first holy communion - church of saint mary 18, 2020.pdffirst holy communion saint mary church 40...
Post on 25-Jan-2021
2 Views
Preview:
TRANSCRIPT
-
Saint Mary Church 40 Spring Mount Road Schwenksville, PA 19473
610-287-8156 www.churchofsaintmary.org
First Holy Communion October 17 & 18, 2020
Gabriella Bluhm, Caitlin Bochanski, Colin Callahan, Jameson Chioffe, Jack Corbin, Bree D’Avenia,
Alexis Dougherty, Christopher Erickson, Madeline Garner, Lena Gaspar, Addison Gizzi,
Bernadette Goudsward, Molly Gould, Adrianna Hartzman, Steven Kukulski, Emmaline Kushner, Harrison Kushner,
Dominic Leffert, Roman Maga, Duncan McClain, Isabella McMaster, Nolan Megay, Aidan Monserrat,
Alexandra Moyer, Matthew Quinn, Jack Quinn, Shamus Quinn, Bennett Reiter, Mikayla Rhuberg,
Anna Romero, Tyler Rosler, Mark Sands, Gabriella Schiele, Isaac Shortall, Ayrtin Smith,
Nicholas Trojansky, Colton Vloyanetes, Drew Yablonski, Olivia Yanan, Penelope Zamrin
-
Saint Mary Parish is a community of Catholics, striving to be an open and caring people, living our faith, spreading God's word, and serving as Jesus' disciples to our families, our parish and our surrounding communities.
Reverend Louis P. Bellopede Pastor fatherb@churchofsaintmary.org Reverend Charles J. McElroy Pastor Emeritus
Reverend Brian M. Kean In Residence
Deacon Donald O. Nichols Permanent Deacon dnichols@churchofsaintmary.org Mrs. Mary Beth O’Connor Director of Operations/ moconnor@churchofsaintmary.org Business Manager Mrs. Kathleen Wasniewski Bookkeeper & Purchaser kwaz@churchofsaintmary.org Mrs. Susan Rodzewich Administrative Assistant srodz@churchofsaintmary.org Business & Operations Mrs. Sandra Olzinski Administrative Asst. to Pastor; solzinski@churchofsaintmary.org Parish Secretary Ms. Peggy Hinson Head Sacristan
Parish Office Center Hours Monday - Friday: 9:00 a.m. - 5:00 p.m.
Mrs. Mary Goudsward Coordinator, Religious Education; mgoud@churchofsaintmary.org Principal of PREP Mrs. Susan Rodzewich Administrative Assistant to PREP srodz@churchofsaintmary.org Mr. John Coen Campus Security
Parish Religious Education Program (PREP) 610-287-8156 (Day) † 484-522-0330 (Evening)
PREP Classes: 1st thru 7th Level (Sept. - May)
6:30 - 7:45 p.m. Monday or Tuesday
Youth Group 9th - 12th Grade: Sundays from 7:00 - 9:00 p.m.
Children’s Liturgy of the Word Sunday 10:30 a.m. Mass (October - May)
Mr. Philip Repko Principal, Saint Mary School prepko@smsk-8.org Dr. Robert DeFinis Chair, Board of Limited Jurisdiction Ms. Elizabeth Pastorius Saint Mary School Secretary epastorius@smsk-8.org Mrs. Suzette Moyer Director of Enrollment & Retention smoyer@smsk-8.org Mr. Kurt Jefferis Facilities
Saint Mary Catholic School
610-287-7757 † Website: smsk-8.org Office Hours
Monday - Friday: 8:00 a.m. - 3:00 p.m.
O C S H
S M S S H
PREP S H
M S Monday - Saturday
9:00 a.m. †
Anticipated Sunday Mass Saturday at 4:00 p.m.
Sunday Mass 7:30 a.m. 9:00 a.m.
12:00 p.m. †
Saturday Confessions 12:00 - 1:00 p.m.
P C Ex-Officio
Deacon Don Nichols Parochial Deacon and Vice Chair
Mary Goudsward Coordinator, Parish Religious Education Program
Steve Bakey Parish Finance Council Member
Appointed by Pastor Susan Rodzewich
Karen Hoffman Juan Lugo
Elected by the Parishioners Dawn Brown • Andy Gdonski
Anamaria Hazel • Mike Mazzio Tim Truckley
Council Secretary Andrea Gdonski
F C Ex-Officio
Deacon Donald O. Nichols Parochial Deacon
Members Steve Bakey, Chair & Facilitator Karen Bakey • Jim Bickel
Chris Ford • William Gordon Peggy Hinson
Consultants Mary Beth O’Connor
Parish Business Manager & Director of Operations Kathy Wasniewski
Parish Bookkeeper & Purchaser
Recording Secretary Maureen Frederick
-
Dear Parish Family, WELCOME BACK! I sincerely welcome back all of our parishioners and friends who are physically with us today and to all those joining us virtually. If there is anything I can do for you, please do not hesitate to contact me by phone or email. Please be assured of my love and prayers for each of you!
CONGRATULATIONS: Congratulations and Prayerful best wishes to our young parishioners who celebrated their First Holy Communion this weekend. As you know their First Holy Communion was postponed this year due to the pandemic. In a very special way I thank their parents,
teachers/catechists, and our entire parish family as you all helped in their Religious formation. May these children always hunger for Jesus, the Bread of Life.
BONANZA RAFFLE and OKTOBERFEST: On Saturday, October 24 beginning at 5 PM until 8 PM Saint Mary Parish will be hosting our 1st Oktoberfest in conjunction with our $10,000
Bonanza Raffle Drawing! Please join us for this Autumn Celebration. Dinner will only be $10. Drinks and other specialty items of food will be sold separately. Please log onto our website concerning our "curbside or sit under the tent" Oktoberfest. Did you buy/sell your Bonanza Raffle? All extra tickets are at the entrances of our church or at the Parish Office Center. If you can buy or sell two tickets that will be great. Each ticket costs $100. Top Prize: $10,000, Second Prize: $5,000, and Third Prize: $2,500. There will be Seller Prizes for each category. The Raffle will be drawn outdoors by our new patio adjacent to the Parish Office Center. Return your ticket stub and payment marked "Bonanza Raffle" in the Sunday collection or mail it to the Parish Office Center.
40 HOURS DEVOTIONS: Saint Mary Parish will host our Annual Forty Hours Eucharistic Devotions on Sunday, October 25, Monday, October 26 and Tuesday, October 27 at 7 PM. Evening Prayer or Vespers will be sung each evening. Our guest homilist will be Father Sandro P. Giardini,
Parochial Vicar of Saint Eleanor Parish, Collegeville. Please mark your calendars. Father Giardini will hear confessions on Sunday and Monday evening from 6 PM until 6:55 PM. Confessions will not be heard on Tuesday evening.
A MEMORIAL GIFT (Father Sam Kelly): People have inquired about a gift in memory of our 5th Pastor, Father Sam Kelly. We are in need of a Holy Water font for our Chapel. It will be beautiful and will be mounted to the wall as you enter the chapel. If you desire to make a gift in memory of
Father Kelly, please put your donation in an envelope and mark, "In memory of Father Kelly". Thus every time we enter the chapel to bless ourselves, we will “say a little prayer for you", Father Kelly.
ELECTRONIC GIVING: Please consider Electronic Giving to our Parish. During this pandemic we are struggling to make our weekly bills. With Electronic Giving your donation
comes to the parish each week regardless if you are present with us. With our busy schedules we can be visiting relatives and friends, or may be under the weather on any particular Sunday/Holy Day, however, your donation will always make it to our shared home: Saint Mary Church. Thanks! Please contact Sandi at the Parish Office Center if you have any questions.
ANNUAL CENSUS and APPEAL: Very important for this year is our Annual Census and Appeal. The Appeal funding will address the major financial fall we have experienced because of COVID-19.
Please be as generous as you can.
Have a great week, everyone!
Love and Prayers,
New Parishioners: If you have recently moved into our community, welcome! Please call the Parish Office Center to register.
Sacrament of Baptism Baptisms during the pandemic are celebrated every Sunday. Contact the Parish Office Center to schedule.
Sacrament of Marriage Parishioners must contact the Parish Office Center at least six months prior to the wedding date. Pre-Cana session is required.
Pastoral Care of the Sick If you know of anyone who is sick, elderly or homebound, please notify the Parish Office Center for arrangements.
Sponsor Certificates Certificates are needed in order to be a baptism or confirmation sponsor. To be eligible:
Must be at least 16 years old Must have received the sacraments of Baptism, 1st Communion and Confirmation If married, must have been married in a Catholic Church or a Convalidation Ceremony Must be a registered and active member of Saint Mary Parish.
Please call the Parish Office Center at least 1 month in advance of date needed.
Evangelization Resource Center Hours: Closed during the pandemic restricted phase.
SCRIP Gift Card Program Call the Parish Office Center for information on this program.
P S
-
Pirrall Family
Saturday October 17 4:00 p.m. Joseph F. Gimber - wife, Carmella
Sunday October 18 29th Sunday in Ordinary Time 7:30 a.m. Mary Zimmer - Family & Friends 9:00 a.m. Paul J. Smith - Carol & Holly Smith 10:30 a.m. Living & Deceased Members Saint Mary Parish 12:00 p.m. John E. Appleton - Marlena Kroll
Monday October 19 Saints John de Brebeuf & Isaac Jogues 9:00 a.m. Eleanor & Russel Godshall - Pat & Jerry
Tuesday October 20 Saint Paul of the Cross 9:00 a.m. Intentions of LouAnn Pirrall - Kristen Seddon
Wednesday October 21 Weekday 9:00 a.m. Living & Deceased Members Carley & Murray
Families - Harry & Anne Boeshore
Thursday October 22 Saint John Paul II 9:00 a.m. Intentions of Franco Salandra’s Birthday - Patrick
Reo
Friday October 23 Saint John of Capistrano 9:00 a.m. Annamae O’Callaghan - Frederick Family
Saturday October 24 Saint Anthony Mary Claret 9:00 a.m. Intentions of Fr. Ray Himsworth & Fr. Alessandro
Giardini - Deacon Ed Hinson 4:00 p.m. Drew F. Weber - Mary Lou Weber & Family
Sunday October 25 30th Sunday in Ordinary Time 7:30 a.m. Living & Deceased Members Saint Mary Parish 9:00 a.m. Josephine Poatsy 20th Anniversary - Gormley &
Poatsy Families 10:30 a.m. Charlotte Roy - Paul & Children 12:00 p.m. All Those Enrolled in the Memorial Fund
Weekly Memorial Intentions
CHURCH
Rose For Life In memory of ______ Requested by ______ Rose for Resurrection In memory of ______ Requested by ______ Sanctuary Lamp In memory of Carroll F. Arnold Requested by Patrick Taylor Altar Candles In memory of ______ Requested by ______ Altar Bread & Wine In memory of ______ Requested by ______
CHAPEL
Vigil Light In memory of Paul J. Smith Requested by the Smith Family Sanctuary Lamp In memory of Daniel G. Smith Requested by the Smith Family Altar Candles In memory of ______ Requested by ______
Monday, October 19th through Sunday, October 25th Daily Mass Monday through Saturday streamed on Facebook Page
Sunday Masses streamed on YouTube Channel, Facebook Page and Parish Website.
Friday, October 23rd: Daily Mass: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM Saturday, October 24th: Daily Mass: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM Sunday, October 25th: Sunday Mass - 30th Sunday Ordinary Time: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM
All Masses, Reflections and Evening Prayer videos are archived on our
YouTube Channel.
Monday, October 19th: Daily Mass: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM Tuesday, October 20th: Daily Mass: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM Wednesday, October 21st: Daily Mass: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM Thursday, October 22nd: Daily Mass: 9:00 AM Father Bellopede Daily Reflection: 1:30 PM Evening Prayer with Deacon Don & Linda: 6:30 PM
If you are interested in Mass Intentions or Memorials in memory or honor of a loved one, please contact the Parish Office Center. Memorials are for one week and begin on Sunday.
Donations: Announced Mass: $10, Unannounced Mass: $5 Rose for Life, Rose for Resurrection, & Vigil Light: $5, Sanctuary Lamp: $10
Altar Candles: $20, Bread and Wine: $50, Altar Flowers: $175
-
SSaint Mary Prayer Groups
Adoration All day, every day in our Divine Mercy Adoration Chapel.
Rosary The Rosary will be prayed daily before the 9:00 a.m. Mass and on Sundays before the 7:30 a.m. Mass.
Divine Mercy Chaplet Daily after the 9:00 a.m. Mass.
Miraculous Medal Novena Mondays after the 9:00 a.m. Mass.
Divine Mercy Holy Hour The Thursday before the first Friday of the month from 7:00 – 8:00 p.m. in the Divine Mercy Adoration Chapel.
Fatima Rosary Group First Saturday of every month at 8:00 a.m.
Flame of Love Rosary Every Monday at 6:15 p.m. in Annex Room 1.
In the Spirit Prayer Group Every Monday at 7:30 p.m. in Annex Room 1.
Oasis Women’s Prayer Group Every Friday at 1:00 p.m. in Annex Room 1.
Please note that all meetings are suspended until further notice.
PRAY FOR THOSE SERVING OUR COUNTRY
Albert J. Augustine Bridgette Augustine Madeline Augustine Yaphet Blair Michael Boehret Matthew Bulen Matthew P. Burns David Capobianchi Brianna Carroll Kayla Carroll David Casas Wayne Cherry, Jr. Aaron Chomyn Noah Colapreto Matthew Dager Ryan Decker Brian Dunn Thomas Fisher Tim Fitzgerald Jennifer Foley Matthew Foley Blaise Fountaine Eric Funk David Gentner Jim Gotlewski Richard Granozio Tom Gutherman Collin Hamel Brian Handel Tim Harris Aaron Hart Eric Himmel William Holdsworth Kyle Houchins Michael Ingram Kyle Kearney Matthew Kearney Alexander Klobusicky Brett R. Karkheck Fr. Joseph Lea Gabriel Leone George Lockbaum Charles Maloney III Jordan Mares Keith E. Mason Bobby McCall Timothy R. McGinnis Jacob McLendon Jonathan Minkler Meghan Morton Danielle Murdoch Brian Murray Tim Murray Shawn O’Connor Kevin O’Malley Geoff Ostrowski Jackie Perrie Gerard Pettine Michael Regan Martin D. Roth Elizabeth Schnaubelt William Schweitzer Sara Saraceni Lauren Shaw Angela M. Sills Ashley L. Sills Brian Sinclair David Sinnk Owen Sisbarro Sharon Sisbarro Brian Smith John Walsh John Weaver Mark Wimmer Kathleen Winters Molly Winters Joseph Wolf Damian Zottoli Dante Zottoli Dominic D. Zottoli Zachary Zottoli
Bonnie Abers, Margaret Addario, Rowen Aldridge, Brendan Avvento, Betty Beatty, Philip Berardi, Ed Brennan, Nicholas Caruso, Kenny Castagnini, Jack Castenova, Patricia
Cox, Shirley Cox, Jill Deenihan, Leslie DeFrancesco, Tony DiFronzo, Tim Dippolito, Louis DiTanna, Loretta Dulin, Nicholas Esposito, Erica Fox, Harold Frisch, Patrick Gardenier, Len Geary, Delores Giera, Frank Gormley, Michelle Gormley, James Halpin, Betty Jo Hayes, Amy Herkins, Esther Hunter, Jack Hunter, Mary Interrante, Jim Jaconski, Joe Jaconski, Frieda Keller, Jane Kerr, Suzanne Kraekel, David Krummel, Frank Larkins, Terry Leichner, Keeley Levitsky, Emelia Marasilio, Patricia Storti Martin, Jay Mason, Shep Michael Mason, Jenifer Mason, Steve Mason, Pat Matthews, Pat McMahon, Baby Merrill, Bill Moore, Dave Nester, Cathy Neve, Jim Neve, Ruth Nikish, Jerry Nikish, Billy Okumu, Jack Orsini, Lynette Orsino, Jack Palm, Melinda Palm, Ryan Palm, Kathy Pedriani, Maria Peranteau-Keller, Ann Petty, Claudia Rooney, Brian Salisbury, Tom Schnaubelt, Angelina Schneidinger, Desiree Sedgwick, Ernestine Shofran, Sophia Southerling, Alex Stadtlemaier, Maureen Steinmetz, Joshua Stern, Patricia Tacconelli, Eileen Taylor, Marie Tressler, Dianne Wachtendorf, Marie Willinger, Dottie Wynn, Therese Yanan, Patrick Zampetti, Stacey Zavala
If you would like to add a loved one or friend to the Prayer List please contact the Parish Office Center at 610-287-8156 or solzinski@churchofsaintmary.org.
If you are in need of urgent or emergency prayers for situations that arise unexpectedly, please contact Saint Mary Prayer Warriors at
SMCprayerwarriors@gmail.com
-
MASS & CONFESSION SCHEDULE Our Mass and confession schedule is as follows:
Confessions Saturday 12:00 - 1:00 PM
Anticipated Sunday Mass Saturday 4:00 PM
Sunday Mass 7:30 AM 9:00 AM 12:00 PM
Sunday Mass will live stream on Sundays at 9:00 AM. We ask everyone to wear a mask while in the church building and follow the directions of our parish Ushers in order for us to adhere to social distancing requirements. We are asking for your patience and help as we work together to keep all our parishioners and friends safe and healthy!
WELCOME…… and God’s Blessings on Elijah Patrick Kane Slomiany who was baptized by Father Louis P. Bellopede on Sunday, October 11th.
CYO HAYRIDE
Saint Mary CYO will sponsor a Hayride on Friday, October 23rd from 6 to 9pm at Abby’s Pumpkins, 2471 Little Road,
Perkiomenville (rain date October 30th). Please note: This is a change of date from previously advertised. Cost is $10 per person and includes the corn maze, hayride and bonfire. Light refreshments will be available for sale. Flashlights are recommended for the corn maze. Face masks and social distancing will be required. For more information email saintmarysspartans@gmail.com.
2021 MASS BOOK The 2021 Mass book is now open. However, due to the pandemic restrictions, the Parish Office Center is open by appointment only. If you wish to
schedule Mass intentions please call the Parish Office Center at 610-287-8156 or email Sandi at solzinski@churchofsaintmary.org and we will be happy to schedule them for you. Please note: Masses will not be filled in person. Thank for your cooperation in keeping everyone safe.
WOMEN’S BIBLE STUDY Join us for a 3 week study on “Hope, An Anchor in Today’s World” to be held on October 22nd, October 29th and November 5th from 7 to 8:30pm via Zoom. One of the great theological virtues,
Hope is a sign of our trust in God, the foundation for making our way through difficulties, and an invitation to witness to God's care in our lives. For more information or to register please contact Linda Nichols at donlin335@gmail.com or 215-256-4941. Please register by October 15th in order to receive the zoom invite. There is a nominal fee for the study guide.
USHER MINISTRY Looking for a way to participate more at Saint Mary Parish? Help your fellow parishioners by joining the Usher Ministry. Usher duties consist of guiding the seating of parishioners
and assisting those with special needs, and collecting the weekly tithing and presenting these tithing gifts at the Altar. These duties are performed at all weekend Masses as well as on Holy Days of Obligation and other special Parish Liturgies. We especially need help during this restricted green phase of public Masses. Please consider joining this important ministry of service. If interested please contact Sandi at solzinski@churchofsaintmary.org or by calling the Parish Office Center at 610-287-8156.
PERPETUAL EUCHARISTIC ADORATION A scheduled adorer's testimony from the Night Division (12:00AM-5:00AM): ‘I was getting ready for bed, thinking of my night holy hour, and was complaining to myself about losing sleep. I sensed God saying to me, “If you could see Jesus
in person at the Chapel, would you be complaining?” I thought “No. Ok, I get it. He is there in Person! Help my faith Lord!” And I counted my blessings that I am able to spend that quiet time with my Savior!’ We have many Night Open Hours; please prayerfully consider signing up. Open Hours: Sun 11:00PM; Mon 1:00AM; Tues 1:00AM; Wed 3:00AM, 9:00pm & 11:00pm; and Thurs 12:00AM. Substitutes are always needed. If interested please contact MK at marykath14@gmail.com or 610-476-4490.
EVENING PRAYER Join Deacon Don and Linda Nichols each evening at 6:30 PM for Evening Prayer, part of the Liturgy of the Hours. Evening Prayer will be broadcast on our YouTube Channel, Facebook
Page, and parish website. You can find the prayers for each evening on our parish website by clicking on the IBreviary box.
PRIVATE PRAYER Saint Mary Church is open Monday through Saturday from 10am to 3pm for private prayer. While the Blessed Sacrament will not be exposed, Jesus is still present in the
tabernacle. Please remember that you must wear a mask, practice social distancing, and we kindly ask that you do not enter church if you are not feeling well for the health and safety of all.
-
CHRISTIAN INITIATION FOR ADULTS The Rite of Christian Initiation of Adults (RCIA) is the way by which persons become “citizens of the Kingdom” through Baptism, Confirmation, and Eucharist. If you, or someone
you know, would like to learn more about the Catholic Faith, or are thinking about coming into full communion with the Catholic Church, please contact Deacon Don Nichols at dnichols@churchofsaintmary.org or call 610-287-8156.
Christian Initiation of Adults: Every Tuesday from 6:30 to 8:00pm from September thru June. Lay Missionaries of Charity: First Saturday of every month from 9:30am to 1:00pm. Legion of Mary: Every Tuesday from 7:30 to 9:00pm.
Living Water Bible Study: Every 2nd and 4th Saturday from 9:45am to 12:15pm September thru May. Men’s Gospel Reflection: Every Saturday from 8:00 to 9:00am. Patricians: 3rd Thursday of every month from 7:00 to 9:00pm from September thru May. Women’s Bible Study: Two sessions on Thursdays: 9:30 to 11:00am and 7:00 to 8:30pm. Sessions are offered at various times of the year.
PREP REGISTRATION 2020-2021 IS ONLINE After much prayer and careful consideration, the decision has been made to conduct classes virtually for the PREP year 2020-2021. You will have the choice of either Catechist-led virtual classes on Monday or Tuesday evening from 6:30pm to 7:45pm or a traditional homeschool option, where parents are the catechists. Please register online by choosing PREP from the Religious Education tab at the top of the parish website, and tap on the yellow “Click here to register online” button at the bottom of the registration flyer. It’s not too late to register for this school year. For more information, please contact Mary Goudsward at 610-287-8156 or mgoud@churchofsaintmary.org.
Saint Mary Catholic School ~ Grades K-8 A competitive academic curriculum with a full time designated learning support room and teacher
available to students, and full time art and music teachers, who encourage our students to discover and display their inner gifts God has given them through Art, Music, and Drama as part of their curriculum.
Agnus Dei Academy ~ Pre-K 3 and 4 Year Olds We partner with parents in developing the whole child by fostering a love of learning and encourage independence and imagination to inspire your
child to become a thinker, an explorer, and above all, a life-long learner.
To register or to schedule a private tour call Suzette Moyer at 610-287-7757 x244.
COME SEE US!
Saint Mary Catholic School Learning Today, Leading Tomorrow
PROGRAMS MOVIES AUDIO BOOKS PICK OF THE WEEK
Lectio: Mary
Why is Mary so important to Catholics and why have so many people been devoted to her over the centuries? Dr. Brant Pitre, Professor of Sacred Scripture at the Augustine Institute Graduate School, examines what the Old and New Testaments, the life of Christ, and the early Church Fathers reveal about the life and identity of Mary.
Registering is easy - just go to saintmaryrcc.formed.org, click on the blue next button and complete the registration information. Questions on how to use this service? Contact Mary Goudsward at 610-287-8156 or email mgoud@churchofsaintmary.org. Subscription is free!
NEVER STOP LEARNING! Faith is a journey and there is always something new to learn no matter what your
age! To find a faith formation that suits you best, or for more information on any of those listed above, contact Mary Goudsward, Coordinator of Religious Education, at mgoud@churchofsaintmary.org or 610-287-8156.
-
S | O ₂₅, ₂₀₂₀ 30th Sunday in Ordinary Time
12:00 p.m. | S O M followed by Exposition/Adoration
6:00 p.m. | C 7:00 p.m. | E P
Homily and Benediction Followed by Nocturnal Adoration
M | O ₂₆, ₂₀₂₀ Weekday
9:00 a.m. | H M followed by Exposition/Adoration
6:00 p.m. | C 7:00 p.m.| E P
Homily and Benediction followed by Nocturnal Adoration
T | O ₂₇, ₂₀₂₀ Weekday
9:00 a.m. | H M followed by Exposition/Adoration
7:00 p.m.| S C Evening Prayer, Homily, Eucharistic Procession,
Benediction, and Reposition in our Perpetual Adoration Chapel
Each evening service will be streamed live
Via our Facebook Page, YouTube Channel & Website
Forty Hours P E D
G H R A G , P V
S E , C , PA
-
PJP VIRTUAL OPEN HOUSE Pope John Paul II High School, 181 Rittenhouse Road, Royersford will host a VIRTUAL Fall Open House on Tuesday, October 27, 2020, from 6:30-8:30 PM. You will have the opportunity to
meet our administration, teachers, and coaches and learn more about our academic curriculum, athletics, clubs & activities, and so much more! We look forward to "virtually" seeing you and your family in October! To register to attend the PJP VIRTUAL Fall Open House visit www.pjphs.org for more details.
VILLA MARIA ACADEMY HIGH SCHOOL Villa Maria Academy High School, located in Malvern, will host an Entrance–Scholarship Exam on Saturday, October 24, 2020 on campus. Eighth graders may take the exam on
either date. For additional information, please contact the Admissions Office at 610-644-2551 or register online at www.vmahs.org. Learn about what Villa Maria sisterhood has to offer!
PARISH WEBSITE For up to date information, schedules, and access to all live streaming, go to our parish website at:
www.churchofsaintmary.org
SIGN UP FOR YOUTUBE TODAY! Saint Mary Parish has our own YouTube Channel! When you subscribe to our channel, you can watch all streaming events like daily and Sunday Mass, Father Bellopede’s daily
reflections, Deacon Don’s evening prayer You can subscribe to the Saint Mary channel by clicking on the “Subscribe to our YouTube channel” picture below. The most recent videos will come up on the home screen, or click on the Videos tab to see all the videos on our channel in case you missed something or want to see something again! It’s the next best thing to being here!
NNEIGHBORHOOD NEWS
LEGACY OF FAITH CAMPAIGN AS OF OCTOBER 11, 2020
Amount Pledged……………………..……….. $1,997,791.96
Pledge Income………………………………... $1,149,430.44
Expenses Paid………………………………… $927,456.60
Bank Balance…………………………………. $221,973.84
Legacy of Faith Campaign Goal……………... $2,000,000.00
THANK YOU FOR YOUR GENEROSITY!
POST-ABORTION HEALING RETREAT Rachel’s Vineyard Ministries will be hosting a retreat for healing after abortion. It is designed to help you experience the mercy and compassion of God, focus on the buried
emotions of the past and begin healing in a non-judgmental, safe, loving and confidential environment. The retreat will be held November 6-8, 2020 in Malvern. For information call or email Lauren at 215-720-5828 or RachelsVineyardGP@gmail.com.
BEREAVEMENT CORNER If you or someone you know has suffered a loss and you would like to speak with a member of our bereavement ministry, please call Saunie Kirby at 610-754-6927 or Gail
Schlanser at 610-454-7228. All calls are confidential.
-
Don’t let sexual violence silence you. Healing can start with a call. Visit www.pacrimevictims.com/healing or call
1-888-800-8780.
LIFE MINISTRIES Saint Mary Parish is committed to the promotion and sanctity of all Human Life from the first moment of conception until natural death. Let us together as a parish community stand up and speak boldly for every person born and unborn.
Rachel’s Vineyard: 1-800-395-HELP(4357) Helpline for Abortion Recovery: 1-866-482-LIFE(5433) Suicide Hotline: 1-800-273-8255 Domestic Abuse: 1-866-Safe-014 Pregnancy Hotline: 1 (800) 712-HELP
Bulletin Submissions: All information and announcements to be published in the bulletin are due to the Parish Office Center by Friday the week prior to publication. All bulletin submissions should be emailed to solzinski@churchofsaintmary.org.
FFINANCIAL FACTS
PLEASE, NO CORN, BEANS OF ANY KIND, CONDIMENTS, NOODLES, PASTA, PASTA SAUCE,
OR CEREALS! Gift cards to local grocery stores are always appreciated!
Paper Towels Dry Mashed Potatoes
Canned Fruit Canned Chicken
CannedTuna Peanut Butter
Jelly Soups
Pork & Beans
Spaghetti Mac & Cheese
Stuffing Gravies
Cranberry Sauce Canned Carrots
Canned Asparagus Canned Beets
Coffee/Tea
Saint Vincent de Paul Corner Our conference here at Saint Mary Parish uses your contributions and donations to help those in need from our parish and local community.
Client Needs: #187: Girl’s clothes; size 14-16
Special Need: We have several families in need of a car , van or SUV, inspected and in good running condition. For more information, or if you or someone you know is able to help, please call Peggy Hinson at 610-287-8156.
FOOD PANTRY NEEDS The food pantry is in need of the following items:
Due to the current situation, there will be no monthly pantry collection. However, donations can be dropped off during the week under the overhang of Hedge Hall. Please be as generous as you are able since there will be no monthly collection and the need is great! The monies collected in the poor boxes throughout Saint Mary Church go directly to the Saint Vincent de Paul Society to assist their clients who are in need.
Follow Saint Mary on these social media sites Flocknote Facebook Instagram YouTube Twitter
Collection for October 11, 2020 Week 15
Weekend Collection (Weekly Offering Envelopes) Target Needed for the 20-21 Fiscal Year…….. $900,000.00 Weekly Target Needed for 20-21 Fiscal Year….. $17,307.69 Collection for Weekend of October 11........….. $10,468.74 Parish Giving & PayPal……………………........ $6,144.04 Over (Under) Target.............................................. ($694.91)
School Mortgage (Blue Envelope) Target Needed for the 20-21 Fiscal Year…….. $98,000.00 Weekly Target Needed ……………………….… $1,884.61 Collection for Weekend of October 11.............. $395.62 Over (Under) Target.............................................. ($1,488.99) Catholic Education Center Mortgage: Balance as of August 30, 2020.……...…...…... $1,290,385.89 September Principal Payment…...........…….... $8,633.70 Balance as of September 30, 2020..........…..… $1,281,752.19 Next Monthly Principal Due October 30, 2020
Total Collected To Date...................................... $232,402.53
Envelopes Mailed…………. 1,010 Total Used…...….…. 93 Parish Giving Enrollment…. 376 Total Used…….……. 176 c
Parish Debt (Gold Envelope) Debt……………………………………………... $755,703.38 Debt Reduction (Gold Envelope)……………….. $825.00 New Debt Total…………………………………. $754,878.38 $
The Parish Debt represents invoices that we owe to the Archdiocese of Philadelphia. These invoices are for assessments, insurance, property and liability, etc. incurred between the years of 2005 – 2012. The Archdiocese has been very gracious to cover these invoices during a time when we could not afford to do so. By using your Parish Debt (Gold) Envelope, you are helping our parish pay the obligation we owe to the Archdiocese. From 2013 to today we are current on all our Archdiocesan invoices. Thank you for your kind generosity.
PLANNED GIVING: All parishioners and friends of Saint Mary Church are kindly asked to include Saint Mary Parish in their will and estate planning. We kindly thank you in advance for remembering this great community of faith in your will so its mission and ministry may continue in the years ahead.
All of our parishioners are invited to use our new option of electronic funds transfer by logging onto our website and clicking ‘PARISH GIVING’.
-
004 St. Mary, Schwenksville (i) John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
ParishionerDr. Diane Fries
OPTOMETRISTMedicare • Aetna • BS • Davis Vision • Imed
531 N. Charlotte St., Pottstown 610-323-6369
STEPHEN TEPHEN P. . IMMS,MMS, J JR.R.ATTORNEY AT LAWATTORNEY AT LAW
Real Estate & ZoningWills & Estate PlanningEstate Administration
Small Business & CorporationsSt. Mary’s Parishioner
396 Main Street • Harleysville215-256-6209215-256-6209
R.L. Williams, Jr. Funeral Home, Inc. Skippack ~ (610) 584-6611www.RLWilliamsFuneralHome.comR.L. Williams, Jr., President
Williams-Bergey-Koffel Funeral Home, Inc. Telford (Franconia Twp.) ~ (215) 703-9800 www.WilliamsBergeyKoffel.com
J. Lowell Bergey, Supervisor
We have a long tradition of serving Catholic families in Montgomery County. We are dedicated to providing families with genuine, attentive, personal care consistent with the values, traditions and principles of the Catholic Church, following the Order of Christian Funerals guidelines.
Whether you are planning services for yourself in advance or for a loved one at the time of need, we believe that serving you is a privilege and an
honor, and welcome you to contact us at any time for assistance.
KEENAN, EENAN, CICCITTO & ICCITTO & ASSOC., LLPSSOC., LLPATTORNEYS AT LAWATTORNEYS AT LAW
376 E. Main StreetCollegeville
(610) 489-6170www.KeenanLaw.com
Serving the community for over 30 years.Serving the community for over 30 years.
HORGAN BROTHERS INC.
ASPHALT • CONCRETEEXCAVATION • PRIVATE HOMES
Commercial • Industrial • FREE ESTIMATESAsk For Jim Kelly
215-513-9300Fax: 215-513-7556
$350Off Any New Stairlift
With This Ad
• FREE in home evaluations• Family owned & operated for
more than 20 years
1.888.900.8883www.Tri-StateStairlifts.com
$69 Air Conditioning Tune-Up$69 Air Conditioning Tune-Up
RIGHTWAY WATERPROOFING CO.
BASEMENT WATERPROOFINGMOLD REMEDIATIONFOUNDATION REPAIR
215-427-1727www.RightwayWaterproofi ng.com
FREE INSPECTIONLicensed & Insured
Family Owned and Operated Since 1987
Church
Member
Discoun
ts
Morgan Exteriors, LLCStucco Remediation Specialist
Roofi ng
Hardie Siding Specialist
484.568.4457Best Prices & Warranties in the Business
www.morganexteriorsllc.com
BASEMENTWATERPROOFING
FOUNDATION REPAIRMOLD REMEDIATION
1-888-5DRY-TECHwww.DryTechCorp.com
Parishioner
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
What’s My Name?The #WHATSMYNAME
Movement asks everyone to simply ask drivers “What’s my name?” before entering their
vehicle to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
Mallory’s Army Foundation
United Together In The Fight Against Bullying...
Don’t Just Teach Kindness...
B E K I N D N E S S !www.MallorysArmy.com
(973) 440-8657info@mallorysarmy.org
It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers -
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
vate & Public Healthcare - La- - - - wforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficercercercecececercercercercercercercercersssFirst Responders - Food & d & d & d & d & d & d &d &d &d & &&& && AAgAgAgAgAgAgAgAgAgAgAgrAgriAgAgture - Energy Sector - Wa- Wa- Wa- Wa- Wa WaW- WW- WaW stststsstststststeststst &aterwaste - Transportatatattatttttttttttion ionionionionion ion ion ionion ion ion onion ion & L& L& L& Lo& L& L& L& L& L& L&&&&& giss - Public Works & - InfrInfrInfrInfrInfrInfrInInfInfInfInInInInIn astrastrastrastrastrastrastrastrastrastrastrastrastrastrastructuuuuuuuuuuuu re
ications & IIIIIIIIIIIInfnfnfnfornfornfornfornfornfornfornfornformatimmmmmmmmmmmm onchnology WWorkeorkeororkeorororor rs -rs -rs -rs -rs -rs -rs -rs -rs -rs rs -rs s Community &
t WWWWWWWWWWWWWWWorororororkeorkeorkeorkeorkeorkeorkeorkeorkeorkeorkers -s -s -s s s -s CriCCCC tical Manacturing - Cheemicamicamicamicamicamicamicamicamicamicamicamicamicamicamicalllllllll & lllll Hazardousaterials Finanancancancncncncncancncancnnnn ialialialialalialialialialialialialialialia ServSerSerSerSerSerSerSerSeSerSeSeSeSer ices - Defensedustrial Base ase ase asease asasasasasasasas - C- C- C- C- C- C- C- CCo- C- C- C- C- - C mmercia is Workersersersersersersersersersersersersererr - R- R- R- R- R- R- R- R- R- RR- R- R- R- Residesesee ential & Shelterrvvvvvvvvvicesicicicicccicicciiccc & F& FFFFFFFFFF& FFFFacilacilacilaciaciacilacilacilacilaaaaa ities - Hygiene Prodts & S& S& S& S& S& S& S& S& S& S& S& S& S& S& Serverververviervierviervierviervierviervierviervervierv ccces - Private & Publicalalalalalalalalalalalalalalalthcathcathcathcathcathcathcathcathcathcathcathcathcathcathcare re re re re re -re -re -re -re -re -re -re -re re - Law Enforcement, Publicfety -ty -ty -ty -ty -ty -ty -ty -y -y -y -y -y -ty -y - OffiOffiOffiOffiOfOOOO cers & First RespondersFood &&&&&&&&&&&&& Agriculture Energy Sec
To all thosevate & Publicvate & Pforcement, Publforcement, Publ
ssentialFirst RespoFirst Respoture Eneture Eneworkersaterwaste - aterwaste -P bli WP bli Weeping CommuniCommunih l Wl Ws safe,chnology Wogvernmentvernment
youral Facilal Facilservice isntial & Shelte& SheltHygiene ProdHygiene Prod
invaluable &- Private & Publi- Private & PublE f t P bliE f t P bliappreciated.& First Responder& First Responder
ulture Energy Secturethan
k yo
u
- WaWWWWaaWaaaaaWWWaaaWWWaaWWWWaWaaWWaaW stste stesssssssstttesttststteee & Waterwaste - Traatioaaaa oooa oa ooa oon & n & n & &n & n &&&&nn &nn &&&& LogiLogiLooLogiogogiogioLooLooLogogogLoggoog sticsticsticstictiststicstictsticicsticccsticsticcs cciccs ccs - s --s -s -s - s -s PublPPPPPPPPPPPPPPPP ic Wnfrfrnfrnfrnn rnfrfrnfrnfnnnfrfnnnnn rn rfrastrastrastrastrastrastrastrtstrsttrtaaasa tra tt uuuccctutuu tuctuuuctutututttuucttucttucctuuture -re -re -rerere -re -re -rere -re -ree -rre ---e -re rrrrer ComComComCoCComComCoomomComCommmComCoComComomComCCComComoComCommunimunmunmmunmunmmummmmunmuumunmunmunmununummmmmunnnmunnnmmunm catcacacatcatcaccccaaatcatcaaacaaaaatttformormormmmmmmormormmrrrmrrrmmmmmmmmatiatiotiiatatitttattaaaaaa n Technology Work
-
004 St. Mary, Schwenksville (b) John Patrick Publishing Company (800) 333-3166 • www.jppc.net
MIRPhysical Therapy
A Community PracticeA Community Practicewith University Experiencewith University Experience
R S , PTLederach
S . M ’ M
215-256-1991
610-287-1595C H • A
R • G • B - D • K
Sambrick1@comcast.net
BUILDERS INC
DELPHI FAMILYDELPHI FAMILYHEALTH CENTERHEALTH CENTERDennis A. DeBias M.D.Serving the needs of all our
St. Mary families.Member of St. Eleanor Parish
1000 Rte. 29Schwenksville 610-287-6650
F.E. “Tuck” Hunter DMDtuckhunter@verizon.net610.584.9666fax 610.584.4385 SKIPPACK VILLAGE DENTISTRYwww.skippackvillagedentistry.com4077 Skippack Pike Box 527Skippack, PA 19474
Holcombe Funeral Home, Inc.Holcombe Funeral Home, Inc.RICHARD A. HOLCOMBE, FUNERAL DIRECTOR-SUPERVISOR
TRAPPE, PA610/489-7266 VOICE • 610/489-2300 FAX
INFO@HOLCOMBEFH.COMPre-planning for all services
Serving Montgomery County For Over 35 Years
610.539.9586www.PicardConstruct.com
• Kitchens & Baths• Roofi ng• Finished Basements• Decks• Windows & Doors
St. Mary’s Parishioner
Save On Quality Roofi ng & Siding
Roofi ng • Siding • Stucco • Windows • Gutters • Insulation & More...Free Estimates • Licensed & Insured • Family Owned & Trusted for Over 28 Yrs.610-454-0171 • www.eastcoastsidingcontractors.com
FREEHouse Shutterswith any complete roofi ng or
siding job.
Parishio
ner
Dr. Paul G. SmithDr. John L. Lignelli IIDr. James A. WardDr. Donald E. Rolandwww.pottstownoralsurgery.com
500 Heritage Drive, Pottstown, PA610.326.7880
20 E. Philadelphia Ave. Boyertown, PA610.367.6074
Fax: 610.326.5491
Residential & Commercial Property(Sales & Leasing)
SERVING EASTERN PA, PHILA TO BERKS COUNTY
Ask Me How to Sell Your Home in Any Condition for Top Dollar
HomeSmart Realty AdvisorsYOUR REAL ESTATE EXPERTSean Maloney, Realtor®SRS® Seller Representative SpecialistABR® Accredited Buyer’s Representative
Cell 215.783.6543Offi ce 215.604.1191
sean@seanmaloneygroup.comYou know my Mom & Sister
600 Eagleview Blvd., Suite 360, Exton, PA 193412424 East York Street, Suite 238, Philadelphia, PA 19125
Gilbertsville 610.473.3328 • Chestnutknollhomecare.com2012 People’s Choice Award Recipient
Help Wanted
In Our 4th Decade of Quality Service
French DrainsFoundation RepairMold Remediation
610-696-0100www.morganbasementwaterproofi ng.com
All Work Guaranteed
CURBSIDE PICKUP AND DELIVERY
AVAILABLE
610.831.88141 Town Center Drive
Collegeville
Greenfield is HomeGreenfield is Family
300 Perkiomen Ave.Schwenksville
610.287.1822Please contact Kiersten Rivel
krivel@greenfi eldseniorliving.com
CARING FOR THOSE WHO CARED FOR US
Expert Preparation & Professional Finish
• all phases of interior & exterior painting• wallpaper installation & removal• deck cleaning & staining• drywall repair & installationKevin Gergel 610.633.2184
www.KG-Painting.com
TOM MAGUIREINTERIORPAINTING
Home (610) 222-3824Cell (610) 504-4800
30 Yrs Exp.
10% Off
TUTORSpecializing in
Special Ed & Regular MathGrades 6 - 12
Maria Steinmetz, Parishioner610-547-4863
Maregl202@gmail.com
WE CARE AND IT SHOWS
E A S Y PA S SE A S Y PA S S$99 a day
Beautiful On-Site Chapel with Daily MassRespite Stay Available
We Acknowledge We Appreciate
ST. MARY CENTERRehabilitation & Healthcare
215-368-0900www.center.smmrehab.org
ST. MARY VILLAIndependent & Retirement Living
215-368-0900www.villa.smmrehab.org
Both conveniently located at: 701 Lansdale Ave., LansdaleNO MIN. STAY - St. Mary Villa Only
of LANSDALERob HesslerNeighboring Parishioner• Blinds• Shutters• Shades• Drapes• Home Automation
215.645.0408215.645.0408lansdale@budgetblinds.comlansdale@budgetblinds.com
www.budgetblinds.com/lansdale-paHIC PA 156194
An independently owned and operated franchise.
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if
we can help Save you money with your monthly payments on your commercial property.
Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days!
Four season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net
HistoryItem_V1 AddMaskingTape Range: current page Mask co-ordinates: Horizontal, vertical offset 23.06, 28.08 Width 19.05 Height 729.84 points Mask co-ordinates: Horizontal, vertical offset 22.06, 737.86 Width 585.47 Height 23.06 points Mask co-ordinates: Horizontal, vertical offset 89.22, 661.67 Width 22.06 Height 33.08 points Origin: bottom left
1 0 BL Both CurrentPage
CurrentAVDoc
23.0581 28.0767 19.048 729.8375 22.0555 737.8637 585.474 23.058 89.2246 661.6719 22.0555 33.0833
QITE_QuiteImposingPlus3 Quite Imposing Plus 3.0 Quite Imposing Plus 3 1
5 8 5 1
1
HistoryList_V1 qi2base
top related