genetics pedigrees, mutations and karyotypes. pedigree chart that shows how a trait and the genes...

Post on 22-Dec-2015

218 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

GENETICS

Pedigrees, Mutations and Karyotypes

Pedigree

Chart that shows how a trait and the genes that control it are inherited within a family

Female

Affected Person

Male

Carrier

Marriage

Connects Children & Parents

Twins

Homozygous Recessive Disorders

Must have two recessive genes to have the disorder

Examples:Tay-Sachs: the body can’t break down a certain lipid so it builds up in the brain; it is a fatal disorder

Cystic Fibrosis: excess mucus accumulates in the digestive tract and lungs

Dominant Allele Disorders

Rare because the offspring usually dies before sexual maturity is reached

If you have at least one dominant gene, you have the disorder

Huntington’s disease: disorder in which the brain deteriorates; doesn’t show symptoms until an individual is in his late 30’s or early 40’s

Genetic Counseling

If a disorder is present in past family members, genetic counselors can give parents the probability of passing the genetic disorder to their children

Genetic counselors construct pedigrees and use tests (i.e. alpha-fetoprotein, PKU) to determine probabilities

Mutations

Changes in the DNA that can involve one or more genes; Mutations can be:

Harmful: cause diseases or deformities

Helpful: organism is better able to survive

Neutral: organism is unaffected

If a mutation occurs in a sperm or egg cell, that mutation is passed onto offspring

If a mutation occurs in a body cell, that mutation affects only the organism and is not passed onto offspring

Gene Mutations

Random changes in the sequence of nucleotides in DNA

It’s a mistake that’s made during replication or transcription

There are 4 types:Base Substitution

Base Deletion

Base Insertion

Jumping Gene

Base Substitution

One base is replaced by another base; this is also called a point mutation

ACGUCAGUA Threonine—Serine—Valine

ACGUUAGUA Threonine—Leucine—Valine

Depending on where the mutation occurs, it may have no affect on the protein

ACGUCAGUA Threonine—Serine—Valine

ACGUCGGUA Threonine—Serine—Valine

Wobble: Base pairing between codon and anticodon in which there is nonstandard pairing at the third position of the codon; allows more than one codon to pair with the same anticodon

Base Deletion

Deletion of a base that disrupts the codons; also called a frameshift mutation

ACGUCAGUA Threonine—Serine—Valine

ACGUAGUAC Threonine--STOP

Base Insertion

Insertion of a base that disrupts the codons; also called a frameshift mutation

ACGUCAGUAC Threonine—Serine—Valine

ACGUCGAGUAC Threonine—Serine– Serine

Jumping Genes

Occur when large stretches of DNA are inserted into the gene; this can disrupt the DNA sequence

ACGTCAGTAC

ACGTCTACTGACGTAAGTAC

Chromosomal Mutations

Involve the entire chromosomeDeletion: a chromosome breaks and a piece of the chromosome is lost

Chromosomal Mutations (cont.)

Duplication: part of a chromosome breaks off and is incorporated into its homologous chromosome; the homologous chromosome now has an extra copy of one of its parts

Chromosomal Mutations (cont.)

Translocation: a part of a chromosome breaks off and attaches to a different, non-homologous chromosome

Chromosomal Mutations (cont.)

Inversion:

a part of a chromosome breaks off, turns around, and reattaches in the reverse order

Genome & Karyotype

Genome: base sequence of all of the DNA in an organism

Karyotype: photograph of all of an organism’s chromosomes

Nondisjunction

Failure of the chromosomes to separate during cell division

If it occurs during mitosis, the individual cell is affected, but the organism is not usually harmed

If it occurs during meiosis, the entire organism is affected

Monosomy & Trisomy

Monosomy: the zygote has only one copy of a particular chromosome

Trisomy: the zygote has three copies of a particular chromosome

In humans, monosomy and trisomy are so disruptive in most chromosomes that it kills the embryo

In some chromosomes, however, the embryo survives, but it has developmental difficulties

Diseases Caused by Nondisjunction

Down’s SyndromeCaused by trisomy of chromosome 21Symptoms include mental retardation and a “moon” face

Trisomy 18Caused by trisomy of chromosome 18Symptoms include a webbed neck, severe mental retardation, and hernia (inguinal, umbilical, and diaphramatic)90% mortality by 1 year

Diseases Caused by Nondisjunction (cont.)

Klinefelter’s SyndromeCaused by trisomy of the sex chromosomes, XXYSymptoms include lack of facial and body hair, rounded body type, and infertility

Turner’s SyndromeCaused by monosomy of the sex chromosomes, XOSymptoms include no sexual development, learning disabilities, infertility, heart & kidney abnormalities

Diseases Caused by Nondisjunction (cont.)

Trisomy 13Caused by trisomy of chromosome 13

Symptoms include severe mental retardation and hernias (inguinal and umbilical)

72% mortality by 1 year

Polyploidy

Nondisjunction occurs in all chromosome pairs

Almost always lethal in animals

Usually has a positive effect in plants

Constructing a Pedigree

Construct a pedigree using the following information. Make sure to shade in the affected individuals and carriers. Number each generation with Roman numerals (I, II, III, etc.) and each individual in a generation with Arabic numerals (1, 2, 3, etc.) Write each individual’s genotype under their symbol.

top related