condition. The antioxidant defense arsenal in liver cells
is capable of detoxifying free radicals and repair damage resulting from
highly reactive metabolites (Jaeschke et al., 2003). However, when the
antioxidant defense system is overwhelmed, free radicals may inflict
direct oxidative damage to cellular macromolecules, leading to cell
death (Sabiu et al., 2014).
Timely intervention with exogenous antioxidants augments the
cellular defense system to prevent these ill effects on the cellular
macromolecules. Numerous studies have reported the antioxidant and
cytoprotective effects of Hesperidin and Ascorbic acid (Ahmad et al.,
2012; Mor and Ozmen, 2010). Hence the present study demonstrates
the antioxidant and hepatoprotective potentials of Hesperidin and
Disscussion
131
Ascorbic acid against Ethanol and Antitubercular drug induced oxidative
damage in rat liver.
This study demonstrates for the first time, that the combination of
both Hesperidin and Ascorbic acid effectively prevented ethanol and
antitubercular drugs induced hepatotoxicity.
ETHANOL INDUCED HEAPTOTOXICITY
Ethanol is a natural product with characterized psychophysical
and mood-altering effects which has been available for human
consumption for thousands of years. More than ever before, there is an
upsurge in alcohol abuse; hence alcohol related disorders are becoming
increasingly important causes of morbidity and mortality globally.
Ethanol is metabolised by a number of metabolizing enzyme
systems in the liver by both oxidative and non oxidative pathways
(Samir Zakhari, 2006). During its metabolism acetaldehyde produced by
ADH reaction and ROS by CYP2E1 oxidation will interact with proteins,
lipids, DNA and other biomolecules in the cell to induce oxidative stress.
Neutralisation of this toxic metabolite and ROS are considered to be the
initial therapy in alcohol related liver disorder.
As the majority of serum proteins were synthesised in the liver,
any alteration in the serum proteins was used as an indicator for liver
injury. The reactive metabolite of ethanol (Acetaldehyde) preferably
Disscussion
132
interacts with certain proteins and form stable or unstable protein
adducts.
Albumin is a major protein of the blood and one of its significant
functions is to transport fatty acids from adipose tissue. Therefore,
altered albumin function could impair tissue access to energy from fatty
acid oxidation (Samir Zakhari, 2006). Ethanol consumption reduced the
rate of catabolism of protein in liver due to oxidative stress.
Hypoalbuminemia is a common feature of alcoholic liver disease. In our
present study ethanol significantly reduced the level of serum protein
and albumin. This could be due to the formation of acetaldehyde protein
adducts which will disturb the liver and diminish the protein synthesis.
The findings of our result indicated that the capacity of the liver to
synthesis protein was affected by alcohol. Severe alcoholic hepatitis is
indicated by the increased level of bilirubin and decreased level of
circulating proteins (Luis et al., 2003).
Conversely, concurrent treatment with Hesperidin and / or
ascorbic acid stabilizes the serum protein and albumin levels thereby
improving the functional status of the liver.
The excess alcohol drinking will disturb the cell membrane along
with the release of cytoplasmic enzymes into the systemic circulation.
Laboratory test often assists in the diagnosis of Alcoholic liver diseases.
The elevated levels of liver marker enzyme like AST, ALT etc.; in almost
Disscussion
133
all the alcoholic patient clearly indicates the liver injury. In our present
study ethanol intoxication significantly increased the level of liver marker
enzymes like Bilirubin, AST, ALT, ALP and LDH in serum when
compared to the control group (Adewusi et al., 2010). Bilirubin is the
sensitive marker used in the diagnosis of liver disease. Abnormal
bilirubin level clearly indicates the impairment of functional capacity of
the liver.
Research evidence stated that ethanol induced peroxidative
damage to the cell membrane alter the membrane permeability and
functional integrity of the hepatocytes. This will translocate the cellular
content into circulation. Accordingly, Adewusi et al. (2010), Bautista,
(2001), Gaskill et al. (2005) reported that release of transaminases
(AST and ALT) and lactate dehydrogenase (LDH) from the cell cytosol
can occur secondary to cellular necrosis. In accordance with the earlier
reports, our Histopathological results shows the presence of necrotic
damage in the ethanol intoxicated rats which altered the membrane
integrity and cause leakage of liver specific marker enzymes into the
systemic circulation. Hence the serum levels of liver marker enzymes
are elevated in the present study.
Conversely, co treatment with HDN and / or AA significantly
reduced the enzyme activities in rats suggesting that both these
compounds were able to ameliorate the deleterious effects of ethanol by
inhibiting the peroxidative damage, thereby stabilising the membrane as
Disscussion
134
well as protecting the hepatocytes from necrotic damage. The effects
were more pronounced in the rats treated with the combination of both
HDN and AA compared to the individual treatment with either HDN or
AA alone.
Hesperidin is a bioflavanoid having radical scavenging property
scavenges the ROS formed during ethanol metabolism. On the
otherhand Ascorbic acid also scavenges the ROS by its antioxidant
property and act synergistically with the flavonoid HDN. The synergistic
action of HDN and AA enhanced the antioxidant defense mechanism,
stabilised the hepatocytes cell membrane and prevented the
acetaldehyde induced peroxidative damage to the hepatocytes. Hence
the membrane stabilising effect of HDN and AA was indicated by the
decreased level of liver marker enzymes in the circulation. Accordingly,
the membrane protective effect of Hesperidin and ascorbic acid were
reported by Pari et al. (2014), Sabiu et al. (2015).
Liver plays a central role in the synthesis and metabolism of
lipids. Hyperlipidaemia is an important complication of alcohol induced
liver injury. Early reports state that ethanol administration can produce
accumulation of cholesterol and triglycerides in the liver as well as in the
serum (Parmar et al., 2009). In our present study ethanol significantly
increased the level of triglycerides and total cholesterol when compared
to the control group. This might be due to the enhanced activity of HMG
CoA reductase enzyme which catalyzes the cholesterol biosynthesis in
Disscussion
135
the liver (Wu et al., 2011) or it may be due to the diminished activity of
the lecithin cholesterol acyl transferase enzyme (LCAT) involved in the
esterification of cholesterol in plasma.
However the significant increase in the serum triglycerides in
ethanol treated animals signifies a simultaneous accumulation of
lipoproteins. This might be due to decreased activity of lipoprotein
lipase, which is involved in the uptake of triglycerides rich lipoprotein by
extra hepatic tissue. On the otherhand, it is reported that increased
synthesis or decreased lipid deposition or both result in simultaneous
accumulation of triglycerides in the serum (Ringseis et al., 2007). The
imbalance in the lipid metabolism plays a role in aggravating the lipid
peroxidation (Makni M et al., 2010).
In contrary, co treatment with Hesperidin and / or Ascorbic acid
decreased the serum level of TC and TG. The antioxidant property
could also contribute to the protection of membrane lipids from free
radical, thereby HDN +/ AA attenuated the abnormal dispersion of
membrane lipids in circulation as well as reduced the excessive
generation of more toxic peroxides. This will drastically reduce the level
of TG and TC. However the combination of both HDN and AA
treatment shows better antilipidemic effect when compared to the
individual treatment with either HDN or AA alone. This implies the
synergistic action of Hesperidin and Ascorbic acid. The lipid lowering
effect of hesperidin was studied by MM El-Shafey and MF Abd-Ellah,
Disscussion
136
(2014). Similarly Aleisa et al. (2013), Eteng et al. (2006) in their study
demonstrated the antilipidaemic effect of ascorbic acid.
Ethanol or its metabolites (Acetaldehyde) alters the peroxidative
balance of the liver towards autoxidation, either by acting as pro-oxidant
or by lowering the cellular antioxidant level. On the otherhand the
acetaldehyde oxidation and ROS generation (superoxide and hydroxyl
radicals) by ADH/ALDH and CYP2E1 produces harmful effects
(Comporti et al., 2010; You and Crabb, 2005). This ROS contributes to
alcohol-induced oxidative damage to a variety of tissues by causing
oxidative stress and also enhances the apoptosis triggered by various
stimuli. ROS in association with acetaldehyde induced lipid peroxidation
which is considered to play a pivotal role in the mechanism by which
ethanol may exert its toxic effects on the liver and other extra hepatic
tissues (Bautista, 2001; Nordmann, 1994).
In the present study, ethanol induced peroxidative damage is
evidenced by increased levels of TBARS in liver. Accordingly Bautista,
(2001) reported that ethanol enhanced the level of hepatic lipid
peroxidation due to free radical injury. During ethanol metabolism the
CYP 450 catalytic cycle use NADPH to reduce O2 leading to the
production of ROS (Sid et al., 2013). The prolonged exposure of ethanol
increased the generation of ROS thereby inducing the peroxidative
damage to the hepatocytes. This might be the reason for observed
Disscussion
137
necrotic changes in the liver. This necrotic damage to the hepatocytes
will alter the membrane permeability which results in the leakage of
serum marker enzymes into the circulation. In contrast, the group
supplemented with HDN+/ AA the level of TBARS was significantly
diminished when compared to the ethanol group. The protective effect
of HDN and AA against ethanol induced peroxidative damage was
mainly mediated by inhibition of free radical generation and also by
enhancement of the radical scavenging action. Our results are in
parallel with that of Ahmad et al. (2012) and Sabiu et al. (2015).
Our body is empowered with an antioxidant defense system
which counteracts the free radical induced peroxidative damage and
protects the body against oxidative stress. This is obtained via
enzymatic (SOD, CAT etc.,) and non enzymatic antioxidants (VIT C, Vit
E and GSH).
Acetaldehyde promotes cell death by depleting glutathione levels
which impair a major antioxidant defense mechanism against oxidative
damage. This reduction may be due to the increased utilization of GSH
and other antioxidants for quenching enormous free radicals produced
during ethanol metabolism. This might be the reason for diminished
level of antioxidants (SOD, CAT, GSH, Vit C and Vit E) in the present
study. The impairment in the enzymatic and non-enzymatic antioxidant
defense systems has been reported in alcoholics and experimental
animals (Rukkumani et al., 2004).
Disscussion
138
Increased LPO and the deficiency of antioxidant on ethanol
exposure might be due to the excess production of ROS so that the
antioxidants are not able to quench them which result in failure of
antioxidant defense system.
Concurrent supplement with HDN +/ AA along with ethanol
impaired the lipid peroxidation (TBARS) and restored the enzymatic and
non enzymatic antioxidant enzymes. Hence the observation in our
present study indicated that Hesperidin and Ascorbic acid are effective
antioxidants in the biological system that mediates its antioxidant effect
by scavenging free radicals and protect the hepatocytes from the
oxidative damage.
In the present study, the protection offered by Hesperidin against
ethanol-induced hepatotoxicity may be generally linked to its beneficial
effects including its ability to scavenge free radicals by inhibiting
antioxidant depletion and potentiating the antioxidant defense
mechanism. These finding of our study are in parallel with the results of
the earlier reported study (Ahmad et al., 2012).
Similarly, the ability of Ascorbic acid to trap free radicals and
protect biological membranes from peroxidative damage by effectively
quenching the reactive oxygen species was reported by Sminorff and
Wheeler, (2000). This might be suggestive of its effect exhibited in the
treatment groups. The previous study reported that ascorbic acid is an
Disscussion
139
excellent electron donor to free radicals which subsequently quench
their deleterious activity on cellular macromolecules, thus playing a role
in antioxidant defense mechanism (Odigie et al 2007; Banerjee et al.,
2009; Sabiu et al., 2015).
Furthermore the peroxidative damage induced by ethanol is
further confirmed by our Histopathological examination. The
microscopic examination shows that ethanol disturbs the lobular
structure along with necrosis in the hepatocytes. Necrosis was due to
ROS produced during ethanol metabolism which acted on the
polyunsaturated fatty acid and initiated peroxidative damage to the
hepatocytes. On the otherhand treatment with HDN+/ AA apparently
annulled degenerative changes caused by ethanol on the architectural
features of hepatocytes. In fact, architectural organization of the
hepatocytes in the animals treated with combination of both HDN and
AA was almost completely restored to normal. This shows the protective
role of HDN and AA against ethanol induced oxidative damage. The
standard drug Silymarin also ameliorated the changes induced by
ethanol and restored their levels to near normal.
Conclusively, the restoration of degenerative changes caused by
ethanol by concurrent treatment with Hesperidin and/or Ascorbic acid as
an indication of their inherent antilipidemic, antioxidant and
hepatoprotective attributes in rats. The effects were more pronounced in
combined treatment with both HDN and AA compared to the individual
Disscussion
140
treatment, which clearly indicates the synergistic effect of Hesperidin
and Ascorbic acid against ethanol induced hepatic damage.
ANTITUBERCULAR DRUGS INDUCED HEPATOTOXICITY
Tuberculosis is a world health issue and the standard treatment
regimen for TB includes Isoniazid, Rifampicin and Pyrazinamide.
Hepatotoxicity is the one of the most serious adverse effect of Anti TB
treatment regimen. This will result in reducing the effectiveness of the
therapy by compromising the tubercular regimen (Khalili et al., 2009). If
this hepatic damage is not recognized earliest it may be fatal (Sarich et
al., 1995). Levels of liver marker enzymes were elevated in 20% of the
patients. Most of the patients adapt to this, and the enzymes come
down to normal. But few patients develop severe liver injury out of
which some may end in liver failure (Peng cheng et al., 2016).
In humans Isoniazid, Rifampicin and Pyrazinamide are the most
effective and basic component in the treatment regimen. Hence in our
present study Isoniazid, Rifampicin and Pyrazinamide are used in
combination to induce liver damage because these drugs were
relatively hepatotoxic and when given in combination their hepatoxic
effect enhanced in synergistic manner (Vijaya Padma et al., 1998).
Anti TB drug mediated hepatotoxicity is through the production of
toxic metabolite in its metabolic pathway. Two major pathways are
involved in Isoniazid (INH) metabolism. In first pathway INH acetylated
Disscussion
141
through N-acetyl transferase 2 (NAT 2) to form acetyl isoniazid and in
second pathway it undergoes hydrolysis by amidases to produce
Isonicotinic acid and Hydrazine. Then the acetyl isoniazid undergoes
hydrolysis to form isonicotinic acid and diacetylhydrazine. These (acetyl
hydrazine and Hydrazine) metabolites are oxidised by CYP2E1 in the
liver, which leads to the formation of reactive oxygen species (ROS)
that triggers oxidative stress and liver damage (Preziosi, 2007 ;Tayal et
al., 2007). Rifampicin is an enzyme inducer and when given in
combination with Isoniazid it stimulates the Isoniazid hydrolase enzyme
thereby enhancing the production of toxic metabolite (hydrazine)
leading to hepatic injury (Sarma et al., 1986). The combination of
Pyrazinamide with other antitubercular drug like Isoniazid and
Rifampicin will increase the incidence of liver damage.
The exact mechanism of Anti TB drug (HRZ) induced
hepatocellular damage is still unknown. Numerous studies have shown
that, it is primarily due to the parent drug / reactive metabolite formed
during metabolism which will induce oxidative stress (ROS formation).
These ROS bind to the hepatocytes macromolecules and induce
cellular damage (Ali, 2012). In a case study HRZ treatment for 6 weeks
resulted in jaundice with rise in bilirubin and ALP level leading to liver
failure and the patients has undergone liver transplantation (Farrell et
al., 1994).
Disscussion
142
In our present study HRZ induced hepatotoxicity is evidenced by
increased level of Bilirubin. Similarly the serum level of Creatinine and
Urea were also increased in the HRZ group. However Bilirubin is one of
the most useful clinical clues to the severity of necrosis. Hence the
accumulation of bilirubin in serum is an important binding, conjugation
and excretory capacity of hepatocytes. In our present study the elevated
level of bilirubin in the serum of HRZ groups might be due to the
diminished hepatic clearance, endorsing jaundice condition (Saukkonen
et al., 2006; Gupta and Misra, 2006). Byre et al. (2002) stated that
Rifampicin interfere with bilirubin uptake and result in hyperbilirubinemia
by inhibiting bilirubin excretion through bile salt export pump.
Liver is the most important organ in maintaining the blood
ammonia levels through the urea cycle. Formation of urea and
creatinine are the mode of disposal of nitrogen (Stryer, 1995). In
hepatotoxic condition, due to the failure of the liver to convert amino
acids and ammonia to urea, a significant increase in urea and creatinine
were observed in our present study. Conversely co treatment with
Hesperidin +/ Ascorbic acid aids the hepatocytes to function properly,
by boosting the hepatic clearance of Bilirubin, creatinine and urea.
One of the major functions of the liver is to synthesize proteins
like albumin, globulin and fibrinogen. The liver functions were impaired
in disease condition which results in diminished synthesis of proteins.
On the otherhand amino acid metabolism was impaired in liver disease
Disscussion
143
which decreases the amino acid availability and impairs protein
synthesis.
Antitubercular drug mediated oxidative stress contributed to the
changes in the rough endoplasmic reticulum in the liver which disturb
the protein synthesis and hence the level of total protein and albumin
were significantly decreased in our present study. This is in accordance
with an earlier reported study (Chandane et al., 2013).
On the otherhand HDN+/ AA co treatment protected the
hepatocytes from experimental injury induced by HRZ and retained the
function of the liver cells to synthesize proteins. It probably did so by
counteracting the antitubercular drugs mediated oxidative damage of
polyribosomal profiles in the rough endoplasmic reticulum. Hence their
levels were increased in HDN and / or AA treated group when
compared to the HRZ treated group. The combination of both HDN and
AA shows better result compared to the individual treatment with either
HDN or AA alone which shows the synergistic effect of HDN and AA.
During TB treatment, the level of serum marker enzymes (AST,
ALT, ALP, LDH etc.,) were increased which indicates the hepatic injury.
ATDH is a treatment emergent which increases the level of liver marker
enzymes with or without symptoms of hepatitis or jaundice (Saukkonen
et al., 2006). In accordance with the earlier report, our results show that
antitubercular drug significantly elevated the level of liver marker
Disscussion
144
enzymes (AST, ALT, ALP, ACP, γ-GT and LDH) in the circulation.
Oxidative stress mediated hepatic damage is the main ascription
mechanism behind ATDH (Kale et al., 2003).
HRZ induced oxidative stress might be due to formation of toxic
metabolite and ROS in excess of antioxidant detoxification capacity
which will induce peroxidative damage to the hepatocytes. When there
is hepatopathy the integrity of the cell membrane is lost which result in
the leakage of these enzymes into blood stream (Nkosi et al., 2005).
Elevated levels of these marker enzymes clearly indicated the drug
induced hepatic damage, which is further confirmed by our
Histopathological examination which showed the presence of necrotic
damage in the liver of HRZ administered group. Imogen et al. (1995)
stated that sub acute and chronic treatment with Isoniazid increased the
level of serum transaminases and phosphatases. Our results are in line
with an earlier reported study (Imogen et al., 1995; Basini Jyothi et al.,
2013; Mohamed Saleem Thattakudian Sheik Uduman et al., 2011).
Conversely significant reduction in the activities of AST, ALT,
ALP, γ GT and LDH were observed in the rats supplemented with either
Hesperidin or Ascorbic acid. This shows that these compounds were
able to ameliorate the deleterious effect produced during the
antitubercular therapy by quenching the generated free radicals (lipid
peroxides) and thereby maintaining the hepatocyte integrity. However
Disscussion
145
the combination of both HDN and AA treatment restored the liver
marker enzymes to normal level compared to the individual treatment.
Hesperidin and Ascorbic acid stabilise the hepatic cell membrane
thereby it protect the hepatocytes from the toxic effect of HRZ which
reduces the leakage of enzymes into the circulation. The membrane
protective effect of Hesperidin and Ascorbic acid has been reported by
Pari et al. (2015) and Grajeda-Cota et al. (2004).
Liver is the major site for synthesis and metabolism of
cholesterol, bile acids and phospholipids. The major disorder
encountered in antitubercular drugs-induced hepatotoxicity is fatty
accumulation in the liver, which develops either due to excessive supply
of lipids to the liver or interference with lipid deposition. Oxidative stress
triggers the hepatic damage by altering the lipids (Shali et al., 2015).
Antitubercular drug treatment affects the metabolism of cholesterol, TG,
FFA and bile acid in the liver (Wang P et al., 2016). In the present study
HRZ induced hyperlipidemia is evidenced by significant increase in the
levels of serum total cholesterol, triglycerides, LDL, VLDL, free fatty acid
and eventual decrease in the level of HDL and phospholipids. This
elevated concentration of LDL in the HRZ treated rats might be due to
defect in LDL receptor either through failure in its production (or)
function. HDL is protective by reversing cholesterol transport, inhibiting
the oxidation of LDL and by neutralizing the atherogenic effects of
oxidized LDL. A greater increase of LDL and VLDL might have been
Disscussion
146
due to reduction in the level of HDL and diminished lecithin cholesterol
acyl transferase activity (Sabesin et al., 2011).
Furthermore, the level of triglycerides in serum reflects a balance
between the rates of exogenous supply and endogenous fatty acid
synthesis. The decreased removal of triglyceride and cholesterol from
serum is due to diminished lipoprotein activity (You et al., 2002).
Phospholipids play a significant role in maintaining the structural
integrity of the cellular membrane (Endo et al., 1992). Our data showed
a decrease in phospholipids content, this might be due to the increased
activity of phospholipases and lipid peroxidation which degrades
membrane phospholipids.
Pal et al. (2008) in their finding reported that Isoniazid and
Rifampicin increase the level of total lipids, TC, TG and decreased the
levels of phospholipids. In another study by Chen and Raymond,
(2005) stated that Rifampicin decreased the level of HDL and increased
the level of TC, TG by inhibiting the CYP A71 (a rate limiting enzyme in
the conversion of cholesterol to bile acids). Our results are in
accordance with the report of the previous study.
In our present study Hesperidin and Ascorbic acid exhibited a
notable hypolipidemic effect as evidenced by its modulating effects on
the serum lipid profile against HRZ induced hyperlipidaemia. This might
be due to its inhibitory effect through free radical quenching activity,
Disscussion
147
since lipids are the primary target of free radicals. Wang et al.(2011),
MM El-Shafey and MF Abd-Ellah, (2014) have shown that citrus
flavonoid Hesperidin reduces the lipid profile like Total cholesterol,
triglycerides and LDL concentrations and increases the HDL
concentrations in the rats fed with high-cholesterol diet, which cope with
the results of our present study.
In another study HDN lower cholesterol and Triglyceride by
inhibiting the HMG CoA reductase and Acyl CoA: cholesterol acyl
transferase (ACAT) (Bok et al., 1999) and also enhance the expression
of LDL R encoding gene (Wilcox et al., 2001). Similarly a study by
Ahmed et al. (2012) showed the hypolipidemic effect of Hesperidin in
Type 2 diabetes rats. Yoshida et al. (2010) in their study showed that
Hesperidin block the TNF α induced FFA release by down regulating the
perilipin and PDE 3B (antilipolytic gene). These are the some of the
possible mechanism underlying hypolipidemic effect of Hesperidin.
Similarly hypolipidemic effect of Ascorbic acid (Marc and McRae,
2008) also reported in earlier studies. Vitamin C has a favorable effect
on lipid profile. El Mashad et al. (2016) in their study stated that Vitamin
C supplement decrease the LDL, TC, TG and increases the HDL level
in children on hemodialysis.
Oxidative stress alters the redox homeostasis of the liver leads to
the generation of radicals that induces lipid peroxidation and
Disscussion
148
dysfunction the antioxidant defence system. This will play a critical role
in the pathogenesis of AntiTB drug induced liver damage (Chowdhury et
al., 2001). Isoniazid metabolism involves CYP2E1 enzymes which result
in the generation of ROS and the hepatotoxic metabolite (Sarich et al.,
1999; Delaney et al., 1995). On the otherhand Rifampicin upregulated
the transcription of Phase I and Phase II drug metabolizing enzyme like
CYP and GST and enhance the isoniazid metabolism (Burk et al., 2004;
Nannelli et al., 2008). This will result in excessive generation of ROS
and toxic metabolite which will induce peroxidative damage to the lipid.
Lipid peroxidation (LPO) is a multistep chain reaction that initiates
when a free radical react with the polyunsaturated fatty acid (PUFA) in
cell membrane to form conjugated dienes. This reacts with O2 and OH•
atoms from other cellular lipids, producing lipid hydroperoxides, MDA,
cyclic peroxides and other radicals (Jomova and Valko, 2011). Our
results shows that antitubercular drugs administration results in the
significant elevation of peroxidative markers like TBARS, conjugated
dienes and hydroperoxides enzymes levels. This increased LPO might
be due to the excess production of reactive metabolite during the
detoxification of AntiTB drug which induce the necrotic damage to the
hepatocytes. Hence the integrity of the hepatocyte will be lost which
result in the leakage of enzymes in to the circulation. Our studies are in
parallel with other studies (Georgieva et al., 2004; Chowdhury et al.,
2001). Moreover TB patients with ATDH have been shown to have
Disscussion
149
lower plasma levels of glutathione and higher malondialdehyde, which
may be due to the result of oxidative stress from the antituberculosis
therapy (Chowdhury et al., 2001).
Research evidence suggested that the Antitubercular drugs
causes’ hepatocellular damage through the induction of oxidative stress
and consequence dysfunction of hepatic antioxidant defense system
(Attri et al., 2000). In physiological condition both enzymatic and non
enzymatic antioxidant are involves to protect the body from oxidative
stress (Young and Woodside, 2001). Therefore they are used as a
measure to evaluate the oxidative stress level.
In our present study antitubercular drug reduces the level of
enzymatic (SOD,CAT,GST,GPx,GR) and nonenzymatic (GSH,VIT C &
E) antioxidant, this might be due to excessive production of oxidant
species, so the antioxidant are not able to neutralize them, which result
in the depletion or failure of intracellular antioxidant defense system.
Hydrazine a principle reactive metabolite of INH, deplete GSH by
reacting with their sulfahydral groups and initiate oxidative stress
(Chowdhury et al., 2006). This depletion in the GSH content might be
the effect of maximum utilization for detoxification of ROS and reactive
metabolite. GSH play a role as a free radical scavenger it undergoes
Sulfhydryl conjugation and facilitates the elimination of toxic metabolite
from the body. GSH acts as a substrate in the scavenging reaction
Disscussion
150
catalysed by the enzyme glutathione peroxidase (GPx) and also play a
role in scavenging the radicals of Vitamin C & E (Ortotani et al., 2010).
GPX reduction is subsequent of GSH reduction.
In our study the serum GSH concentration significantly decreased
in HRZ administration which might be due to an increased utilization of
GSH to detoxify the toxic metabolite. Vit C is a water soluble naturally
occurring chain breaking antioxidant (Abraham, 2005). We have
observed a significant reduction the levels of Vit C in anti TB drug
intoxicated animals which could be due to the enhanced Vitamin C
utilization, as an antioxidant defense against ROS. On the otherhand it
may also due to the reduced concentration of GSH because, GSH
involved in the recycling of vitamin C. The Vitamin E plays a major role
in maintaining cell membrane integrity by limiting lipid peroxidation by
ROS. The declined concentration of Vitamin E might be due to
extensive utilization of Vitamin E in scavenging the oxyradicals or due to
the deficiency of vitamin C, there is a well established interaction
between Vitamin E and C.
GST involved in the detoxicification of the reactive metabolite that
is formed by oxidation of hydrazine and acetyl hydrazine during the
metabolic pathway of Isoniazid. The conjugation of reduced form of
glutathione to electrophilic substance are catalysed by GST thereby it
reduces the peroxidative damage toward the cellular substance. The
homogenous null mutation in the GST genotype reduce the catalytic
Disscussion
151
activity of GST enzyme hence leads to the accumulation of toxic
metabolite which will induce hepatotoxicity (Bing et al., 2011; Tang et
al., 2013; Huang et al., 2007).
On the otherhand SOD and CAT are the front line antioxidant
enzymes, which are inactivated by the excess generation of lipid
peroxides (Reiter et al., 2000). SOD scavenges the superoxide anion
into form hydrogen peroxide thereby it diminishes deleterious effects
caused by the radical (Kharpate et al., 2007). CAT is an important
enzyme which protects the cell from oxidative damage induced by the
free radicals (ROS). It catalyses the conversion of hydrogen peroxide to
water and oxygen. In the current study higher level of LPO along with
reduced levels of CAT and SOD indicate the presence of oxidative
insult due to excess generation of peroxide radicals so that the
antioxidant where are not able to neutralise them result in peroxidative
damage.
In our present study concurrent treatment with Hesperidin and
ascorbic acid ameliorate the Anti TB drug associated rise in TBARS,
CDs, LHP & depletion of antioxidant enzymes. This could be attributed
to the scavenging activity of Hesperidin (Pari et al., 2015) and Ascorbic
acid (Wu et al., 2004) towards ROS and sparing of endogenous
antioxidant enzymes.
Disscussion
152
Flavanoids are effective in combating the oxidative stress in
human. Dietary flavanoids act as an electron donor and functions as
exogenous antioxidant by scavenging the free radicals (Issabeagloo et
al., 2012). It also induces phase II detoxification enzyme and protect the
tissue from oxidative damage (Talalay et al., 1995).
Hesperidin is a natural and pharmacologically active bioflavonoid
found in citrus fruits, with their antioxidant effect and free radical
neutralizing property (pari et al., 2015). Hence this bioflavonoid has a
good intracellular radical quenching activity and is able to inactivate
reactive metabolites and ROS at the site of its production itself (Sam-
Long Hwang and Gow-Chin Yen, 2008). The previous study stated that
HDN functions as a scavenger for ROS acts as a chain breaking
antioxidant, which quench the free radicals and also it act as a protector
for ascorbic acid (Singh and Agarwal, 2006). In another study HDN
attenuated the cisplatin induced oxidative stress by decreased the level
of ROS and MDA and enhanced the antioxidant enzyme (Sahu et al.,
2013). These studies are in parallel with our result.
Similarly ascorbic acid at cellular level mitigates the deleterious
effect of ROS directly by increasing antioxidant enzyme activities and
indirectly by reducing oxidized form of vitamin E and GSH (Neuzil et al.,
1997; Wu et al., 2004). Ascorbic acid capable scavenging the ROS and
sparing the other endogenous antioxidant from consumption (Wu et al.,
2004). Vitamin C is a water-soluble chain breaking antioxidant,
Disscussion
153
scavenges free radicals produced during metabolic pathways of
detoxification. Preservation of intracellular ascorbic acid levels
minimizes the peroxynitrite-mediated injury which is attributable to the
beneficial effect of ascorbic acid (Carnes et al., 2001). Thus it can
prevent the peroxidation of poly unsaturated lipids present in the plasma
membrane and other sub cellular organelles like endoplasmic reticulum,
mitochondria and helps to maintain its integrity and prevent leakage of
cellular contents.
Hesperidin and Ascorbic acid enhances the expressions of
endogenous antioxidant by maintaining their levels higher compared to
the HRZ intoxicated rats. Our findings are further confirmed by
histopathological results which show the absence of necrotic lesions.
Our result shows that HDN and AA decreased the level of peroxidative
damage and increased the level of enzymatic and non enzymatic
antioxidant thereby prevent the membrane from the peroxidative
damage and stabilise the membrane. This proves the antioxidant
property of HDN and AA against the peroxidative damage induced by
HRZ. This antioxidant property of Hesperidin (Cho 2006, Ahmad et al.,
2012) and Ascorbic acid (Banerjee et al., 2009) are well in accordance
with the earlier report.
Enhanced oxidative damages on the membrane are further
evident from altered ATP ases (Na+K+, Ca2+, and Mg2+ ATPases)
activities in the liver tissue of HRZ administered groups. Hydrazine, the
Disscussion
154
active metabolite of Isoniazid inhibits the ATP production and alters the
electron transport chain in hepatocytes (Lee et al., 2013). ATPase has
been described as prominent enzymes found in all organisms providing
metabolic energy for energy-dependent processes. It is an integral
membrane protein and required thiol groups and phospholipids to
maintain their structure and function (Hazarika and Sankar, 2001). It is
also responsible for the transport of ions through the membrane and
thus regulates cellular volume, osmotic pressure and membrane
permeability.
Peroxidative damage to membrane phospholipids not only alter
the lipid profile, structural and function integrity of membrane but also it
affected the activities of various membrane bound ATPase. The
membrane-bound enzymes such as Na+K+, Ca2+ and Mg2+ ATPases are
responsible for transport of sodium/potassium and calcium ions across
the cell membrane at the expenses of ATP, and they are lipid-
dependent membrane-bound enzymes susceptible to lipid peroxidation
(Stekhoren and Bonting 1981; Selvendiran and Sakthisekaran, 2004).
In this context, Geetha and colleagues have suggested that lipid
peroxidation in cells decreases the activity of membrane-bound ATPase
because cell membrane is extremely susceptible to free radical attack
and any alteration in membrane lipid leads to change in membrane
fluidity, which in turn alters the ATPase activities and cellular functions
(Geetha A et al., 1991). The diminished activities of membrane bound
Disscussion
155
ATPases in the present investigation might be due to the free radicals
induced damage caused by HRZ administration and this is well in
accordance with the previous reports of several investigators
(Saraswathy SD et al., 1998; Ohta Y et al., 2002).
In contrast, concurrent treatment with Hesperidin and / or
Ascorbic acid increased the level of the ATPases this might be due to
the protective role of Hesperidin & Ascorbic acid in membrane
permeability and stabilizing potential. In addition, it can maintain the
structural integrity of cell membrane probably by protecting the
membrane ATPases from the deleterious effect of lipid peroxidation
caused by the HRZ. The membrane stabilising activity of Hesperidin
(Pari et al., 2015) and Ascorbic acid (Grajeda-Cota, et al., 2004) have
reported in previous studies.
Antitubercular induced liver damage is further confirmed by
abnormal histological findings. Toxicity manifestations by HRZ in the
liver tissue are revealed by morphological changes such as
inflammation around portal triad, sinusoidal dilation, necrosis and
central vein congestion. These changes revealed that ROS and active
metabolite formed during antitubercular drug metabolism induces lipid
peroxidation results in hepatic injury. In Previous studies the active
metabolite acetyl hydrazine does not show any toxic effect but
hydrazine is responsible for antitubercular drug mediated necrotic
damage, macrovesicular degeneration and steatosis in liver (Richards
Disscussion
156
et al., 2004). Our results are in parallel with that of the above reports.
The observation in liver of patients who died in Rifampicin and
Pyrazinamide induced toxicity shows bridging necrosis, increased
fibrosis and infiltration of lymphocyte and micronodular cirrhosis was
observed (Westphal et al., 1994; Brown et al., 2005).
Treatment with either HDN or AA showed maximum recovery of
hepatocytes with mild congestion. However treatment with the
combination of HRZ and AA shows the normal liver architecture this
might due to their antioxidant property which enhance the action of
antioxidant defense system and protect the hepatocytes from the
peroxidative damage induced by toxic metabolites. Similary standard
drug silymarin treatment with HRZ shows almost near normal
architecture.
Antitubercular drug mediated apoptosis is mainly due to the
formation of highly reactive oxygen species within mitochondria which
leads to mitochondrial membrane depolarization which triggers caspase
cascade and initiate apoptosis (Bhadauria et al., 2010; Desagher and
Martinou, 2000). Apoptosis is an ATP dependent programmed cell
death which is mediated by activating caspase cascade pathways
(Intrinsic and extrinsic pathway). The intrinsic pathway triggered by
drug or toxic metabolite activate caspase cascade and damage the
mitochondria (Battaglia et al., 2009; Riedl and shi, 2004). It is mediated
through Bcl2 family of protein which includes proapoptotic Bax and anti
Disscussion
157
apoptotic Bcl2. Studies shows that Bax act as the positive regulator will
enhance mitochondrial polarization and induces cell death; Bcl2 act as
the negative regulator of cell death by restores the mitochondrial
polarization (Desagher and Martinou, 2000). Bcl2 family proteins are
essential for regulating the apoptosis.
On the otherhand extrinsic apoptotic pathway is activated by
binding of death ligand (TNF α, FasL etc.,) to death receptor (TNF R1)
induces conformation changes in the receptor and activate the effector
caspase cascade (Yin and Ding, 2003; Zhang et al., 2015). Caspase
are cysteine protease enzyme involved in apoptosis act as a initiator
caspase (8,9,10) or effector caspase (3,6,7). Caspase 3 involved in
cleaning a various cellular protein and DNA strands break (Bratton et
al., 2000). To investigate the HRZ induced apoptotic damage the
expression of Bax, Bcl2, Caspase 3 and Caspase 9 were analysed.
In our western blotting and RT PCR analysis antitubercular drugs
up regulated the expression of caspase 3 and caspase 9 might be due
to the migration of proapoptotic marker Bax to the mitochondria and
inhibit the protective effect of antiapoptotic Bcl2. Therefore in our
analysis Bax is up regulated and Bcl2 is down regulated by
antitubercular drugs due to the activation of intrinsic apoptotic pathway
by ROS. Bazhanova et al. (2015) stated that combined administration of
antitubercular drug induces apoptosis by activating both intrinsic and
extrinsic apoptotic pathway.
Disscussion
158
Conversely treatment with either HDN or AA with antitubercular
drugs moderately increased the expression of Bcl2 and decreased
expression of Bax, Caspase 3 and Caspase 9. However treatment with
the combination of both HDN and AA more pronouncedly upregulated
the expression of Bcl2 and down regulated the expression of Bax,
Caspase 3 and Caspase 9 which indicates that these drugs stabilize
the mitochondrial membrane from the oxidative damage thereby it
prevent the activation of caspase cascade mediated intrinsic apoptotic
pathway. On the otherhand it also restored the balance between Bax
and Bcl2 and prevents the hepatocytes from apoptosis. Reports shown
that enhanced expression of Bcl-2 inhibit the transcriptional activation of
proapoptotic proteins Bax and inhibit the release of cyt c from
mitochondria, thereby inhibiting the activation of caspase, and apoptosis
(Desagher and Martinou, 2000; Budihardjo et al., 1999; Imogen et al.,
1995). Moreover, Antiapoptotic effect of Hesperidin was reported by
various authors (Ahmad et al., 2012; Tamilselvam et al., 2013).
Hesperidin scavenge the ROS generated during oxidative stress
and protect the cellular macromolecules from the oxidative damage and
established the mitochondrial polarization thereby it prevent the
expression of Bax, caspase 3, 9 and upregulated the Bcl2 expression
by its antioxidant effect (Hewage et al., 2016). In another study
Hesperidin attenuates cisplatin induced renal injury by down regulated
the caspase 3 & DNA damage (Sahu et al., 2013). Similarly Naseer et
Disscussion
159
al. (2011) in their study reported that vitamin C impaired apoptosis by
down regulated the expression of Bax, caspase-9, caspase-3,
cytochrome-c, and significantly upregulated the expression of
antiapoptotic Bcl-2 protein. On the otherhand ascorbic acid inhibits
apoptosis by induction of phase II enzymes involved in the detoxification
of toxic metabolite and eliminates ROS (Garcia et al., 2009).
Moreover, the DNA fragmentation detected by gel electrophoresis
as a DNA ladder representing a series of fragments. There is always a
positive association between apoptosis and the DNA fragmentation. Fig
(25) showed the laddering pattern of DNA in group fed with HRZ
compared to the control. DNA fragment analysis clearly indicate that
antitubercular drug induced hepatic damage is mediated through the
apoptosis induction. In the combination group of both HDN and AA
dramatically reduce the laddering pattern thereby it prevented the DNA
fragmentation and apoptosis induced by HRZ. The increased level of
antioxidant decreases the ROS level and inhibits the apoptosis which is
indicated by the absence of laddering in HRZ+HDN+AA and silymarin
treated rats.
On the otherhand ROS triggers an inflammatory response
through the activation of transcription factor NF-κB (Czaja, 2007). The
NF-κB-activating pathway is induced by pro-inflammatory cytokines
(TNFα) (Martin and Wesche, 2002; Devin et al., 2000). Research
evidence stated that oxidative stress along with toxic metabolite
Disscussion
160
increase the production of TNF-α which act on TNF-α receptor 1 and
leads to the production of other proinflammatory cytokines (Tacke et al.,
2009; Leagins et al., 2015; coffin et al., 2011; Leifeld et al., 2006). In our
present study Antitubercular drugs increase the expression of NF-κB
and TNF-α. The activation of extrinsic apoptotic pathway by the ROS
might be the reason for enhanced expression of NF-κB and TNF-α.
Furthermore, IL-10 with anti-inflammatory and immunomodulatory
effects can prevent the activation of TNF-α-induced activation of NF-κB
pathway (Bourdi et al., 2002; Dhingra et al., 2009). In our study
antitubercular drugs enhanced the expression of IL-10 because of
compensatory mechanism against TNF-α induced inflammation.
Inversely concurrent treatment with Hesperidin and Ascorbic acid
down regulated the level of TNF-α, IL-10 and NF-κB to near normal in
HRZ intoxicated rats. Thus Hesperidin and ascorbic acid ameliorated
the oxidative stress by neutralising the ROS thereby it prevent the
activation of NF-κB pathway and subsequently suppress the release of
proinflammatory cytokines (TNF-α). Hence the expression of TNF-α and
NF-κB was reduced in our study. Furthermore the level of anti-
inflammatory cytokines IL- 10 was diminished in Hesperidin and
Ascorbic acid treatment. This could be due to attenuation of
inflammatory stress which in turn secured the formation of anti-
inflammatory cytokines (IL-10). Hence Hesperidin and Ascorbic acid
have protective effect against inflammation by suppressing the release
Disscussion
161
of proinflammatory cytokines and oxidative stress responsive
transcription factor there by inhibit the activation of caspase 3 and
caspase 8 mediated apoptotic pathway (extrinsic pathway).
Hesperidin suppresses the proinflammatory cytokine TNF-α by
inhibiting the NF-κB protein complex. Analysis of gene expression after
Hesperidin treatment enhance the NF-κB inhibitor which block the
activity of NF-κB and associated genes regulated by NF-κB factor
(Milenkovic et al., 2011). Our results are in parallel with the findings of Li
et al. (2008) and Visnagri et al. (2014).
Numerous studies stated that Hesperidin suppress the apoptosis
and inflammation by inhibiting the intrinsic and extrinsic apoptotic
pathway (Tamilselvam et al., 2013; Ahmad et al., 2012). On the
otherhand Cárcamo JM et al.(2002) data pointed out that vitamin C
suppress NFkB activation by inhibiting TNF-α, These results of our
study stated that vitamin C can influence inflammatory and apoptotic
processes via inhibition of NFkB activation.
Our results shows that individual treatment group with either HDN
or AA markedly reduced all the changes induced by Antitubercular
drugs (HRZ). However the combination of both HDN and AA more
efficiently ameliorated all the changes induced by antitubercular drugs.
This shows the synergistic effect of hesperidin and ascorbic acid
against antitubercular drug hepatotoxicity. Vitamin C works better when
Disscussion
162
accompanied by flavonoid molecule as their presence in the cell spares
Vit C and provides greater antioxidant.
On the otherhand Silymarin is the standard hepatoprotective drug
which protects the hepatocytes from the oxidative damage by its
antioxidant property. Numerous researchers investigated the
hepatoprotective and antioxidant property of Silymarin against various
hepatotoxic drugs like paracetomol (Sabiu et al., 2015), carbon
tetrachloride (Jia et al., 2013), antitubercular drug (Eminzade et al.,
2008) etc., In our present study Silymarin was used as a positive control
for its known hepatoprotective effect. Our results shows silymarin exerts
its protective effect against HRZ induced hepatotoxicity by impaired the
oxidative stress, apoptosis and inflammation.
The combination of flavonoid and ascorbic acid produce a
synergistic effect. The previous studies shown that flavonoids
Quercetin in combination with vitamin C synergistically regenerate
Vitamin E while the regeneration not happen with either Vit C or
Quercetin alone treatment. Furthermore the combination of citrus
flavonoid and vitamin C previously reported to produce synergistic
antioxidant effect in lipoprotein oxidation model (Seiichiro et al., 2006).
In another study by Joe et al. (2001) described the antioxidant
property of citrus extract and Ascorbic acid on hypercholesterolemic
human subjects. The results shows that there was no invivo antioxidant
Disscussion
163
effect of ascorbic acid alone but the effect was more significant in the
combination of both Vitamin C and citrus fruits.
From our study citrus flavonoid Hesperidin and Ascorbic acid
when given alone it moderately attenuated the antitubercular induced
toxicity. But when given in combination, it effectively reduced oxidative
damage induced by Isoniazid, Rifampicin and Pyrazinamide by
preventing oxidative stress, hyperlipidemia, mitochondrial dysfunction,
apoptosis and inflammation. This implies that the Hesperidin and
Ascorbic acid work synergistically and prevent the liver from the
oxidative damage.
This finding may have important implications in the use of
Hesperidin and ascorbic acid against antitubercular drug induced
hepatotoxicity.
Conclusion
164
8. CONCLUSION
The present study described the hepatoprotective effect of
hesperidin and Ascorbic acid in 2 different hepatotoxic models (Ethanol
and antitubercular drug).
The result of our present study shows that administration of
ethanol induces hepatic damage which is evidence by increased level of
liver marker enzymes (AST, ALT, ALP, LDH), total cholesterol,
triglycerides, lipid peroxidation (LPO) and subsequently decreased the
level of antioxidant enzymes (SOD, CAT, GSH, VIT C , VIT E).
Concurrent treatment with Hesperidin and Ascorbic acid
attenuated all the changes induced by ethanol and protect the
hepatocytes from the oxidative damage.
On the otherhand antitubercular drug induced oxidative stress
and hepatotoxicity is evidenced by increased level of liver marker
enzymes (AST, ALT, ACP, ALP, LDH, γ GT), LPO, and subsequently
decreased the level of antioxidant enzymes (SOD, CAT, GSH, GST,
GR, GPx, VIT C, VIT E). Antitubercular drug induces hyperlipidaemia is
evidenced by increased level of LDL, VLDL, FFA, TC, TG and
decreased level of HDL and phospholipids.
Similarly, Antitubercular drugs induced apoptosis and
inflammation is evidenced by upregulation of Apoptotic markers
Conclusion
165
(caspase 3, 9, BAX) and down regulation of antiapoptotic markers (Bcl
2). In addition, antitubercular drug upregulated the expression of
inflammatory markers(TNFα, NFκB) &antiinflammatory markers (IL- 10).
Antitubercular drugs leads to membrane destabilisation which is
evidenced by decrease the level of membrane bound ATP ase enzymes
like Na+ K+ ATP ase, Mg+ ATP ase and Ca+ ATP ase.
Conversely supplement with Hesperidin and / or Ascorbic acid
attenuates all the changes induced by the ethanol and antitubercular
drugs and protect the hepatocytes from the oxidative damage. This
shows the hepatoprotective, antioxidant, antilipidemic, antiapoptotic and
membrane stabilising action of HDN and AA against drugs induced
toxicity.
The hepatoprotective effect offered by the combination of both
Hesperidin and Ascorbic acid treatment was found to be significantly
greater than the treatment with either hesperidin or ascorbic acid alone.
This implies the synergistic action of Hesperidin and Ascorbic acid.
Therefore, our study favors the view that Hesperidin and Ascorbic
acid combination may be a useful modulator in alleviating ethanol and
antitubercular drug induced hepatotoxicity. However further research is
need to validate Hesperidin and ascorbic acid combination as a new
therapeutic agent supplemented with antitubercular drugs in the
treatment of TB and also in alcoholic liver disease.
Limitations
166
9. LIMITATIONS AND FUTURE PROSPECTS
Antitubercular drug induced hepatotoxicity was mainly due to the
induction of CYP 2E1 and deficiency of phase II detoxification enzyme
(GST). The gene expression of CYP2E1 and GST was not measured in
our study.
Hence our future prospects will be to examine the genetic variation in
the expression of CYP2E1 Microsomal enzymes and GST.
On the otherhand we planned to investigate the hepatocytes growth
factor gene therapy in drug induced hepatotoxicity.
Bibliography
167
10. BIBLIOGRAPHY
Abraham P. Vitamin C may be beneficial in the prevention of
Paracetamol-induced renal damage. Clin Exp Nephrol. 2005; 9(1):24-
30.
Adewusi EA, Afolayan AJ. Effect of Pelargonium reniforme roots on
alcohol induced liver damage and oxidative stress. Pharm Biol. 2010;
48(9): 980-987.
Agrawal YO, Sharma PK, Shrivastava B, Ojha S, Upadhya HM.
Hesperidin Produces Cardioprotective Activity via PPAR-c Pathway in
Ischemic Heart Disease Model in Diabetic Rats. PLOS ONE.2014;
9(11): e111212.
Ahmad ST, Arjumand W, Nafees S, Seth A, Ali N, Rashid S, Sultana
S,et al. Hesperidin alleviates acetaminophen induced toxicity in Wistar
rats by abrogation of oxidative stress, apoptosis and inflammation.
Toxicol Lett. 2012; 208(2):149-16.
Ahmed OM, Mahmoud A M, Abdel-Moneim A, Ashour M B. Antidiabetic
Effects Of Hesperidin And Naringin In Type 2 Diabetic Rats.
Diabetologia Croatica. 2012; 41(2):53-67.
Aleisa AM, Hatem M, Abuohashish, Mohammed M. Ahmed, Salim S. Al-
Rejaie, Osama A, et al. Ameliorative effects of rutin and ascorbic acid
Bibliography
168
combination on hypercholesterolemia-induced hepatotoxicity in female
rats. Afr J Pharm. Pharmacol. 2013;7(6): 280-288.
Ali ZY. Biochemical Evaluation of Some Natural Products against
Toxicity Induced By Anti-tubercular Drugs in Rats. New York Sci J.
2012; 5(10): 69-80.
Al-Jasabi S, Abdullah MS. The Role of Antioxidant Hesperidin in the
Attenuation of Lung Cancer Caused by Benzo(a) pyrene in Balb/c Mice.
World Applied Sciences Journal. 2013; 22 (8): 1106-1110.
Amir Khan, Deepti Malhotra. Protective Role of Ascorbic Acid (Vitamin
C) Against Hyperlipidemia and Enhanced Oxidizability of Low Density
Lipoprotein in Young Smokers. European Journal of Experimental
Biology. 2011; 1(1):1-9.
Anand AC, Seth AK, Paul M, Puri P. Risk Factors of hepatotoxicity
during anti-tuberculosis treatment. MJAFI .2006; 62(1): 45-49.
Anita S, Tej KB, Om PS. Clinical biochemistry of hepatotoxicity. J Clin
Toxicol. 2011;S4:1–9.
Asduq SA, Kaiser P, Sharma SC, Johri RK. Potentiation of isoniazid-
induced liver toxicity by rifampicin in a combinational therapy of
antitubercular drugs (rifampicin, isoniazid and pyrazinamide) in Wistar
rats a toxicity profile study. Hepatol. 2007;37(10):845-53.
Bibliography
169
Attri S, Rana SV, Vaiphei K, Sodhi CP, Katyal R, Goel RC,et al.
Isoniazid and Rifampicin induced oxidative hepatic injury protection by
N-acetylcysteine. Hum Exp Toxicol 2000;19(9):517-22.
Ayman MM, Mousa OG, Ayman SS. Berberine attenuates Isoniazid
induced Hepatotoxicity by modulating peroisome proliferator activated
receptor γ, oxidative stress and inflammation. International journal of
pharmacology. 2014; 10(8): 451-460.
Banerjee P, Bhattacharyya N, Bhattacharjee S, Boujedaini AR, Khuda-
Bukhsh B. Ascorbic acid combats arsenic-induced oxidative stress in
mice liver.Ecotox Eaviron Safe. 2009; 72: 639-649.
Bartoszewski R, Hering A, Marszall M, Stefanowicz Hajduk J,
Bartoszewska S, Kapoor N, et al. Mangiferin has an additive effect on
the apoptotic properties of hesperidin in Cyclopia sp tea extracts. PLOS
One.2014;9(3): e92128.
Basini Jyothi, Mohanalakshmi S, Anitha k. Protective effect of Mirabilis
jalapa leaves on Anti-tubercular drugs induced hepatotoxicity. Asian J
Pharm Clin Res. 2013;6 Suppl 3: 221- 24.
Battaglia V, Compagnone A, Bandino A. Cobalt induces oxidative stress
in isolated liver mitochondria responsible for permeability transition and
intrinsic apoptosis in hepatocyte primary cultures. Int J Biochem Cell
Biol. 2009;41(3):586–594.
Bibliography
170
Bautista AP. Free radicals, chemokines and cell injury in HIV-I and SIV
infections and alcoholic an official Publication of Phcog.Net hepatitis.
Free Radic Biol Med. 2001;31:1527–1532.
Bazhanova ED, Sukhanov DS, Teplyi DL. Pathways of apoptosis
regulation in hepatocytes induced by first-line antitubercular drugs. Bull
Exp Biol Med. 2015; 158(5):650–653.
Bhadauria S, Mishra R, Kanchan R, Tripathi C, Srivastava A, Tiwari A.
Isoniazid-induced apoptosis in HepG2 cells. generation of oxidative
stress and Bcl-2 down-regulation.Toxicol Mech Methods. 2010; 20(5):
242–251.
Bhadauria S, Singh G, Sinha N, Srivastava S. Isoniazid induces
oxidative stress, mitochondrial dysfunction and apoptosis in Hep G2
cells. Cell Mol Biol (Noisy-le-grand). 2007; 53(1):102-14.
Bing C, Xiaomeia C, Jinhenga L. Gene dose effect of NAT2 variants on
the pharmacokinetics of isoniazid and acetylisoniazid in healthy
Chinese subjects. Drug Metabol Drug Interact. 2011; 26:113–8.
Bok SH, Lee SH, Park YB, Bae KH, Son KH, Jeong TS, et al. Plasma
and hepatic cholesterol and hepatic activities of 3-hydroxy-3-methyl-
glutaryl-CoA reductase and acyl CoA: cholesterol transferase are lower
in rats fed citrus peel extract or a mixture of citrus bioflavonoids. J Nutr.
1999; 129:1182–1185.
Bibliography
171
Bonting, S.L. Sodium potassium activated adenosine triphosphatase
and carbon transport. In Membrane and Iron Transport, (ed Bittar EE),
WileyInterscience, London .1970; 1: 257-363.
Bourdi M, Masubuchi Y, Reilly TP, Amouzadeh HR, Martin JL, George
JW, Shah AG, Pohl LR. Protection against acetaminophen-induced liver
injury and lethality by interleukin 10: Role of inducible nitric oxide
synthase. Hepatology. 2002; 35: 289–298.
Bratton SB, MacFarlane M, Cain K, Cohen GM. Protein complexes
activate distinctcaspase cascades in death receptor and stress-
activated apoptosis. Exp Cell Res.2000; 256: 27-33.
British Medical Research Council (Hong Kong Chest Service).
Controlled trial of 2, 4 and 6 months of pyrazinamide in 6 month, three
times weekly regimens for smear positive pulmonary tuberculosis,
including an assessment of a combined preparation of isoniazid,
rifampin and pyrazinamide. Ann Rev Respir Dis.1991; 143: 700-6.
Brown JS, Wilson WE, Grant LD. Dosimetric comparisons of particle
deposition and retention in rats and humans. Inhal Toxicol. 2005; 17(7-
8): 355–385.
Budihardjo I, Oliver H, Lutter M, Luo X, and Wang X. “Biochemical
pathways of caspase activation during apoptosis,” Annual Review of
Cell and Developmental Biology. 1999; 15: 269–290.
Bibliography
172
Burk O, Koch I, Raucy J. The induction of cytochrome P450 3A5
(CYP3A5) in the human liver and intestine is mediated by the xenobiotic
sensors pregnane X receptor (PXR) and constitutively activated
receptor (CAR) J Biol Chem. 2004;279:38379–38385.
Byrne JA, Strautnieks SS, Mieli-Vergani G. The human bile salt export
pump: characterization of substrate specificity and identification of
inhibitors. Gastroenterology. 2002;123(5):1649–1658.
Carcamo JM, Pedraza A, Bórquez-Ojeda O, Golde DW. Vitamin C
suppresses TNF alpha-induced NF kappa B activation by inhibiting I
kappa B alpha phosphorylation.Biochemistry. 2002;41(43):12995-3002.
Carlberg I, Mannervik B. Glutathione reductase levels in rat brain.
Journal of Biological Chemistry. 1975; 250 (90):5475–5480.
Carnes CA, Chung MK, Nakayama T, Nakayama H, Baliga RS, Piao S,
et al. Ascorbate attenuates atrial pacing-induced peroxynitrite formation
and electrical remodeling and decreases the incidence of postoperative
atrial fibrillation. Circ Res. 2001;89(6):E32–8.
Chan AC. Partners in defense, Vitamin E and Vitamin C. Can J Physiol.
Pharmacol. 1993;71(9): 725-731.
Chandane RD, Jaju JB, Ghadlinge MS, Bhosale RR, Chandrakapure
AR. Effect of honey on hepatotoxicity induced by antitubercular drugs in
albino rats. Int J Basic Clin Pharmacol. 2013; 2(2):177-81.
Bibliography
173
Chanet A, Milenkovic D, Manach C, Mazur A, Morand C. Citrus fla-
vanones: what is their role in cardiovascular protection. J. Agric. Food
Chem.2012; 60(36): 8809–8822.
Chen J, Raymond K. The effect of rifampicin on cholestasis.
International Journal of Pharmacology. 2005;3(2).
Chen Q, Espey MG, Sun AY, Pooput C, Kirk KL, Krishna MC, et al.
Pharmacologic doses of ascorbate act as a prooxidant and decreases
growth of aggressive tumor xenografts in mice. Proc. Natl Acad Sci.
2008;105(32): 11105–11109.
Cho J. Antioxidant and neuroprotective effects of hesperidin and its
aglycone Hesperetin. Arch Pharm Res. 2006; 29(8):699-706.
Chowdhury A, Santra A, Bhattacharjee K, Ghatak S, Saha DR, Dhali
GK. Mitochondrial oxidative stress and permeability transition in
isoniaizd and Rifampicin induced liver injury in mice. J Heapatol. 2006;
45(1):117-26.
Chowdhury A, Santra A, Kundu S. Induction of oxidative stress in
antitubercular drug-induced hepatotoxicity. Indian J. Gastroenterol.
2001; 20(3): 97–100.
Christine Morand, Claude Dubray, Dragan Milenkovic, Delphine Lioger,
Jean Franc¸ Ois Martin, et al. Hesperidin contributes to the vascular
Bibliography
174
protective effects of orange juice: a randomized crossover study in
healthy volunteers. Am J Clin Nutr. 2011; 93:73–80.
Coffin CS, Fraser HF, Panaccione R, Ghosh S. Liver diseases
associated with anti-tumor necrosis factor-alpha (TNF-α) use for
inflammatory bowel disease. Inflamm Bowel Dis. 2011;17:479–484. doi:
10.1002/ibd.21336.
Comporti M, Signorini C, Leoncini S, Gardi C, Ciccoli L, Giardini A, et al.
Ethanol-induced oxidative stress basic knowledge. Genes &
Nutrition, 2010; 5(2):101–109. http://doi.org/10.1007/s12263-009-0159-
9
Corazza N, Kassahn D, Jakob S, Badmann A, Brunner T. TRAIL-
induced apoptosis: between tumor therapy and immunopathology. Ann
N Y Acad Sci. 2009;1171: 50–58.
Corbett EL, Watt CJ, Walker N, Maher D, Williams BG, Raviglione MC,
et al. The growing burden of tuberculosis: global trends and interactions
with the HIV epidemic. Arch Intern Med. 2003; 163(9):1009–1021.
Crozier A, Jaganath IB, Clifford MN. Dietary phenolics. Chemistry,
bioavailability and effects on health. Nat Prod Rep. 2009; 26(8):1001-
43.
Bibliography
175
Cuddihy SL, Parker A, Harwood T, Vissers MC, Winterbourn C.
Ascorbate interacts with reduced glutathione to scavenge phenoxyl
radicals in HL 60 cells. Free. Radic Biol Med. 2008; 44(8): 1637-1644.
Czaja MJ. Cell signalling in oxidative stress induced liver injury. Semin.
Liver Dis. 2007; 27(4): 378-389.
Dakhale GN, Khanzode SD, Khanzode SS, Saoji A. Supplementation of
vitamin C with atypical antipsychotics reduces oxidative stress and
improves the outcome of schizophrenia. Psychopharmacology.
2005;182(4):494–8.
Dawsey SP, Hollenbeck A, Schatzkin A, Abnet CC, Lee JE. A
prospective study of vitamin and mineral supplement use and the risk of
upper gastrointestinal cancers. PLOS One. 2014; 9(2):e88774.
Deavall GD, Elizabeth AM, Judith MH, Ruth R. Drug-induced oxidative
stress and toxicity. J Toxicol. 2012.
http://dx.doi.org/10.1155/2012/645460.
Deck DH, PharmD & Winston LG. Antimycobacterial Drugs. In; Katzung
BG, Masters SB Trevor AJ. Basic & clinical pharmacology. 12th ed.
New York: McGraw Hill Lange; 2012:839-847.
Delaney J, Timbrell JA. Role of cytochrome P450 in hydrazine toxicity in
isolated hepatocytes in vitro. Xenobiotica. 1995;25:1399– 410.
Bibliography
176
Deng X, Luyendyk JP, Ganey PE, Roth RA. Inflammatory stress and
idiosyncratic hepatotoxicity: Hints from animal models. Pharmacol Rev.
2009; 61(3): 262- 282.
Desagher S, Martinou JC. “Mitochondria as the central control point of
apoptosis,”. Trends in Cell Biology. 2000; 10(9): 369–377.
Desai ID. Vitamin E analysis methods for animal tissues. Methods
Enzymol. 1984;105:138-144.
Desta Z, Soukhova NV, Flockhart DA .Inhibition of cytochrome P450
(CYP450) isoforms by isoniazid: potent inhibition of CYP2C19 and
CYP3A.Antimicrob Agents Chemother. 2001; 45(2): 382-392.
Devin A, Cook A, Lin Y, Rodriguez Y, Kelliher M, Liu Z. The distinct
roles of TRAF2 and RIP in IKK activation by TNF-R1: TRAF2 recruits
IKK to TNF-R1 while RIP mediates IKK activation. Immunity. 2000;
12(4):419-29.
Dhingra S, Sharma A.K, Arora RC, Slezak J, Singal PK. IL-10
attenuates TNF-alpha-induced NF kappa B pathway activation and
cardiomyocyte apoptosis. Cardiovasc. Res. 2009; 82(1): 59–66.
El Mashad GM, ElSayed HM, Nosair NA. Effect of vitamin C
supplementation on lipid profile, serum uric acid, and ascorbic acid in
children on hemodialysis. Saudi J Kidney Dis Transpl. 2016;
27(6):1148-1154.
Bibliography
177
El-Gendy KS, Aly NM, Mahmoud FH, Kenawy A, El-Sebae AK. The role
of vitamin C as antioxidant in protection of oxidative stress induced by
imidacloprid.Food Chem. Toxicol. 2010; 48(1): 215-221.
Ellman GL.Tissue sulfhydryl groups. Arch. Biochem. Biophys.
1959;82:70–77.
Eminzade S, Uras F, Izzettin FV. Silymarin protects liver against toxic
effects of anti-tuberculosis drugs in experimental animals. Nutrition &
Metabolism. 2008;5:18. doi:10.1186/1743-7075-5-18.
Endo Y, Kukuchi T, Nakamura M. Orinithine and histidine
decarboxylase activities in mice sensitized to endotoxin, interleukin-1 or
tumor necrosis factor by D-galactosamine. Br J Pharmacol. 1992;107:
888–894.
Eteng MU, Ibekwe HA, Amatey TE, Bassey BJ, Uboh FU, and Owu DU,
Effect Of Vitamin C On Serum Lipids And Electrolyte Profile Of Albino
Wistar Rats. Nigerian Journal Of Physiological Sciences. 2006; 21 (1-2);
15-19.
Feagins LA, Flores A, Arriens C, Park C, Crook T, Reimold A et al.
Nonalcoholic fatty liver disease: A potential consequence of tumor
necrosis factor-inhibitor therapy. Eur J Gastroenterol. Hepatol. 2015;
27:1154–1160.
Bibliography
178
Figueroa-Mendez R and Rivas-Arancibia S. Vitamin C in Health and
Disease: It’s Role in the Metabolism of Cells and Redox State in the
Brain. Front. Physiol. 2015;6:397.
Filho CB, Del Fabbro L, de Gomes MG, Goes AT, Souza LC, Boeira
SP, et al. Kappa-opioid receptors mediate the antidepressant-like
activity of hesperidin in the mouse forced swimming test. Eur J
Pharmacol. 2013; 698(1-3):286-91. doi: 10.1016/j.ejphar.2012.11.003.
Epub 2012 Nov 20.
Forget EJ, Menzies D. Adverse reactions to first-line antituberculosis
drugs. Expert Opin Drug Saf. 2006; 5:231–49.
Fraschini F, Demartini G, Esposti D. Pharmacology of Silymarin. Clin
Drug Invest. 2002; 22(1):51-65.
Gandhi C, Upaganalawar A, Balaraman R. Protection against in vivo
focal myocardial ischemia/reperfusion injury-induced arrhythmias and
apoptosis by hesperidin.Free Radic Res. 2009; 43(9):817-27.
Gao, Bosong. Interactions between flavonoids, Vitamin C and Vitamin E
in protecting membranes against oxidative stress.
Garcia A, Morales P, Arranz N, Delgado ME, Rafter J, Haza AI.
Antiapoptotic effects of dietary antioxidants towards N-nitrosopiperidine
and N-nitrosodibutylamine-induced apoptosis in HL-60 and HepG2
cells. J Appl Toxicol. 2009;29(5):403-13. doi: 10.1002/jat.1426.
Bibliography
179
Garg A, Garg S, Zaneveld LJ and Singla AK. Chemistry and
pharmacology of the citrus bioflavonoid hesperidin. Phytother Res.
2001;15(8): 655–69.
Gaskill CL, Miller LM, Mattoon JS, Hoffmann WE, et al. Liver
histopathology and liver serum alanine aminotransferase and alkaline
phosphatase activities in epileptic dogs receiving Phenobarbital. Vet
Pathol. 2005;42(2):147–160.
Gautam M, Agrawal M, Gautam M, Sharma P, Gautam AS, Gautam S.
Role of antioxidants in generalised anxiety disorder and depression.
Indian J Psychiatry. 2012; 54(3):244–7.
Geetha A, Marar T, Shyamala Devi CS. Effect of α-tocopherol on
doxorubicin induced changes in rat liver and heart microsomes. Ind J
Exp Biol. 1991; 29(8): 782–785.
Georgieva N, Gadjeva V, Tolekova A. New Isonicotinoylhydrazones
With SSA protect against oxidative- hepatic injury of Isoniazid. TJS.
2004; 2: 37-43.
Glickman SW, Rasiel EB, Hamilton CD, Kubataev A, Schulman KA.
Medicine. A portfolio model of drug development for tuberculosis.
Science. 2006; 311:1246–1247.
Grajeda-Cota P, Ramírez-Mares MV, González de Mejía E. Vitamin C
Protects against in Vitro Cytotoxicity of Cypermethrin in Rat
Bibliography
180
Hepatocytes. Toxicology in vitro. 2004;18(1): 13-19. doi:10.1016/S0887-
2333(03)00077-8
Gueguen S, Pirollet P, Leroy P, Guilland JC, Arnaud J, Paille F et al.
Changes in Serum Retinol, α-Tocopherol, Vitamin C, Carotenoids, Zinc
and Selenium after Micronutrient Supplementation during Alcohol
Rehabilitation. J Am Coll Nutr. 2003; 22:303-310.
Gupta AK, Misra N. Hepatoprotective activity of aqueous ethanolic
extract of Chamomile capitula in paracetamol intoxicated albino rats.
Am J Pharmacol Toxicol. 2006; 1(1):17-20.
Habig, WH, Pabst, MJ, Jakoby, WB. Glutathione S-transferases.
Journal of Biological Chemistry 1974; 249(7):130–7139.
Hamideh Parhiz, Ali Roohbakhsh, Fatemeh Soltani, Ramin Rezaee,
Mehrdad Iranshahi. Antioxidant and Anti-Inflammatory Properties of the
Citrus Flavonoids Hesperidin and Hesperetin: An Updated Review of
their Molecular Mechanisms and Experimental Models. Phytother. Res.
2015; 29:323–331. DOI: 10.1002/ptr.5256
Hamideh Parhiz, Ali Roohbakhsh, Fatemeh Soltani, Ramin Rezaee and
Mehrdad Iranshahi.Antioxidant and Anti-Inflammatory Properties of the
Citrus Flavonoids Hesperidin and Hesperetin: An Updated Review of
their Molecular Mechanisms and Experimental Models. Phytother. Res.
2015; 29: 323–331.
Bibliography
181
Harrison FE. A critical review of vitamin C for the prevention of age-
related cognitive decline and Alzheimer’s disease. J Alzheimers Dis.
2012; 29(4):711–26.
Hayes JD, Flanagan JU, Jowsey IR. Glutathione transferases. Annu
Rev Pharmacol Toxicol. 2005; 45:51-88.
Hazarika A, Sarkar SN .Effect of isoproturon pretreatment on the
biochemical toxicodynamics of anilofos in male rats. Toxicol.
2001;165:87-95.
Head KA. Ascorbic acid in the prevention and treatment of cancer.
Altern Med Rev. 1998; 3(3):174–86.
Heikal TM, Mossa ATH, Khalil WKB. Protective Effects of Vitamin C
against Methomyl-Induced Injures on the Testicular Antioxidant Status
and Apoptosis-Related Gene Expression in Rat. J Environ Anal Toxicol.
2014; 4: 255. doi: 10.4172/2161-0525.1000255 186.
Hewage SRKM, Piao MJ, Kang KA, et al. Hesperidin Attenuates
Ultraviolet B-Induced Apoptosis by Mitigating Oxidative Stress in
Human Keratinocytes. Biomolecules & Therapeutics. 2016;24(3):312-
319.
Hjerten S, Pan H. Purification and characterization of two forms of low
affinity calcium ion ATPase from erythrocyte membranes Biochim.
Biophys. Acta.1983; 755: 457-466.
Bibliography
182
Hoffman RP, Dye AS, Bauer JA. Ascorbic acid blocks hyperglycaemic
impairment of endothelial function in adolescents with type 1 diabetes.
Pediatr Diabetes. 2012;13(8):607–10.
Holdin MR. Clinical pharmacokinetics of the antituberculosis drugs. Clin
Pharm. 1984; 9(6): 511–544.
Holt MP, Ju C. Mechanisms of drug-induced liver injury. The AAPS
Journal. 2006;8(1):E48-E54.
Huang HS, Chern HD, Su WJ, Wu JC, Chang SC, Chiang CH et al.
Cytochrome P4502E1 genotype and the susceptibility to
antituberculosis drug-induced hepatitis. Hepatology. 2003; 37(4): 924-
930.
Huang YS, Su WJ, Huang YH, Chen CY, Chang FY, Lin HC, et al.
Genetic polymorphisms of manganese superoxide dismutase, NAD
(P)H: quinone oxidoreductase, glutathione S-transferase M1 and T1,
and the susceptibility to drug-induced liver injury. J Hepatol
2007;47:128–34.
Hussain Z, Kar P, Husain SA. Antituberculosis drug-induced hepatitis:
risk factors, prevention and management. Indian J Exp Biol 2003;
41(11):1226-32.
Bibliography
183
Ibrahim MA, Buhari GO, Aliyu AB.Amelioration of Monosodium
Glutamate- Induced Hepatotoxicity by Vitamin C. European Journal of
Scientific Research.2011:60(1);159-165
Ihab T. Abdel-Raheem and Ahmed A. Abdel-Ghany.Hesperidin
Alleviates Doxorubicin-Induced Cardiotoxicity in Rats. Journal of the
Egyptian Nat. Cancer Inst. 2009; 21(2): 175-184.
Imogen M, Julia W, Sarah F, Roger W. Anti-tuberculous therapy and
acute liver failure. The Lancet. 1995; 345: 555- 556.
Isabel Perez-Cruz, Juan M, Carcamo, and David W. Golde. Vitamin C
inhibits FAS-induced apoptosis in monocytes and U937 cells. BLOOD,
2003:102(1):335-343.
Issabeagloo E, Taghizadieh M. Hepatomodulatory Action of Camellia
sinensis Aqueous Extract against Isoniazid-Rifampicin Combination
Induced Oxidative Stress in Rat. Advances in Bioresearch. 2012;3(3):
18 – 27.
Jadhav VB, Thakare VN, Suralkar AA, Deshpande AD, Naik SR.
Hepatoprotective activity of Luffa acutangula against CCl4 and
rifampicin induced liver toxicity in rats. A biochemical and
histopathological evaluation. Indian J Exp Biol. 2010;48:822–9.
Jamis-Dow C. A. Rifampin and rifabutin and their metabolism by human
liver esterases, Xenobiotica. 1997; 27(10): 1015–1024.
Bibliography
184
Jason E. Stout , John J. Engemann , Allen C. Cheng , et al. Safety of 2
months of rifampin and pyrazinamide for treatment of latent
tuberculosis, American Journal of Respiratory and Critical Care
Medicine. 2003;167 (6):824-827.
Jia R, Cao L, Du J, Xu P, Jeney G, Yin G. The protective effect of
silymarin on the carbon tetrachloride (CCl4)-induced liver injury in
common carp (Cyprinus carpio). In Vitro Cell Dev Biol Anim.
2013;49(3):155-61.
Jiang ZY, Hunt JV, Wolff SD. Ferrous ion oxidation in the presenceof
xylenol orange for detection of lipid hydroperoxide in low-
densitylipoprotein, Anal Biochem. 1992; 202:384–389.
Jin, Xiaoting, Li Song, Xiangyuan Liu, Meilan Chen, Zhuoyu Li, Long
Cheng, et al. Protective Efficacy of Vitamins C and E on p,p9-DDT-
Induced Cytotoxicity via the ROSMediated Mitochondrial Pathway and
NF-kB/FasL Pathway. PLOS ONE. 2014; 9(12): e113257.
Jomova K, Valko M. Importance of iron chelation in free radical-induced
oxidative stress and human disease. Curr Pharm Des. 2011;
17(31):3460-73.
Jyothi Basini S, Mohanalakshmi G, Mallikarjuna. Mechanisms For
Hepatotoxicity Induced By Anti-Tubercular Drugs: A Review. Journal of
Pharmacy Research. 2012;5(8):4338-434.
Bibliography
185
Kakkar P, Das B and Viswanathan PN. A modified spectrophotometric
assay of SOD. Indian Journal of Biochemistry Biophysics. 1984; 2:130-
132
Kale BP, Kothekar MA, Tayade HP, Jaju JB. Effect of aqueous extract
of Azadirachta indica leaves on hepatotoxicity by antituberculosis drugs
in rats. Indian J Pharmacol. 2003;35:177–80.
Kalpana KB, Devipriya N, Srinivasan M, Vishwanathan P, Thayalan K,
Menon VP, et al. Evaluating the radioprotective effect of hesperidin in
the liver of Swiss albino mice. Eur J Pharmacol. 2011; 658(2-3): 206–
12.
Kalpana KB, Srinivasan M, Menon VP. Evaluation of antioxidant activity
of hesperidin and its protective effect on H2O2 induced oxidative
damage on pBR322 DNA and RBC cellular membrane. Mol Cell
Biochem. 2009; 323: 21–29.
Kamaraj S, Anandakumar P, Jagan S, Ramakrishnan G, Devaki T.
Modulatory effect of hesperidin on benzo (a) pyrene induced
experimental lung carcinogenesis with reference to COX-2, MMP-2 and
MMP-9. European Journal of Pharmacology. 2010; 649: 320–327.
Kamaraj S, Anandakumar P, Jagan S, Ramakrishnan G, Devaki T.
Modulatory effect of hesperidin on benzo(a)pyrene induced
Bibliography
186
experimental lung carcinogenesis with reference to -COX-2, MMP-2 and
MMP-9. Eur J Pharmacol. 2010; 649: 320–327.
Kaplowitz N. Drug-induced liver disorders: implications for drug
development and regulation. Drug Saf. 2001; 24(7): 483-490.
Kawaguchi K, Kikuchi SI, Hasunuma R, Maruyama H, Yoshikawa T,
Kumazawa Y. A citrus flavonoid hesperidin suppresses infection-
induced endotoxin shock in mice. Biol Pharmaceut Bull. 2004; 27: 679–
683.
Kawanaka M, Nishino K, Nakamura J, Suehiro M, Goto D, Urata N, et
al.Treatment of nonalcoholic steatohepatitis with vitamins E and C: a
pilot study. Hepat Med. 2013, 5:11-16.
Khalili H, Dashti-Khavidaki S, Rasoolinejad M, Rezaie L, Etminana
M.Anti-tuberculosis drugs related hepatotoxicity Incidence, risk factors,
pattern of changes in liver enzymes and outcome. DARU. 2009;17: 163-
167.
Kim HK, Jeong TS, Lee MK, Park YB, Choi MS. Lipid-lowering efficacy
of hesperetin metabolites in high-cholesterol fed rats. Clin Chim Acta.
2003; 327(1-2):129-37.
Kim SH, Kim BK, Lee YC. Antiasthmatic Effects of Hesperidin, a
Potential Th2 Cytokine Antagonist, in a Mouse Model of Allergic
Asthma. Mediat Inflamm.2011: 485402.
Bibliography
187
Klaassen CD; (Ed.); Casarett and Doull's toxicology; the basic science
of poisons;7th Edition;Mc-Graw Hill, New York; 2008; 557-576.
Koch OR, Pani G, Borrello S, Colavitti R, Cravero A, Farre S, Galeotti T.
Oxidative stress and antioxidant defenses in ethanol-induced cell injury.
Mol Asp Med. 2004; 25:191–198.
Kumar R, Shalimar, Bhatia V, Khanal S, Sreenivas V, Gupta SD, et al.
Antituberculosis therapy-induced acute liver failure: magnitude, profile,
prognosis, and predictors of outcome. Hepatology. 2010;51:1665–74.
Lacroix CT, Phan Hoang J, Nouveau C, Guyonnaud G, Laine H,
Duwoos, Lafont O. et al., Pharmacokinetics of pyrazinamide and its
metabolites in healthy subjects, European Respiratory Journal. 1989;
36( 4): 395-400.
Lammert C, Bjornsson E, Niklasson A, Chalasani N. Oral medications
with significant hepatic metabolism at higher risk for hepatic adverse
events. Hepatology. 2010;51:615–20.
Lee KK, Fujimoto K, Zhang C, Schwall CT, Alder NN, Pinkert CA, et al.
Isoniazid-induced cell death is precipitated by underlying mitochondrial
complex I dysfunction in mouse hepatocytes. Free Radic Biol Med.
2013;65:584–94.
Bibliography
188
Leifeld L, Nattermann J, Fielenbach M, Schmitz V, Sauerbruch T,
Spengler U. Intrahepatic activation of caspases in human fulminant
hepatic failure. Liver Int. 2006; 26: 872–879.
Li R, Cai L, Xie XF, Yang F, Li J. Hesperidin suppresses adjuvant
arthritis in rats by inhibiting synoviocyte activity. Phytother Res. 2010;
24: 71–76.
Li R, Li J, Cai L, Hu CM, Zhang L. Suppression of adjuvant arthritis by
hesperidin in rats and its mechanisms.J Pharm Pharmacol. 2008;
60(2):221-8. doi: 10.1211/jpp.60.2.0011.
Li S, Tan H-Y, Wang N, et al. The Role of Oxidative Stress and
Antioxidants in Liver Diseases. Piva T, ed. International Journal of
Molecular Sciences. 2015;16(11):26087-26124.
Liao K and Yin M. Individual and combined antioxidant effects of
phenolic agents in human erythrocyte membrane ghosts and
phophatidylcholine liposome systems: importance of the partition
coefficient. J Agric Food Chem. 2000;48:2266-2270.
Loscalzo LM, Wasowski C, Paladini AC, Marder M. Opoid receptors are
involved in the sedative and antinociceptive effects of hesperidin as well
as in its potentiation with benzodiazepines. Eur J Pharmacol. 2008, 580:
306-313.
Bibliography
189
Loscalzo LM, Yow TT, Wasowski C, Chebib M, Marder M. Hesperidin
induces antinociceptive effect in mice and its aglycone, hesperetin,
binds to μ-opioid receptor and inhibits GIRK1/2 currents. Pharmacol
Biochem Behav. 2011 ; 99(3):333-341. doi: 10.1016/j.pbb.2011.05.018.
Lothar Rossig, Jorg Hoffmann, Benedicte Hugel, Ziad Mallat, Astrid
Haase, Jean-Marie Freyssinet et al. Circulation. 2001;104:2182-2187.
Lowry OH, Rosebrough NJ, Farr AL, Randell RJ. Protein measurement
with the folin phenol reagent. J Biol Chem. 1951;193:265-75.
Luis S M, Christian Mendez, Daniell Hill, Shirish Barve, Craig JM.
Diagnosis and Treatment of Alcoholic Liver Disease and Its
Complications. Alcohol Research & Health. 2003;27(3):247-256.
Mahfouz MM, Kummerow FA. Vitamin C or vitamin B6 supplementation
prevent the oxidative stress and decreases of prostacyclin generation in
homocysteinemic rats. Int J Biochem CellBiol. 2004;36:1919–1932.
Mannan Hajimahmoodi, Ghazaleh Moghaddam, Seyed Mohsen
Mousavi, Naficeh Sadeghi, Mohammad Reza Oveisi, Behrooz Jannat.
Total Antioxidant Activity, and Hesperidin, Diosmin, Eriocitrin and
Quercetin Contents of Various Lemon Juices. Tropical Journal of
Pharmaceutical Research. 2014; 13 (6): 951-956.
Bibliography
190
Marc P, McRae. Vitamin C supplementation lowers serum low density
lipoprotein cholesterol and triglycerides: a meta-analysis of 13
randomized controlled trials. JCM. 2008; 7(2):548–81.
Marc P, McRae. Vitamin C supplementation lowers serum low-density
lipoprotein cholesterol and triglycerides: a meta-analysis of 13
randomized controlled trials. J Chiropr Med. 2008; 7(2): 48–58.
Martin MU, Wesche H. Summary and comparison of the signaling
mechanisms of the Toll/interleukin-1 receptor family. Biochim Biophys
Acta. 2002; 1592(3): 265-80.
Mehmedagic A, Verite P, Menager S, Tharasse C, Chabenat C, André
D. et al. Determination of pyrazinamide and its main metabolites in rat
urine by high-performance liquid chromatography, Journal of
Chromatography B: Biomedical Sciences and Applications.1997;695(2):
365-372.
Naseer MI, Ullah N, Ullah I, Koh PO, HY Lee, Park MS, Kim
MO.Vitamin C protects against ethanol and PTZ-induced apoptotic
neurodegeneration in prenatal rat hippocampal neurons.2011:65(7),
562–571.
Mikirova N, Casciari J, Rogers A, Taylor P. Effect of high-dose
intravenous vitamin C on inflammation in cancer patients. J Transl Med.
2012; 10:189.
Bibliography
191
Milenkovic D, Deval C, Dubray C, Mazur A, Morand C. Hesperidin
displays relevant role in the nutrigenomic effect of orange juice on blood
leukocytes in human volunteers: a randomized controlled cross-over
study. PLOS One. 2011 ;6(11):e26669. doi:
10.1371/journal.pone.0026669.
Mitchell JR, Snodgrass WR, Gillette JR. The role of biotransformation in
chemical-induced liver injury, Environ Health Perspect. 1976;15:27-38.
Miwa Y, Mitsuzumi H, Sunayama T, Yamada M, Okada K, Kubota M et
al. Glucosyl hesperidin lowers serum triglyceride level in
hypertriglyceridemic subjects through the improvement of very low-
density lipoprotein metabolic abnormality. J Nutr Sci Vitaminol (Tokyo).
2005; 51(6):460-70.
MM El-Shafey and MF Abd-Ellah Mostafa. Hesperidin Improves Lipid
Profile and Attenuates Oxidative Stress in Hypercholesterolemic Rats.
Int J Pharma Sci. 2014, 4(3): 554-559.
Mohamed Saleem Thattakudian Sheik Uduman, Ramkanth
Sundarapandian, Azagusundharam Muthumanikkam,Gnanaprakash
Kalimuthu, Angala Parameswari S,Thiruvengada Rajan Vasanthi
Srinivas, et al. Protective effect of methanolic extract of Annona
squamosa linn in Isoniazid-Rifampicin induced hepatotoxicity in rats.
Pak J Pharm Sci. 2011; 24(2):129-134.
Bibliography
192
Monfort A, Wutz A. Breathing-in epigenetic change with vitamin C.
EMBO Rep. 2013; 14: 337–346.
Mor F, Ozmen O. Effect of vitamin C in reducing the toxicity of
endosulfan in liver in rabbits. Exp Toxicol Pathol. 2010; 62:75-80.
Nakajima A, Fukami T, Kobayashi Y, Watanabe A, Nakajima M, Yokoi
T. Human arylacetamide deacetylase is responsible for deacetylation of
rifamycins: rifampicin, rifabutin, and rifapentine, Biochem Pharmacol.
2011; 82( 11);1747–1756.
Nannelli A, Chirulli V, Longo V. Expression and induction by rifampicin
of CAR- and PXR-regulated CYP2B and CYP3A in liver, kidney and
airways of pig. Toxicology. 2008; 252:105–112.
Naseer MI, Ullah N, Ullah I, Koh PO, Lee HY, Park MS, Kim
MO.Vitamin C protects against ethanol and PTZ-induced apoptotic
neurodegeneration in prenatal rat hippocampal neurons. Synapse.
2011; 65(7): 562–571.
Naveen Tirkey, Sangeeta Pilkhwal, Anurag Kuhad, Kanwaljit
Chopra.Hesperidin, a citrus bioflavonoid, decreases the oxidative stress
produced by carbon tetrachloride in rat liver and kidney. BMC
Pharmacology. 2005; 5(2):1-8.doi:10.1186/1471-2210-5-2
Bibliography
193
Nelson SD, Mitchell JR, Timbrell JA, Snodgrass WR, Corcoran GB.
Isoniazid and iproniazid: activation of metabolites to toxic intermediates
in man and rat. Science. 1976; 193(4256): 901-903.
Neuzil J, Thomas SR, Stocker R. Requirement for, promotion, or
inhibition by alpha-tocopherol of radical-induced initiation of plasma
lipoprotein lipid peroxidation. Free Radic Biol Med.1997;22:57–71.
Nishikimi M, Fukuyama R, Minoshima S, Shimizu N, Yagi K. Cloning
and chromosomal mapping of the human nonfunctional gene for L-
gulono-γ-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis
missing in man. J Biol Chem. 1994; 269: 13685–13688.
Nkosi CZ, Opoku AR, Terblanche SE. Effect of pumpkin seed
(Cucurbita pepo) protein isolate on the activity levels of certain plasma
enzymes in CCl4-induced liver injury in low protein fed rats. Phy Res.
2005;19:341–5.
Nordmann R. Alcohol and antioxidant systems. Alcohol and Alcoholism.
1994; 29: 513–522.
Odigie IP, Okpoko FB, Ojobor PD. Antioxidant effects of vitamin C and
E on phenyl hydrazine-induced haemolysis in Sprague Dawley rats:
evidence for a better protection by vitamin E. Nig Postgrad Med J. 2007;
14: 1-7.
Bibliography
194
Ohkawa H, Ohishi N, Yagi K. Assay of lipid peroxide in animal tissue by
TBA reaction. Anal Biochem. 1979;95:351-8
Ohnishi T, Suzuki T, Suzuki Y, Ozawa K. A comparative study of
plasma membrane Mg2+ ATPase activities in normal, regenerating and
malignant cells. Biochem Biophys Acta.1962; 684 :67-74.
Ohta Y, Kongo-Nishimura M, Hayashi T, Kishikawa T. Effect or Oren-
gedoku-To (Huanglian-Jie-Du-Tang) extract on disruption of hepatic
antioxidant defense system in rats treated with D-galactosamine. J
Ethanopharmacol. 2002; 94: 323–329.
Omaye ST, Turnbull JD, Sauberlich HE. Selected methods for the
determination of ascorbic acid in animal cells, tissues and fluids.
Methods Enzymol.1979; 62:1–11.
Ortotani, Novelli G. Conti A, Raffade de Gondio A, Moraldi E cantini.
The effect of glutathione and N. Acetyl cysteine on lipid peroxidative
damage in patients with early septic shock. Am J RespirCrit Care Med.
2010; 161:1907-11.
Osama A Alkhamees. Protective Effects of Vitamin-P and Vitamin-C on
Hypercholesterolemia -induced Oxidative Hepatic Damage and Lipid
Profile Changes in Female Rats: A Comparative Study. Journal of
Applied Pharmaceutical Science. 2013; 3(4): 099-105.
Bibliography
195
OShea RS, Dasarathy S, McCullough AJ. et al. Alcoholic liver disease.
AASLD practice guidelines. Hepatology. 2010; 51(1): 307-328.
Ostapowicz G, Fontana RJ,Schiodt FV, Larson A, Davron JT, Steven
HB, et al. Results of a prospective study of acute liver failure at 17
tertiary care centers in the United states. Ann Intern Med. 2002;
137(12):947-954.
Ozer A, Bruick RK. Non-heme dioxygenases: Cellular sensors and
regulators jelly rolled into one. Nat Chem Biol. 2007; 3(3): 144–153.
Padayatt SJ, Katz A, WangY, Eck P, Kwon O, Lee JH, et al.Vitamin C
as an antioxidant evaluation of its role in disease prevention. J Am Coll
Nutr. 2003;22(1):18–35.
Padma V, Suja V, Shyamala Devi CS, Prema .Hepatoprotective effect of
Liv-52 on antitubercular drug induced hepatotoxicity in rats, Fitoterapia.
1998; 69( 6): 520-522.
Pal R, Rana S, Vaiphei K, Singh K. Effect of different doses of
carotenoids in isoniazid-rifampicin induced hepatotoxicity in rats. Trop
Gastroenterol 2008; 29(3):153-9.
Pal R, Rana SV, Vaipheib K, Singha K. Isoniazid-rifampicin induced
lipid changes in rats. Clinica Chimica Acta. 2008; 389(1–2): 55–60.
Pandit A. Drug-Induced Hepatotoxicity: A Review, J Appl Pharm Sci.
2012; 02( 05) :233-243.
Bibliography
196
Papiya Bigoniya, Kailash Singh. Ulcer protective potential of
standardized Hesperidin, a citrus flavonoid isolated from Citrus sinensis.
Rev Bras Farma.2014; 24(3): 330-340.
Pari L, Karthikeyan A, Karthika P, Rathinam A. Protective effects of
Hesperidin on oxidative stress, dyslipidaemia and histological changes
in iron-induced hepatic and renal toxicity in rats. Toxicology Reports.
2014; 2:46–55.
Park H J, Kim M J, Ha E, Chung J H. Apoptotic effect of hesperidin
through caspase3 activation in human colon cancer cells, SNU-C4.
Phytomedicine. 2008; 15(1–2):147–151.
Parmar MY, Shah P, Thakkar V, Gandhi TR. Hepatoprotective activity
of Amomum subulatum Roxb against ethanol-induced liver damage. Int
J Green Pharm.2009; 3(3): 250-254.
Partha Pal, Sayantan Ray.Alcoholic Liver Disease: A comprehensive
Review. EMJ. 2016;1(2):85-92 .
Patel T, Roberts LR, Jones BA and Gores GJ. Dysregulation of
apoptosis as mechanism of liver disease: an overview. Semin Liver Dis.
1998; 18(2):105-114.
Patil JR, Chidambara Murthy KN, Jayaprakasha GK, Chetti MB, Patil
BS. Bioactive compounds from Mexican lime (Citrus aurantifolia) juice
Bibliography
197
induce apoptosis in human pancreatic cells. J Agric Food Chem. 2009;
57(22):10933–10942.
Perez-Cruz I, Cárcamo JM, Golde DW. Caspase-8 dependent TRAIL-
induced apoptosis in cancer cell lines is inhibited by vitamin C and
catalase. Apoptosis. 2007; 12(1): 225-34.
Pradeep K, Park SH, Ko KC. Hesperidin a flavanoglycone protects
against g-irradiation induced hepatocellular damage and oxidative
stress in Sprague–Dawley rats. Eur J Pharmacol. 2008; 587(1-3): 273–
280.
Preziosi P. Isoniazid: metabolic aspects and toxicological correlates.
Curr Drug Metab. 2007; 8(8): 839–851.
Ramappa V, Aithal GP. Hepatotoxicity Related to Anti-tuberculosis
Drugs: Mechanisms and Management. Journal of Clinical and
Experimental Hepatology. 2013; 3(1):37-49.
doi:10.1016/j.jceh.2012.12.001.
Recknagel RO and Glende EA. Spectrophotometric detection of lipid
conjugated dienes. Methods Enzymol. 1984; 105: 331-337.
Reiter RJ, Tan DX, Osuna C, Gitto E. Actions of melatonin in the
reduction of oxidative stress. A review. J Biomed Sci. 2000;7(6):444–58.
Bibliography
198
Richards VE, Chau B, White MR, McQueen CA. Hepatic gene
expression and lipid homeostasis in C57BL/6 mice exposed to
hydrazine or acetylhydrazine. Toxicol Sci. 2004; 82:318–332.
Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during
apoptosis. Nat Rev Mol Cell Biol. 2004; 5(11):897–907.
Ringseis R, Muschick A, Eder K. Dietary Oxidized Fat Prevents
Ethanol-Induced Triacylglycerol Accumulation and Increases
Expression of PPARa Target Genes in Rat Liver. J Nutr. 2007; 137(1):
77-83.
Roohbakhsh A, Parhiz H, Soltani F, Rezaee R, Iranshahi M. Molecular
mechanisms behind the biological effects of hesperidin and hesperetin
for the prevention of cancer and cardiovascular diseases. Life Sci.
2015; 124:64-74. doi: 10.1016/j.lfs.2014.12.030.
Roy B, Chowdhury A, Kundu S. Increased risk of antituberculosis drug-
induced Hepatotoxicity in individuals with glutathione S-transferase M1
'null' mutation. J Gastroenterol Hepatol. 2001;16 (9):1033-7.
Rukkumani R, Aruna K, Suresh Varma P, Menon VP. Influence of
ferulic acid on circulatory prooxidant–antioxidant status during alcohol
and PUFA induced toxicity. J Physiol Pharmacol. 2004 ; 55(3) : 551–
561.
Bibliography
199
Sabesin SM, Kuiken LB and Ragland JB. Hepatoprotective effects of
polyprenols from Ginkgo biloba L. leaves on CCl4-induced
hepatotoxicity in rats. Fitoterapia. 2011; 82(6): 834-840.
Sabiu S, Taofik O. Sunmonu, Emmanuel O. Ajani, Taofeek O. Ajiboye.
Combined administration of silymarin and vitamin C stalls
acetaminophen-mediated hepatic oxidative insults in Wistar rats.
Brazillian journal of pharmacology. 2015 ;25 :29–34.
Sabiu S, Wudil AM, Sunmonu TO. Combined administration of
Telfairaoccidentalis and Vernonia amygdalina leaf powders ameliorates
garlic-inducedhepatotoxicity in Wistar rats. Pharmacologia.2014; 5:
191–198.
Sahu BD, Kuncha M, Sindhura GJ, Sistla R. Hesperidin attenuates
cisplatin-induced acute renal injury by decreasing oxidative stress,
inflammation and DNA damage. Phytomedicine. 2013; 20(5): 453-60.
Saiprasad G, Chitra P, Manikandan R, Sudhandiran G. Hesperidin
induces apoptosis and triggers autophagic markers through inhibition of
Aurora-A mediated phosphoinositide-3-kinase/ Akt/mammalian target
of rapamycin and glycogen synthase kinase-3 beta signalling cascades
in experimental colon carcinogenesis. Eur J Cancer. 2014; 50(14):
2489-2507.
Bibliography
200
Salonen RM, Nyyssonen K, Kaikkonen J, Porkkala-Sarataho E,
Voutilainen S, Rissanen TH, et al. Effect of combined Vitamin C and E
supplementation on atherosclerotic progression: the antioxidant
supplementation in atherosclerosis prevention (ASAP) study.
Circulation.2003;107(7):947–953.
Sana Tufail , Javed Iqbal , Aamir Abbas. Antituberculous Treatment
Induced ALT & ALP Derangements and The Role of Onion Extract in
Male Albino Rats. APM. 2010;4(1): 33-38.
Sankar M, Johanna Rajkumar, Sridhar.Hepatoprotective activity Of
Heptoplus On Isoniazid And Rifampicin Induced Hepatotoxicity In Liver
Cell Lines. Int J Pharm Pharm Sci. 2015; 7(5): 215-219.
Santos IMS, Da Rocha-Tome A, Saldanha GB, Ferreira PMP, Militao
GCG, De Freitas RM. Oxidative stress in the hippocampus during
experimental seizures can be ameliorated with the antioxidant Vitamin
C. Oxid Med Cell. Longev.2009; 2: 214–221.
Saraswathy SD, Suja V, Gurumurthy P, Shyamala Devi CS. Effect of
LIV 100 against antitubercular drugs (isoniazid, rifampicin and
pyrazinamide) induced hepatotoxicity in rats. Indian Journal of
Pharmacology. 1998; 30(4): 233-8.
Bibliography
201
Sarich TC, Adams SP, Petricca G, Wright JM. Inhibition of isoniazid-
induced hepatotoxicity in rabbits by pretreatment with an amidase
inhibitor. J Pharmacol Exp Ther. 1999;289:695–702.
Sarich TC, Zhou T, Adams SP, Bain AI, Wall RA, Wright JM. A model of
isoniazid-induced hepatotoxicity in rabbits. J Pharmacol Toxicol
Methods. 1995; 34:109–116.
Saukkonen JJ, Cohn DL, Jasmer RM, Schenker S, Jereb JA. Official
ATS Statement: Hepatotoxicity of antituberculosis therapy. Am J Respir
Crit Care Med. 2006;174(8): 935-952.
Seiichiro Fujisawa, Mariko Ishihara, Toshiko Atsumi, Yoshinori Kadoma.
A Quantitative Approach to the Free Radical Interaction Between Alpha-
tocopherol or Ascorbate and Flavonoids. In vivo. 2006; 20: 445-452.
Selvendiran K, Sakthisekaran D. Chemopreventive effect of piperine on
modulating lipid peroxidation and membrane bound enzymes in
benzo(a)pyrene induced lung carcinogenesis. Biomed
Pharmacother. 2004; 58(4): 264–277.
Seung-Woo Hong, Dong-Hoon Jin, Eun-Sil Hahm, Sei-Hyun Yim,Jong-
Seok Lim, Keun-Il Ki. Ascorbate (vitamin C) induces cell death through
the apoptosis-inducing factor in human breast cancer cells. Oncology
Reports.2007;18: 811-815,
Bibliography
202
Sha Li, Hor-Yue Tan, Ning Wang, Zhang-Jin Zhang, Lixing Lao, Chi-
Woon Wong, et al. The Role of Oxidative Stress and Antioxidants in
Liver Diseases. Int J Mol Sci. 2015; 16(11): 26087–26124.
Shailja Chambial, Shailendra Dwivedi, Kamla Kant Shukla, Placheril J.
John, Praveen Sharma. Vitamin C in Disease Prevention and Cure: An
Overview. Ind J Clin Biochem. 2013; 28(4):314–328.
Shailja Chambial, Shailendra Dwivedi, Kamla Kant Shukla, Placheril J.
John. Praveen Sharma.Vitamin C in Disease Prevention and Cure: An
Overview. Ind J Clin Biochem. 2013; 28(4):314–328.
Shang Z. Abdulqader, Inaam A.Mustafa. The Protective Role of Vitamin
C against Formaldehyde induced-hepatotoxicity and nephrotoxicity in
Male Rats . JPBS. 2014; 9(4):21-26.
Sharma GR, Immanuel C, Kailasam S, Narayana AS, Venkatesan P.
Rifampin-induced release of hydrazine from isoniazid. A possible cause
of hepatitis during treatment of tuberculosis with regimens containing
isoniazid and rifampin. Am Rev Respir Dis. 1986; 133(6):1072–1075.
Shashank Kumar, Abhay K. Pandey .Chemistry and Biological Activities
of Flavonoids: An Overview. The Scientific World Journal. 2013 ;2013:1-
16.
Bibliography
203
Shiha TY, Paib CY, Yang P, Chang WL, Ning-Chi Wang NC , Hua
OYP. A Novel Mechanism Underlies the Hepatotoxicity of
Pyrazinamide, Antimicrob Agents Chemother. 2013; 57(4): 1685-1690.
Shoko Kobayashi, Soichi Tanabe. Evaluation of the anti-allergic activity
of Citrus unshiu using rat basophilic leukemia RBL-2H3 cells as well as
basophils of patients with seasonal allergic rhinitis to pollenInternational
Journal of Molecular Medicine. 2006; 17(3):511-5.
Singh A, Bhat TK, Sharma OP.Clinical Biochemistry of Hepatotoxicity. J
Clinic Toxicol. 2011; S4:001. doi:10.4172/2161-0495.S4-001.
Singh M, Sasi P, Rai G, Gupta VH, Amarapurkar D, Wangikar PP.
Studies on toxicity of antitubercular drugs namely isoniazid, rifampicin,
and pyrazinamide in an in vitro model of HepG2 cell line. Med Chem
Res. 2011; 20(9): 1611-15.
Singh Robin, Kumar Sunil, Rana AC, Sharma Nidhi. Different models of
hepatotoxicity and related liver diseases: A Review. IRJP.
2012;3(7):86-95.
Singh RP, Agarwal R. Natural flavonoids targeting deregulated cell
cycle progression in cancer cells. Curr Drug Targets. 2006;7(3):345–54.
Sinha AK. Colorimetric assay of catalase. Anal. Biochem.1972; 47: 389-
394.
Bibliography
204
Siow RC, Richards JP, Pedley KC, Leake DS, Mann GE. Vitamin C
protects human vascular smooth muscle cells against apoptosis
induced by moderately oxidized LDL containing high levels of lipid
hydroperoxides. Arterioscler Thromb Vasc Biol. 1999;19:2387-94.
Smirnoff N, Wheeler GL. Ascorbic acid in plants: biosynthesis and
function. Crit Rev Biochem Mol Biol. 2000; 35(4):291-314.
Sodhi CP, Rana SV, Mehta SK, Vaiphei K, Attari S, Mehta S. Study of
oxidative-stress in isoniazid-rifampicin induced hepatic injury in young
rats. Drug Chem Toxicol. 1997;20:255–69.
Sodhi CP, Rana SV, Mehta SK, Vaiphei K, Attri S, Thakur S, et al.
Study of oxidative stress in isoniazid induced hepatic injury in young
rats with and without protein energy malnutrition. J Biochem Toxicol.
1996;11(30):139-146.
Stangeland T, Remberg SF, Lye KA. Total antioxidant activity in 35
Ugandan fruits and vegetables. Food Chem. 2008;113: 85–91.
Steele MA, Burk RF, DesPrez RM. Toxic hepatitis with isoniazid and
rifampicin. Chest .1991; 99(2):465‑71.
Stekhoren MA, Bonting SL. Transport of ATPases: properties and
functions. Physiol Rev.1981; 61: 1–76.
Bibliography
205
Sudhir Kumar, Khushboo Ambreen, Rolee Sharma, Kaleshwar P Singh.
Anti-Tuberculosis Drug-Induced Hepatotoxicity: A Review. IJBR. 2014;
5(3):423-437
Susara Ruwan Kumara Madduma Hewage, Mei Jing Piao, Kyoung Ah
Kang, Yea Seong Ryu, Xia Han, Min Chang Oh et al. Hesperidin
Attenuates Ultraviolet B-Induced Apoptosis by Mitigating Oxidative
Stress in Human Keratinocytes. Biomol Ther. 2014; 5(3):423-437.
Tacke FT, Luedde, trautwein C. Inflammatory pathways in liver
homeostasis and liver injury. Clin Rev Allergy Immunol. 2009; 36:4-12.
Talalay P, Fahey JW, Holtzclaw WD, Prestera T, Zhang Y.
Chemoprotection against cancer by phase 2 enzyme induction. Toxicol
Lett. 1995; 82-83: 173-179.
Tamilselvam K, Braidy N, Manivasagam T, Essa MM, Prasad NR,
Karthikeyan S, et al. Neuroprotective effects of hesperidin, a plant
flavanone, on rotenone-induced oxidative stress and apoptosis in a
cellular model for Parkinson's disease.Oxid Med Cell Longev.
2013;2013:102741.
Tang N, Deng R, Wang Y, Lin M, Li H, Qiu Y, et al. GSTM1 and GSTT1
null polymorphisms and susceptibility to anti-tuberculosis drug-induced
liver injury: a meta-analysis. Int J Tuberc Lung Dis. 2013;17:17–25.
Bibliography
206
Tarasankar Maity, Ayaz Ahmad, Nilanjan Pahari. Evaluation of
hepatotherapeutic effects of Mikania Scandens (L.) Willd. On alcohol
induced hepatotoxicity in rats. Int J Pharm Pharm Sci. 2012; 4(3): 490-
494.
Tasduq SA, Peerzada K, Koul S, Bhat R, Johri RK. Biochemical
manifestations of anti‑tuberculosis drugs induced hepatotoxicity and the
effect of silymarin. Hepatol Res. 2005; 31(3):132‑5.
Tayal V, Kalra BS, Agarwal S, Khurana N, Gupta U. Hepatoprotective
effect of tocopherol against isoniazid and rifampicin induced
hepatotoxicity in albino rabbits. Indian J Exp Biol. 2007;45(12):1031-6.
Tayal V, Kalra BS, Agarwal S, Khurana N, Gupta U. Hepatoprotective
effect of tocopherol against isoniazid and rifampicin induced
hepatotoxicity in albino rabbits. Indian J Exp Biol. 2007; 45(12):1031-6.
Temple RJ. Himmel MH. Safety of newly approved drugs: implications
for prescribing. JAMA.2002; 287(17): 2273-2275.
Tierney, Lawrence M, McPhee, Stephen J, Papadakis, Maxine A.
Current Medical Diagnosis & treatment. 45th ed. McGraw- Hill;
2006.666-9.
Tostmann A, Boeree MJ, Aarnoutse RE, De Lange WC, Van der Ven
AJ, Dekhuijzen R. Antituberculosis drug-induced hepatotoxicity: concise
up-to-date review. J Gastroenterol Hepatol.2008; 23(2): 192-202.
Bibliography
207
Tostmann A, Boeree MJ, Aarnoutse RE, De Lange WC, Van Der Ven
AJ, Dekhuijzen R. Anti-tuberculosis drug-induced hepatotoxicity:
Concise up-todate review. J Gastroenterol Hepatol. 2008; 23(2): 192-
202.
Tsui WMS. Drug – associated changes in the liver. Current diagnostic
pathol 2003;9:96-104.
Ungo JR, Jones D, Ashkin D, Hollender ES, Bernstein D, Albanese AP,
Pitchenik AE. Antituberculosis drug-induced hepatotoxicity. The role of
hepatitis C virus and the human immunodeficiency virus. Am J Respir
Crit Care Med. 1998; 157(6): 1871-1876.
Uwe Wenzel, Alexander Nickel, Sabine Kuntz, Hannelore Daniel.
Ascorbic acid suppresses drug-induced apoptosis in human colon
cancer cells by scavenging mitochondrial superoxide anions.
Carcinogenesis. 2004; 25(5):703-712.
Vargas-Mendoza N, Madrigal-Santillán E, Morales-González Á.
Hepatoprotective effect of silymarin. World Journal of Hepatology.
2014;6 (3):144-149. doi:10.4254/wjh.v6.i3.144.
Vesna Kunti, Jasmina Brbori, Ivanka Holclajtner - Antunovi, Snezana
Uskokovi-Markovi. Evaluating the bioactive effects of flavonoid
hesperidin – A new literature data survey. Vojnosanit Pregl. 2014; 71(1):
60–65.
Bibliography
208
Vidhya A and Indira M. Protective effect of Quercetin in the Regression
of Ethanol-Induced Hepatotoxicity. Indian J Pharm Sci. 2009; 71(5):
527–532.
Vijaya Padma V, Suja R, Shyamala Devi CS. Hepatoprotetive effect of
Liv.52 on Antitubercular Drug induced Hepatotoxicity in rats. Fitoterapia
(LXIX). 1998; 6: 520-522.
Vinson JA and Jang J. In vitro and in vivo lipoprotein antioxidant effect
of a citrus extract and ascorbic acid on normal and hypecholesterolemic
human subjects. J Med Food. 2001; 4(4): 187-192.
Visnagri A, Kandhare AD, Chakravarty S, Ghosh P, Bodhankar SL.
Hesperidin, a flavanoglycone attenuates experimental diabetic
neuropathy via modulation of cellular and biochemical marker to
improve nerve functions. Pharm Biol. 2014; 52(7): 814-28.
Vollbracht C, Schneider B, Leendert V, Weiss G, Auerbach L, Beuth J.
Intravenous vitamin C administration improves quality of life in breast
cancer patients during chemo-/radiotherapy and aftercare: results of a
retrospective, multicentre, epidemiological cohort study in Germany.
2011; 25(6):983-990.
Wang P, Pradhan K, Zhong X, Ma X. Isoniazid metabolism and
hepatotoxicity. Acta Pharmaceutica Sinica B. 2016;6(5):384-392.
Bibliography
209
Wang X, Hasegawa J, Kitamura Y, Wang Z, Matsuda A, Shinoda W, et
al. Effects of hesperidin on the progression of hypercholesterolemia and
fatty liver induced by high-cholesterol diet in rats. J Pharmacol Sci.
2011; 117:129-138.
Wen X, Wang JS, Neuvonen PJ, Backman JT. Isoniazid is a
mechanism-based inhibitor of cytochrome P450 1A2, 2A6, 2C19 and
3A4 isoforms in human liver microsomes. Eur J Clin Pharmacol. 2002;
57(11):799-804.
Wen X, Wang JS, Neuvonen PJ, Backman JT. Isoniazid is a
mechanism-based inhibitor of cytochrome P450 1A2, 2A6, 2C19 and
3A4 isoforms in human liver microsomes. Eur J Clin Pharmacol. 2002;
57(11):799-804.
Westphal JF, Vetter D, Brogard JM. Hepatic side-effects of antibiotics.
J. Antimicrob. Chemother. 1994; 33(3): 387- 401.
Whitehouse LW, Lodge AWBY, Thomas BH. Metabolic disposition of
pyrazinamide in the rat: identification of a novel in vivo metabolite
common to both rat and human. Biopharmaceutics & Drug Disposition.
1987;8(4): 307-318.
Wilcox LJ, Borradaile NM, Dreu LE, Huff MW. Secretion of hepatocyte
apoB is inhibited by the flavonoids, naringenin and hesperetin, via
Bibliography
210
reduced activity and expression of ACAT2 and MTP. J Lipid Res. 2001;
42(5):725–734.
Wintergerst ES, Maggini S, Hornig DH. Immune-enhancing role of
vitamin C and zinc and effect on clinical conditions. Ann Nutr Metab.
2006;50(2):85–94. doi:10.1159/000090495
World Health Organization (WHO), Global tuberculosis report WHO;
2015.
Wu CC, Bratton SB. Regulation of the intrinsic apoptosis pathway by
reactive oxygen species. Antioxidants & redox signalling 2013; 19(6):
546–558.
Wu D, Cederbaum AI. Alcohol, oxidative stress and free radical
damage. Alcohol Res Health. 2003; 27(4): 277-284.
Wu D, Zhai Q, Shi X. Alcohol-induced oxidative stress and cell
responses. J Gastroenterol Hepatol. 2006; 21(3):S26-29.
Wu G, Fang YZ, Yang S, Lupton JR, Turner ND. Glutathione
metabolism and its implications for health. J Nutr. 2004;134(3):489–492.
Wu N, Sarna LK, Siow YL, Karmin O. Regulation of hepatic cholesterol
biosynthesis by berberine during hyperhomocysteinemia. Am J Physiol
Regul Integr Comp Physiol. 2011; 69: R635-R643.
Bibliography
211
XavierS M, Barbosa C, Barros DO, Silva RF, Oliveria AA, Freitas RM.
Vitamin C antioxidant in hippocampus of adult Wistar rats after seizures
and status epilepticus induced by pilocarpine. Neurosci Lett.
2007;420(1): 76–79.
Yin XM, Ding WX. Death receptor activation-induced hepatocyte
apoptosis and liver injury. Curr Mol Med. 2003;3(6):491–508.
Yoshida H, Takamura N, Shuto T, Ogata K, Tokunaga J, Kawai K, Kai
H. The citrus flavonoids hesperetin and naringenin block the lipolytic
actions of TNF-alpha in mouse adipocytes. Biochem Biophys Res
Commun. 2010; 394(3):728-32. doi: 10.1016/j.bbrc.2010.03.060.
You M, Crabb DW. Recent advances in alcoholic liver disease. II.
Minireview: molecular mechanisms of alcoholic fatty liver. Am J Physiol
Gastrointest Liver Physiol. 2005; 287:G4–G63.
You M, Fischer M, Deeg MA and Crabb DW. Ethanol induces fatty acid
synthesis pathways by activation of sterol regulatory element-binding
protein (SREBP). J Biol Chem.2002; 277(32): 29342-29347.
Young IS, Woodside JV. Antioxidants in health and disease. J Clin
Pathol. 2001; 54(3):176-86.
Zakhari S. Overview: How Is Alcohol Metabolized by the Body? Alcohol
Research & Health. 2006; 29(4):245-254.
Bibliography
212
Zhang H, Huang C, Wang Y, Lu Z, Zhuang N, Zhao D, et al. Hepatitis B
virus X protein sensitizes TRAIL-induced hepatocyte apoptosis by
inhibiting the E3 ubiquitin ligase A 20. PLOS One.
2015;10(5):e0127329.
Zimmerman HJ. Hepatic injury from the treatment of infectious and
parasitic diseases. In Zimmerman HJ. Hepatotoxicity: the adverse
effects of drugs and other chemicals on the liver. 2nd ed. Philadelphia:
Lippincott. 1999;589:73-96.
Zimmerman HJ.Drug induced liver disease. Cli Liver Dis. 2004;4:73-96.
List of publications
213
11. LIST OF PUBLICATIONS
1. Nathiya S, Rajaram S, Philips Abraham. Hesperidin alleviates
antitubercular drug induced oxidative stress, inflammation and
apoptosis in rat liver. International journal of Biomedical
Research. 2016; 7(7): 439-446.
2. Nathiya S, Rajaram S, Philips Abraham, Vennila G, Sivakami.
Hepatoprotective and antioxidant effect of Hesperidin against
Isoniazid, Rifampicin and Pyrazinamide induced hepatotoxicity in
rats. Journal of Pharmacy Research. 2015; 9(7):469-475.
top related