genetics, plant breeding and agriculture - uganda - november 2012

Plant Science into Practice

Dr Tina Barsby

Genetics, Plant Breeding and

Agriculture

Dr Tina Barsby

NIAB, Huntingdon Road, Cambridge, UK

Agriculture: the most important

event in human history

Matthew 7:18-7:20 A good tree cannot bring forth evil fruit, neither can a

corrupt tree bring forth good fruit. Every tree that bringeth not forth good

fruit is hewn down, and cast into the fire. Wherefore by their fruits ye

shall know them.

Agriculture is at the Center of Many of Society’s

Most Important Debates

Exciting time for Agriculture & Plant Breeding

• Global food security •Enhanced productivity

•Increased yield

•Sustainable production

• Water availability •Drought-tolerant crops

• Biofuels •Yield technologies to help meet

demand for both food and fuel

• Global warming •CO2 footprint

•Fertilizer use

Dr Tina Barsby

Food security: From “How to Feed the World in 2050” (FAO World Food

Summit document, Nov 2009)

• By 2050 the world’s population will reach 9.1 billion, 34 % higher than

• In order to feed this larger, more urban and richer population, food

production (net of food used for biofuels) must increase by 70 %

Environmental Challenges: (Climate Change 2007: Synthesis report,

• Climate change/agriculture’s global warming contribution

- Agriculture and forestry account for 31% of global anthropogenic

greenhouse gas emissions

• Declining resources: Water, nutrients, natural habitats, biodiversity

- Agriculture is responsible for 70% of freshwater withdrawal

(United Nations Environment Programme)

Meeting the challenges

Meeting the Demands of a Growing Global Market

• World population continues to increase

• Per capita food consumption continues to rise

• Consumers continue to demand improved taste, convenience, and nutrition

GROWING WORLD POPULATION (B)

Source: FAO, WHO

RISING CEREAL DEMAND (MMT)

1981 1999 2015 2030

TRANSITION NATIONS DEVELOPED NATIONS DEVELOPING NATIONS

“To feed the eight billion people expected by 2025, the world will have to double food production…”

CSIS - Seven Revolutions

Scarcity The green revolution

Set aside, CAP changes Subsidy and Surplus

Security

Set Aside

Biofuels

Food Prices

Food Security

sunlight

plants

plant biodiversity

science Agriculture, Land

Use & Society

Plants provide sustainable solutions

‘ultimate green & clean technology’

fossil reserves biorenewables

oil...refineries bio...refineries

CHEMICALS MATERIALS FUELS

yesterday today and tomorrow

sunlight

plant biomass

a solar energy source for manufacturing

Dr Tina Barsby

‘Better seeds…better crops’

• Food crisis after WW1

• NIAB established by charitable

donations for ‘the improvement of

crops with higher genetic quality’

• Barriers to plant breeding, and to

access for growers to improved

varieties, were recognised barriers to

enhanced food production

Dr Tina Barsby

The First Farmers Leaflets

1932 Farmers leaflet 1931 Farmers leaflet

Genetic Software & Hardware

Feeding future populations means doubling the productivity of neglected but

nutritious crops such as yams and green bananas

• How’s my country doing? Is there an Agriculture strategy?

– Availability

– Affordability

– Safety

– Choice

– Quality …

Dr Tina Barsby

•DuPont Food security index (there

are others)

•http://foodsecurity.eiu.com

Availability

Affordability

Safety and Quality

Norman E. Borlaug

Growth rates due to early years of the

Green Revolution (1961-1980)

Latin America Asia Middle East Africa

Other inputs

Cultivars

Growth rates due to late years of the

Green Revolution (1981-2000)

Latin America Asia Middle East Africa

Other inputs

Cultivars

Genetic history: plant breeding.

Dwarfing genes

allow increased:

•Nitrogen fertiliser

levels.

Which increased

susceptibility to

disease. But plants

were protected by

newly developed:

•Fungicide

Dwarfing genes

reduced the

weight of straw,

changing the

distribution of

resources and

resulting in:

•Higher grain

yields.

In addition,

pleiotropic effects

of the dwarfing

gene include

more grains per

• What do plant breeders do?

• How do they ‘introduce dwarfing genes’?

• Where do these new genes come from?

• Other questions?

Pedigree method

Performance under

farmers’ conditions

and farmers’

acceptance

Participatory maize breeding in Africa

• Prioritize most important stresses

under farmers’ conditions

• Manage trials on experiment

station and evaluate large numbers

of cultivars,

• Select the best, and …

• Involve farmers

– Mother trials in center of farming

community grown under best-bet

input conditions

– Farmer-representative input

conditions

– Farmer-managed baby trials

• Partnership with extension, NGOs,

rural schools, and farmer

associations

The Mother / Baby trial design

Collaborative, on-farm evaluation of maize cultivars

Holistic Research

“No matter how excellent the research done in one scientific discipline is, its application in isolation will have little positive effect on crop production. What is needed are venturesome scientists who can work across disciplines to produce appropriate technologies and who have the courage to make their case with political leaders to bring these advances to fruition. ”

Norman E. Borlaug

•Father of the Green revolution:

Norman Borlaug.

•Where did he find the dwarf gene-

Diversity! Japanese

accession..Gene Banks

•How did he make possible to grow

dwarf wheat in a variety of

environments?

Fundamental role of Diversity &

Selection

Reference: Michael Balter (2007) Seeking Agriculture’s Ancient Roots, Science 316, 1830-1835

Crop Biodiversity

The Seed Vault at Svalbard

Global Crop Diversity Trust

Sources of novel variation

• International germplasm

• Landrace, or traditional varieties

• Wild relatives

• Progenitor species

Maize has more molecular diversity than

humans and apes combined

Silent Diversity (Zhao PNAS 2000; Tenallion et al, PNAS 2001)

• Organisation and importance of Diversity

• Selection is a powerful tool but need to

understand & know what to select for.

Courtesy Tobert Rocheford and

Catherine Bermudez Kandianis

Keith Weller

Doug Wilson

Scott Bauer

Keith Weller

biology is the science of the

natural world & critical to the

future of agriculture.

‘all life depends on sunlight

and a green leaf’

Plant Breeding: Mining Diversity

• Genotypic and phenotypic assessment of 440 CIMMYT primary SHW

• Identified reduced group of 94 for back-crossing to Xi19 & Paragon by diversity analysis

• Develop UK adapted synthetic backcross derived lines (SHW-D) approx. 6,000 lines

• Assess agronomic characteristics of SHW-D including pest & disease resistance, yield components, drought tolerance and nitrogen use efficiency

SHW back-crossing by NIAB

SHW back-crossing by CIMMYT

Delayed senescence Increased grain sites

Paragon x SHW BC1F2 selections

Drought in Africa between now and 2090

Red, Orange =

More prone to

drought

Blue =

Wetter and less

prone to

drought

Hadley Centre, Met Office, UK

Evaluation of drought tolerance High spike photosynthesis

Stem reserves

Large seed

Early ground cover

Leaf traits: wax, rolling, thickness, etc.

Long coleoptile

Water relations: stomatal conductance, etc.

Cellular traits: osmotic adjustment, heat tolerance, etc. High pre-anthesis biomass

Drought assessment at CIMMYT Mexico

Tractor-mounted Giddings soil corer

Drought trials at Obregon, N. Mexico

Conventional pedigree selection

Reproduced from Koebner & Summers 2003

Marker- Aided Selection

• Locating and tagging the genes

• Genes??

Genes (Every organism carries inside itself what are known as genes)

• DNA is divided into sections called genes.

• Each gene codes for a protein

• Each protein has a function

DNA - the code for life

• The DNA code consists of just 4 building blocks: – A, C, T and G.

• Whether we are bacteria, fungi earthworms, mushrooms or humans our DNA has the same building blocks, just in a different order.

A C T G ...GCCTTACG…

....ACTGCCTGGAAC….….TGACGGACCTTG….

Source: Microsoft Encarta

Chromosome changes: mutations

• A new characteristic is the result of a gene mutation

• Genes can be amplified and ‘seen’ as molecular markers.

• Breeders are choosing genes or combinations of genes which give the characters the farmer needs

Vavilov 1887-1943

•Soviet botanist & geneticist

•Discovered and identified

centres of origin of cultivated

plants

•Criticised the non-

Mendelian concepts of

Lysenko

•Arrested in 1940, died of

malnutrition in prison in

Many plant species have been domesticated around the world

All of the principal crops we rely on today come from domesticated species

The practice of artificial selection has been practiced by farmers for thousands of years and has transformed wild plants into the crops we depend on today through this process of domestication

Domestication: the first plant breeders

Crop origins and diversification: multiple births

Science 316, 1830-1835

ESEB Congress, Uppsala,

Sweden, August 2007

Domestication

traits: traits that

distinguish seed &

fruit crops from

their progenitors

Little overlap between centres of origin & today’s productive agriculture.

Sweden, August 2007

Nature Vol 418, 700-707

• Genetics: the science underlying plant breeding.

Heredity

•Heredity is the

passing of traits

to offspring

(from its parent

or ancestors).

Offspring resemble their parents more than they

resemble unrelated individuals (why is this so?)

Charles Darwin

Evolution is driven by natural selection

Darwin’s mentor

Great Teachers often feature in the development of Great People!

Dr Tina Barsby

•Agriculture depends on plant

breeding, choosing the best, crossing

the best with the best and hoping for

the best…

•With a little guidance from genetics!

•And the blessing of good soil and

rainfall.

Sexual reproduction in plants

F1 Hybrids

Sweden, August 2007

To put your footer here go to View > Header and Footer 65

USA: Historic Maize Yields

(tonnes/ha)

1875 1925 1975

Hybrid vrs Open pollinated maize

On the right a

new, hybrid

maize variety

developed by

CIMMYT

with PASS

funding.

On the left, a

local landrace

variety

Hybrid Vigour is the superiority of progeny (offspring) (F1)

over the mean of its two parents (P)

heterozygous

heterosis inbreeding depression

homozygous

selfing

Concepts of Hybrid Production - Hybrid Vigour (Heterosis)

United States

Inbred Varieties Hybrid Cultivars

History of Hybrids in Sorghum

Hybrid Seed Production – Getting the cross

• Hybrids are produced by hand emasculation in corn.

• In wheat, chemicals are used to sterilize the pollen.

• Cytoplasmic male sterility (CMS) is used for hybrid seed production in sorghum and pearl millet.

Training of Seed Growers in Hybrid Production

Crossing A and B lines Heat sterilization of pollen using polythene bag

Identifying the different parts of the sorghum plant

Gregor Johann Mendel,

(b. 22 July 1822; d. 6 January 1884)

Moravia, Austro-Hungarian Empire

Originator of the concept of the gene (autosomal inheritance)

Birthplace of Modern Genetic Analysis Augustinian monastry garden, St. Thomas,

Brünn, Austria

Brno (Czech Rep.) Experimemts, 1856-1870

Mendel’s Laws

• Law of equal segregation (First Law) - The two members of a gene pair

segregate from each other into the gametes; so that half the gametes carry one member of the pair and the other half of the gametes carry the other member of the pair.

• Law of Independent Assortment (Second Law) - different gene pairs assort

independently during gamete formation

Reasons for choosing to study garden pea

• Can be grown in a small area

• Produce lots of offspring

• Easily identifiable traits

• Can be artificially cross-pollinated

A pea flower with the keel cut and opened to expose the reproductive parts

Artificial cross pollination

Genes (The genes are codes or messages. They carry information. The information they carry is used to tell the organism what chemicals it needs to make in order

to survive, grow or reproduce )

• Genes make us who we are

• We receive our genes from our parents

• The same is true for all animals, plants and microbes

The seven character differences studied by Mendel

purple-flowered (f) x white flowered (m)

Summary and conclusions of Mendel’s experiments

•After crossing pure parental strains, the F1 produced 100% of one character.

•After self-pollinating the F1, both characters showed up in a 3:1 ratio.

•Because the same types of ratio kept coming up, Mendel believed that there must be some mathematical formula or explanation for the observed data

•The first assumption made by Mendel was that there must be a ”pair of factors” that controls the trait in pea plant. This “pair of factors” idea helped him formulate his principles

Dominant and recessive traits

Mendel’s Laws

• Law of equal segregation (First Law) - The two members of a gene pair

segregate from each other into the gametes; so that half the gametes carry one member of the pair and the other half of the gametes carry the other member of the pair.

• Law of Independent Assortment (Second Law) - different gene pairs assort independently during gamete formation

Information from genes.

Serendipity: Natural Hybridisation Many modern crop species are the result of ancient (or

recent) hybridisation events.

Cotton

Oilseed Rape

Wheat a classic allo-hexaploid

Sweden, August 2007

Science Vol 316, 1862-1866

The New Rice for Africa

Monty Jones 2004

Selective breeding is a powerful tool

Sweden, August 2007

‘Doubly Green Revolution’ Sir Gordon Conway

• The aim

•repeat the success of the Green Revolution

•on a global scale to include Africa

•in many diverse localities

• and be

•equitable

•sustainable

•and environmentally friendly

Daily calorie intake in developing world

Rice 45%

Wheat 29%

Maize 11%

Cassava 3%

Sorghum 2%

Potato 2%

Sweet potato 2%

Millet 2%

Soybean 2%

Bean 1%

US maize yields still rising –

Source: Defra & USDA

ALL THREE ARE CRITICAL IN DELIVERING YIELD TODAY – AND TOMORROW

BREEDING

Strategically breed plants

to create new, more robust

seeds that perform better –

and longer – in the field.

AGRONOMICS

Use precision ag, planting density,

plant health protection, and

conservation tillage to make acres

more productive.

BIOTECHNOLOGY

Supplement breeding

advancements by adding

special beneficial genes

to the plant.

“The Three Pillars of Yield”

The Importance of Genetics

Market Identification

by Trait, Crop,

species

Transgenic Plant Development

Cell Culture

Molecular Biology

Genetics

Variety Development

Yield Trials

Product Testing

Products

Genetic diversity

Analytical Screens

Biochemistry

Germplasm Development

Traditional &

Molecular Breeding

Genetics

Molecular Genetics

• 24 ABI 377 Automated sequencers

• 20,000 Lane per week capacity

Gene Discovery

Plant Biology

Genomics

Bioinformatics

SNP Genotyping

DNA Sequencing and ‘Omics

DAVID MARCHAL

The Life sciences revolution

Molecular biology

Computer science

Mathematics

Exciting time

Unlocking the genetic potential of the biosphere

Sustainable food

production

Breeding

ATGGATCTATCCCTGGCTCCGACAACAACAACAAGTTCCGACCAAGAACAAGACAGAGACCAAGAATTAACCTCCAACATGGAGCAAGCAGCAGCTCCGGTCCCAGCGGAAACAACAACAACCTTCCGATGATG

ATGATTCCACCTCCGGAGAAAGAACACATGTTCGACAAAGTGGTAACACCAAGCGACGTCGGAAAACTCAACAGACTCGTGATCCCTAAACAACACGCTGAGAGTATTTCCCTCTAGACTCCTCAAACAACCAAA

ACGGCACGCTTTTGAACTTCCAAGACAGAAACGGCAAGATGTGGAGATTCCGTTACTCGTATTGGAACTCTAGCCAGAGCTACGTTATGACCAAAGGATGGAGCCGTTTCGTCAAAGAGAAAAAGCTCGATGCA

GGAGACATTGTCTCTTTCCAACGAGGCATCGGAGATGAGTCAGAAAGATCCAAACTTTACATAGATTGGAGGCATAGACCCGACATGAGCCTCGTTCAAGCACATCAGTTTGGTAATTTTGGTTTCAATTTCAATT

TCCCGACCACTTCTCAATATTCCAACAGATTTCATCCATTGCCAGAATATAACTCCGTCCCGATTCACCGGGGCTTAAACATCGGAAATCACCAACGTTCCTATTATAACACCCAGCGTCAAGAGTTCGTAGGGTAT

GGTTATGGGAATTTAGCTGGAAGGTGTTACTACACGGGATCACCGTTGGATCATAGGAACATTGTTGGATCAGAGCCGTTGGTTATAGACTCAGTCCCTGTGGTTCCCGGGAGATTAACTCCGGTGATGTTACC

GCCGCTTCCTCCGCCTCCTTCTACGGCGGGAAAGAGACTAAGGCTCTTTGGGGTGAATATGGAATGTGGCAATGACTATAATCAACAAGAAGAGTCATGGTTGGTGCCACGTGGCGAAATTGGTGCATCTTCTT

CTTCTTCTTCAGCTCTACGACTAAATTTATCGACTGATCATGATGATGATAATGATGATGGTGATGATGGCGATGATGATCAATTTGCTAAGAAAGGGAAGTCTTCACTTTCTCTCAATTTCAATCCATGA

DNA – a common language across living organisms in the biosphere

genome programmes link understanding of biology to agriculture

implications for:

- forestry

- aquaculture

- livestock

- arable

Contemporary Science

Democratisation of genomics

Roche 454: Metagenomics,

amplicon sequencing, BAC

sequencing

Illumina: HiScanSQ for genomes, transcriptomes or GBS / MiSeq for

amplicons, small genomes, focused GBS and pilot experiments

Ion Torrent: PGM for metagenomics, small genomes, BACS / Proton (due Sep ‘12!) for genomes, transcriptomes

Genes provide the foundation of new products for

farmers

biomass utility?

improved agronomy?

tolerance to cold?

yield?

tolerance to drought?

flowering time?

Genes Protein Trait Product

In Era of Gene-Based Breeding, Amount of Data Explodes, Accelerating

Ability to Realize Step-Change Improvements

Reference

genomes for

each crop

Genomes

targeted for

specific traits

(disease)

Genome for

every yield plot

GENOMES/YEAR Traits

•Heterosis

•Phenotypic & metabolic plasticity

•Perenniality

•Evolution breeding systems

•Ecological competitive ability

•Intra & inter-genotypic Competition •Nutrient mobilisation

Crop & Root ideotypes Water utilisation

PREDICTION POWER ACCELERATING

• Gene prediction knowledge will grow exponentially • Unlocks the opportunity for gene-based breeding

May 2000

Life Science Companies

Seed Companies

Joint Ventures

Cooperatives

Other Companies

GarstGarstSeed Co.Seed Co.December 1997

20% Equity

ExSeedExSeedGenetics LLCGenetics LLC

AstraZenecaPLC

United Kingdom

Mogen International NVMogen International NVThe Netherlands

Cooperatie CosunCooperatie CosunUA UAThe Netherlands

InterstateInterstatePayco Payco

August 199650% Equity

June 1997

$78 M 100% Equity

100% Equity

Advanta BVAdvanta BVThe Netherlands

RoyalVanderHaveRoyalVanderHaveThe Netherlands

Koipesol Koipesol //AgrosemAgrosem//AgraAgraSpain ItalyFrance

ZimmermanZimmermanHybrids, Inc.Hybrids, Inc.

1998100% Equity

France

April 1998100% Equity

November 199850% Equity

Land O’ LakesNovember 1998

50% Equity

December 199840% Equity

July 1999100% Equity

July 199980% Equity

U.S. CooperativeU.S. CooperativeSystem:System:

CroplanCroplanGenetics, FFR, Genetics, FFR, GrowMarkGrowMark, etc., etc.

Wilson Seeds, Inc.Wilson Seeds, Inc.

Sturdy Grow Hybrids, Inc.Sturdy Grow Hybrids, Inc.

MaisadourMaisadourSemencesSemencesSASA

Novartis AGNovartis AG(Syngenta AG)

Switzerland

AgritradingAgritradingItaly

EridaniaEridaniaBeghinBeghin-Say -Say France

July 199920% Equity

Syngenta Syngenta AGAGDiversa Corp. Diversa Corp.

CalgeneCalgene, Inc., Inc.

May 1998$100 M 50% Equity

Joint Venture

1982100% Equity

AgriProAgriPro SeedSeedWheat Wheat DivisionDivision

Cargill Hybrid SeedsCargill Hybrid SeedsNorth AmericaNorth America

May 1998$100 M 50% Equity

Joint Venture

HybriTechHybriTechEurope SAEurope SAFrance

February 199690% Equity

PauPau EuralisEuralisFrance

CargillCargill, Inc., Inc.

RenessenRenessen

Cargill’s Cargill’s InternationalInternationalSeed DivisionSeed Division

Corn States Hybrid Service, Inc.Corn States Hybrid Service, Inc.Corn States International Corn States International SarlSarl..

Asgrow SeedAsgrow SeedCompany LLCCompany LLC

July 1998$525 M 100% Equity

July 1998$1.4 B (est)

March 1996$1.2 B 40% Equity

May 1998$2.5 B 100% EquityTotal cost $3.7 Billion

November 1996$240 M 100% Equity

January 1997$1.02 B 100% Equity

November 1997$150 M 100% Equity

April 1996$30 M 50% EquityNovember 1996

$50 M 5% EquityMay 1997

$242 M 45% EquityTotal cost $322 Million

April 1996$150 M 100% Equity

November 1997JV with FTSementes

June 1998

DeKalb GeneticsDeKalb GeneticsCorporationCorporation

AgracetusAgracetus, Inc., Inc.

Plant BreedingPlant BreedingInternationalInternational

Cambridge, Cambridge, LtdLtd..United Kingdom

First Line Seeds, First Line Seeds, LtdLtd..Canada

MonsoyMonsoyBrazil

Jacob Jacob HartzHartzSeed Co., Inc.Seed Co., Inc.

1983100% Equity

Holden’sHolden’sFoundationFoundation

SeedsSeeds

Monsanto/Pharmacia

Sementes AgroceresSementes AgroceresSASABrazil

HybriTechHybriTechSeedSeedInt’l., Inc. Int’l., Inc.

Custom Farm SeedCustom Farm Seed

July 1997

CereonCereon

Mendel BiotechMendel Biotech

Paradigm GeneticsParadigm Genetics

March 199916.4% Equity

UnitedUnitedAgriseedsAgriseeds, Inc., Inc.

Morgan SeedsMorgan SeedsArgentina

AdvancedAdvancedAgriTraitsAgriTraits

December 1996$9.4 M 18.75%

Equity

March 199983.6% Equity

March 1999$15 M

25% Equity

April 1998$32 M

100% Equity

September 1996$34.6 M

100% Equity

February 1996$72 M

100% Equity

September 1998100% Equity

October 1998$322 M 100% Equity

MycogenMycogenCorporationCorporation

Illinois Foundation Seed, Inc.Illinois Foundation Seed, Inc.

Dow Agrosciences

VerneuilVerneuilHolding SAHolding SA

France

HibridosHibridosColoradoColorado LtdaLtdaFT FT Biogenetics Biogenetics dedeMilho LtdaMilho Ltda

Brazil

DinamilhoDinamilhoCarolCarolProductos Agricolas LtdaProductos Agricolas Ltda

Brazil

Large Scale Biology (BioSource)Large Scale Biology (BioSource)

DiversaDiversa)

BayerBayerParadigm

Incyte

Exelixis

BASFBASFLynx

Lexicon

Incyte

Exelixis

Ag Chem & Seed Industry

1993 80% Equity

March 199850% Equity

12% Equity

BiotechnicaBiotechnicaInternational, Inc./International, Inc./

LG SeedsLG Seeds

Akin Seed Co.Akin Seed Co.

Callahan Callahan SeedsSeeds

October 199380% Equity

July 199485% Equity

June 1994100% Equity

99%Equity

1997 55% Equity

Aventis CropScienceAventis CropScienceAgrEvoAgrEvo

Aventis SAAventis SA

France

Schering Schering AGAGGermany

199725% Equity

KWS KWS SaatSaat

Mais AngevinMais AngevinFrance

BiogemmaBiogemmaFrance

RhoBioRhoBioFrance

France

PauPau EuralisEuralisFrance

NickersonNickersonSeedsSeeds

United Kingdom

Great LakesGreat LakesHybrids, Inc.Hybrids, Inc.

Canada

King King Agro Agro Inc.Inc.Canada

Groupe Groupe LimagrainLimagrain

France

ProagroGroupProagroGroupIndia

Plant Genetic Systems Plant Genetic Systems International (PGS)International (PGS)

August 199675% Equity- $550M

Germany

Sementes Ribeiral LtdaSementes Ribeiral Ltda..Sementes Fartura LtdaSementes Fartura Ltda

Mitla Pesquisa Agricola LtdaMitla Pesquisa Agricola LtdaBrazil

Plantec BiotechnologiePlantec BiotechnologieGermany

199695% Equity

15% Equity

Nidera SemillasNidera SemillasArgentina

PendingUp to 25% Equity

Agritope/Agrinomics

Diversa

Brazil

DoisDois MarcosMarcos

Protein Technologies Protein Technologies

InternationalInternational

December 1997$1.5 B 100% Equity

Optimum QualityOptimum QualityGrains, LLCGrains, LLC

HybrinovaHybrinovaSASA

April 1998100% Equity

E.I. DuPont deE.I. DuPont deNemours & Co.Nemours & Co.

Pioneer Hi-BredInternational, Inc.Pioneer Hi-BredPioneer Hi-Bred

International, Inc.International, Inc.

AffymetrixCuraGen

Maxygen

Distribution of Miscanthus Species

after Hodkinson & Renvoize et al. 2001

N 55°

N 24°

Taiwan

IGER’s hunt for Asian elephant grass

http://www.iger.bbsrc.ac.uk/News/9march2007miscanthus.htm

Crossing

• Hybridisation Strategy • 2n M. sinensis x 2n M.

sinensis from wide geographical origins

• 4n M. sacchariflorus x 2n M. sinensis to produce 3n M. x giganteus types

Selection

ADPglucose

Amylose

Amylopectin

STARCH BIOSYNTHESIS ENZYMES

200 bp

300 bp

400 bp

100 bp

external fragment (PCR positive control)

wild type amplicon

mutant specific amplicon

•Tetra-ARMs PCR applied to both these genes. •Example below is a gel of the waxy amplicons

Waxy & Starch Synthase – Tetra-ARMs

Ghana’s Success

• MDG 1 achieved • Malnourished - 5.8m in

1993 to 2.7 m in 2003. • Declines in %

underweight children and mortality

• Strong agricultural growth since 80s

• 25% increase due to area expansion

• Maize yield up by 36%, cassava by 50%

• New maize, yam, rice and cassava varieties

• A pest resistant cassava. • Strong growth in

smallholder cocoa & pineapples

• Market liberalisation • New rural infrastructure

Sources: Development Outreach,

October, 08;Coulombe & Wodon,

World Bank; Irish Hunger Report

All this is threatened by Climate Change

• Higher temperatures

• Greater & more intense rainfall

• Greater droughts

• River bank erosion

• Rising sea levels

• More intense cyclones

• Salt water incursions

The biosphere – nature’s solutions

Breeding: major technology platform for food, water & energy security

Next steps ?

Proteomics

Genomics

Analytical Technology

Transgenic Traits

Molecular Engineering

Winter Nurseries

Computer Technology

Plot Mechanisation

Quantitative Genetics

Statistics

Pedigree Breeding

Hybridisation

Open Pollinated Selection

inable

Plant Breeders use any

combination of these technologies

to develop enhanced products for

customers, and continue to

explore technologies to enhance

this process

New Opportunities for Agriculture

Dr Tina Barsby

•Developing an industry-wide resource, showcasing new

technology and innovation in plant genetic development

for the agriculture and horticulture sectors, on themes of:

genetics, plant breeding and agriculture - uganda - november 2012

Technology

introduction to maize breeding nathan schnur. overview what...

intro: genetics and breeding

plant breeding, genetics and biotechnology program...

breeding and genetics - cotton

genetics breeding fall-2011

genetics of tomato rootstock breeding: genetic distance...

department of plant breeding and genetics degree...

uganda pig genetics

1. animal genetics and breeding · agb-602 molecular...

applied genetics selective breeding and genetic engineering

ah100 genetics & plant breeding wo pix

history and progress in cotton breeding, genetics, and...

genetics of plant breeding systems promoting outcrossing

genetics of plant breeding systems promoting outcrossing

advances in dairy cattle genetics and breeding- … ·...

using genetics, genomics, and breeding to understand...

quantitative genetics and plant breeding

biotech seed potato breeding in uganda - november 2012

genetics of animal breeding 9

animal breeding and genetics mcq’s answer