expression profiling of reporter genes induced by rice...
Post on 24-May-2020
1 Views
Preview:
TRANSCRIPT
ii
Expression Profiling of Reporter Genes Induced by Rice Polyphenol
Oxidase Promoter in Transgenic Model Plant
Doctor of Philosophy
in
PLANT BIOCHEMISTRY AND MOLECULAR BIOLOGY
BY
WASIM AKHTAR
DEPARTMENT OF PLANT SCIENCES, FACULTY OF BIOLOGICAL SCIENCES,
QUAID-I-AZAM UNIVERSITY, ISLAMABAD, PAKISTAN
2016
iii
Expression Profiling of Reporter Genes Induced by Rice Polyphenol
Oxidase Promoter in Transgenic Model Plant
A Dissertation Submitted in the Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in PLANT BIOCHEMISTRY AND MOLECULAR BIOLOGY
BY
WASIM AKHTAR
DEPARTMENT OF PLANT SCIENCES, FACULTY OF BIOLOGICAL SCIENCES,
QUAID-I-AZAM UNIVERSITY, ISLAMABAD, PAKISTAN
2016
iv
DECLARATION
This is to certify that the dissertation entitled “Expression Profiling of Reporter Genes
Induced by Rice Polyphenol Oxidase Promoter in Transgenic Model Plant”
submitted by Wasim Akhtar is accepted in its present form by the Department of Plant
Sciences, Quaid-i-Azam University Islamabad, Pakistan, as satisfying the dissertation
requirement for the degree of Doctor of Philosophy in PLANT BIOCHEMISTRY AND
MOLECULAR BIOLOGY.
Supervisor: ______________________________ Dr. Tariq Mahmood
External Examiner: ______________________________ Dr. Asma Jabeen Asst. Professor Environmental Sciences Program Fatima Jinnah Women University,
External Examiner: ______________________________ Dr. Sarwat Naz Mirza Dean Dept. Forestry University of Arid Agriculture Rwalpindi(PMAS)
Chairperson: ______________________________ Dr. Tariq Mahmood
Date: ______________________________
v
Foreign Examiners
1. Prof. Dr. Meral YUCEL
Middle East Technical University
Department of Biological Sciences06800Cankaya/Ankara/Turkey
2. Xianchun Xia
Professor in Applied and Wheat Breeding
Institute of Crop Sciences
National Wheat Improvement Center
Chinese Academy of Agricultural Sciences (CAAS)
Zhongguancun South Street 12
Bejing 100081
China
Phone: +86-10-82108610, 13717542298
Fax: +86-10-82108547
Email: xiaxianchun@caas.cn; xiaxianchun@yahoo.com
3. Prof. Loran Dawson
Head of Forensic Soil Science, James Hutton Institute, Aberdeen & Dundee
Visiting Professor, Robert Gordon University, Aberdeen.
Aberdeen Craigiebuckler Aberdeen AB15 8QH Scotland UK
Tel: +44(0)8449285428
Fax:+44(0)8449285429
info@hotton.com
vi
Dedicated
to my
beloved parents
vii
I with gratitude acknowledge Higher Education Commission, Pakistan
for support grant for providing funds that made my research work
possible.
viii
ACKNOWLEDGEMENT
All Praises to Almighty Allah, the omnipotent, the most compassionate and His
Prophet Muhammad (P.B.U.H) The Most perfect among all human beings ever born on
the surface of earth, Who is forever a source of guidance and knowledge for humanity as
a whole.
I feel great pleasure in expressing my ineffable thanks to my encouraging,
inspirational and cool minded supervisor Dr. Tariq Mahmood for his sense of devotion,
creativity, affectionate criticism and keen interest in my work; it was because of his
inspiring guidance and dynamic cooperation during entire study program that I could
complete this manuscript.
I tender my thanks to Professor Dr. Wasim Ahmed, Dean Faculty of Biological
Sciences, QAU for helpful conduct. Words are inadequate to express my thanks to my
senior Faiza Muneer, Ph.D Scholar whose scholastic criticism made it possible for me to
complete this hard job quite smartly. I am indeed humbly grateful to Dr. Koiwa for his
kind attitude, valuable suggestions, most cooperative affectionate behavior, impetuous
guidance and moral help during International Research Initiative Support Program (IRSIP)
in Texas A&M University, USA. Moreover, I’m thankful to Akihito F and Telly Jordan my
lab fellows in USA for their help when I needed.
I feel great pleasure in expressing my heartiest thanks to my seniors Awais Rasheed,
Faiza Munir, and Sobia Kanwal and to my junior Muhammad Ilyas, Shazia Rehman and Ejaz
Aziz for being there whenever I needed any help. I wish to record my deep sense of
gratitude and sincere thanks to all lab fellows.
I convey my thanks from the deepest of my heart to my very caring friends Waqas
Kayani and Ammir Shahbaz. Words do not come out easy for me to mention the feelings of
obligations towards my affectionate parents. My father proved the ocean of love, care for me
in which I saturated myself. In life he is the man who tells me what life is, how to pass it,
how to go through the problems, etiquettes and the every aspect of my life is incomplete
without him. I am most earnestly appreciative to my mother for the strenuous efforts done by
ix
her in enabling me to join the higher ideals of life. I am grateful to my parents, brothers and
sisters for their financial and moral support, patience and prayers they had made for my
success. May ALLAH ALMIGHTY infuse me with the energy to fulfill their noble
inspirations and expectations and further edify my competence.
Wasim Akhtar
i
Contents
Page
No.
LIST OF FIGURES v
LIST OF ABBREVIATIONS viii
ABSTRACT x
1. INTRODUCTION
1.1 Biochemistry of Polyphenol Oxidases (PPOs) 1
1.2 Resistance in Postharvest Proteolysis 3
1.3 Disease Resistance 4
1.4 Insect Resistance
1.5 Wound Stress Responses
1.6 PPO in Drought and Salt Stresses
1.7 Promoter Analysis
1.8 Aims and Objectives
6
8
9
10
11
2. MATERIALS AND METHODS
2.1 Isolation of OsPPO Promoter
2.2 Primer Designing
2.3 Plant Material
2.4 Genomic DNA Isolation
2.5 Amplification of OsPPO Promoter
2.6 Purification of PCR Product
2.7 Restriction Digestion of PCR Product
2.8 Gel Purification of PCR Product
2.9 Designing the Expression Cassettes of OsPPO
2.10 OsPPOLUC Expression Vector Designing
2.10.1 Plasmid Preparation of pEnOPTOEINTLUC THSP18 Plasmid
13
13
13
13
14
14
14
15
15
15
15
ii
2.10.2 Digestion of Plasmid
2.10.3 Gel Purification of Plasmid
2.10.4 Ligation of OsPPO Promoter
2.10.5 Electroporation into E. coli
2.10.6 Screening of Right Ligation
2.10.7 Restriction Digestion of Entry Clone
2.10.8 Sequencing of OsPPOLUC Entry Clone
2.10.9 Purification of OsPPOLUC Plasmid
2.10.10 Column Preparation
2.10.11 Recombination Reaction
2.10.12 Electroporation of OsPPOLUC Expression Clone into E. coli
2.10.13 Screening of OsPPOLUC Expression Clone
2.10.14 Digestion of OsPPOLUC Expression Clone
2.10.15 Agrobacterium Transformation of OsPPOLUC Expression Clone
2.10.16 Confirmation of Agrobacterium Transformation
2.11 OsPPOGUS Vector Designing
2.11.1 Plasmid Preparation of pEnOPTOEINTGUS THSP18 Plasmid
2.11.2 Amplificaion of GUS Gene
2.11.3 Purification of PCR Product
2.11.4 Digestion of OsPPOLUC
2.11.5 Ligation of GUS Gene
2.11.6 Electroporation into E. coli
2.11.7 Screening of Colonies
2.11.8 Restriction Digestion of Positive Clones
2.11.9 Sequencing OsPPOGUS Entry Vector
2.11.10 Recombination Reaction
2.11.11 Electroporation of OsPPOGUS Expression Clone into E. coli
2.11.12 Confirmation of OsPPOGUS Expression Clone
2.11.13 Agrobacterium Tsransformation of OsPPOGUS Expression Clone
16
16
17
17
17
17
18
18
19
19
20
20
20
21
21
21
21
21
20
20
22
23
23
23
23
24
25
25
25
iii
2.11.14 Confirmation of Transformation of OsPPOGUS Expression Clones in
Agrobacterium
2.12 Plants Transformation
2.12.1 Plants Preparation
2.12.2 Soil Preparation and Shifting of Arabidopsis
2.12.3 Transformation Solution
2.12.4 Floral Dip Transformation
2.12.5 Procurement of T1 and T2 Transgenic Lines
2.13 Stress Treatments
2.13.1 Wounding Stress
2.13.2 ABA and MJA Application
2.13.3 Drought and Salt Stress
2.14 RNA Isolation and cDNA Synthesis
2.15 RT-PCR
26
26
26
26
26
27
27
27
27
28
28
28
29
3. RESULTS
3.1 Genomic DNA Isolation
3.2 OsPPOLUC Vector Designing
3.2.1 PCR Amplification
3.2.2 Purification and Digestion of PCR Product
3.2.3 Extraction of LUC and GUS Entry Vectors
3.2.4 Cloning of OsPPO Promoter
3.2.5 Confirmation of Cloning into DH10B
3.2.6 Sequencing of OsPPOLUC Clone
3.6.7 PLACE Signal Scan of OsPPO Promoter Sequence
3.2.8 Confirmation of OsPPOLUC Expression Clone
3.2.9 Agrobacterium Transformation and Confirmation
3.3 OsPPOGUS Vector Designing
30
30
30
30
30
34
34
34
34
37
37
37
iv
3.3.1 Amplification of GUS Gene
3.3.2 Cloning of GUS Gene
3.3.3 Confirmation of Cloning
3.3.4 Sequencing of OsPPOGUS Entry Clone
3.3.5 Transformation of OsPPOGUS Expression Clone in Agrobacterium
3.3.6 Glycerol Culture Maintenance
3.4 Plant Transformation
3.4.1 Plant Preparation and Floral Dip Transformation
3.4.2 Procurement of Transgenic Seeds
3.5 Analysis of Transgenic Plants
3.5.1 Treatments
3.5.2 RNA Isolation
3.5.4 RT-PCR
3.5.5 Induction of OsPPO by Wounding
3.5.6 Induction of OsPPO in Response to MJA and ABA Application
3.5.7 Drought and Salt Response of OsPPOGUS
3.6 General Microscopy of Transgenic Arabidopsis
37
37
41
41
41
41
44
44
44
44
44
44
45
48
52
52
60
4.
5. 6.
DISCUSSION
4.1 Induction of OsPPO by Wounding
4.2 Induction of OsPPO in Response to MJA and ABA Application
4.3 Drought and Salt Response of OsPPOGUS
4.4 Signal Scan (PLACE) of OsPPO Promoter Sequence
CONCLUSION
REFERENCES
64
64
67
68
70
71 72
v
LIST OF FIGURES
Figure
No.
Title Page
No.
1.
2.
Theoretical mechanisms of action of PPO in response to
pathogen infection, insect infestation and water stress
Genomic DNA isolation from genomic DNA isolated from
Oryza sativa L var. Basamati.
12
31
3. Optimization of PCR amplification of PPO promoter. 31
4. Digestion of PCR amplified OsPPO promoter with SmaI
enzyme and column purification.
29
5. pEnOPTOEINTLUC THSP 18 entry clone extraction and
digestion.
29
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Visualization of pEnOPTOEINTLUC THSP 18 entry clone
vector after antarctic phosphatase and elution.
PCR confirmation of correct ligation.
Confirmation of cloning of OsPPO by restriction digestion
with EcoRV
The 1020 bp region of OsPPO promoter showing distribution
and positions of cis-regulatory elements on + and – strands.
Confirmation of recombined OsPPOLUC expression clones
by PCR.
Confirmation of OsPPOLUC expression clones by restriction
digestion with EcoRV.
Confirmation of OsPPOLUC expression clone after
Agrobacterium transformation by PCR.
Confirmation of OsPPOLUC expression clone after
Agrobacterium transformation by Luciferase expression.
Digestion of OsPPOLUC entry clone.
PCR amplification of GUS gene.
PCR confirmation of correct ligation.
30
32
32
33
35
35
36
36
40
37
42
vi
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
Confirmation of OsPPO ligation in OsPPOGUS entry clone
by restriction digestion with EcoRV.
Digestion confirmation of OsPPOGUS expression clone after
recombination of OsPPOGUS entry clone with pMDC99
destination vector.
Confirmation of LR clones in Agrobacterium by PCR.
Arabidopsis thaliana (Col-0) after four weeks showing
appropriate flowering for transformation by floral spray
Hygromycin resistant transgenic T1 seedlings on simple MS
media
Total RNA isolation from wounded T2 trangenic Arabidopsis
thaliana plants after wounding.
RNA isolation from ABA and MJA stressed T2 transgenic
Arabidopsis thaliana plants.
RT-PCR amplification of GUS and 18 S internal control
genes.
Quantification of OsPPOLUC mRNA level induced by
wounding.
Quantification of OsPPOGUS mRNA level induced by
wounding.
Wound induced LUC expression of OsPPO carried out on ten
days old T2 transgenic Arabidopsis lines.
Wound induced GUS expression of OsPPO carried out ten
days old T2 transgenic Arabidopsis lines.
RT-PCR analysis of OsPPOLUC activity by ABA (A) and
MJA (M) applications.
RT-PCR analysis of OsPPOGUS activity by ABA (A) and
MJA (M) applications.
42
43
43
45
46
46
47
47
49
49
50
51
53
53
vii
31a.
31b.
32a.
32b.
33.
34.
35.
36.
37.
Luciferase expression by OsPPO promoter fused with LUC
reporter gene by ABA application.
Luciferase expression by OsPPO promoter fused with GUS
reporter gene by MJA application.
GUS expression by OsPPO promoter fused with GUS reporter
gene by ABA application.
GUS expression by OsPPO promoter fused with GUS reporter
gene by MJA application.
Induction of OsPPO promoter fused with GUS reporter gene
under osmotic stress.
Induction of OsPPO promoter fused with GUS reporter gene
in salt stress.
OsPPO promoter derived GUS expression in Arabidopsis leaf
tissues.
OsPPO promoter derived expression of GUS in stem of
transgenic Arabidopsis.
OsPPO promoter derived GUS expression in root of
transgenic Arabidopsis.
54
55
56
57
58
59
61
62
63
viii
LIST OF ABBREVIATIONS
ABA
APE
WB
bp
Abscicic acid
A Plasmid Editor
Washing buffer
Base pairs
˚C
cDNA
CTAB
Centigrade
Complementary DNA
Cetyltrimethylammonium Bromide
CVMV Cassava Vein Mosaic Virus
DNA
DMSO
Deoxyribo Nucleic Acid
Dimethyl sulfoxide
dNTPs
E. coli
deoxyribo Nucleoside Tri Phosphates
Escherichia coli
EDTA Ethylene Di amine Tetra Acetic acid
GA
GUS
Gibberellic acid
β-glucuronidase
Kb
LB
Kilo base pairs
Luria broth
LUC
M
Luciferase
Molar
mg Milli gram
MgCl2 Magnesium Chloride
Min
MJA
Minute
Methyl Jasmonate
μl Micro liter
ml Milli liter
mM
MPa
Milli Molar
Mega Pascal
ix
NaCl
ND
NARC
Sodium Chloride
Nanodrop
National Agriculture Research Center
n Blast
NEB
Nucleotide BLAST
New England Biolabs
ng Nano gram
PCR
PIs
PLACE
Polymerase Chain Reaction
Proteinase inhibitors
Plant cis-acting Regulatory DNA Elements
pmol
PPO
qPCR
Pico mole
Polyphenol oxidases
Quantitative PCR
RNA
ROS
Ribo Nucleic Acid
Reactive oxygen species
Rpm
RT-PCR
Revolutions per minute
Real-Time PCR
SA Salicylic acid
TAE Tris Acetate Ethylene Diamine Tetra Acetic
acid
TE Tris Ethylene Diamine Tetra Acetic acid
UV Ultraviolet
V Volt
x
ABSTRACT
Polyphenol oxidase (PPO) enzymes are ubiquitous in plant
kingdom that catalyzes the oxidation of phenols to highly
reactive quinones. PPO plays important role in plant defense
mechanisms against biotic and abiotic stresses but the
regulation of PPO promoter in response to stresses remains
unclear. Here, Oryza sativa polyphenol oxidase (OsPPO)
promoter was fused separately to β-glucuronidase (GUS) and
firefly Luciferase (LUC) reporter genes. Agrobacterium strain
GV3101 harbouring OsPPOLUC and OsPPOGUS (separate
clones) was used to transform Arabidopsis by floral dip
method. T1 transgenic seeds were used to obtain T2 lines
which were finally checked for the effects of wounding, ABA,
MJA applications and drought as well as salt stress on PPO
regulation. Expressional profiling of OsPPO promoter by real-
time (RT-PCR) in transgenic Arabidopsis has revealed a
higher level (11 folds) of expression by wounding. However,
OsPPO promoter was also expressed in response to ABA by
an induction of 3 fold but it was not induced by MJA. ABA
plant hormone which regulates key processes biotic and
abiotic stresses ultimately triggering plant defense related
genes. ABA and wound inducibility of OsPPO promoter is a
strong indicative of its role in plant defense mechanism
against biotic and abiotic stresses. Moreover, transgenic T2
plants were also screened against different concentrations of
osmotic stress (PEG-6000) and salt (NaCl). Experimental data
showed that relative GUS expression of OsPPO gene
promoter increased with the increase of osmotic stress. In case
of salt stress, OsPPO induction showed similar trend and GUS
expression was increased as salt concentration increased. This
response of OsPPO to drought and salt stress suggest the
x
xi
possible participation of PPO in plants defense against
drought as well as salt stress. Moreover, OsPPO promoter
sequence was computationally analyzed by Signal Scan
(PLACE), which indicated the presence of different cis-
regulatory elements, for example wound responsive elements,
ABA signaling complexes responsive to drought and salt
responsive regulatory elements. During in vivo experimental
work, the induction and expression of reporter genes proved
the presence and functioning of these cis-regulatory elements.
In summary the role of OsPPO in wounding, ABA
application, drought and salt stresses, and the subsequent
OsPPO promoter induction indicates that these stresses induce
PPO expression in plants as a defense mechanism.
1
INTRODUCTION
Plants growing in nature are continuously exposed to biotic and abiotic stresses. Plants
secure themselves by triggering several defense mechanisms which control the growth
and spread of pathogens. These mechanisms include programmed cell death (Greenberg,
1997; Li and Steffens, 2002), initiation of defense or defense related genes (Dixon and
Harrison 1990), cross linking and strengthening of cell walls (Brisson et al., 1994),
biosynthesis of phytoalexins and metabolism of phenolic compounds (Nicholson and
Hammerschmidt, 1992), and production of active oxygen species, such as singlet oxygen,
superoxide, hydrogen peroxide and hydroxyl radical (Bolwell, 1999).
PPO is ubiquitous enzyme found in almost all life forms and also found in prokaryotes
and eukaryotes including bacterium, fungi, plants, invertebrates and higher animals
(Mayer, 2006). Mosses reported to have PPO and characterized from Physcomitrella
patens (Richter et al., 2005). Bacillus and Marinomonas bacteria possess ability to
produce PPO which ultimately catalyses oxidation of polyphenols.
Different plant species were characterized for PPO as Araucaria angustifolia (Daroit et
al., 2010), Olea europaea (Ortega-Garcia et al., 2010),
Anacardium occidentale (Queiroz et al., 2010), Trapa acornis (Zhu and Zhan, 2009),
Dolichos lablab (Kanade et al., 2009). Plants used for forage as Festuca arundinacea,
Festuca pratense, Phleum pratense, Lolium multiflorum,
Trifolium repens and cereal grasses such as Pennisetum glaucumsorghum; Triticum
species, Hordeum vulgare, Zea mays, Aevna sativa and Brassica including
Brassica oleraceae, Brassica rapa (Anderson et al., 2010; Parveen et al., 2010). Morus
alba that is cheap and renewable source for food processing as it is edible having non-
toxic nature was found to have PPO (Kocabas et al., 2010). All land plant families
possess PPO system except Arabidopsis (Tran et al., 2012).
1.1 Biochemistry of Polyphenol Oxidases (PPO)
Polyphenol oxidases (PPO) are universal in the plant kingdom and extensively studied by
biologist for their roles in defense mechanism. They are nuclear encoded plastid-localized
copper metallo enzymes that use molecular oxygen for the oxidation of mono and o-
2
diphenols to o-diquinones. PPOs have been comprehensively studied for their role in
plant defense and for their importance in post-harvest agricultural losses (Aniszewski et
al., 2008). PPO enzymes are inert when they are in thaylakoid, become active upon
release from the thylakoid by disruption such as wounding, senescence and attack by
insect pests or pathogens. When PPO from plastid or mono/o-diphenolic substrates
released from the vacuole, o-diphenols are oxidized to o-quinones in the presence of
oxygen which are highly reactive electrophiles. These o-quinines undergo complex series
of secondary and non-enzymatic reactions. During secondary reactions, these o-quinines
covalently added to cellular nucleophiles and rearrangement of o-quinones to quinines
occurs.
An alternate pathway is reversed, disproportionate of quinones to semiquinone radicals,
which may add covalently to other molecules or complete the single-electron reduction of
molecular oxygen to the superoxide anion radical (O2_), which consequently form other
reactive oxygen species (ROS). These black and brown quinone adducts formed by PPO
activity are renowned and the reason for interest in postharvest physiology of many
vegetable and fruit crops (Mayer and Harel, 1991; Friedman, 1997). So, PPO catalyzes
oxidation of phenols to quinones, highly reactive intermediates which undergo secondary
reactions and ultimately bring about oxidative browning that accompanies plant
senescence, wounding and responses to pathogens (Thipyapong et al., 2004).
Although PPOs have been focused well for their importance in the food industry (Mayer,
1987), the biochemical roles or functions of PPOs in plant growth and development
remain to be fully investigated. Due to their obvious reaction products and their wound
and pathogen inducibilities, PPOs have commonly been suggested to contribute in plant
defense against pests and pathogens (Thipyapong and Steffens, 1997).
PPO along with proteinase inhibitors (PIs) forms an important part of anti-herbivore
defense in plants. PPOs are capable of oxidizing phenolic acids to highly reactive
quinines. These PPO generated quinines alkylate essential amino acids of nutritional
proteins in host plant rendering them anti-nutritive for insects and pathogens (Constabel
3
and Ryan, 1998). The role of PPO in defense has been proposed from early days of PPO
research. Up-regulation of PPO by pathogen attacked plants indicates strong correlation
of PPO in defense (Mayer, 2006; Raj et al., 2006). The question of PPO involvement in
plant defense has been addressed in transgenic plants with modified PPO expression in
different plants.
1.2 Resistance in Postharvest Proteolysis
Excessive proteolysis during silage in grasses causes economic losses (approximately
$100 million per year) to farmers (Sullivan et al., 2004; Sullivan and Hatfield, 2006).
Some ensilage forages such as alfalfa (Medicago sativa), the proteolysis degradation of
forage proteins (37-87 %) causing high economic losses (Papadopoulos and McKersie,
1983). On contrary, red clover (Trifolium pratense) contains forage protein content like to
alfalfa but proteolysis is 90 % less during ensiling (Papadopoulos and McKersie, 1983).
Inherent proteolytic activity was found similar in both red clover and alfalfa (Jones et al.,
1995a). Low level of postharvest proteolysis attributed to the presence of abundant
combination of PPO and o-diphenol substrate in leaves (Jones et al., 1995b, 1995c;
Sullivan and Hatfield, 2006). While alfalfa showed relatively very less PPO activity or o-
diphenol in its leaves (Jones et al., 1995b; Sullivan et al., 2004). It has been investigated
that PPO generated quinones bind to endogenous cellular proteases and inhibit
postharvest proteolysis during silage. When o-quinones were removed from red clover
the proteolysis increased five folds (Sullivan and Hatfield, 2006).
Red clover PPO gene was expressed in alfalfa under cassava vein mosaic virus (CVMV)
constitutive promoter. Transgenic expression of PPO gene caused browning in alfalfa
leaf extracts when o-diphenol or caffeic acids were added. Transgenic PPO expression in
alfalfa was also accessed by PPO antiserum immune blotting assay. Expression of red
clover PPO1 gene in transgenic alfalfa inhibited postharvest proteolysis shown by 80 %
decrease in amino acid released by caffeic acid effect. Moreover transgenic alfalfa over-
expressing PPO gene exhibited five fold increased o-phenol dependent low proteolysis as
compared with control alfalfa. Transgenic alfalfa expressing red clover PPO provides
outstanding model system for more characterization of the red clover PPO enzymes and
4
PPO mediated inhibition of postharvest proteolysis. This natural system of protein
protection to inhibit postharvest proteolysis can be used in a variety of ensiled forages
(Sullivan et al., 2004; Sullivan and Hatfield, 2006).
1.3 Disease Resistance
PPO provides defense in plant pathogen interaction. It has been reported that high level
of PPO in plants is helpful in resisting pathogen attacks (Raj et al., 2006). PPO catalyzed
phenolic oxidation has critical role in preventive disease development. PPO genes are
important because they are highly conserved, show differential expression, broad range
of variation in temporal and spatial expression and induced by different abiotic and biotic
factors (Thipyapong and Steffens, 1997; Thipyapong et al., 1997). Transgenic plants with
altered PPO expression provide a unique system to find the relationship of PPO in plant
disease resistance. Role of PPOs in ‘induced plant defense’ has been validated in
transgenic plants; PPO over-expressing lines and PPO down-regulated lines showed their
vital role in pathogen attacks (Li and Steffens, 2002; Thipyapong et al., 2004a) and pest
infestations (Wang and Constabel, 2004).
PPO over-expression depicted critical role of PPOs against bacterial disease resistance.
Li and Steffens (2002) transformed tomato with PPO cDNA gene (with sense orientation)
under caulimosaic virus 35S (CaMV 35S) promoter to investigate role of PPO in plant
disease resistance. It was observed that transgenic tomato over-expressing PPO showed
an enhanced resistance against Psedomonas syringae pv. tomato. As compared to control
plants, transgenic tomato exhibited low sternness of disease symptoms, 15 fold fewer leaf
lesions and higher hindrance in bacterial growth, about 100-fold decline of bacterial
population on infected leaves. Increased PPO activity leads to the oxidation of higher
proportion of endogenous chlorogenic acid. This higher potential of phenolic oxidation is
attributed to considerably higher resistance to the bacterial pathogen P. syringae pv.
tomato which cause speck disease in tomato. These outcomes reveal the significance of
PPO catalyzed phenolic oxidation in limiting plant disease progression. On contrary
Escobar and Shilling (2008) revealed that transgenic tobacco plants expressing walnut
(Juglans regia) PPO gene did not show resistance against Pseudomonas syringae pv.
5
tabaci. This non anti pathogenic activity is attributed to lack of indigenous PPO substrate
(quinines) for appropriate PPO activity.
In another experiment hybrid transgenic poplar plants over-expressing PPO gene was
screened for changes in rhizosphere populations and diversity. But a narrow effect was
noticed on fungal and bacterial populations as compared with non transformed control
poplar plants. The reason might be that a large number of species were screened for PPO
expression tests. So, narrow groups or indicator species of rhizopshere may give
significance of PPO (Oliver et al., 2008). Soybean (Glycine max [L.] Merr.) GmaPPO12
gene was characterized by stable transformation in soybean. GmaPPO12 gene was
induced strongly by fungus in soybean and tobacco. Moreover GmaPPO12 promoter
showed immediate early induction of GmaPPO12 gene shortly after Phytophothora sojae
zoospores infection in soybean. Deletion mutation analysis of GmaPPO12 highlighted
that 113 bp fragment in promoter is important for these inducible activities (Chai et al.,
2013). In a recent report, it was found that over-expression of strawberry (Fragaria
ananassa) FaPPO gene halts powdery mildew and grey mold infection in strawberry.
Moreover PPO over-expression also affected the expression of other pathogen related
genes (Jia et al., 2015).
Accordingly the down-regulation of PPO (with anti-sense orientation) was expected to
enhance the susceptibility to pathogen. Plants with down-regulated PPO by antisense
expression highly increased the vulnerability of transgenic tomato against P. syringae pv.
tomato without effecting plant growth and development in green house. Down-regulated
PPO genes differentially induced in transgenic tomato and showed 55 fold increase in
bacterial growth and three times larger lesions than untransformed tomato plants. Young
leaves became more susceptible than old ones in compatible interaction while in
incompatible interaction old leaves became more vulnerable than young ones. The
increased in lesion size in suppressed PPO expression suggest that induced PPO activity
adjoining to lesions may help to bound bacterial growth. So PPO clearly plays role in
resistance of tomato against P. syringae (Thipyapong et al., 2004a).
6
Dandelion (Taraxacum officinale) possesses a high degree of resistance against bacteria
and fungi. Its PPO-2 gene was induced in response to Botrytis cinerea and P. syringae pv.
tomato. When pathogen induced PPO-2 gene was specifically silenced through RNAi
approach in transgenic dandelion plant, it became more vulnerable to P. syringae pv.
tomato. Similarly, transgenic Arabidopsis expressing PPO-2 gene exhibited antibacterial
activity against P. syringae in its leaf extract in the presence of substrate suggesting a
substrate dependent antibacterial activity of PPO produced quinones. These findings
strengthen the concept of PPO involvement in disease resistance (Richter et al., 2012).
Dandelion PPOs are also found to be involved in latex coagulation and wound sealing. It
is natural latex that causes wound sealing, barrier for microbes and prevent herbivory (El-
Moussaoui et al., 2001).
1.4 Insect Resistance
PPO has also been concerned in plants against insect pest resistance. Induction and
regulation of PPO by insects confirms its role in defense. Cotton bollworm (Helicoverpa
armigera) and beet armyworm (Spodoptera exigua) are destructive and widely
distributed pests of tomato, sugar beet, legumes, cotton, maize, soybean, tobacco, pepper,
alfalfa, potato, onion, sunflower, and citrus, as well as many weeds. Biological control
failed as these both developed resistance against insecticide (Bhonwong et al., 2008). As
PPO catalyzed qinones alkylate amino acid making them indigestible for insects (Felton
et al., 1989). Using this strategy the cotton plants were transformed with over-expressing
PPO gene. Over-expressed PPO plants showed higher foliage weight and resistance to
cotton bollworm and beet armyworm than non-transformed and under-expressed PPO
plants. Weights gained by cotton bollworm and beet armyworm were compared on PPO
over-expressed, non-transformed and PPO under-expressed cotton plants. The lowest
weight gained by worms was found on PPO over-expressed plants. The weight gained
was intermediate on non-transformed and highest on under-expressed PPO plants.
Likewise PPO activities were measured highest in PPO over-expressed, intermediate in
non-transformed and lowest in PPO under-expressed plants respectively. These results
implicate PPO as component of defensive system against insects (Bhonwong et al., 2008).
7
Similarly, the transgenic tomato plants over-expressing PPO also decreased insect
growth rates and increased their mortality compared to those feeding on leaves of non-
transformed and transgenic plants with under-expressed PPO activity. Weight gained by
common cutworm (Spodoptera litura) (F.) and cotton bollworm (Heliothis armigera)
(Hübner) and leaf area consumed was negatively inversely related to PPO activity
(Thipyapong et al., 2006; Mahanil et al., 2008).
Polyphenol oxidase is supposed to play role in herbivory defense in biological and
agricultural systems. A study was designed to see the direct impact of PPO elevated
levels in transgenic poplar plant on tree feeding carter pillars. For this purpose Lymantria
dispar and Orgyia Leucostigma two carter pillars were fed on transgenic poplar with
over-expressing PPO. On contrary elevated levels of PPO was not found to be
significantly correlated with insect consumption or growth rate. The efficiency of PPO
was found weaker against caterpillar. Addition of chlorogenic acid, a substrate for PPO
elevated activity in poplar leaves again showed no increased oxidation suggesting that
induced PPO activity has not increased defense against tree feeding caterpillars in
transgenic poplar (Barbehenn et al., 2007).
Anti-herbivory role of poplar PPO was reported in poplar plants. PPO over-expressing
and PPO under-expressing plants were generated without affecting phenotypes. The
forest tent caterpillar larva (Malacosoma disstria) feeding on PPO over-expressing plant
were not able to gain weight and consume leaf area as compared with feeding on non-
transformed and plant with under-expressing PPO. So effect of PPO over-expression
significantly enhanced oxidative defense against forest tent caterpillar in poplar (Wang
and Constabel, 2004). PPO genes showed an induction by feeding of forest tent
caterpillar on hybrid poplar plants indicating PPO as anti-herbivory protein in plants
(Constabel et al., 2000). In another experiment it was seen that Aspen (Populus
tremuloides) PPO mRNA level elevated dramatically after feeding by forest tent
caterpillar (Haruta et al., 2001) relating the PPO involvement against insects.
1.5 Wound Stress Responses
8
Plant defense against chewing insects is thought to be signaled by jasmonic acid (JA) and
modulated by ethylene (Stotz et al., 2000). Wounding generates H2O2 at injured sites
which induce PPO genes along with other proteinase inhibitors showing that H2O2 is
diffusible signaling molecule for activation of defense genes (Orozco-Cardenas et al.,
2001). Induced PPO expression by cell disruption results the generation of reactive
oxygen species (ROS) so amplifying wounding signals and directly prevents pathogen
spread to other plant parts (Torres et al., 2002). Quarta et al. (2013) studied PPO silenced
walnut plants and found that PPO plays central role in the metabolism of tyrosin in
walnut and indirect regulator of cell death. In transgenic pineapple, analysis revealed that
PINPPO1 promoter possesses low basal activity and was cold and wound inducible.
These cold and wound inducible effects were further tested in transgenic tobacco by
strong expression of reporter gene. Through mutational analysis of gibberelline
responsive complexes, it was further shown that PINPPO1 promoter was gibberellic acid
(GA) responsive in stable transgenic tobacco (Zhou et al., 2003).
Transgenic tomato plants over-expressing prosystemin gene were also found to possess
another defensive protein that is PPO which is induced in leaves by wounding and MJA.
Analysis showed that systemin also regulate PPO activity indicating that both systemin
and PPO genes are induced by wounding and co-activated by octadecanoid signaling
pathway (Constabel et al., 1995). When PPO gene was silenced by RNAi in transgenic
dandelion, the PPO activity was reduced than control non-transformed dandelion plants.
Knockdown plants showed significant reduction in latex abundance. Latex fluidity
analysis in silenced plants revealed a strong connection between PPO and latex
coagulation rate. So latex specific PPO plays important role in latex coagulation and
wound sealing in dandelion plants (Wahler et al., 2009).
Aspen (Populus tremuloides) PPO complementary DNA (cDNA) expressed by
wounding and MJA. Unwounded leaves on wounded plants also showed PPO activity
indicating its role in herbivory defense pattern (Haruta et al., 2001). In apple and potato,
systemic wound induction of PPO is characterized by an increased PPO activity as a
result of elevated steady-state levels of PPO specific mRNAs (Boss et al., 1995;
9
Thipyapong et al., 1995). In hybrid poplar, two PPO genes have been shown to be
induced by wounding and MJA (Constabel et al., 2000; Wang and Constabel, 2004).
1.6 PPO in Drought and Salt Stresses
PPOs are also considered to play role in drought and other stresses. Phenolic content in
osmotic stressed rice seedlings were found to be very high as compared to well watered
seedlings. Total phenolics were accumulated at a higher amount in shoot (93 %) under
osmotic stress which affects to decrease in PPO activity. PPOs play a role in cell
adjustment against stress and also decrease cell membrane fluidity (Gaballah et al., 2006;
Lee et al., 2007). Increased level of phenolics in shoot accompanied by decreased PPO
activity was supposed to overcome osmotic stress (Ali and Abbas, 2003). Transgenic
plants with suppressed PPO exhibited an increased drought tolerance showing wilting,
curling and yellowing of old leaves than non transgenic and PPO over-expressing plants
under drought. So PPO suppressed plants showed favorable water stress relations
indicating role of PPO in osmotic stress. PPO was induced in older leaves in response to
water stress in non transgenic and PPO over-expressing plants facilitating abscission to
overcome water loss and limit nutrients movement. This differential expression pattern of
PPO may have additional roles of PPO genes in various tissues to stand against different
stresses (Thipyapong et al., 2004b). It has also been reported that in coconut, PPO
activity was found to be increased by water stress (Shivishankar, 1988). Similarly, Kaur
et al. (2015) showed that PPO increased under water and salt stress in drought tolerant
wheat (C 306).
Ultraviolet (UV) and salinity can also induce PPO activity. Trigonella foenum graecum
calli growing on medium containing sodium chloride (NaCl) showed increased PPO
activity (Niknam et al., 2006) while in UV radiated tomato, PPO activity was decreased
to minimize stress injury (Balakumar et al., 1997). Ali and Abbas (2003) demonstrated
that PPO activity increases by treatment with 100mM NaCl and phenyl urea by
decreasing phenolics, flavonoids and peroxidase enzymes in shoot. While in roots
phenolics and indol acetic acid decreased which was accompanied by increase in PPO,
peroxidases and flavonoides which ultimately decrease the growth of salt stressed plant
10
as compared with non saline plants. In another report, it was found that PPO activities in
Acanthophyllum sordidum increased at 50 mM NaCl but decreased at higher
concentrations (Meratan et al., 2008). Recently Jia et al. (2015) reported the regulation of
FaPPO gene by sodium chloride stress. However, further investigations are required for
clarification of PPO role in drought and salinity.
Plants synthesize hormones in various organs to initiate defense mechanism to cope with
environmental stresses. Ethylene, MJA, ABA, gibberellic acid (GA) and salicylic acid
(SA) are signaling molecules which play a pivotal role in growth and development, plant
defense, and senescence. These signals interact in a mutually synergistic or in an
antagonistic manner to overcome attack of pathogen and herbivorous insects (Pieterse
and Dicke, 2007; Spoel et al., 2007; Pieterse et al., 2009). PPO has shown response to
various signaling molecules such as ethylene (Newman et al., 2011), ABA (Chai et al.,
2013; Jia et al., 2015; Kaur et al., 2015), GA (Zhou et al., 2003), MJA and SA (Shetty et
al., 2011; Jia et al., 2015) indicating role of PPO in plant defensive mechanism.
Among these ABA is the most important plant hormone in defense mechanisms. Plants
are continuously exposed to diverse biotic and abiotic stresses, such as pathogens,
drought and salt which adversely affect plant growth and development in terms of crop
yield. ABA in plants functions as a chemical signal in reply to environmental stresses.
Signals are changed to ABA which triggers the activation of a number of plant
physiological and developmental processes in order to cope with environmental stress
(Ton et al., 2009). Defense responses to biotic and abiotic stress have been extensively
investigated (Popko et al., 2010). ABA responses to stomatal defense and biotic and
abiotic responses through the regulation of stomatal movement has revealed that ABA is
involved in drought and fungal defenses in plants (Lim et al., 2015).
1.7 Promoter Analysis
Upstream side of gene is needed for RNA polymerase to recognize proper motifs to start
up the transcription. Promoter analysis is very important as they control expression of
gene. Promoter characterization revealed PPO promoter induction by wounding and
11
wound signals. Moreover, PPO was also found to be modulated by ethylene signals
(Thipyapong and Steffens, 1997). Tomato PPO promoter was systematically induced by
Alternaria solani and Pseudomonas syringae pathogens. Newman et al. (2011) reported
the PPO promoter response to ethylene.
PPO promoter which regulate PPO expression in plants have not been enough studied so
far. Pattern of defense responses differ in various plants such as between Arabidopsis and
tomato because of differences in regulatory elements (Shetty et al., 2011). Analysis of
PPO promoter from plants revealed the presence of cis-regulatory elements involved in
various environmental stresses such as wounding (Pastuglia et al., 1997; Chai et al.,
2013), ABA or stress responsive elements (Xie et al., 2005; Li et al., 2014; Yu et al.,
2015), salt and drought responsive motifs (Urao et al., 1993; Park et al., 2004). Keeping
in mind the importance of PPO, a study was designed for functional characterization of
rice Oryza sativa (OsPPO) promoter against wounding, ABA, MJA, drought and salt
stresses in transgenic Arabidopsis thaliana.
Sense and antisense technology in transgenic plants for functional analysis of PPO and
its roles in different biotic and abiotic stresses were addressed. Abiotic and biotic stresses
are addressed by plants by signal transduction pathway though ABA, MJA, ethylene and
systemin signals which trigger PPO activity. This PPO activity ultimately results
quinones and reactive oxygen species to cope with stresses (Thipyapong et al., 2007) as
shown in Figure1.
1.8 Aims and Objectives
The main objective of the present research project is to analyze expression profiling of
OsPPO promoter fused separately to to LUC and GUS reporter genes in wounding, ABA,
MJA, drought and salt stresses. For this purpose Agrbacterium based transformation was
carried out and expression analysis was conducted on T1 transgenic Arabidopsis lines.
12
Fig. 1: Theoretical mechanisms of action of PPO in response to pathogen infection, insect infestation and water stress (Thipyapong et al., 2007).
13
MATERIALS AND METHODS
2.1 Isolation of OsPPO Promoter
Polyphenol oxidase (PPO) gene promoter sequence from rice (Oryza sativa) var.
Basmati (Accession # JQ284399) was retrieved from Genbank.
2.2 Primer Designing
A pair of primer was designed from promoter sequence available in Genbank.
Specific primers were designed to amplify 1020 bp region of upstream of OsPPO
gene. Primer 3 software tool was used for primer designing. The sequence of
designed primer is;
PPO F: 5ʹ CTGGTCATAACTAGATTAAGAT 3ʹ
PPO R: 5ʹ GTCGTAGATTAGATTACCGAT 3ʹ
2.3 Plant Material
Rice seeds were arranged from National Agriculture Research Center (NARC),
Islamabad, Pakistan. Seeds were grown in petri plates on wet blotting papers on room
temperature with 16 hours of illumination. Ten days old germinating seedlings were
used for DNA extraction.
2.4 Genomic DNA Isolation
Genomic DNA was extracted by Cetyltrimethylammonium Bromide (CTAB) method
(Richards, 1997) with some modifications. Almost 0.4 g leaves were homogenized
with preheated (65 ˚C) 2X CTAB. The homogenized material was incubated for 90
minutes at 65 ˚C and centrifuged at 12,000 rpm for 10 minutes. After shifting
supernatant to new eppendorf, an equal amount of chloroform:isoamyle alcohol (24:1)
was added with gentle mixing. Following centrifugation (Centurion Scientific, K3
Series) at 12,000 rpm for 10 minutes, supernatant was again shifted to new tube and
an equal amount of chilled isopropanol was added. The tubes were ice cooled for 10
minutes and centrifuged at 12,000 rpm for 10 minutes. The obtained DNA pellet was
washed with 70 % ethanol and air dried. Pellet was then dissolved in 0.1 X TE (Tris
ethylene diamine tetra acetic acid) and DNA quality was checked on 1 % agarose gel.
14
2.5 Amplification of OsPPO Promoter
OsPPO was amplified from rice genomic DNA by phusion polymerase. PCR
conditions used for amplification were pre-denaturation at 94 ˚C for 5 minutes
following 35 cycles of denatuartion at 94 ˚C for 30 seconds, annealing at gradient of
50 ˚C to 60 ˚C for 30 seconds and extension at 72 ˚C for 40 seconds. Final extension
was 72 ˚C for 3 minutes. A PCR reaction volume of 30 µl with 0.3 µl of 50 pico
moles of primer (forward and reverse) mix, 6 µl of 5X buffer, 2.4 µl of 2 mM of
dNTPs, 0.9 µl of 25 mM MgCl2, 0.9 µl Dimethyl sulfoxide (DMSO) and 0.3 µl of
phusion polymerase was used. Amplified product was checked on 1.5 % agarose gel.
2.6 Purification of PCR Product
PCR product was purified by phenol extraction by adding an equal volume of phenol,
centrifuged for 10 minutes and aqueous supernatant was carefully removed. Ethanol
precipitation was performed to concentrate PCR product by adding 0.1 volume of
Sodium acetate (3M) and 3 volume of 100 % ethanol to phenol extracted PCR
product and centrifuged for 10 minutes. Pellet was then washed with 70 % ethanol,
dried and stored at – 20 ˚C.
2.7 Restriction Digestion of PCR Product
PCR product was set up for restriction digestion with SmaI restriction enzyme for
overnight at 37 ˚C and reaction mixture was used as following
PCR product 4 µl
Buffer 10 X (NEB) 4 µl
SmaI (NEB) 2 µl
Distilled water (DW) 30 µl
Digested PCR product was then checked on agarose gel.
2.8 Gel Purification of PCR Product
15
The 40 µl of PCR product was run on low melting point agarose gel (1 %) with DNA
marker for 20 minutes using 100 volt current. Then amplified band was column
eluted by following method. Gel band was carefully excised and melted with GEX
buffer (0.1g/300 µl) by incubating on 55 ˚C for 10 minutes and casual shaking to melt.
The solution was added to QIAGEN column and centrifuged at 4,000 rpm. The flow
through was discarded. Then 0.5 ml of binding buffer solution was applied on spin
column and centrifuged for 1 minute. Again flow through was discarded and 0.5 ml
of washing buffer (WB) was added to column and centrifuged at 12,000 rpm for 1
minute. This step was repeated twice. The column was centrifuged for 2 minutes
without adding solution to remove residual ethanol. The column was finally set in
new eppendorf tube and 8 µl of elution buffer was applied on column membrane and
stand for 5 minutes. Then it was centrifuged at 12,000 rpm for 1 minute and eluted
band was finally checked on 1.5 % agarose gel.
2.9 Designing the Expression Cassettes of OsPPO
The next plan was to design a expression cassettes of OsPPO promoter fused to
Luciferase (LUC) and β-glucuronidase (GUS) reporter genes in two vectors namely
pEnOPTOEINTLUC and pEnOPTOEINTGUS.
2.10 OsPPOLUC Expression Vector Designing
2.10.1 Plasmid Preparation of pEnOPTOEINTLUC THSP18 Plasmid
pEnOPTOEINTLUC THSP 18 plasmid was extracted as following:
Single colony from streaked plate was inoculated in 35 ml of liquid Luria broth (LB)
with 50 mg/L kanamycine and shaked overnight at 37 ˚C. Culture was spin down at
12,000 rpm for 5 minutes and resuspended in 3 ml 1X TE. Then 6 ml of solution 2
(4M NaCl, 16 mM Sodium Citrate, 32 mM Citric Acid) was added and solution was
mixed gently. Then 4.5 ml of solution 3 (100% Ethanol) was added and again mixed
well. Centrifugation was carried out at 12,000 rpm for 5 minutes. Supernatant was
transferred to new tube, 0.6 volume of isopropanol was added and centrifuged at
12,000 rpm for 5 minutes. Supernatant was removed and pellet was dissolved in 1X
16
TE. Again 1 ml of solution 2 and 1ml of solution 3 were added and mixed and
centrifuged at 12,000 rpm for 5 minutes. Supernatant was transferred to new tube; 3
ml of isopropanol was added and centrifuged at 12,000 rpm. Then pellet was
dissolved in 1X TE, 250 µl of 12.5 M LiCl was added, mixed and kept on ice for 5
minutes. After centrifuging at 12,000 rpm for 5 minutes, supernatant was transferred
to new tube and 0.6 ml isopropanol was added. It was centrifuged at 12,000 rpm for 5
minutes, supernatant was removed and 1 ml of 70 % ethanol was added. Mixture was
then centrifuged at 12,000 rpm for 1 minute and pellet was dried and resupended in
100 µl 1X TE RNase. Plasmid was then checked on 1 % agarose gel.
2.10.2 Digestion of Plasmid
Luciferase (LUC) plasmid was digested with SnaBI and StuI restriction enzymes at 37
˚C for overnight. A total reaction volume of 20 µl was set up as following;
Plasmid 10 µl
Buffer 10 X (NEB) 2 µl
SnabI (NEB) 1 µl
StuI (NEB) 1 µl
Distilled water 6 µl
After restriction for overnight by SnaBI and StuI, reaction mixture was treated with
antarctic phosphatase and antarctic phosphatase buffer by keeping at 37 ˚C for 15
minutes and again incubated at 70 ˚C for 5 minutes. Then it was stored at – 20 ˚C.
2.10.3 Gel Purification of Plasmid
Twenty micro liter of plasmid was run on low melting point agarose gel (1 %) for 20
minutes using 100 volts. Required band was carefully excised from low melting point
agarose gel, melted with buffer and purified by QIAGEN Kit method as described
earlier. Plasmid was finally eluted in 8 µl autoclaved water and checked on agarose
gel.
17
2.10.4 Ligation of OsPPO Promoter
PPO PCR product (gel purified) and LUC vector (gel purified) were ligated in a
following reaction setup and incubated at 4 ˚C overnight.
Luciferase vector 0.5 µl
OsPPO PCR product 2 µl
T4 DNA ligase buffer (NEB) 0.34 µl
T4 DNA ligase (NEB) 0.5 µl
Distilled water 1.66 µl
After overnight incubation, 0.25 µl of 800 units/ml Protienase K was added and
reaction mixture was again incubated at 37 ˚C for 30 minutes.
2.10.5 Electroporation into E. coli
Using 1 µl ligation mixture electroporation was carried out into DH10B E.coli strain.
Then electroporated mixture was incubated in 1 ml LB at 37 ˚C with shaking and 200
µl LB out of 1 ml incubated mixture was then spread on solid LB plates with 50 m/gL
Kanamycin selection for overnight.
2.10.6 Screening of Right Ligation
Antibiotic resistant colonies were analyzed through colony PCR for correct ligation
using vector specific primers which can amplify 1.3 kb region including whole PPO
promoter region. Few colonies were screened and colonies with desired amplified
band were selected for further restriction digestion and sequencing.
2.10.7 Restriction Digestion of Entry Clone
Plasmid of colonies with right amplification bands were subjected to plasmid
isolation and were checked on agarose gel. Plasmids were then digested to find out
correct ligated clone. Restriction digestion was carried out with EcoRV enzyme.
Reaction set up was prepared as following;
18
Plasmid OsPPOLUC entry clone 5 µl
Restriction Buffer 10 X 1 µl
EcoRV 1 µl
Distilled water 3 µl
The reaction was incubated at 37 ˚C overnight and then digestion pattern was
analyzed on 1 % agarose gel. Some clones gave same pattern of digestion as
compared with A Plasmid Editor (APE) software digested pattern of OsPPOLUC in
LUC entry clone. Such clones were selected for further sequencing and expression
vector designing.
2.10.8 Sequencing of OsPPOLUC Clone
After digestion, the positive clone was carried out to sequence PPO promoter region
from entry clone vector by using Applied Biosystems® 3130 Genetic Analyzer.
2.10.9 Purification of OsPPOLUC Plasmid
Entry clones were column purified for sequencing. To 30 µl of OsPPOLUC entry
clone plasmid, 400 µl of binding buffer was added, mixed well and purified in regular
blue column. Again it was washed with washing buffer (WB) and then followed
normal protocol for plasmid purification. The plasmid was finally eluted into 40 µl
elution buffer. Then isolated plasmid was checked on agarose gel. The sequencing of
entry clone was carried out using two primers with separate reaction for both primers
as follows;
Plasmid 0.5 µl
Big Dye (BD) buffer 1.6 µl
Big Dye (BD) enzyme 0.4 µl
Primer 0.1 µl
Distilled water 4.4 µl
The sequencing reaction was setup for overnight.
19
2.10.10 Column Preparation
PCR tubes were used for sequencing. A hole was made in PCR tube by needle and
placed in column tube. Silvanized beads were added with small spoon to cover the
bottom and sephadex G50 solution was added to fill up to top of PCR tube. PCR
tubes were centrifuged for short spin at 2800 rpm and flow through was discarded.
This step was repeated twice. Again the tubes were centrifuged for 10 minutes. Then
50 µl distilled water was added with sequencing PCR product, mixed well and
applied on bead by placing it in eppendorf tube. Column was then centrifuged at
2,800 rpm for 10 minutes and upper bead column was removed. Eluted mixture was
finally dried in speed vacuum for 30 minutes and placed for sequencing.
2.10.11 Recombination Reaction
For recombination reaction attL-containing entry clone and an attR-containing (LR)
destination vector (pMDC99) from E.coli host strain BD3.1 were used to generate
expression clone. For this, OsPPOLUC entry clone was digested with NheI to cut and
open plasmid. Following reaction mixture was prepared as follow;
Plasmid 5 µl
Cut Smart 10 X Buffer 1 µl
NheI 1 µl
Distilled water 3 µl
The reaction mixture was incubated overnight at 37 ˚C. Then 1 µl out of 10 µl was
used for agagrose gel check on 1 % agarose gel. Remaining 9 µl was ethanol
precipitated, pallet was speed vacuum dried and resuspended in 5 µl distilled water.
Then 1 µl was checked on agarose gel and 1 µl was used in LR reaction which was
set as follow;
Plasmid 1 µl
pMDC99 Destination Vector 0.25 µl
20
1 X TE 0.75 µl
LR Clonase enzyme 0.5 µl
LR reaction was then kept at room temperature for overnight. After that 0.25 µl of
800 units/ml Protienase K was added to it and incubated at 37 ˚C for 30 minutes and
stored at 4 ˚C.
2.10.12 Electroporation of OsPPOLUC Expression Clone into E.coli
LR reaction mixture was electroporated into DH10B strain of E.coli by using 1 µl of
mixture and 200 µl out of 1 ml was spread on LB (50 mg Kanamycine/L) plates and
kept on 37 ˚C overnight.
2.10.13 Screening of OsPPOLUC Expression Clone
Colony PCR was carried out to check correct OsPPOLUC expression clone by
amplifying 681 bp region. Sequencing primers targeted the LUC gene one from inside
of gene and other from outside the LUC gene from expression vector. Plasmids of
expression clones were extracted and checked on agarose gel. Then glycerol stocks
were maintained.
2.10.14 Digestion of OsPPOLUC Expression Clone
OsPPOLUC LR recombined clones were setup for restriction digestion to check for
correct digestion pattern of LR clones as following;
Plasmid 2 µl
Restriction Buffer 10 X 1 µl
EcoRV 1 µl
Distilled water 6 µl
Digestion reactions were incubated at 37 ˚C for one hour and then checked on 1 %
agarose gel and all five plasmids showed correct digestion pattern.
21
2.10.15 Agrobacterium transformation of OsPPOLUC Expression Clone
Expression clone was electroporated into Agrobacterium GV 3101 strain and
electroporated mixture was shaked on 28 ˚C in liquid LB (Kanamycin 50mg/L) for
one hour and 200 µl of this mixture was spread on LB (50 mg/L Kanamycin) plates
and incubated on 28 ˚C for 2-3 days.
2.10.16 Confirmation of Agrobacterium Transformation
The transformation of OsPPOLUC expression clones was confirmed by PCR (using
primers designed inside and outside of LUC gene) to amplify 682 bp fragment using
vector specific primers. Luciferase expression was also confirmed for these clones
and glycerol stocks were maintained using 2.5 ml LB liquid media (Kanamycin
50mg/L).
2.11 OsPPOGUS Vector Designing
GUS expression vector was designed by placing GUS gene in place of LUC gene in
previous OsPPOLUC entry clone vector.
2.11.1 Plasmid Preparation of pEnOPTOEINTGUS THSP18 Plasmid
Plasmid was isolated from DH10B E.coli by method as described for LUC vector
extraction before.
2.11.2 Amplificaion of GUS Gene
GUS gene (1.8 Kb) was amplified from pFAJEL2 vector as template. PCR conditions
used for amplification were pre-denaturation at 94 ˚C for 2 minutes following 35
cycles of denatuartion at 94 ˚C for 15 seconds, annealing at 55 ˚C for 30 seconds and
extension at 72 ˚C for 1 minute. Final extension was 72 ˚C for 3 minutes. A PCR
reaction volume of 30 µl with 0.3 µl of 50 pico moles of primer mix, 6 µl of 5X
buffer, 2.4 µl of 2 mM of dNTPs, 0.9 µl of 25 mM MgCl2, 0.9 µl DMSO and 0.3 µl of
phusion polymerase was used. Amplified product was checked on 1 % agarose gel.
2.11.3 Purification of PCR Product
22
PCR product was ethanol precipitated by using 0.1 volumes of 3 molar (M) Sodium
acetate and 3 volume of 100 % ethanol and centrifuged at 15,000 rpm for 10 minutes.
Pellet was dried in speed vacuum and digested with NotI and NcoI enzymes.
2.11.4 Digestion of OsPPOLUC
OsPPOLUC entry clone was digested with NotI, NcoI and ppuMI enzymes to cut
down LUC gene by following reaction set up;
Vector 10 µl
Cut smart 10X buffer 3 µl
NcoI 1 µl
NotI 1 µl
PpuMI 1 µl
Distilled water 14 µl
The reaction was incubated at 37 ˚C overnight and checked on agarose gel for
digestion confirmation. The digested product was treated with antarctic phosphatase
and incubated at 37 ˚C for 15 minutes first and then at 70 ˚C for 5 minutes. Finally, it
was stored at – 20 ˚C for further use.
2.11.5 Ligation of GUS Gene
Digested vector and purified GUS PCR product were ligated by using T4 DNA ligase
and reaction was carried out at 4 ˚C for overnight. The reaction mixture was prepared
as followed;
Digested vector 2 µl
PCR product 1 µl
T4 DNA ligase buffer 0.5 µl
T4 DNA ligase 0.5 µl
23
Distilled water 1 µl
2.11.6 Electroporation into E.coli
Using 0.5 µl of ligation mixture, electroporation was done in E.coli, DH10B strain.
The electroporated cells were incubated in 1 ml LB at 37 ˚C for one hour and then
spread on LB media with 50 mg/L Kanamycin selection for overnight.
2.11.7 Screening of Colonies
E.coli colonies were screened for finding the correct ligated clones. Colony PCR was
carried out using vector specific primers to amplify 730 bp regions from OsPPOGUS
and PCR positive clones were selected for further experiments.
2.11.8 Restriction Digestion of Positive Clones
Plasmids were isolated from these clones and digested with EcoRV enzyme for
confirmation of positive ligated clones. Reaction was carried out at 37 ˚C as
following and digestion pattern was checked on agarose gel. Preparation of reaction
mixture was as followed;
Plasmid 2 µl
Restriction Buffer 10 X 1 µl
EcoRV 1 µl
Distilled water 6 µl
2.11.9 Sequencing OsPPOGUS Entry Vector Positive ligated clone was again confirmed by sequencing. Primers were used to
cover whole GUS gene (1.8 kb). Clone was purified and column was prepared as
described earlier. Three reactions were separately run and reaction mixtures were
prepared with columns as described previously. The reaction set up was as follow;
Plasmid 0.5 µl
Big Dye buffer 1.6 µl
Big Dye enzyme 0.4 µl
Primer 0.1 µl
24
Distilled water 4.4 µl
2.11.10 Recombination Reaction
For LR reaction, OsPPOGUS entry clone was digested with NheI enzyme to cut and
open it and reaction was set as following;
Plasmid 5 µl
Cut smart buffer 10X 1 µl
NheI 0.5 µl
Distilled water 3.5 µl
The reaction was carried out at 37 ˚C overnight. Digested plasmid was then ethanol
precipitated and resupended in 5 µl distilled water and checked on 1 % agarose gel.
Using 0.5 µl out of 5 µl plasmid, LR reaction was set as following;
Plasmid 1 µl
pMDC99 0.25 µl
1X TE buffer 0.75 µl
LR clonase II enzyme 0.5 µl
Total 2.5 µl
The reaction was carried out at room temperature for overnight. Then 0.25 µl of 800
units/ml Protienase K was added to LR mixture and incubated at 37 ˚C for 30 minutes.
2.11.11 Electroporation of OsPPOGUS Expression Clone into E.coli
Using 1 µl of reaction mixture, E.coli DH10B strain was transformed and 1 ml of LB
was shaked at 37 ˚C for one hour. Then 200 µl LB was spread on LB plates (50 mg/L
Kanamycin) plates. Plates were incubated for overnight at 37 ˚C.
2.11.12 Confirmation of OsPPOGUS Expression Clone
25
Plasmids of some of clones with OsPPOGUS expression vectors were extracted and
checked on 1 % agarose gel. These plasmids were digested with EcoRV enzyme to
confirm the correct digestion pattern of right LR clones. The reaction was set as
follow;
Plasmid 2 µl
Restriction Buffer D 10 X 1 µl
EcoRV 1 µl
Distilled water 6 µl
The reaction was incubated at 37 ˚C for overnight and checked on 1 % agarose gel.
2.11.13 Agrobacterium Transformation of OsPPOGUS Expression Clone
Confirmed expression clone weas transformed into Agrobacterium GV 3101 strain by
electroporation. The electroporated mixture was shaked on 28 ˚C for one hour and
200 µl of this mixture was spread on LB plates having (50 mg Kanamycin/L) and
incubated at 28 ˚C for 2-3 days.
26
2.11.14 Confirmation of Transformation of OsPPOGUS Expression Clones in
Agrobacterium
OsPPOGUS expression clones were confirmed by colony PCR to amplify 263 bp
fragment of OsPPOGUS expression vector using vector specific primer set and
glycerol stocks were maintained.
2.12 Plants Transformation
2.12.1 Plants Preparation
Arabidopsis thaliana (Col-0) seeds were sterilized by 70 % ethanol. Almost 100
seeds were placed in eppendorf tube and 1 ml of 70 % ethanol was added and shaked
vigorously by vortex. Ethanol was removed after short spin and seeds were washed
with sterilized distilled water three times by shaking and spinning. Seeds were soaked
in 1 ml of 0.1 % agar and spread on MS (Murashge and Skoog, 1962) media and kept
on 4 ˚C for 48 hours. After that plates were shifted to growth rooms.
2.12.2 Soil Preparation and Shifting of Arabidopsis
Soil was prepared from Metromix 366 (Scott) and autoclaved. After cooling soil ½
Marathon (insecticide) was mixed well in soil. A nutrient solution of 1 small spoon of
Miracle-Gro and Banrot were dissolved in 1 gallon tap water. Soil was wet with 1 L
nutrient water and mixed well. This soil was dispensed in pots. Seven days old
Arabidopsis seedlings were shifted to soil available in pots and placed in growth
room with 16 hours light/8 hours dark cycle at 25 ˚C in50 % humidity. Plants were
watered after 3 days intervals. Then twenty eight days old flowering plants were used
for transformation.
2.12.3 Transformation Solution
GV 3101 strain carrying OsPPOLUC and OsPPOGUS vectors were streaked on LB
(Kanamycin 50 mg/L) plates. Single colony of both OsPPOLUC and OsPPOGUS
was picked from these plates and grown in liquid LB (Kanamycin 50 mg/L) media
27
separately at 28 ˚C for overnight. Bacterial cultures were harvested by spinning at
8,000 rpm for 10 minutes. Bacterial pellets of OsPPOLUC and OsPPOGUS were
resuspended separately in transformation solution prepared by adding 5 % sucrose
and 0.03 % Silwet L-77.
2.12.4 Floral Dip Transformation
Arabidopsis floral buds were sprayed with these transformation solutions separately.
Plants were kept in growth chamber for overnight. After that plants were watered
from top to remove excess of sugar.
2.12.5 Procurement of T1 and T2 Transgenic Lines
After 15 days of spray, T0 seeds were collected from mature plants and kept in open
air with light for drying for 24 hours. T0 seeds were divided in five pools (1000
seeds/pool) and sterilized with 70 % ethanol. Seeds were spread on MS media
provided with 40 mg hygromycin for selection of transgenic seedling. After 2 days
transgenic hygromycin resistant (T1) seedlings were collected and transferred to
hygromycin free MS media. Shifting of these hygromycin resistant seedlings
continued for five days. After ten days these growing seedlings were shifted to soil
and pots were kept in growth chambers. Upon maturation, T1 plants gave T1 seeds
that were collected and dried. Again T1 seeds were harvested, dried and used to get
T2 lines with OsPPOLUC and OsPPOGUS stable expression which were finally
used for stress treatments and Real-Time (RT) PCR analysis.
2.13 Treatments
Different stress and hormonal applications were designed for this study namely
wounding stress, ABA application, MJA application, salt and osmotic stresses. Ten
days old plants were used for each treatment. The detail of each application is
mentioned below;
2.13.1 Wounding Stress
28
T1 seeds were grown on MS media after sterilization with 70 % ethanol. For
wounding stress OsPPOLUC and OsPPOGUS T2 plants were used. Plants leaves
were injured with forceps on half of leaves on each plant and other half leaves
remained unwounded. Wounding was given for 12, 24, 36 and 48 hours (h) to plants
on MS media. Control plants left unwounded. Then plants were tested with relative
expression of OsPPO promoter by LUC and GUS activities as well as RT-PCR.
2.13.2 ABA and MJA Application
ABA and MJA solutions for stress treatments were in concentrations of 50 µM, 150
µM, 250 µM, 350 µM and 450 µM. These dilutions were prepared from 100 folds
stocks of ABA and MJA with 0.01 % Silwet L-77 to facilitate infusion. Control
solution used for control plants was prepared from distilled water with 0.01 % Silwet
L-77. One week old plants were used for spray with ABA and MJA and plants were
kept in growth room for 24 hours. After that plants were used for LUC and GUS
relative expression of OsPPO promoter and qPCR screening.
2.13.3 Drought and Salt Stress
Transgenic T2 plants were grown on MS media. For osmotic stress poly ethylene
glycol gel (PEG-6000) was used. Briefly 30 ml of MS media in each plate was
solidified with 0.7 % agar and overlaided by 30 ml of liquid PEG-6000 containing the
5, 10, 15, 20, 25, 30 % of PEG-6000 that finally yielded -0.3, -0.6, -0.9, -1.2, -1.5
and -1.8 mega pascal (MPa) water potential. Plants were placed on these PEG
containing MS plates for 24 hours and then relative expression was checked by GUS
staining. Similarly salt stress was applied on one week old plants in MS media
provided with 100 mM, 200 mM, 300 mM, 400 mM, 500 mM and 600 mM. Plants
were placed in salt stressed conditions for 24 hours and then relative expression was
measured by GUS staining technique.
2.14 RNA Isolation and cDNA Synthesis
Total RNA was isolated from plants stressed with wounding, ABA and MJA by
manual method using DNase (RQ1 RNase-free DNase; Promaga M6101). Total RNA
29
was checked on 1.5 % agarose gel. Total RNA quantification was done by nanodrop
(ND 1000). Reverse transcriptase reaction was carried out using 1 µg of total RNA. A
total 10 µl reaction volume of each sample with 2 µl 5X Goscript buffer, 1.2 µl
MgCl2, 0.5 µl 10 mM dNTPs, 0.5 µl RNase inhibitor, 0.5 µl random hexamers and
0.5 Goscript RT enzyme. Conditions for cDNA synthesis used were incubation at 25
˚C for 5 minutes following cycles of 42 ˚C for 60 minutes and 70 ˚C for 15 minutes.
Final hold was 4 ˚C.
2.15 RT-PCR
RT-PCR (Roche Light Cycler-480) analysis was done with EvaGreen protocol using
EvaGreen reagent (Biotium). Five times diluted cDNA was used in making reaction
for loading on RT-PCR plate. GUS and LUC genes were used as target and 18 S
primers as reference along with control samples. Samples were loaded in duplicates
on RT-PCR plate. Thresholds crossing point (CP) values were automatically
calculated by giving specific targets to RT-PCR and finally CP values were used for
calculating fold change for each treatment along with control.
30
RESULTS
3.1 Genomic DNA Isolation Genomic DNA was isolated from rice (Oryza sativa var. Basmati) by CTAB method with
few modifications (Richards, 1997). DNA was treated with RNase (Invitrogin) and run
on 1 % agarose gel after staining with ethedium bromide (Fig. 2). DNA quantification
was carried with the help of spectrophotometer.
3.2 OsPPOLUC Vector Designing
3.2.1 PCR Amplification
Amplification of PPO promoter (~1020 bp) region was optimized by gradient PCR at
different annealing temperatures with a range of 50 ˚C to 60 ˚C. Best PCR amplification
quality was noted on 58 ˚C for 1 minute. For cloning purpose phusion polymerase was
used. Then PCR product was confirmed by running on 1.5 % agarose gel (Fig. 3).
3.2.2 Purification and Digestion of PCR Product
Highly purified OsPPO promoter PCR product was prepared by phenol extraction and
ethanol precipitation. Purified pellet was collected after centrifugation and washed with
70 % ethanol. Then PCR product was digested with SmaI (NEB) restriction enzyme.
Digested mixture was column purified by running on 1 % low melting point agarose gel
and eluted band was confirmed on agarose gel (Fig. 4).
3.2.3 Extraction of LUC and GUS Entry Vectors
Following midi scale preparation from 35 ml culture shaked overnight on 37 ˚C, plasmids
of both pEnOPTOEINTLUC THSP 18 and pEnOPTOEINTGUS THSP 18 were checked
on agarose gel. LUC vector was digested with SnabI and StuI restriction enzymes for
overnight and treated with antarctic phosphatase (Fig. 5). Digested and antarctic
phosphatase treated LUC vector was agarose gel excised and eluted (Fig. 6).
31
Fig. 2: Visualization of genomic DNA isolated from Oryza sativa L var. Basasmati.
Equal amount of DNA was loaded in each well of each sample plant.
Fig. 3: PCR amplification of PPO promoter. Lane 1: showing ~1020 bp amplicon of PPO
promoter region by phusion polymerase. Lane 2: 2 log DNA ladder (NEB).
1 2
1 2
1 2
1020 bp
500 bp
1000 bp
32
Fig. 4: Digestion of PCR amplified OsPPO promoter with SmaI enzyme and column
purification. Lane 1: Purified PCR product. Lane 2: 2 log DNA ladder (NEB).
Fig. 5: pEnOPTOEINTLUC THSP 18 entry clone extraction and digestion. Lane 1:
LUC vector isolation by midi scale preparation. Lane 2: Digestion of LUC Entry Clone
with SnabI and StuI restriction enzymes. Lane 3: 2 log DNA ladder (NEB).
1 2 3
1 2
1020 bp
33
Fig. 6: Visualization of pEnOPTOEINTLUC THSP 18 entry clone vector after antarctic
phosphatase and elution. Lane 1: 2 log DNA ladder (NEB). Lane 2: LUC vector after
agarose gel excision and elution.
34
3.2.4 Cloning of OsPPO Promoter
Digested LUC vector ligated with PCR product by T4 DNA ligase (Thermo Fisher
Scientific) and ligation mixture was electroporated into DH10B for cloning of OsPPO
promoter region. Electroporated mixture was spread on LB plates (50 mg/L Kanamycin)
to get transformed colonies containing cloned OsPPOLUC promoter.
3.2.5 Confirmation of Cloning into DH10B
Cloning of OsPPO promoter was confirmed by PCR and restriction digestion. Correct
ligated clone was confirmed by PCR using colonies growing on LB media containing 50
mg Kanamycine/L. Primers were chosen from vector to amplify 1.3 kb region covering
whole OsPPO promoter (Fig. 7). Plasmids of PCR confirmed positive clones were
extracted and subjected to EcoRV restriction digestion to see correct digestion pattern of
ligated clones (Fig. 8). Clone that gave correct restriction banding was further selected
for sequencing and recombination reaction.
3.2.6 Sequencing of OsPPOLUC Clone
Enough plasmid was isolated for sequencing of OsPPO clone. Plasmid was column
purified and eluted. Vector specific primers set chosen from OsPPOLUC entry vector to
cover OsPPO promoter. Sequence results were analyzed by their sequence matches.
3.2.7 Signal Scan (PLACE) of OsPPO Promoter Sequence
OsPPO promoter 1020 bp sequence was scanned by PLACE signal software to find cis-
regulatory elements responsive for wounding, ABA, MJA, salt and osmotic stresses.
Signaling scan showed that OsPPO promoter possesses regulatory elements homologous
to different stress signaling boxes. Motifs such as MYC (4), WRKY (8), MYB (2) and
DPBF (2) transcription binding elements were found in promoter region of rice PPO
promoter responsible for ABA, water stress and plant defense signaling. Moreover, W-
boxes (6) were also found in OsPPO promoter for wound response signaling and GT-1 (1)
motif signaling for salt stress. The presence of these cis-regulatory elements further
supports the involvement of OsPPO promoter in wounding, ABA, drought and salt stress
responsive induction (Fig. 9).
1 2 3
35
Fig. 7: PCR confirmation of correct ligation. Lane 1: 1.3 Kb band showed the right
ligated clone from OsPPOLUC entry vector and lane 2 showed unspecific band. Vector
specific primer set was used to amplify entire 1020 bp PPO promoter. Lane 3: 2 log DNA
ladder (NEB).
Fig. 8: Confirmation of cloning of OsPPO by restriction digestion with EcoRV. PCR
positive clones digested to see correct restriction pattern of right ligation. Lane 1: 2 log
DNA ladder (NEB). In lane 2: Clone showed unspecific digestion pattern. Lane 3:
Accurate restriction banding of OsPPOLUC entry clone.
1 2 3
1.3 kb
4076 bp
2125 bp
36
Fig. 9: The 1020 bp region of OsPPO promoter showing distribution and positions of cis-regulatory elements on + and – strands.
37
3.2.8 Confirmation of OsPPOLUC Expression Clone
After recombination of entry vector with pMDC99 destination vector, OsPPOLUC
expression clones were confirmed by PCR and restriction digestion. Colony PCR was
performed using vector specific primers chosen from vector. A region of 682 bp was
amplified targeting one primer from inside of LUC gene and another primer outside of it
(Fig. 10). Further OsPPOLUC expression clone was restricted with EcoRV to confirm
correct combined expression vector (Fig. 11).
3.2.9 Agrobacterium Transformation and Confirmation
OsPPOLUC expression plasmid was extracted from DH10B and electroporated into
GV3101. This transformation was confirmed by PCR and LUC expression. Plasmids
were extracted and subjected to PCR with the help of vector specific primer set to
amplify 682 bp region of right OsPPOLUC expression clones (Fig. 12). Luciferase
expression was also confirmed from growing Agrobacterium by charge couple device
(CCD) (Fig. 13).
3.3 OsPPOGUS Vector Designing
OsPPOLUC entry clone was digested with NcoI, NotI and ppuMI restriction enzymes for
overnight at 37 ˚C. After digestion the vector was checked on agarose gel (Fig. 14) and
treated with antarctic phosphatase.
3.3.1 Amplification of GUS Gene
GUS gene was amplified from pFAJEL2 vector template using phusion polymerase. PCR
product was purified by ethanol precipitation with 0.1 volume of sodium acetate and 3
volume of ethanol and finally checked on agarose gel (Fig. 15).
3.3.2 Cloning of GUS Gene
Purified GUS gene was ligated in pEnOPTOEINTLUC THSP 18 entry vector by T4
DNA ligase for overnight at 4 ˚C. Ligated mixture was electroprated in DH10B for
cloning of GUS gene. The electroporated bacterial culture was spread on LB (50 mg/L
38
Fig. 10: Confirmation of recombined OsPPOLUC expression clones by PCR. Lane 2-11:
682 bp region amplified by vector specific primer set covering inside of LUC and outside
of it from OsPPOLUC expression clone. Lane 1: 2 log DNA ladder (NEB).
Fig. 11: Confirmation of OsPPOLUC expression clones by restriction digestion with
EcoRV. Lane 1: 2 log DNA ladder (NEB). Lane 2-6: OsPPOLUC expression clones
showing correct digestion pattern.
1 2 3 4 5 6 7 8 9 10 11
1 2 3 4 5 6
682 bp
6354 bp
3404 bp
2624 bp
39
Fig. 12: Confirmation of OsPPOLUC expression clone after Agrobacterium
transformation by PCR. Lane 1-3: 682 bp region amplified by vector specific primer set
covering inside of LUC and outside of it from OsPPOLUC expression clone. Lane 4: 2
log DNA ladder (NEB).
A B
Fig. 13 A: Confirmation of OsPPOLUC expression clone after Agrobacterium
transformation by Luciferase expression. PCR tested colonies showing Luciferase
expression in CCD camera after spray with 2 mM Luciferine. B: Luciferase lumination
scale.
1 2 3 4
1 2
682 bp
40
Fig. 14: Digestion of OsPPOLUC entry clone. Lane 1: PPOLUC entry clone digested
with NcoI, NotI and ppuMI restriction enzymes. Lane 2: 2 log DNA ladder (NEB).
Fig. 15: PCR amplification of GUS gene. Lane 1: Ethanol precipitated and column eluted
1.8 kb GUS gene amplification by phusion polymerase. Lane 2: 2 log DNA ladder (NEB).
kanamycine) plates and incubated at 37 ˚C for overnight to get desired transgenic
colonies containing GUS reporter gene.
3.3.3 Confirmation of Cloning
Cloning of GUS in OsPPOGUS clone was confirmed by PCR and restriction digestion.
Right clones were confirmed by colony PCR amplification of 730 bp fregment by vector
1 2
3859 bp
1189 bp
1.8Kb
41
specific set of primer from OsPPOGUS entry clones (Fig. 16). PCR positive clones were
subjected to plasmid isolation and digested with EcoRV to check the correct digestion
pattern of right ligated clones (Fig. 17).
3.3.4 Sequencing of OsPPOGUS Entry Clone
Enough plasmid was extracted for sequencing of GUS gene cloned in OsPPOGUS clone.
After column purification and elution, sequencing reactions were run with three vector
specific primers to cover GUS gene from vector. Sequence results were analyzed by their
peaks for checking any mismatch.
3.3.5 Transformation of OsPPOGUS Expression Clone in Agrobacterium
After recombination of entry vector with pMDC99 destination vector, OsPPOGUS
expression clones were confirmed by restriction digestion. Expression clones were
digested with EcoRV to confirm correct banding pattern of right OsPPOGUS clones
from E.coli (Fig. 18). Plasmid was extracted from DH10B and electroporated into
GV3101. OsPPOGUS clones (in Agrobaterium GV3101) were confirmed by colony PCR
to amplify 263 bp fragment by vector specific primer set (Fig. 19).
3.3.6 Glycerol Culture Maintenance
Glycerol cultures of Agrobaterium tumefaciens GV3101 strain containing OsPPOGUS
and OsPPOLUC expression vectors were prepared separately in 50 % glycerol solution.
Glycerol cultures were stored in – 80 ˚C for long term use.
42
Fig. 16: PCR confirmation of correct ligation. Lanes 3-9: 730 bp bands showed the right
ligated clone from OsPPOGUS entry vector. Vector specific primer set was used to
amplify 730 bp from OsPPOGUS entry clone. Lane 1: 2 log DNA ladder (NEB).
Fig. 17: Confirmation of OsPPO ligation in OsPPOGUS entry clone by restriction
digestion with EcoRV. Lane 1: 2 log DNA ladder (NEB). Lane 2-5: PCR positive
digested clones showing correct restriction pattern.
1 2 3 4 5 6 7 8 9
1 2 3 4 5
730 bp
1335 bp
43
Fig. 18: Digestion confirmation of OsPPOGUS expression clone after recombination
with pMDC99 destination vector. Lane 1: 2 log DNA ladder (NEB). Lane 2-6: PPOGUS
LR clones digested with EcoRV restriction enzyme showing correct digestion.
Fig. 19: Confirmation of transformation of OsPPOGUS expression clone in
Agrobacterium by PCR. Lane 1: 2 log DNA ladder (NEB). Lane 2-5: Amplification of
263 bp fragment vector specific primer set from OsPPOGUS expression vector.
1 2 3 4 5 6
1 2 3 4 5
7063 bp
2624 bp
263 bp
44
3.4 Plant Transformation
3.4.1 Plant Preparation and Floral Dip Transformation
Arabidopsis thaliana (Col-0) seeds were sterilized with 70 % ethanol. After plating and
48 hours cold treatment on MS media plates were placed in growth room. One week old
growing plants were shifted to soil. Twenty eight days old flowering shoots were now
ready for transformation (Fig. 20) by floral dip. Floral buds were transformed by spray of
OsPPOLUC and OsPPOGUS solutions separately. Plants were watered from top after 16
hours to remove excess of bacteria and sugar.
3.4.2 Procurement of Transgenic Seeds
T0 seeds were collected and dried in air for 24 hours. T0 seeds were selected on
hygromycin to get only transgenic seedlings. Hygromycin resistant transgenic plants T1
seedlings transferred to hygromycin free MS media then to soil (Fig. 21). Upon T1 seeds
maturation and collection these seeds were used to get T2 transgenic plants which were
used for stress treatment, RNA isolation and RT-PCR analysis.
3.5 Analysis of Transgenic Plants
3.5.1 Stress Treatments
Wounding, MJA, ABA, drought and salt stresses were given to T2 plants growing MS
media. For wounding, ABA, and MJA treatments ten days old plants were used. After
stress treatments plants were subjected to RNA isolation, cDNA synthesis and RT-PCR
analysis.
3.5.2 RNA Isolation
Total RNA was isolated from wounded, MJA and ABA stressed plants by manual
method using DNase (Promega). Integrity of RNA was checked on 1.5 % agarose gel
(Fig. 22 and 23). RNA was quantified by nanodrop and concentration of total RNA was
measured in ng/µl.
45
3.5.4 RT-PCR
RT-PCR (Roche Light Cycler-480) analysis was done with EvaGreen protocol using
EvaGreen reagent. Five times diluted cDNA was used for TR-PCR. LUC and GUS gene
were used as target and 18 S gene as internal control (Fig. 24). Samples were loaded on
PCR plate in duplicate and CP values was automatically calculated by giving specific
targets. These CP values were then used to calculate fold change in expression for
wounding, MJA and ABA stress treatments.
Fig. 20: Arabidopsis thaliana (Col-0) after four weeks showing appropriate flowering for
transformation by floral spray.
46
A B
Fig. 21: Hygromycin resistant transgenic T1 seedlings on simple MS media. A: Five days
old plants. B: Ten days old plants.
Fig. 22: Total RNA isolation from wounded T2 transgenic Arabidopsis thaliana plants.
Lane 1: Control plants. Lane 2-5: Total RNA isolated after wounding of 12, 24, 36 and
48 hours intervals from T2 transgenic lines.
1 2 3 4 5
47
Fig. 23: Total RNA isolation from ABA and MJA stressed T2 transgenic Arabidopsis
thaliana plants. Lane 1: Total RNA of control T2 plants. Lane 2-6: Total RNA isolated
by application of 50, 150, 250, 350 and 450 µM ABA. Lane 7-11: Total RNA isolated by
application of 50, 150, 250, 350 and 450 µM MJA.
Fig. 24: RT-PCR amplification of GUS and 18 S internal control gene. Lane 1 and 14: 2
log DNA ladder (NEB). All even number wells are indicative of GUS gene and all odd
number amplicons showing 18 S internal control gene.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
1 2 3 4 5 6 7 8 9 10 11
48
3.5.5 Induction of OsPPO by Wounding
Effect of wounding was monitored on T2 transgenic Arabidopsis thaliana. Quantitative
RT-PCR analysis was carried out to detect OsPPOLUC and OsPPOGUS transcript level
in ten days old T2 transgenic plants wounded for 12, 24, 36 and 48 hours on MS media.
Fold change values were calculated from RT-PCR CP values of LUC and GUS target
genes.
Transcript level represents OsPPOLUC and OsPPOGUS mRNA compared with
reference. Both LUC and GUS mRNA levels showed that mechanical injury induced
transcript accumulation of respective LUC and GUS transcripts. Response of OsPPO
promoter showed an increasing trend with the passage of time. After 12 hours the
transcript level increased up to 3 folds and reached maximum level of up to 11 folds after
36 hours of wounding. After this maximum fold change OsPPO transcript level
decreased at 48 hours (Fig. 25 and 26).
Inducibility of OsPPO promoter was also checked by LUC expression under CCD
camera and GUS staining. These LUC and GUS expression also confirmed that OsPPO
promoter induced slowly after wounding and reached to higher expression after 36 hours
and declined after 48 hours. The unwounded leaves on wounded plant also showed
LUC/GUS activity (Fig. 27 and 28). The relative expression levels of LUC and GUS
revealed that OsPPO exhibited a wound induced response in transgenic Arabidopsis host.
So OsPPO is sensitive to mechanical injuries and increases response with the passage of
time showing wound induced OsPPO expression.
49
Fig. 25: Quantification of OsPPOLUC mRNA level induced by wounding. Ten days old
T2 transgenic Arabidopsis lines were subjected to mechanical injury growing on MS
media and real-time PCR was performed after intervals of 12 hours to detect wound
induced response of PPO promoter by accumulation of OsPPOLUC transcripts (Key, H:
hours). Each value given in the graph is a mean of three independent experiments.
Fig. 26: Quantification of OsPPOGUS mRNA level induced by wounding. Ten days old
T2 transgenic Arabidopsis lines were subjected to mechanical injury growing on MS
media and real-time PCR was performed after intervals of 12 hours to detect wound
induced response of PPO promoter by accumulation of OsPPOGUS transcripts (Key, H:
hours). Each value given in the graph is a mean of three independent experiments.
50
C
A B
C D
E F
Lumination Scale
Fig. 27: Wound induced LUC expression of OsPPO carried out on ten days old T2
transgenic Arabidopsis lines. Control plants (transgenic unwounded) (B). Mechanically
injured plants were incubated on MS media and tested after 12 hours (C), 24 hours (D),
36 hours (E) and 48 hours (F) intervals. Wounds were produced on half number of leaves
on each plant (Key. A: bright field, B: control, H: hours).
51
A B C
D E
Fig. 28: Wound induced GUS expression of OsPPO carried out ten days old T2
transgenic Arabidopsis lines. Control plants (transgenic unwounded) (A). Mechanically
injured plants were incubated on MS media and tested after 12 hours (B), 24 hours (C),
36 hours (D) and 48 hours (E) intervals. Wounds were produced on half number of leaves
on each plant (Key. CO: Control, H: hours).
52
3.5.6 Induction of OsPPO in Response to MJA and ABA Application
To check the response of OsPPO on hormonal applications, RT-PCR was used to
characterize expression profile in transgenic T2 plants. ABA and MJA were sprayed on
transgenic plants, and a wide range of concentrations of ABA and MJA (50 µM, 150 µM,
250 µM, 350 µM, and 450 µM) were used and kept in growth chamber for 24 hours.
Quantitative LUC and GUS gene transcripts levels indicated that OsPPO promoter
induced only by ABA up to 3 folds at 350 µM concentrations but not by MJA (Fig. 29
and 30). OsPPO response to ABA was supported by LUC and GUS activities (Fig. 31a
and 32a) and no increase in LUC and GUS activity was observed by MJA stress (Fig. 31b
and 32b). These results suggest that OsPPO promoter was induced by ABA only and not
by MJA.
3.5.7 Drought and Salt Response of OsPPOGUS
To find out the response of OsPPO promoter to drought and salt, T2 Arabidopsis lines
carrying OsPPOGUS were stressed on MS media with drought (PEG-6000) and salt
(NaCl) for 24 hours and stained with GUS solution for overnight. Osmotic stress was
given with PEG-6000 (5 %, 10 %, 15 %, 20 %, 25 %, and 30 %) in MS media to analyze
the effect of PEG-6000 on OsPPO promoter. While salt stress treatments were also given
in MS media. Salt concentrations of 50, 100, 150, 200, 250 and 300 mM were used to
analyze the effect of salt stress on GUS expression driven by OsPPO promoter.
GUS staining technique revealed that OsPPOGUS activity was not detectable in
untreated control plants. The relative GUS expression of OsPPO started with PEG-6000
at 5 % and continued to increase with increase in drought reaching maximum in whole
plant parts at 20 % after staining in GUS for overnight (Fig. 33). Similarly increasing salt
concentration showed more GUS activity with strong expression in root, stem and leaves
at 200 mM and then uniform up to 300 mM (Fig. 34). OsPPO promoter induced well by
higher drought and salt stress treatments. These results are clear indicative that OsPPO
promoter is responsive to higher drought as well as salt stresses.
53
Fig. 29: RT-PCR analysis of OsPPOLUC activity by ABA (A) and MJA (M)
applications. Quantitative RT- PCR was carried out to detect OsPPOLUC transcripts
level in ten days old T2 transgenic Arabidopsis lines by sprays of ABA and MJA
solutions (μM) growing on MS media. Each value given in the graph is a mean of three
independent experiments.
Fig. 30: RT-PCR analysis of OsPPOGUS activity by ABA (A) and MJA (M)
applications. Quantitative real-time PCR was carried out to detect OsPPOGUS transcript
level in ten days old T2 transgenic Arabidopsis lines by sprays of ABA and MJA
solutions (μM) growing on MS media. Each value given in the graph is a mean of three
independent experiments.
54
A B C D
E F G
Lumination Scale
Fig. 31a: 5. Luciferase expression by OsPPO promoter fused with LUC reporter gene by
ABA application. Transgenic Arabidopsis T2 lines were sprayed with different
concentrations 50 μM (C), 150 μM (D), 250 μM (E), 350 μM (F) and 450 μM (G) of
ABA on MS media for 24 hours (A: Bright field, B: control, ABA: abscisic acid).
55
A B C D
E F G
Lumination Scale
Fig. 31b: Luciferase expression by OsPPO promoter fused with LUC reporter gene in
MJA application. Transgenic ArabidopsisT2 lines were sprayed with different
concentrations of 50 μM (C), 150 μM (D), 250 μM (E), 350 μM (F) and 450 μM (G) of
MJA and kept on MS media for 24 hours (A: Bright field, B: Control, MJA: Methyl
Jasmonate).
56
A
E
B
C D
F
A
E
Fig. 32a: GUS expression by OsPPO promoter fused with GUS reporter gene by ABA
application. Transgenic ArabidopsisT2 lines were sprayed with different concentrations
50 μM (B), 150 μM (C), 250 μM (D), 350 μM (E) and 450 μM (F) of ABA on MS for 24
hours. Plants were immersed in GUS staining solution for overnight (Key. A: Control,
ABA: Abscisic Acid).
57
A B
C D
E F
Fig. 32b: GUS expression by OsPPO promoter fused with GUS reporter gene by MJA
application. Transgenic ArabidopsisT2 lines were sprayed with different concentrations
50 μM (B), 150 μM (C), 250 μM (D), 350 μM (E) and 450 μM (F) of MJA on MS for 24
hours. Plants were immersed in GUS staining solution for overnight (Key. A: Control,
MJA: Methyl Jasmonate).
58
Fig. 33: Induction of OsPPO promoter fused with GUS reporter gene in osmotic stress.
Transgenic T2 Arabidopsis thaliana lines were subjected with different concentrations of
PEG-6000 yielding - 0.3 to - 1.8 MPa water potential on MS for 24 hours. Plants were
immersed in GUS staining solution for overnight and analyzed for relative GUS
expression of OsPPO in response to water stress. (PEG-6000 used in A: Control, B: 5 %:
C: 10 %, D: 15 %, E: 20 %, F: 25 % and G: 30 %).
59
Fig. 34: Induction of OsPPO promoter fused with GUS reporter gene in salt stress.
Transgenic T2 Arabidopsis thaliana lines were subjected with different NaCl
concentrations on MS media for 24 hours. Plants were immersed in GUS staining
solution for overnight and analyzed for relative GUS expression of OsPPO in response to
salt stress. A: Control, B: 50 mM, C: 100 mM, D: 150 mM, E: 200 mM, F: 250 mM and
G:300mM).
60
3.6 General Microscopy of Transgenic Arabidopsis
Transgenic Arabidopsis were subjected to microscopic (Leica DMLB2, 20X and 40X)
analysis. GUS expression showed that control plant leaves did not have any obvious GUS
staining activity in leaf veins and other mesophyll tissue regions. In transgenic leaf after
12 hours of wounding diffused GUS activity appeared mainly in midrib and very light in
surrounding mesophyll tissues. With the passage of time after wounding GUS activity
started increasing in leaf tissues. After 36 hours of injury GUS expression diffused from
midrib outwards into mesophyll area becoming intense in all tissues of leaf including
vascular veins, mesophyll and also in stomatal guard cells. The outer layer of vascular
bundles was found to have more GUS expression showing more OsPPO activity than
inner vascular layer (Fig. 35).
In stem the GUS expression increases after injury in all regions. Diffused GUS activity
was observed in cortex and vascular region after 12 and 24 hours. However, after 36
hours GUS activity increased throughout stem and vascular bundles and cortex tissues
showed somewhat uniform intensity of GUS staining. Moreover, outer layers of vascular
cells showed more OsPPO promoter activity than inner cells (Fig. 36). In roots prominent
GUS activity was found with more intense expression in vascular regions than cortex
after 24 hours of injury. With the passage of time after 36 hours all root tissues cortex as
well as vascular region showed uniform GUS activity to some extents with a little bit
more in outer portions of vascular bundles than inner vascular region. Root hairs also
indicated slight GUS staining after wounding (Fig. 37).
61
Fig. 35: OsPPO promoter derived GUS expression in Arabidopsis leaf tissues A: Control
plant leaf with no GUS; B, C: Low diffused GUS expression seen in stomatal guard cells,
leaf veins and surrounding tissues after 12 hours of wounding; D, E: Stomatal guard cells,
veins and surrounding mesophyll area showing higher GUS activity after 24 and 36 hours
of injury.
A B
C D
E
62
Fig. 36: OsPPO promoter derived expression of GUS in stem of transgenic Arabidopsis.
A: Control plant showing no GUS after wounding; B, C: Diffused GUS expression in
stem after 12 and 24 hours; D: GUS activity in stem after 36 hours of wounding.
A B
C D
63
Fig. 37: OsPPO promoter derived GUS expression in root of transgenic Arabidopsis. A:
Root showing GUS expression after 24 hours of injury; B: Root showing uniform GUS
expression in root cells; C, D: Root hairs showing slight GUS activity after wounding.
A B
C D
64
DISCUSSION
Major finding of present research indicates that OsPPO promoter highly responded to
wounding and also induced by ABA treatment as revealed by LUC, GUS activities and
transcript accumulation analyzed by RT-PCR. Moreover, OsPPO promoter was found to
be induced by higher drought and salt stresses. Highly wound inducible OsPPO promoter
was profiled with relative expression in ABA, MJA, drought and salt stresses in
transgenic Arabidopsis. Here it was found that OsPPO promoter was highly induced by
mechanical injuries. Expression profiling pattern was elucidated by RT-PCT in T2
transgenic Arabidopsis lines.
A hormonal response of OsPPO was checked by transcript levels and LUC and GUS
activities under ABA and MJA stresses. OsPPO promoter showed response in ABA
application revealed by RT-PCR analysis as well as LUC and GUS activities. At 350 µM
ABA treatment, OsPPO was induced up to 3 folds. In case of MJA, OsPPO remained
non-responsive as revealed by LUC, GUS activities as well as by their mRNA transcripts.
In general OsPPO induced by ABA but not by MJA.
Similarly it was found that OsPPO promoter is responsive to drought and salt. Drought
induced OsPPOGUS expression as PEG-6000 percentage increases. At 20 % PEG-6000
maximum GUS expression was found. Likewise OsPPO promoter was induced by salt
stress and GUS intensity was increased with increasing salt concentration and reached
maximum at 200 mM. So OsPPO noticeably showed response to higher drought and salt
stress.
4.1 Induction of OsPPO by Wounding
PPO is widely distributed in plant kingdom and involved in plant defense (Aniszewski et
al., 2008). It is well known that plant PPO gene expression is induced by different biotic
and abiotic stresses (Constabel et al., 2000; Quarta et al., 2013). Transgenic tobacco over
expressing peroxidases showed PPO accumulation. Upon wounding treatments of one
week overproduction of peroxidase resulted in browning indirectly through PPO
induction (Lagrimini, 1991). Similarly transgenic tomato plants expressing systemin gene
65
were tested by wounding stress. Upon crushing leaves of these transgenic tomato leaves
and exogenous application of systemin, excised leaves of transgenic tomato enhanced the
PPO up to 70 fold levels than wild plants (Constabel et al., 1995). These findings of PPO
involvement support of OsPPO relative expression induced by wounding.
Moreover it was seen that unwounded leaves of wounded Arabidopsis also showed
expression of OsPPOLUC and OsPPOGUS activities in T2 transgenic lines. This pattern
of expression indicates the possible role of PPO in insect resistance (Haruta et al., 2001).
The undamaged (control) hybrid poplar plants showed very minute level of detectable
mRNA of PtPPO which increased after localized damage on leaves. In another report it
was found that feeding by forest tent caterpillar raised Aspen (Poplus tremuloide) PtPPO
mRNA level as did by mechanical wounding demonstrating the induction of PtPPO by
wound stimulation as well as by real herbivory.
Similarly in hybrid poplar (Poplus trichocarpa x Poplus deltoides) PPO was also induced
by mechanical wounding and insect attack (Constabel et al., 2000). Moreover OsPPO is
not an early responsive as it showed late response after 36 hours that is very close to
PtPPO wound response (Harutta et al., 2001). Relative expression of pineapple (Ananas
comsus) PPO gene promoter after two days is also a late wound response which is
comparable to our OsPPOGUS and OsPPOLUC transcript level expression after 36
hours (Zhou et al., 2003). In another related study, analysis revealed that artichoke
(Cynara cardunculus) PPO significantly induced by wounding after 48 hours (Quarta et
al., 2013).
PPO in wound responses and defense mechanism was also reported in other plants which
are in consistent to OsPPO wound inducible activity as Strewat et al. (2001) reported
pineapple PPO induction by wounding. In another investigation, RT-PCR expression of
Hevea brasiliensis PPO gene varied in different tissues and developmental stages of
leaves and HbPPO transcript regulation was also associated with wounding (Li et al.,
2014).
66
Wound induction of OsPPO promoter suggests a possible role of PPO gene in plant
defense. This notion was also supported by experimental data in transgenic tomato lines
over-expressing potato PPO gene improved resistance to bacterial pathogen
Pseudomonas syringae (Li and Stiffen, 2002). PPO over-expression in dandelion was
found to be strongly induced by Botrytis cinerea. Dandelion PPO gene expression in
transgenic Arabidopsis showed antibacterial activity against Pseudomonas syringae
(Richter et al., 2012). In another investigation, it was found that over-expression of PPO
gene in transgenic populous enhanced the resistance against forest tent caterpillar (Wang
and Constabel, 2004).
Similarly altered PPO gene expression in transgenic plants showed anti-herbivory against
various insects such as forest tent caterpillar (Haruta et al., 2001; Wang and Constabel,
2004), tree feeding caterpillars (Constabel et al., 2000; Barbehenn et al., 2007), common
cutworms and cotton bollworm (Thipyapong et al., 2006), cut worms (Mahanil et al.,
2008) and bollworm and armyworm (Bhonwong et al., 2009). Recently, Jia et al. (2015)
found that in strawberry (Frgaria ananas) over-expression of FaPPO gene delayed
fungal pathogen attack during fruit development. Fungal assays on soybean over-
expressing (Glycin max) GmaPPO gene revealed that its promoter is a Phytophthora
sojae immediatly induced promoter (Chai et al., 2013). In a related study, it was seen that
plant PPO is considered as part of defense mechanism due to its induction in wound and
pathogen attacks (Tran et al., 2012).
As expected on the other hand, plants with down-regulated PPO showed more
vulnerability to pathogens. Potato antisense PPO gene expression in transgenic tomato
reduced PPO expression 40 folds which dramatically increased susceptibility to P.
syringae by 55 folds increased growth (Thipyapong et al., 2004a). Richter et al. (2012)
also reported P. syringae susceptibility of dandelion with PPO down-regulation. PPO
knocked down walnut plants with less than 5 % PPO activity noticeably acquired necrotic
leaves lesion even in the absence of pathogen as depicted by transcriptoms and
metabolomes compared to wild walnut. Thus PPO possesses a role in cell death in walnut
(Araji et al., 2014).
67
OsPPO promoter derived expression of GUS in transgenic Arabidopsis leaves, stem and
roots may be attributed to the defensive role to the site of injury to prevent several
pathogens (Ludlum et al., 1999; Wang et al., 2004; Madhayam et al., 2006; Raj et al.,
2006; Thipyapong et al., 2007; Bhonwong et al., 2008 and Berbehenn et al., 2009).
OsPPO may have similar role against microbial pathogen entry at the site of injury as
microbial activities of Botrytis and Psedumonas at lesions in Taraxacum officinale
strongly induce GUS directed PPO expression (Richter et al., 2012). These studies
correlate the OsPPO roles in plant defense against pathogens.
4.2 Induction of OsPPO in Response to MJA and ABA Application
To verify the role of OsPPO promoter to ABA and MJA, the transcript assembly of
OsPPOLUC and OsPPOGUS were analyzed. RT-PCR data indicated an up-regulation of
OsPPO promoter under ABA stress and it was also revealed by GUS and LUC activities.
Therefore it was found that OsPPO promoter is ABA inducible. Similar results were
found in GmaPPO gene promoter of soybean where quantitative RT-PCR was performed
to test accumulation of GmPPO gene in transgenic soybean. Expression profiling showed
2.5 folds up-regulation of GmPPO gene treated with ABA but there was no inductivity in
response to MJA (Chai et al., 2013). Moreover, banana PPO gene also remained non-
responsive to MJA where 5-methyl jasmonate did not induce PPO expression in banana
fruit and leaves (Gooding et al., 2001).
As ABA signal transduction was found to be involved in biotic and osmotic stress, ABA
plays significant role in development and adaptation to various stresses. Plants synthesize
ABA in stress which initiates defense mechanisms and regulation of stomata. This
regulated stomatal opening and closing is to control pathogen (Lim et al., 2015). Plant’s
response to water and salt stress and insect and pathogen attack are biochemically
interlinked relations. Initial biochemical models indicated that ABA is an important
hormone in response to water and salt stresses (Thaler and Bostock, 2004).
Similarly salinity exposure revealed a reduced resistance of ABA deficient lines against
insect Spodoptera exigua signifying a positive correlation between responses to water
68
stress and herbivory through ABA signalling (Thaler and Bostock, 2004). Recently, it
was investigated that ABA is involved in regulation of FaPPO in transgenic straw berry.
FaPPO gene was found to be regulated by fungal pathogens of powdery mildew and gray
mold and strawberry showed delayed fungal infection process during fruit development
(Jia et al., 2015). OsPPO induction by ABA plant hormone is likely to be attributed to a
possible role of OsPPO in plant defense through ABA signaling. Plant naturally evolved
an intricate signaling mechanism to recognize environmental stress and to react through
proper morphological and physiological changes (Xiong and Yang, 2003). ABA, MJA
and ethylene are thought to play important role in osmotic stress (Lehmann et al., 1995).
4.3 Drought and Salt Response of OsPPOGUS
Presently, it was observed that OsPPOGUS activity showed increasing trend with higher
osmotic stress produced by different concentrations of PEG-6000 and achieved constant
intensity level at 20 %. Drought induction of OsPPO promoter is comparable with GUS
expression of potato PPO in transgenic tomato in response to drought. Tomato plants
transformed with potato sense PPO gene over-expressing PPO, antisense PPO gene
suppressing PPO expression and non transgenic control were tested in drought
(Thipyapong et al., 2004b).
Drought induced expression of PPO in control and PPO over-expressing transgenic
tomato plants with highest magnitude in adult leaves and abscission regions was observed
which facilitate cell death showing an adjustment to reduce water loss and nutrients
movement in younger leaves during drought event (Thipyapong et al., 2004b). Moreover,
abscission in adult leaves and pith damage is earlier in non transgenic and PPO over-
expressing plants. Induction of PPO may also activate several other defensive genes to
prevent pathogen attack after organ loss in drought (Campillo et al., 1992; Coupe et al.,
1997; Hong et al., 2002; Kong et al., 2002). This PPO induction may point out a cross
talk between biotic and abiotic signaling to protect pathogen infection and to ensure plant
survival in unfavorable environment (Thipyapong et al. 2004b) as revealed by
antimicrobial activity and antifungal activity of quinon and hydrogen peroxide (Mayer
and Harel, 1979; Peng and Kuc, 1992).
69
On the other hand transgenic tomato with suppressed PPO exhibited increased drought
tolerance. As drought event proceeded, control and over-expressing PPO tomato plants
began to show wilting and curling stress indications earlier than suppressed PPO plants.
In addition leaf yellowing was also late in suppressing PPO tomato lines. Water potential
was also measured in transgenic and control lines. Suppressing PPO genotypes has less
negative water potential (- 1.4 MPa) than control and over-expressing lines (- 1.7 MPa)
after 9 days of osmotic stress. The differential induction and down-regulation of PPO
showed additional role of PPO in environmental stresses (Thipyapong et al., 2004b).
Drought responsive induction of OsPPO from is in accordance with the activity of PPO
induced by water stress that has already been demonstrated in tomato (Loeb et al., 1997).
PPO induction was found to be elevated by water stress in coconut (Shivishankar, 1988)
and wheat (Kaur et al., 2015). In another report Ramonda serbica desiccated leaves
activated several fold higher PPO induction when plants were subjected near to complete
drying conditions (Veljovic-Jovanovica et al., 2008).
It was also observed that OsPPO exhibited induction in response to salt stress and
relative GUS expression and intensity reached higher at 300 mM NaCl and expression
attained uniform intensity. OsPPO salt responsive induction can be correlated with PPO
activity previously noted in salt stress conditions. Bean seedling upon NaCl stress
showed higher PPO activity (Demir and Kocacaliskan, 2001). Similarly Ali and Abbas
(2003) also reported PPO activity by treatment with NaCl in barely decreasing growth
rate. Moreover, it was observed that NaCl caused changes in PPO activity in calli and
seedling.
In another report, Trigonella foenum callus growing on media supplemented with salt
(NaCl) showed gradually increased PPO activity with the increase of external salinity
level. Similarly, PPO activity slightly increased in T. foenum seedlings up to 200 mM
NaCl concentration (Niknam et al., 2006). Recently, over-expression of FaPPO was
found to be regulated by NaCl in transgenic strawberry over-expressing FaPPO. Salt
70
stress along with cold damages imparts fruit susceptibility to bacterial and fungal
infection during which FaPPO induced (Jia et al., 2015). It was also reported that salt
stress reduced the chemical induction of pathogenesis related proteins and increased
chance of pathogen attack on ABA deficient plants after short salinity stress (Thaler and
Bostock, 2004).
4.4 Signal Scan (PLACE) of OsPPO Promoter Sequence
During the expression profiling of OsPPO gene promoter, it was observed that this
promoter is performing a wide range of functions in response to different hormonal
applications or stresses, which in indicative of the presence of different responsive
elements related to wound, ABA, drought and salt in its promoter region. PLACE signal
scan analysis of 1020 bp OsPPO promoter sequence revealed many such stress
responsive elements in it with a possible role in wound, ABA, drought and salt stress
inducibilities.
Presence of W-boxes responsible for wound induced in 1020 bp region of OsPPO
promoter were found like to W-boxes which involve in rapid activation of genes in
wounding stress (Nishiuchi et al., 2004). At present OsPPO promoter sequence data is
also comparable with wound responsive elements as in Cynara cardunculus (CsPPO)
promoter (Quarta et al., 2013). Occurrence of ABA or stress responsive regulatory sites
such as DPBF, MYB, MYC and WRKY suggest that OsPPO promoter can mediate such
induction activities (Kim et al., 1997; Abe et al., 2003; Xie et al., 2005).
Chai et al. (2013) reported the presence of MYB and MYC cis-regulatory elements in
GmaPPO promoter which was found to be ABA and Phytophtora inducible. Moreover,
OsPPO promoter also contain GT-1 motif that is salt responsive and water stress related
cis-elements MYB were also found (Urao et al., 1993; Park et al., 2004). Occurrence of
these ABA, drought, salt and wound responsive sites further affirms OsPPO induction by
ABA and wounding (Urao et al., 1993; Nishiuchi et al., 2004; Park et al., 2004; Chai et
al., 2013).
71
The induction of OsPPO promoter by ABA and wound stresses may possibly indicate its
role to insect, pathogen and drought resistance. These results are helpful in potential
understanding of plant responses to such stressors. These findings may also be helpful for
studying regulatory motifs responsible for OsPPO gene expression and its role in plant
defense mechanism against insects or pathogens. OsPPO promoter responded well under
water and salt stress indicating its positive correlation with increased abiotic stresses such
as drought and salt stress. This drought and salt responsiveness of OsPPO demonstrated
that rice PPO is involved in defense mechanism against environmental stresses such as
water shortage and saline pressure.
CONCLUSIONS
In summary OsPPO promoter showed good response to applied stresses namely
wounding, drought and salt and hormonal application except MJA application.
Expression profiling of mRNA transcript of reporter genes revealed that OsPPO
promoter induced up to 11 folds by wounding and 3 folds by ABA but not by MJA. This
mRNA accumulation was also confirmed by relative LUC and GUS expression intensity
under wounding and ABA stresses. Moreover, the relative GUS expression intensity
showed induction of OsPPO promoter by drought and salt conditions. Considering the
role of OsPPO in wounding, ABA, drought and salt stresses, and the consequent OsPPO
promoter induction indicates that these stresses induce PPO expression in plants as a
defense mechanism.
72
REFERENCES
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003).
Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional
activators in abscisic acid signaling. The Plant Cell 15(1): 63–78.
Ali RM, Abbas HM (2003). Response of salt stressed barely seedlings to phenylurea.
Plant soil and Environment 49, (4): 158–162.
Anderson JV, Fuerst EP, Tedrow T Hulke B Kennedy AC (2010). Activation of
polyphenol oxidase in dormant wild Oat caryopses by a seed-decay isolate of
Fusarium avenaceum. Journal of Agriculrural and Food Chemistry. 58. 10597-
10605.
Aniszewski T, Lieberei R, Gulewicz K (2008). Research on catecholases, laccases and
cresolases in plants. Recent progress and future needs. Acta Biologica
Cracoviensia Series Botanica 50: 7–18.
Araji S, Grammer TA, Gertzen R, Anderson SD, Mikulic-Petkovsek M Veberic R, Phu
ML, Solar A, Leslie CA, Dandekar AM, Matthew A. Escobar MA (2014). Novel
roles for the polyphenol oxidase enzyme in secondary metabolism and the
regulation of cell death in walnut. Plant Physiology 164: 1191–1203.
Balakumar T, Gayathri B, Anbudurai,PR (1997). Oxidative stress injury in tomato plants
induced by supplemental UV-B radiation. Biologia Planarum 39: 215-221.
Barbehenn RV, Jones CP, Yip L, Tran L, Constabel CP (2007). Limited impact of
elevated levels of polyphenol oxidase on tree-feeding caterpillars: assessing
individual plant defenses with transgenic poplar. Oecologia. 154: 129–140.
Bhonwong A, Stout MJ, Attajarusit J, Tantasawat P (2008). Defensive role of tomato
polyphenol oxidases against cotton bollworm (Helicoverpa armigera) and beet
armyworm (Spodoptera exigua). Journal of Chemical Ecology 35: 28–38.
Bolwell GP (1999). Role of active oxygen species and no in plant defense responses.
Current Opinion in Plant Biology 2: 287–294.
Boss PK, Gardner RC, Janssen BJ, Ross GS (1995). An apple polyphenol oxidase cDNA
is up-regulated in wounded tissues. Plant Molecular Biology 27: 429–33.
73
Brisson LF, Tenhaken T, Lamb C (1994). Function of oxidative cross-linking of cell wall
structural proteins in plant disease resistance. Plant Cell 6: 1703–1712.
Campillo ED, Lewis LN (1992). Identification and kinetics of accumulation of proteins
induced by ethylene in bean abscission zones. Plant Physiology. 98: 955–961.
Chai C, Lin Y, Shen D, Wu Y, Li H, et al. (2013). Identification and Functional
Characterization of the Soybean GmaPPO12 Promoter Conferring Phytophthora
sojae Induced Expression. PLoS ONE 8(6): e67670.
doi:10.1371/journal.pone.0067670.
Constabel CP, Bergey DR, Ryan CA (1995). Systemin activates synthesis of wound-
inducible tomato leaf polyphenol oxidase via the octadecanoid defense signaling
pathway. Proceedings of the National Academy of Sciences USA Vol. 92, pp.
407–411.
Constabel CP, Ryan CA (1998).A survey of wound- and methyl jasmonate-induced leaf
polyphenol oxidase in crop plants. Phytochemistry 47: 507–11.
Constabel CP, Yip L, Patton JJ, Christopher ME (2000). Polyphenol oxidase from hybrid
poplar. Cloning and expression in response to wounding and herbivory. Plant
Physiology 124: 285–295.
Coupe SA, Taylor JE, Roberts JA (1997). Temporal and spatial expression of mRNAs
encoding pathogenesis-related proteins during ethylene-promoted leaflet
abscission in Sambucusnigra. Plant Cell Environment 20: 1517–1524.
Daroit D J, A P F Correa, Klug T V, A Brandelli (2010). Partial purification and
characterisation of polyphenol oxidase from Araucaria angustifolia. Journal of
Food Chemistry. 34. 1216-1230
Demir Y, Kocaliskan I (2001). Effect of NaCl and proline on polyphenol oxidase activity
in bean seedling.BiologiaPlantarum 44(4): 607–609.
Dixon RA,Harrison MJ (1990). Activation,structure and organization of genes involved
in microbial defenses in plants. Advances in Genetics28: 165–234.
El-Moussaoui A, Nijis M, Paul C, Wintjents R, Vincentelli J, Azakan M, Looze Y (2001).
Revisiting the enzymes stored in the laticifers of Carica papaya in the context of
their possible participation in the plant defense mechanism. Cellular and
Molecular Life Sciences 58: 556–570.
74
Escobar MA, Shilling A (2008). Characterization of polyphenol oxidase from walnut.
Journal of the American Society for Horticultural Science 133(6): 852–858.
Felton GW, Donato K, Del Vecchio RJ, Duffey SS (1989). Activation of plant foliar
oxidases by insect feeding reduces nutritive quality of foliage for noctuid
herbivores. Journal of Chemical Ecology 15: 2667–2694.
Friedman M (1997). Chemistry, biochemistry, and dietary role of potato polyphenols.
Journal of Agriculture Food Chemistry 45: 1523–1540.
Gaballah MS, Ouda SA, Mandour MS, Rady MM (2006). Predicting the role of
antioxidants and irrigation on sunflower yield grown under saline conditions.
Environ. Sound Technology Water Res. Manage. Proceeding (515).
Gooding PS, Bird C, Robinson SP (2001). Molecular cloning and characterization of
banana fruit polyphenol oxidase Planta 213: 748–757.
Greenberg JT (1997). Programmed cell death in plant-pathogen interactions. Annual
Review of Plant Physiology Plant Molecular Biology 48: 525–545.
Haruta M, Pedersenb JA, Constabela CP (2001). Polyphenol oxidase and herbivore
defense in trembling aspen (Populus tremuloides): cDNA cloning, expression,
and potential substrates. Physiologia Plantarum 112: 552–558.
Hong JK, Hwang BK (2002). Induction by pathogen, salt and drought of a basic class II
chitinase mRNA and its in situ localization in pepper (Capsicum annuum).
Physiologia Plantarum 114: 549–558.
Jia H, Zhao P, Wang B, Tariq P, Zhao F, Zhao M, Wang Q, Yang T, Fang J (2015).
Over-expression of Polyphenol Oxidase Gene in Strawberry Fruit Delays the
Fungus Infection Process. Plant Molecular Biology Reporter 1–15.
Jones BA, Hatfield RD, Muck RE (1995a). Characterization of proteolysis in alfalfa and
red clover. Crop Science 35: 537–541.
Jones BA, Hatfield RD, Muck RE (1995b). Screening legume forages for soluble phenols,
polyphenol oxidase and extract browning.Journal of Science of Food and
Agriculture 67: 109–112.
Jones BA, Muck RE, Hatfield RD (1995c). Red clover extracts inhibits legume
proteolysis. Journal of the Science of Food and Agriculture 67: 329–333.
75
Kanade SR, Rao DH, Hegde RN Gowda LR (2009). The unique enzymatic fuction of
field bean (Dolichos lablab) D-galactose specific lectin: a polyphenol oxidase.
Glycoconjugation Journal. 26. 535-545.
Kaur L, Zhawar VK (2015). Phenolic parameters under exogenous ABA, water stress,
salt stress in two wheat cultivars varying in drought tolerance. Indian Journal of
Plant Physiology 20: 151-156.
Kim SY, Chung HJ, Thomas TL (1997). Isolation of a novel class of bZIP transcription
factors that interact with ABA-responsive and embryo-specification elements in
the Dc3 promoter using a modified yeast one-hybrid system. The Plant Journal
11(6): 1237–51.
Kocabas D S, Ogel ZB, Bakir U (2010). Screening of tree leaves as annual renewable
green biomass for phenol oxidase production and biochemical characterisation of
mulberry (Morus alba) leaf phenol oxidase. World Journal of Microbial
Biotechnology. 27: 701-707.
Kong HY, Jung HW, Lee SC, Choi D, Hwang BK (2002). A gene encoding stellacyanin
is induced in Capsicum annuum by pathogens. Physiologia Plantarum 115: 550–
562.
Lagrimini LM (1991). Wound-induced deposition of polyphenols in transgenic plants
over-expressing Peroxidase. Plant Physiology 9: 577–583.
Lee YR, Kim JY, Woo KS, Hwang IG, Kim KH, Kim KJ, Kim JH, Jeong HS (2007).
Changes in the chemical and functional components of Korean rough rice before
and after germination. Food Science and Biotechnology 16: 1006–1010.
Lehmann J, AtzornR, Bruckner C, Reinbothe S, Leopold J, Wasternack C, Parthier B
(1995). Accumulation of jasmonate, abscisic acid, specific transcripts and proteins
in osmotically stressed barley leaf segments. Planta 197: 156–162.
Li D, Deng Z, Liu C, Zhao M, Guo H, Xia Z, Liu H (2014). Molecular cloning,
expression profiles, and characterization of a novel polyphenol oxidase (PPO)
gene in Hevea brasiliensis. Bioscience, Biotechnology, and Biochemistry Vol. 78,
No. 10: 1648–1655.
Li L, Steffens JC (2002). Over-expression of polyphenol oxidase in transgenic tomato
plants results in enhanced bacterial disease resistance. Planta 215: 239–247.
76
Lim CW, Baek W, Jung J, Kim JH, Lee SC (2015). Function of ABA in stomatal
defense against biotic and drought stresses. International Journal of Molecular
Sciences 16: 15251–15270.
Loeb EG, Stout MJ, Duffey SS (1997). Drought stress in tomatoes: Changes in plant
chemistry and potential nonlinear consequences for insect herbivores. OIKOS 79:
456–468.
Ludlum CT, Felton GW, Duffey SS (1999). Plant defences: Cholorogenic acid and
polyphenol oxidase enhance toxicity of Bacillus thuringiensis sub sp. Kurstaki to
Heliothis zea. Journal of Chemical Ecology. 17(1): 217-237.
Madhayam M, Reddy BVS, Anandhan R, Senthlkumar M, Poonguzhali S,
Sa T (2006). Plant growth promoting Methylobacterium induces defence response
in Groundnut (Arachis hypogaea) compared with rot diseases. Current
Microbiology. 53: 270-276.
Mahanil S, Attajarusit J, Stout MJ, Thipyapong P (2008). Over-expression of tomato
polyphenol oxidase increases resistance to common cutworm. Plant Science 174:
456–466.
Mayer AM (1987). Polyphenol oxidases in plants – recent progress.Phytochemistry 26:
11–20.
Mayer AM (2006). Polyphenol oxidases in plants and fungi: going places? A review.
Phytochemistry 67: 2318–2331.
Mayer AM, Harel E (1979). Polyphenol oxidases in plants, Phytochemistry18: 193–215.
Meratan AA, Ghaffari SM, Niknam V (2008). Effects of salinity on growth, proteins and
antioxidant enzymes in three Acanthophyllum species of different ploidy levels.
JSUT 33(4): 1–8.
Murashige T, Skoog F (1962). A revised medium for rapid growth and bio-assays with
tobacco tissue cultures. Physiolgia Plantarum 15(3): 473-497.
Newman SM, Tantasawat P, Steffens JC (2011). Tomato polyphenol oxidase B is
spatially and temporally regulated during development and in response to
ethylene. Molecules 16: 493–517.
Nicholson RL, Hammerschmidt R (1992). Phenolic compounds and their role in disease
resistance. Annual Review of Phytopathology 30: 369–389.
77
Niknam V, Razavi N, Ebrahimzadeh H, Sharifizadeh B (2006). Effect of NaCl on
biomass, protein and proline contents, and antioxidant enzymes in seedlings and
calli of two Trigonella species. Biologia Plantarum 50: 591–596.
NishiuchT, ShinshiH, Suzuki K (2004). Rapid and transient activation of transcription of
the ERF3 gene by wounding in tobacco leaves: Possible involvement Of
NtWRKY sand autorepression. The Journal of Biological Chemistry 279: 55355-
55361.
Oliver KL, Hamelin RC Hintz WE (2008). Effects of transgenic hybrid Aspen over-
expressing polyphenol oxidase on Rhizosphere diversity. Applied and
Environmental Microbiology 5340–5348.
Orozco-Cardenas ML, Narvaez-Vasquez J, Ryan CA (2001). Hydrogen peroxide acts as a
second messenger for the induction of defense genes in tomato plants in response
to wounding, systemin, and methyl jasmonate. Plant Cell 13: 179–191.
Ortega-Garcia F, S Blanco, M A Peinado, J Peragon (2010). Polyphenol oxidase and
oleuropein in Olive and their changes during olive ripening. Olives and olive oil
in health and disease prevention. ISBN: 978-0-12-374420-3.
Papadopoulos YA, McKersie BD (1983). A comparison of protein degradation during
wilting and ensiling of six forage species. Canadian Journal of Plant Sciences 63:
903–912.
Park HC, Man Lyang Kim ML, Yun Hwan Kang YH et al. (2000). Pathogen and NaCl-
induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box
that interacts with a GT-1-like transcription factor. Plant Physiology 135(4):
2150–2161.
Parveen I, Threadgill MD, Moorby JM, Winters A (2010).Oxidative phenols in forage
crops containing polyphenol oxidase enzyme. Journal of agricultural and Food
Chemistry. 58. 1371-1382.
Pastuglia M, Roby D, Dumas C, Cock JM (1997). Rapid induction by wounding and
bacterial infection of an S gene family receptor-like kinase gene in Brassica
oleracea, Plant Cell 1. 49e60
Peng M, JucJ (1992). Peroxidase-generated hydrogen peroxide as a source of antifungal
activity in vitro and on tobacco leaf disks. Phytopathology 82: 696–699.
78
Pieterse CM, Dicke M (2007). Plant interactions with microbes and insects: from
molecular mechanisms to ecology. Trends in Plant Science 12: 564–9.
Pieterse CM, Leon-Reyes A, Van der Ent S, Van Wees SC (2009). Networking by small
molecule hormones in plant immunity. Nature Chemical Biology 5: 308–16.
Popko J, Hansch R, Mendel RR, Polle A Teichmann T (2010). The role of abscisic acid
and auxin in the response of poplar to abiotic stress. Plant Biology (Stuttg.) 12:
242–258.
Quarta A, Mita G, Durante M, Arlorio M, De Paolis A (2013). Isolation of a polyphenol
oxidase (PPO) cDNA from artichoke and expression analysis in wounded
artichoke heads. Plant Physiology Biochemistry 68: 52–60.
Queiroz C, A J R Da Silva, M L M Lopes, E Fialho, V L Valente-Mesquita (2010).
Polyphenol oxidase activity, phenolic acids composition and browning in cashew
apple (Anacardium occidentale, L.) after processing. Food Chemistry. 125: 128-
132.
Raj SN, Sarosh BR, Shetty HS (2006). Induction and accumulation of polyphenol
oxidase activities as implicated in development of resistance against pearl millet
downy mildew disease. Functional Plant Biology 33: 563–571.
Richards EJ (1997). Preparation of plant DNA using CTAB. In: Auaubel FR, Brent RE,
Kingston DD, Moor JG, Siedman IA, Struhl K, Editors. Short protocol in
molecular biology. Willey Biology 2: p. 10–11.
Richter H, Lieberei R, K von Schwartzenberg (2005). Identification and characterisation
of a bryophyte polyphenol oxidase encoding gene from
Physcomitrella patens. Plant Biology (Stuttg). 7 (3): 283-291.
Richter C, Dirks ME, Gronover CS, Prüfer D, Moerschbacher BM (2012). Silencing and
heterologous expression of ppo-2 indicate a specific function of a single
polyphenol oxidase isoform in resistance of Dandelion (Taraxacum officinale)
against Pseudomonas syringaepv. tomato. Molecular Plant-Microbe Interactions
25 (2): 200-210.
Shetty SM, Chandrashekar A, Venkatesh YP (2011). Eggplant polyphenol oxidase
multigene family: cloning, phylogeny, expression analyses and
79
immunolocalization
in response to wounding. Phytochemistry 72:2275–2287.
Shivishankar S (1988). Polyphenol oxidase isozymes in coconut genotypes under water
stress. Plant Physiology and Biochemistry 15: 87–91.
Spoel SH, Johnson JS, Dong X (2007). Regulation of tradeoffs between plant defenses
against pathogens with different life styles. Proceedings of National Academy of
Sciences USA 104: 18842–7.
Stotz HU, Pittendrigh BR, Kroymann J, Weniger K, Fritsche J, Bauke A, Mitchell-Olds T
(2000). Induced plant defence responses against chewing insects: Ethylene
signaling reduces resistance of Arabidopsis against Egyptian cotton worm but not
diamondback moth. Plant Physiology 124: 1007–1017.
Sullivan ML, Hatfield RD, Thoma SL, Samac DA (2004). Cloning and characterization
of red clover polyphenol oxidase cDNAs and expression of active protein in
Escherichia coli and transgenic Alfalfa. Plant Physiology Vol. 136: 3234–3244.
Sullivan MS, Hatfield RD (2006). Polyphenol oxidase and o-diphenols inhibit
postharvest proteolysis in red clover and Alfalfa. Crop Science 46: 662–670.
Thaler JS, Bostock RM (2004). Interactions between abscisic-acid-mediated responses
and plant resistance to pathogens and insects: Phytohormonal ecology. 85 (1): 48–
58.
Thipyapong P, Hunt DM, Steffens JC (2004a). Antisense down-regulation of polyphenol
oxidase results in enhanced disease susceptibility. Planta 220: 105–117.
Thipyapong P, Hunt MD, Steffens JC (1995). Systemic wound induction of potato
(Solanum tuberosum) polyphenol oxidase. Phytochemistry 40: 673–676.
Thipyapong P, Joel DM, Steffens JC (1997). Differential expression and turnover of the
tomato polyphenol oxidase gene family during vegetative and reproductive
development. Plant Physiology 113: 707–718.
Thipyapong P, Mahanil S, Bhonwong A, Attajarusit J, Stout M J, Steffens JC (2006).
Increasing resistance of tomato to Lepidopteran insects by over-expression of
polyphenol oxidase. Proceedings of the Ninth International Symposium on the
Processing Tomato. W. J. Ashcroft (ed.). November 15–18, 2004, Australia:
Melbourne. Acta Horticulturae 724:
80
Thipyapong P, Stout MJ, Jutharat Attajarusit J (2007). Functional analysis of polyphenol
oxidases by antisense/sense technology. Molecules 12, 1569-1595.
Thipyapong P, Melkonian J, Wolfe DW, Steffens JC (2004b). Suppression of polyphenol
oxidases increases stress tolerance in tomato. Plant Science 167: 693–703.
Thipyapong P, Steffens JC (1997). Tomato polyphenol oxidase (PPO): differential
response of the PPO F promoter to injuries and wound signals. Plant Physiology
115: 409–418.
Torres MA, Dangl JL, Jones DG (2002). Arabidopsis gp91phox homologues AtrbohD
and AtrbohF are required for accumulation of reactive oxygen intermediates in the
plant defense response. Proceedings of National Academy of Science USA 99:
517–522.
Tran LT, Taylor JS, Constabel CP (2012). The polyphenol oxidase gene
family in land plants: Lineage-specific duplication and expansion. BMC
Genomics 13: 395.
Ton J, Flors V, Mauch-Mani B (2009). The multifaceted role of ABA in disease
resistance.
Trends in Plant Science. 14: 310–317.
Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993). An Arabidopsis myb
homolog is induced by dehydration stress and its gene product binds to the
conserved MYB recognition sequence. Plant Cell 5(11): 1529–1539.
Veljovic-Jovanovica S, B Kukavicaa, F Navari-Izzo (2008). Characterization of
polyphenol oxidase changes induced by desiccation of Ramonda serbica leaves.
Physiologia Plantarum 132: 407–416.
Wahler D, Gronover CS, Richter C, Foucu F, Twyman RM, Moerschbacher BM, Fischer
R, Muth J, Prufer D (2009). Polyphenol oxidase Silencing Affects Latex
Coagulation in Taraxacum Species. Plant Physiology 151: 334–346.
Wang J, Constabel CP (2004). Polyphenol oxidase over-expression in transgenic populus
enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria).
Planta 220: 87–96.
Xie Z, Zhang ZL, Zou X, Haung J, Raus P, Thompson D, Shen QJ (2005). Annotations
and functional analyses of the rice WRKY gene superfamily reveal positive and
81
negative regulators of abscisic acid signaling in aleurone ells. Plant Physiology
137 (1): 176–189.
Xiong L, Yang Y (2003). Disease resistance and abiotic stress tolerance in rice are
inversely modulated by an abscisic acid-inducible mitogen-activated protein
kinase. Plant Cell 15: 745–759.
Yu ZH, Han YN, Xiao XG (2015). A PPO promoter from betalain-producing red swiss
chard, directs petiole and root-preferential expression of foreign gene in
anthocyanins-producing plants. International Journal of Molecular Sciences 16,
27032–27043.
Zhou Y, Hare TJO, Jobin-Décor M, Underhill SJR, Wills RBH, Graham MW (2003).
Transcriptional regulation of a pineapple polyphenol oxidase gene and its
relationship to blackheart. Plant Biotechnology Journal 1: 463–478.
Zhu Z, Zhan L (2009). Characterisation of polyphenol oxidase from water caltrop (Trapa
acornis nakano) fruits. Journal of Food Biochemistry. 34: 1125-1140.
top related